introduction/background Bio lab paper
APPLIED AND ENVIRONMENTAL MICROBIOLOGY, 0099-2240/98/$04.0010
July 1998, p. 2554–2559 Vol. 64, No. 7
Copyright © 1998, American Society for Microbiology. All Rights Reserved.
Use of Green Fluorescent Protein To Tag and Investigate Gene Expression in Marine Bacteria
SERINA STRETTON, SOMKIET TECHKARNJANARUK, ALAN M. MCLENNAN, AND AMANDA E. GOODMAN*
School of Biological Sciences, The Flinders University of South Australia, Adelaide 5001, Australia
Received 22 December 1997/Accepted 20 April 1998
Two broad-host-range vectors previously constructed for use in soil bacteria (A. G. Matthysse, S. Stretton, C. Dandie, N. C. McClure, and A. E. Goodman, FEMS Microbiol. Lett. 145:87–94, 1996) were assessed by epifluorescence microscopy for use in tagging three marine bacterial species. Expression of gfp could be visualized in Vibrio sp. strain S141 cells at uniform levels of intensity from either the lac or the npt-2 promoter, whereas expression of gfp could be visualized in Psychrobacter sp. strain SW5H cells at various levels of intensity only from the npt-2 promoter. Green fluorescent protein (GFP) fluorescence was not detected in the third species, Pseudoalteromonas sp. strain S91, when the gfp gene was expressed from either promoter. A new mini-Tn10-kan-gfp transposon was constructed to investigate further the possibilities of fluorescence tagging of marine bacteria. Insertion of mini-Tn10-kan-gfp generated random stable mutants at high frequencies with all three marine species. With this transposon, strongly and weakly expressed S91 promoters were isolated. Visualization of GFP by epifluorescence microscopy was markedly reduced when S91 (mini-Tn10-kan-gfp) cells were grown in rich medium compared to that when cells were grown in minimal medium. Mini-Tn10-kan-gfp was used to create an S91 chitinase-negative, GFP-positive mutant. Expression of the chi-gfp fusion was induced in cells exposed to N*-acetylglucosamine or attached to chitin particles. By laser scanning confocal microscopy, biofilms consisting of microcolonies of chi-negative, GFP1 S91 cells were found to be localized several microns from a natural chitin substratum. Tagging bacterial strains with GFP enables visualization of, as well as monitoring of gene expression in, living single cells in situ and in real time.
The gene encoding green fluorescent protein (GFP) has recently become an important visual marker of gene expres- sion in eukaryotic organisms, as it is more sensitive than other reporter genes, requires no special cofactors for detection (7), and can be quantitated with a spectrofluorimeter (24). GFP has not been as widely applied to prokaryotic organisms be- cause of a lack of constructs useful for diverse groups of bac- teria, although GFP vectors are available for specialized bac- terial systems (13, 24, 33, 41, 42). The wild-type gfp gene has been mutated to improve detection and expression of the flu- orescent protein in prokaryotes (10, 18, 30), and both the wild-type and mutated forms have been used to construct less specialized bacterial GFP vectors.
A broad-host-range plasmid expressing the improved gfp- (mut2) (10) gene from either a lac or an npt-2 promoter has been used successfully to tag gram-negative soil bacteria with GFP (27). Escherichia coli-Pseudomonas spp. shuttle vectors containing gfp(mut2) expressed from lac and tac promoters have been constructed (5), and a GFP cloning cassette con- taining a similarly improved gfp gene is available for creating transcriptional fusions in prokaryotes (30). A suicide plasmid containing a promoterless gfp that recombines wholly with the bacterial chromosome has been constructed to create genomic gfp fusions in a diverse range of gram-negative bacteria (22). Transposons provide an alternative method to insert reporter genes directly into the genomic DNAs of target strains. Several Tn5-based transposons containing either a promoterless gfp gene or a gfp gene expressed from a broad-host-range pro- moter have been generated for use in tagging diverse bacterial
species (6, 9, 27, 40). Tn5 reporter gene systems, however, are not effective in all gram-negative bacteria (2, 36).
GFP-tagged bacteria have been used in ecological studies to monitor single cells or cell populations in activated sludge communities (14) during symbiosis with plant cells (15), during infection of macrophages (24), during plasmid conjugation on semisolid surfaces (9), and in survival studies of E. coli in aquatic environments (26). There have been recent advances in detecting the presence of specific genes in single cells, thereby enabling identification of specific cells in mixtures by in situ PCR (20, 21), as well as in detecting the expression of genes in single cells by in situ PCR after an initial reverse transcription step targeting the mRNA in the cell (8, 39). Although these methods are useful approaches for many ex- periments, they all involve killing the cells because of the fixation step in the procedure and the heating steps in the PCR regimen.
