Urgent management work
1.Introduction- Change.docx
1 Introduction to Book 7
(Author: Jeni Grubb, with revisions by Ingrid Brooks)
In this book we introduce the important issue of change which, for Carlopio and Andrewartha (2008) is the most common activity that demonstrates leadership in organisations. In Yoder-Wise and Menix’s (2003) words: “Change is a natural social process of individuals, groups, organizations, and society” (p.322).
As we have seen in previous discussions, organisations can be conceptualised as open systems, with the forces for change coming from both inside the organisation and outside. They are essentially processes and are composed of people in relationships with other people; nothing more than relationships and social contracts between people. All organisational change therefore “requires personal change in an organisational setting” (Carlopio & Andrewartha, 2008, p.496). However personal change is not easy – it takes effort, persistence and time. With change we adapt, learn and grow although there can be a sense of loss as old ways of doing things become redundant.
Change is a generic term, which, for our purposes, can refer to macro change in the overall health care system, changes at organisational level, or micro change within your specific work unit or department. Indeed it is likely that a macro change, such as a change in the direction of health care policy by the government, can create a ripple effect throughout the health care system (including the private sector), right down to micro changes in actual service delivery. For example, if the government decides to rationalise services in some manner, community hospitals may be amalgamated into a large health care network. Administration may be streamlined; health care services at each campus may be rationalised and staff relocated into new units. Specific work practices may be altered or new technologies introduced. Economies of scale may be achieved through this restructuring but there will be some unpalatable costs, such as staff redundancies, less local input into decision-making, or clients having to travel further to receive care.
According to Beerel (2009) the main purpose of change is “to attune and align the organization to new realities that are continuously emerging and presenting themselves” (p.xvii). If the organisation is to survive, it must adapt to changing conditions, ensuring that employees acquire the knowledge, skills and attitudes required to remain productive and to maintain quality service provision. The sooner the organisation recognises new and emerging realities, the more opportunity and time it has to initiate appropriate strategic responses. Beerel (2009) points out that failure to recognise new realities, or instigating change initiatives based on a false reading of the new realities, is a “sign of poor organisational leadership and inevitably has a detrimental effect on the organization’s future survival (p.xvi). Effective leaders are attuned to environmental changes and trends “because new realities always signal change” (Beerel, 2009, p.xvi).
In this book we will discuss the role of the nurse manager in leading change and consider the challenge of change in health care. We will identify various forces of change and some responses to change; and discuss change theories and strategies. Leading change proactively can offer opportunities to control outcomes and achieve goals. However reacting to changes that are imposed upon the unit/organisation is also an important management responsibility.
2 Learning outcomes
By the end of this book and with further reading and research, you are expected to be able to:
· describe the role of the change agent in planned care;
· discuss the types of change that occur within health care organisations;
· identify forces which facilitate and inhibit the change process within health care organisations;
· evaluate theoretical approaches to planned change; and
· initiate and manage change applying appropriate models and strategies.
3 Leading change
(Author: Jeni Grubb, with revisions by Ingrid Brooks)
Given the pace and size of change in health care, nurse managers are continually involved in some form of change, ranging from the introduction of new equipment or care practices through to major organisational change. These changes will continue with or without the expert guidance of nurses. Nurses cannot afford to simply survive change; they need to be proactive in the change process and in shaping future health care services (Sullivan & Decker, 2009).
Unplanned change is reactive and introduced to deal with unanticipated, or previously ignored, internal or external circumstances. As Marquis and Huston (2009) point out that the nurse manager should be receptive to change and view planned change as a challenge; an opportunity for growth; and a chance to do something creative, new and innovative.
Reflection: your experience of change
Spend a few moments reflecting about the changes that have occurred in your workplace in the past two years. Have these changes been predominantly accidental or have they been planned?
Who has been the initiator of change?
Has change been imposed on you (personally or nursing as a group)?
How have you responded?
To what extent did you have a leadership role?
What is the outcome in a personal cost/benefit analysis?
How did you go? I would be surprised if all of the changes that have occurred have felt totally comfortable for you, even if you are relatively open to change.
Planned change is a proactive enterprise in which change is anticipated and where a change agent, skilled in the theory and practice of organisational change, initiates and manages the change. The change agent may be an external person, such as a consultant or, not infrequently, the manager. Whilst external consultants or newly appointed Chief Executive Officers (CEOs) can provide a more objective assessment of the need for organisational change, they may be at a disadvantage in terms of not understanding the organisational culture, personnel and operating procedures. Further, as external change agents (and some CEOs) move on and do not have to live with the consequences of their changes, they are likely to initiate more drastic changes than insiders. In larger organisations a transitional management team may be allocated the time and responsible for managing the change process. This could include both insiders and outsiders.