We are interested in studying regulation of gene expression (37, 38), surface colonization behavior (11), and plasmid trans- fer (3) in several diverse marine bacterial species in situ. To investigate these processes in living microbial communities, it is necessary to find methods of tagging the different marine species so that cells may be visualized in situ and in real time. For this purpose we compared levels of expression of gfp- (mut2) from two different bacterial promoters on a broad-host- range plasmid (27) in three gram-negative marine bacterial species. As Tn5-based transposons do not work with the ma- rine bacteria we have tested and Tn10-based transposons do (2), we also constructed a Tn10-based reporter transposon containing promoterless gfp(mut2) (hereafter referred to as gfp) to create transcriptional fusions in order to investigate gene expression in marine bacteria further.
Here we show the differences in levels of expression of gfp in three vector-transposon constructs in three marine species:
* Corresponding author. Mailing address: School of Biological Sci- ences, The Flinders University of South Australia, GPO Box 2100, Adelaide, SA 5001, Australia. Phone: (61-8) 8201-5134. Fax: (61-8) 8201-3015. E-mail: [email protected].
2554
Pseudoalteromonas sp. strain S91, Vibrio sp. strain S141, and Psychrobacter sp. strain SW5H. GFP-tagged S91 cells were used to investigate initial biofilm formation on a natural bio- degradable substratum, squid pen, and laser scanning confocal microscopy (LSCM) was used to visualize the hydrated struc- ture of the biofilm at the squid pen surface.
MATERIALS AND METHODS
Bacteria, plasmids, and growth conditions. The bacterial strains and plasmids used in this study are described in Table 1. The gfp reporter transposon con- structed in this study is shown in Fig. 1. The plasmid construct pLOFKmgfp in E. coli SM10 has been lodged with the American Type Culture Collection. E. coli strains were grown in Luria-Bertani broth (LB) (28) at 37°C. All other strains were grown at 30°C in either tryptone soy broth (Oxoid) containing NaCl (0.26 M), MgCl2 (1 mM), and CaCl2 (0.33 mM) (TS); LB containing NaCl (0.26 M), MgCl2 (1 mM), and CaCl2 (0.33 mM); or artificial seawater minimal medium (32) supplemented with 20 mM glutamate (MMMglt) for strains S91 and SW5H or 20 mM glucose for strain S141. Agar plates contained 15 g of Bitek agar (Sigma) liter21 unless otherwise indicated. The following antibiotics (Sigma) and concentrations were used: ampicillin (50 mg ml21), kanamycin (600 mg ml21 for S91 and 100 mg ml21 for all other strains), and streptomycin (100 mg ml21).
DNA manipulations. Plasmid extractions, restriction enzyme digestions, liga- tions, transformations, and agarose gel electrophoresis were carried out by stan- dard methods (35) and according to the manufacturers’ instructions where ap- propriate. Restriction and other enzymes were obtained from New England Biolabs Inc.
PCR. PCR amplification of the 740-bp gfp fragment from pBCgfp was done as previously described (27) with the following primers: gfpSfiI-F (59-CTCCTCGG CCGCCTAGGCCGATTTCTAGATTTAAGAAGG) and gfpSfiI-R (59-CTCC TCGGCCTAGGCGGCCTCATTATTTGTATAGTTCATC). PCR amplifica- tion of the 1.3-kb fragment from pLOFKmgfp transformants was carried out as described above with gfpSfiI-F and Kmseq-F (59-TACAATCGATAGATTGTC
GC), a primer designed to amplify sequence upstream from the kanamycin resistance (Kmr) gene of pLOFKm.
Conjugations. Mobilization of p519gfp, p519ngfp, and pLOFKmgfp from E. coli hosts with E. coli(pNJ5000) as a helper was done by plate matings as previously described (2). The numbers of transconjugants, donors, and recipients from matings between E. coli SM10(pLOFKmgfp) and S91 were determined by plating a dilution series of each cell mix to MMMglt (kanamycin and strepto- mycin) and TS (kanamycin and streptomycin) to select transconjugants, LB (ampicillin) to select donors, and TS (streptomycin) to select recipients.
Screening for extracellular chitinase activity. Chitinase-negative mutants were screened on MMMglt supplemented with 0.1% yeast extract and 0.1% colloidal chitin as previously described (38).
Identification of the transposon-interrupted chitinase gene from S91CGFP. Part of the transposon-interrupted chitinase gene from S91CGFP was amplified by PCR amplification with a primer, PLOFOUT (59-CACTGATGAATGTTCC GTTGC-39), designed to extend outward from the 39 end of the Kmr gene (38) and a primer, CHIAR1 (59-ACCAATGTTGATGCGACC-39), designed to ex- tend inward from the 39 end of a chitinase gene. The 500-bp PCR product obtained was used as a template for DNA sequencing with the PLOFOUT primer by the Taq–Dye-Terminator method on an automated DNA sequencer (Applied Biosystems model 373; DNA Sequence and Synthesis Facility, West- mead Hospital, Sydney, Australia).
Detection of GFP fluorescence and microscopy. Bacterial colonies on solid media were exposed to blue light in a light box constructed to contain a 100-W quartz-halogen lamp with an infrared filter and a 480-nm-band-pass filter (An- dover Corp. part no., FS10-50).
An Olympus BX50 microscope, fitted with epifluorescence and differential interference contrast (DIC) optics, was used to visualize cells grown in liquid with and without colloidal chitin particles. Images were generated by either DIC or epifluorescence (excitation, 488 nm; emission, 520 nm) optics with a 403 oil objective lens, numerical aperture of 1.0. Images were recorded with a Panasonic digital closed-circuit television camera (model WV-BP510/A) and captured and prepared with NIH Image (version 1.59) and Adobe Photoshop (version 3.0.4) software, respectively, running on a model 7600/120 Power Macintosh. For photomicrography, slides were coated with gelatin (3%) to prevent cell move- ment.
For experiments involving LSCM, squid pen, which consists of 40% chitin and 60% protein (wt/wt) (16) was collected from a fish market in Sydney and stored at 280°C as described previously (38). Biofilms of S91CGFP cells were grown on 1-cm2 pieces of squid pen suspended in MMMglt at 30°C. After 24 h and then 7 days, small slices were cut aseptically from a piece of squid pen and placed without further treatment on a glass slide and covered by a coverslip, with MMMglt as the mounting medium.
A Bio-Rad MRC-1000 LSCM system in combination with a Nikon Diaphot 300 inverted microscope was used to obtain LSCM images of bacterial micro- colonies attached to squid pen. The microscope was equipped with a 403, 1.15-numerical-aperture water immersion lens and a krypton-argon laser. Exci- tation at 488/10 nm was used for GFP and chitin. Due to autofluorescence of squid pen at an emission of .515 nm, both GFP and the squid pen surface could be imaged. At an emission of 522/35 nm, only GFP was visualized. Images of microcolonies attached to squid pen were collected as xy and xz sections and
TABLE 1. Strains and plasmids used in this study
Bacterial strain or plasmid Relevant characteristic(s)a Reference or source
Bacterial strains Pseudoaltermonas sp.
Strain S91 Smr 2, 38 Strain S91CGFP S91::mini-Tn10-gfp-kan, Smr Kmr GFP1, chitinase-negative This study
Vibrio sp. strain S141 Smr 32 Psychrobacter sp. strain SW5H Smr 34 Escherichia coli
DH5a supEDlac (f80lacZDM15) hsdR recA endA gyrA thi relA 35 C600 supE hsdR thi thr leu lacY tonA 35 SM10 thi thr leu tonA lacY supE (lpir) recA::RP4-2-Tc::Mu Km 29
Plasmids pBCgfp Cmr gfp1 ATCC 87451
27 p519gfp RSF1010 derivative, Kmr mob1, gfp cloned downstream of the lac promoter ATCC 87452
27 p519ngfp p519gfp with npt-2 promoter in front of gfp ATCC 87453
27 pNJ5000 Tcr, tra1 17 pLOFKm oriR6K mob1 RP4 Apr lacIq mini-Tn10 19 pLOFKmgfp pLOFKm with promoterless gfp cloned upstream of kan This study
a Smr, streptomycin resistant; Cmr, chloramphenicol resistant; Tcr, tetracycline resistant.
FIG. 1. Diagrammatic representation of mini-Tn10-gfp-kan. Tn10 inverted- repeat ends are shown as filled boxes at either end. Genes and relevant restric- tion enzyme sites are indicated; large arrows show the direction of gene tran- scription. Primers used in construction are shown above the boxes, with small arrows indicating the 59-to-39 direction. The diagram is not to scale.
VOL. 64, 1998 USE OF GFP TO TAG MARINE BACTERIA 2555
captured as digital computer files, and quantitative examination was performed with CoMOS (Bio-Rad) computer image analysis software.
RESULTS AND DISCUSSION
Expression of GFP from a lac or an npt-2 promoter. p519gfp and p519ngfp are broad-host-range mob1 plasmids, derived from the broad-host-range RSF1010 derivative pDSK519 (23), that were constructed to contain gfp expressed from a lac or an npt-2 promoter, respectively (27). The npt-2 promoter is known to be more effective than lac in gram-negative bacteria other than E. coli (4, 25, 27, 31). E. coli DH5a carrying either p519gfp or p519ngfp was conjugated separately to each of the three marine strains with the E. coli(pNJ5000) helper. Transconju- gants were selected on TS (kanamycin and streptomycin) plates. Each marine strain carrying either p519gfp or p519ngfp was grown to exponential phase and assessed by epifluores- cence microscopy for expression of gfp. More than 99% of S141 cells expressed GFP uniformly at high intensity from either promoter. Fluorescence was so strong that colonies of S141 carrying either promoter could be easily identified on TS plates by eye. Although more than 99% of SW5H(p519ngfp) cells expressed GFP, fluorescence was not uniform. Of cells express- ing GFP, only 14% (42 of 296) did so at high intensity. Vari- ation in fluorescence of SW5H cells may have resulted from plasmid instability in this strain. pDSK519 was maintained poorly in SW5H cells, whereas the plasmid was well main- tained in S141 and S91 cells (data not shown). Cells expressing GFP were not detected in SW5H(p519gfp) cultures, suggesting that the lac promoter was not functional in this strain. GFP fluorescence of S91(p519gfp) or S91(p519ngfp) cells during exponential growth could not be detected. Weak GFP fluores- cence was detected, however, in S91(p519ngfp) cells after 2 days of growth as colonies on TS plates. It is possible that the npt-2 promoter functioned poorly in S91 such that a relatively longer time was required for GFP to accumulate to levels sufficient for visibility by epifluorescence microscopy but that the lac promoter was not functional at all. Bloemberg et al. reported that gfp was expressed poorly from a tac promoter in Pseudomonas aeruginosa (at a level 10 times lower than in E. coli) and Pseudomonas fluorescens (at a level 20 times lower than in E. coli) and was not expressed from a lac promoter in P. fluorescens (5).
Construction of pLOFKmgfp(mini-Tn10-gfp-kan). As gfp ex- pressed from either promoter on pDSK519 derivatives was not useful for all three marine species tested, each species was tagged with gfp by transposon delivery direct to the chromo- some. It is known that mini-Tn10 (19) yields stable transcon- jugants in our marine strains (2) but that various mini-Tn5, including mini-Tn5-gfp (27), or Tn5 transposons yield no transconjugants (reference 2 and data not shown). It was nec- essary therefore, to construct a mini-Tn10 with gfp as the re- porter gene for use with the marine bacteria. The plasmid pLOFKm contains the mini-Tn10 transposon which carries the Kmr gene (19). A promoterless gfp gene was inserted in a position similar to that of the promoterless lacZ gene in mini- Tn10-lac-kan carried by plasmid pLBT, which was described previously (2). A promoterless gfp fragment, including the T7 (gene 10) ribosome binding site, was amplified from pBCgfp with primers containing an SfiI restriction enzyme site at their 59 ends. The 740-bp product was digested with SfiI and ligated to pLOFKm, also digested with the same enzyme. The ligation mixture was transformed into E. coli SM10 competent cells, and transformants were selected for ampicillin resistance (Apr) and Kmr. Plasmid DNA was extracted from each transformant and linearized with SfiI, and fragments were separated by gel
electrophoresis. One transformant that contained a correctly sized 740-bp insert was selected. Plasmid DNA from this trans- formant was amplified with the primers gfpSfiI-F and Kmseq-F. A 1.3-kb PCR product from this plasmid confirmed the correct orientation of gfp with respect to pLOFKm. The plasmid was named pLOFKmgfp, and the transposon, mini-Tn10-gfp-kan (Fig. 1), was used to create transcriptional gfp fusions.
Use of pLOFKmgfp with marine bacterial strains. The mini- Tn10-gfp-kan transposon, delivered from pLOFKmgfp, trans- posed at high frequency in all three marine strains. Represen- tative data for the recipient, S91, are given here. Of 1.7 3 108
CFU of E. coli donors ml21 and 1.1 3 1010 CFU of S91 recipients ml21, 2.0 3 105 CFU and 2.4 3 105 CFU of S91 Kmr
transconjugants ml21 were recovered on TS (streptomycin and kanamycin) and MMMglt (streptomycin and kanamycin) plates, respectively. Transconjugants were patched to MMMglt (streptomycin and ampicillin) to test for loss or retention of the delivery vector (pLOFKmgfp). Of 192 Kmr transconjugants, 190 were ampicillin sensitive (Aps), indicating loss of the de- livery vector in 99.5% of transconjugants. The mini-Tn10-gfp- kan transposon was assumed to give single random insertions in the three marine bacterial strains, as was shown for mini- Tn10-lac-kan (2). Strong S91 promoters, as well as chitinase- activity-negative S91 mutants, were selected and investigated further.
Expression of GFP from a strong S91 promoter. S91(mini- Tn10-gfp-kan) transconjugants were patched to MMMglt and monitored for fluorescence. Detection of GFP in S91 transcon- jugant colonies was not possible by eye under normal light. Of 250 transconjugant colonies, 25 (10%) could have been scored as fluorescent when they were exposed to blue light. As S91 has a distinct orange pigment, it was not possible, however, to differentiate gfp fluorescent mutant colonies from pigment- negative mutant colonies by eye under blue light. Cells from 96 individual transconjugants were screened by epifluorescence microscopy to identify strongly expressed constitutive promot- ers. Of these, 32 (33%) were GFP positive, including 9 (9%) which showed strong fluorescence and were scored as strongly expressed promoter-gfp fusions. Interestingly, with all S91 transconjugants tested (several hundred), visualization of GFP by epifluorescence microscopy was markedly reduced when cells were grown on TS compared to that when they were grown on MMMglt, either on plates or in broth. It is not known whether this was due to a difference in levels of GFP expres- sion in cells grown in either medium or whether it was due to production of an exterior cell polymer in S91 grown on TS that interfered with visualization of GFP fluorescence.
Use of GFP to investigate chi gene expression in living S91 cells. Approximately 2,000 S91 Kmr transconjugants were screened for altered chitinase activity by patching them onto MMMglt containing 0.1% colloidal chitin. Three mutants were presumptively determined to be chitinase negative after 7 days. One of these, S91CGFP, was identified as being gfp positive by epifluorescence microscopy. Transcription of gfp in this mutant was under the control of the promoter of an interrupted chi gene. DNA sequence information obtained from the chitinase- interrupted gene of S91CGFP revealed that the transposon mini-Tn10-gfp-kan had inserted into the same chi gene as that described for S91CX (38).
Using lacZ as a reporter gene, we previously quantitated induction and repression of this chi gene promoter in a pop- ulation of S91CX cells in response to various environmental conditions and nutrient regimens (38). In order to use this chi-gfp transcriptional fusion mutant to investigate genetic reg- ulation of chitinase genes in living single cells and in situ, S91CGFP was grown in MMMglt and MMMglt with either
2556 STRETTON ET AL. APPL. ENVIRON. MICROBIOL.
0.1% N-acetylglucosamine or 0.1% colloidal chitin. Expression of the chi promoter was monitored by visualization of gfp expression by epifluorescence microscopy. The chi-gfp fusion was up-expressed when cells were exposed to either N-acetyl- glucosamine or colloidal chitin particles, which correlated with the quantitative data previously obtained with lacZ as a re- porter gene (38) (Fig. 2). S91CGFP cells attached to colloidal chitin particles were visible, although not all attached cells were fluorescent. Such variation in levels of expression of the chi gene promoter at cell surfaces highlights the difference between monitoring expression of environmentally regulated genes in single cells in real time and monitoring gene expres- sion in a population of cells. With lacZ as a reporter gene, differential levels of expression of the algC promoter in single living P. aeruginosa cells attached to a surface were observed (12).
Although S91CGFP was unable to degrade purified colloidal chitin because of the insertion of the transposon into the chi gene, cells were still able to grow on squid pen, presumably by digesting the proteinaceous portion of the pen with one or more of the several extracellular proteases produced by the cells (1). To investigate biofilm formation on squid pen, S91CGFP was grown in MMMglt containing pieces of squid pen so that biofilms began to develop from cells attached to and growing on the biodegradable surface (38). Examination of horizontal-optical-section (xy) LSCM images showed that
after 24 h, the surface appeared to be patchily colonized by S91CGFP cells which were mostly localized in microcolonies (data not shown). Vertical-section (xz) LSCM images indicated that microcolonies appeared to be localized a few micrometers away from the surface (Fig. 3). After 7 days, microcolonies had increased in size and still appeared to occur patchily over the pen surface. Localization of the microcolonies several mi- crometers from the autofluorescent pen surface was clear, as shown in Fig. 4. Investigation of the nature of this nonfluores- cent zone between squid pen surface and S91CGFP microcolo- nies is in progress. There was no obvious pitting of the pen surface, in contrast to reports of pitting of solid mineral sur- faces by attached microbial consortia. It may be that microor- ganisms will display different surface colonization strategies and behaviors when forming biofilms on organic versus min- eral or inert solid surfaces. When examining biofilm structures, Dalton et al. found that S91 cells colonized glass poorly as single cells after 24 h but colonized well after a longer time, during which cells appeared to show coordinated behavior (11). A biofilm structure in which the majority of the cell mass was localized several microns away from the surface was found for SW5 colonizing a hydrophilic glass surface (11).
The use of LSCM in combination with GFP-tagged marine bacteria makes it possible to investigate the colonization be- havior of bacteria, as pure and mixed species, on natural bio- degradable substrata such as squid pen. It may now be possible
FIG. 2. Microscope digital image demonstrating GFP fluorescence from a chitinase-negative, GFP-positive mutant (S91CGFP) grown on MMMglt (A and B), MMMglt plus 0.1% N-acetylglucosamine (C and D), or MMMglt plus chitin particles (E and F). Images shown in panels A, C, and E were taken with DIC optics. Panels D, E, and F show the same images, respectively, under epifluorescence microscopy.
VOL. 64, 1998 USE OF GFP TO TAG MARINE BACTERIA 2557
to visualize, in real time, the biodegradation of particulate squid pen by GFP-tagged S91 wild-type cells and compare this to biodegradation by S91 GFP mutants containing various known genetic lesions in the chitinase system. Work is under way to construct a derivative of p519gfp in which gfp expression is driven by the S91 chi promoter. This plasmid can then be introduced into the S91 parent strain, which will remain the wild type with respect to its chitinase activity, and this intro- duction will also enable visualization of the expression of the chi promoter in single living cells in real time.
No single promoter-vector system, or even culture medium, could be guaranteed to allow detection of GFP in bacteria isolated from natural environments. Conditions may need to be optimized to enable visualization of GFP in single cells of different bacterial species. This work demonstrated that mini- Tn10-kan-gfp is a useful tool for identifying promoters that are strongly or weakly expressed in marine bacteria. Such promot- ers can now be used for future fluorescence tagging of marine bacteria. Transposon mini-Tn10-kan-gfp was also useful in con- structing transcriptional gfp fusions in marine bacteria, en-
abling visualization of gene expression in single living cells in situ and in real time.
ACKNOWLEDGMENTS
This work was supported in part by The Flinders University of South Australia. S. Stretton was supported by a Flinders University postgrad- uate scholarship, and S. Techkarnjanaruk was supported by a Royal Thai Government scholarship.
We thank Corbett Research for the thermal cycler, Doug Butler for constructing the blue-light box, and Peter Kolesik (Confocal Facility, Department of Horticulture, Waite Institute, The University of Ad- elaide) for expert assistance with the LSCM.
REFERENCES
1. Albertson, N. H., T. Nystrom, and S. Kjelleberg. 1990. Exoprotease activity of two marine bacteria during starvation. Appl. Environ. Microbiol. 56:218– 223.
2. Albertson, N. H., S. Stretton, S. Pongpattanakitshote, S. Kjelleberg, and A. E. Goodman. 1996. Construction and use of a new mini-Tn10:lac:kan transposon to identify environmentally responsive genes. FEMS Microbiol. Lett. 140:287–294.
3. Angles, M. L., K. C. Marshall, and A. E. Goodman. 1993. Plasmid transfer between marine bacteria in the aqueous phase and biofilms in reactor mi- crocosms. Appl. Environ. Microbiol. 59:843–850.
4. Baumberg, S., G. Cornelis, M. Panagiotakopoulos, and M. Roberts. 1980. Expression of the lactose transposon Tn951 in Escherichia coli, Proteus and Pseudomonas. J. Gen. Microbiol. 119:257–262.
5. Bloemberg, G. V., G. A. O’Toole, B. J. J. Lugtenberg, and R. Kolter. 1997. Green fluorescent protein as a marker for Pseudomonas spp. Appl. Environ. Microbiol. 63:4543–4551.
6. Burlage, R. S., Z. K. Yang, and T. Mehlhorn. 1996. A transposon for green fluorescent protein transcriptional fusions: application for bacterial transport experiments. Gene 173:53–58.
7. Chalfie, M., Y. Tu, G. Euskirchen, W. W. Ward, and D. C. Prasher. 1994. Green fluorescent protein as a marker for gene expression. Science 263:802– 805.
8. Chen, F., M. J. González, A. W. Dustman, A. M. Moran, and R. E. Hodson. 1997. In situ reverse transcription, an approach to characterize genetic di- versity and activities of prokaryotes. Appl. Environ. Microbiol. 63:4907– 4913.
9. Christensen, B. B., C. Sternberg, and S. Molin. 1996. Bacterial plasmid conjugation on semi-solid surfaces monitored with the green fluorescent protein (GFP) from Aequorea victoria as a marker. Gene 173:59–65.
10. Cormack, B. P., R. H. Valdivia, and S. Falkow. 1996. FACS-optimized mutants of the green fluorescent protein (GFP). Gene 173:33–38.
11. Dalton, H. M., A. E. Goodman, and K. C. Marshall. 1996. Diversity in surface colonization behaviour in marine bacteria. J. Ind. Microbiol. 17:228– 234.
12. Davies, D. G., and G. G. Geesey. 1995. Regulation of the alginate biosyn- thesis gene algC in Pseudomonas aeruginosa during biofilm development in continuous culture. Appl. Environ. Microbiol. 61:860–867.
13. Dhandayuthapani, S., L. E. Via, C. A. Thomas, P. M. Horowitz, D. Deretic, and V. Deretic. 1995. Green fluorescent protein as a marker for gene ex- pression and cell biology of mycobacterial interactions with macrophages. Mol. Microbiol. 17:901–912.
14. Eberl, L., R. Schulze, A. Ammendola, O. Geisenberger, R. Erhart, C. Stern- berg, S. Molin, and R. Amann. 1997. Use of green fluorescent protein as a marker for ecological studies of activated sludge communities. FEMS Mi- crobiol. Lett. 149:77–83.
15. Gage, D. J., T. Bobo, and S. R. Long. 1996. Use of green fluorescent protein to visualize the early events of symbiosis between Rhizobium meliloti and alfalfa (Medicago sativa). J. Bacteriol. 178:7159–7166.
16. Gooday, G. W. 1990. The ecology of chitin degradation, p. 387–430. In K. C. Marshall (ed.), Advances in microbial ecology. Plenum Press, New York, N.Y.
17. Grinter, N. J. 1983. A broad host range cloning vector transposable to various replicons. Gene 21:133–143.
18. Heim, R., A. B. Cubitt, and R. Y. Tsien. 1995. Improved green fluorescence. Nature 373:663–664.
19. Herrero, M., V. de Lorenzo, and K. N. Timmis. 1990. Transposon vectors containing non-antibiotic resistance selection markers for cloning and stable chromosomal insertion of foreign genes in gram-negative bacteria. J. Bacte- riol. 172:6557–6567.
20. Hodson, R. E., W. A. Dustman, R. P. Garg, and A. M. Moran. 1995. In situ PCR for visualization of microscale distribution of specific genes and gene products in prokaryotic communities. Appl. Environ. Microbiol. 61:4074– 4082.
21. Jacobs, D., M. L. Angles, A. E. Goodman, and B. A. Neilan. 1997. Improved methods for in situ enzymatic amplification and detection of low copy num-
FIG. 3. Vertical-section (xz) LSCM image demonstrating microcolonies of the GFP1 chitinase-negative mutant (S91CGFP) on the surface of squid pen after 24 h, with the gap between microcolonies and the autofluorescent squid pen estimated to be about 6 mm. The image was first captured at an emission of 522/35 nm so that only GFP was visualized; then the same image was captured at an emission of .515 nm so that both GFP and autofluorescent squid pen were visualized; these two images were then used to generate the composite image shown. Scale bar, 50 mm; arrow, squid pen.
FIG. 4. Vertical-section (xz) LSCM image demonstrating a microcolony of the GFP1 chitinase-negative mutant (S91CGFP) on the surface of squid pen after 7 days, with the gap between the microcolony and the autofluorescent squid pen estimated to be about 20 to 25 mm. Scale bar, 25 mm; arrow, squid pen.
2558 STRETTON ET AL. APPL. ENVIRON. MICROBIOL.
ber genes in bacteria. FEMS Microbiol. Lett. 152:65–73. 22. Kalogeraki, V. S., and S. C. Winans. 1997. Suicide plasmids containing
promoterless reporter genes can simultaneously disrupt and create fusions to target genes of diverse bacteria. Gene 188:69–75.
23. Keen, N. T., S. Tamaki, D. Kobayashi, and D. Trollinger. 1988. Improved broad host-range plasmids for DNA cloning in Gram-negative bacteria. Gene 70:191–197.
24. Kremer, L., A. Baulard, J. Estaquier, O. Poulain-Godefroy, and C. Locht. 1995. Green fluorescent protein as a new expression marker in mycobacteria. Mol. Microbiol. 17:913–922.
25. Labes, M., A. Pühler, and R. Simon. 1990. A new family of RSF1010-derived expression and lac-fusion broad-host-range vectors for Gram-negative bac- teria. Gene 89:37–46.
26. Leff, L. G., and A. A. Leff. 1996. Use of green fluorescent protein to monitor survival of genetically engineered bacteria in aquatic environments. Appl. Environ. Microbiol. 62:3486–3488.
27. Matthysse, A. G., S. Stretton, C. Dandie, N. C. McClure, and A. E. Goodman. 1996. Construction of GFP vectors for use in Gram-negative bacteria other than Escherichia coli. FEMS Microbiol. Lett. 145:87–94.
28. Miller, J. H. 1972. Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N.Y.
29. Miller, V. L., and J. J. Mekalanos. 1988. A novel suicide vector and its use in construction of insertion mutations: osmoregulation of outer membrane proteins and virulence determinants in Vibrio cholerae toxR. J. Bacteriol. 170:2575–2583.
30. Miller, W. G., and S. E. Lindow. 1997. An improved GFP cloning cassette designed for prokaryotic transcriptional fusions. Gene 191:149–153.
31. Nano, F. E., and S. Kaplan. 1982. Expression of the transposable lac operon Tn951 in Rhodopseudomonas sphaeroides. J. Bacteriol. 152:924–927.
32. Östling, J., A. Goodman, and S. Kjelleberg. 1991. Behaviour of IncP-1 plasmids and a miniMu transposon in a marine Vibrio sp.: isolation of starvation inducible lac operon fusions. FEMS Microbiol. Ecol. 86:83–94.
33. Podbielski, A., B. Spellerberg, M. Woischnik, B. Pohl, and R. Lütticken.
1996. Novel series of plasmid vectors for gene inactivation and expression analysis in group A streptococci (GAS). Gene 177:137–147.
34. Poulsen, L. K., H. M. Dalton, M. L. Angles, K. C. Marshall, S. Molin, and A. E. Goodman. 1997. Simultaneous determination of gene expression and bacterial identity in single cells in defined mixtures of pure cultures. Appl. Environ. Microbiol. 64:3698–3702.
35. Sambrook, J., E. J. Fritsch, and T. Maniatis. 1989. Molecular cloning: a laboratory manual, 2nd ed. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.
36. Sangari, F., and J. Agüero. 1991. Mutagenesis of Brucella abortus: compar- ative efficiency of three transposon delivery systems. Microb. Pathog. 11:443– 446.
37. Stretton, S., K. C. Marshall, I. W. Dawes, and A. E. Goodman. 1996. Char- acterisation of carbon dioxide-inducible genes of the marine bacterium Pseudomonas sp. S91. FEMS Microbiol. Lett. 140:37–42.
38. Techkarnjanaruk, S., S. Pongpattanakitshote, and A. E. Goodman. 1997. Use of a promoterless lacZ gene insertion to investigate chitinase gene expression in the marine bacterium Pseudoalteromonas sp. strain S9. Appl. Environ. Microbiol. 63:2989–2996.
39. Tolker-Nielsen, T., K. Holstrøm, and S. Molin. 1997. Visualization of specific gene expression in individual Salmonella typhimurium cells by in situ PCR. Appl. Environ. Microbiol. 63:4196–4203.
40. Tombolini, R., A. Unge, M. E. Davey, F. J. de Bruijn, and J. K. Jansson. 1997. Flow cytometric and microscopic analysis of GFP-tagged Pseudomonas fluorescens bacteria. FEMS Microbiol. Ecol. 22:17–28.
41. Valdivia, R. H., A. E. Hromockyj, D. Monack, L. Ramakrishnan, and S. Falkow. 1996. Applications for green fluorescent protein (GFP) in the study of host-pathogen interactions. Gene 173:47–52.
42. Webb, C. D., A. Decatur, A. Teleman, and R. Losick. 1995. Use of green fluorescent protein for visualization of cell-specific gene expression and subcellular protein localization during sporulation in Bacillus subtilis. J. Bac- teriol. 177:5906–5911.
VOL. 64, 1998 USE OF GFP TO TAG MARINE BACTERIA 2559