For Marquis and Huston (2009) the key to success is to involve all of the people affected by the proposed change in the planning process. They argue that people hate “information vacuums” and propose that if there is no on-going discussion about the change, gossip and negativity will fill the void. Arguing that a partnership between staff and higher management is more effective in producing change than a top-down approach, Sullivan and Decker (2009) identify a number of characteristics of effective change agents that can be cultivated and mastered with practice:
· the ability to combine ideas from unconnected sources;
· the ability to energise others by keeping interest levels up and to have high personal energy levels;
· the ability articulate a vision through versatile thinking and insights;
· well developed interpersonal communication, group management and problem-solving skills;
· the ability to retain the big picture focus whilst dealing with each part of the system;
· enough flexibility to modify ideas when this will improve the change, but enough persistence to resist non-productive tampering with the plans;
· confidence and not inclined to be easily discouraged;
· the ability to handle resistance;
· realistic thinking; and
· trustworthiness: a track record of integrity and success with previous changes (pp.73-74).
A change agent views change as healthy. In initiating needed change proactively, the nurse leader is imaginative, bold, ingenious, persistent and determined.
The first reading is from Carlopio and Andrewartha (2008). It is quite long we would like you to read up to page 505 and come back to the rest of the chapter later on in the topic. Carlopio and Andrewartha (2008) initially focus on personal change, in an organisational context – as you read try to be reflective. We have included this chapter for your convenience and because of their approach to this key topic.
Reading
Carlopio, J., & Andrewartha, G. (2008). Developing management skills: a comprehensive guide for leaders (4th ed.). Frenchs Forest, NSW: Pearson Prentice Hall, Chapter 10: Managing change, pp.492505.
Your reading can be accessed here
We will now consider some forces for organisational change.
4 Forces for change
(Author: Jeni Grubb, with revisions by Ingrid Brooks)
Change can be considered in terms of intensity or according to the level of change. Intensity can range from almost imperceptible to a radical transformation of the whole organisation or system (Tappen, 2003). If we view organisations as an open system, change can occur on different levels: environmental, organisational and individual levels. Robbins, Judge, Millett and Waters-Marsh (2008) identify several forces for change, with examples, in today’s dynamic environment:
· technology: advances in computerisation, deciphering of the human genetic code;
· nature of the workforce: aging population, more cultural diversity;
· competition: mergers and consolidations, global competitors;
· social trends: retirement of baby-boomers;
· world politics: wars, opening of markets in China; and
· economic shocks: the global financial crisis.
Which of these do you consider relevant to health care systems and organisations in your country?
Hernandez and Kaluzny (1994, p.297) propose that health care organisations experience forces for change from four main sources: technical changes; service or product change, administrative, structural or strategy change; and human resources change.
Technical change could involve changes in surgical procedures; altered job assignments; or the introduction of new equipment.
Service or product change could include the introduction of a new service, such as renal dialysis services in a regional centre where previously it was only available in metropolitan organisations.
Administrative, structural or strategic change could involve changes to the organisation’s financial management systems; a flattening of the hierarchal structure; or shifting district nursing services out of an acute care hospital and into a community-based health care service.
Human resource change involves efforts to shape attitudes, values, behaviours and skills of employees (Hernandez & Kaluzny, 1994, p.298).
Graetz, Rimmer, Lawrence and Smith (2002) argue that, in a post-industrial era, the global business environment is characterised by “complexity, uncertainty and turbulence” (p.17). Traditional modes of operating are no longer sustainable and change is random and discontinuous. By definition, this type of change is rapid, revolutionary and traumatic and requires different leadership skills if the challenges faced are to be managed opportunistically and innovatively. What are the challenges for nursing leaders, managers, clinical nurses and change agents in health care organisations in this environment? To what extent has this global business environment affected health care organisations in this decade?
4 Forces for change
4.1 Analysing forces for change
Change can be analysed in terms of the external and internal factors influencing an organisation’s need for change. These factors are used as the basis for analysing the driving forces of change and forces impeding change. Without doubt, the way in which organisations provide health care is influenced by forces beyond the organisation. Increasingly we are part of a global community with political, economic, technological, and environmental factors impacting upon health care.
In monitoring the external environment, managers consider factors such as:
· changes in health care policy and funding;
· economic changes;
· funding cutbacks;
· demands for better health care at lower costs;
· societal values and expectations;
· consumer demands (e.g. more informed patients);
· demographics;
· developments in health care;
· fluctuations in labour markets;
· education trends; and
· the activities of other health care organisations.
Within the organisation, internal factors considered include changes involving the:
· people (e.g. greater employee participation; need to address human resource problems, including poor performance; revised strategic vision; reducing staff numbers);
· technology (e.g. advances in medical technology);
· structure (e.g. restructuring, contracting out for services); and
· tasks (e.g. new clinical pathways).
These factors are some of the main entry points for organisational change. They are so interrelated that a change in one area invariably requires change in the other areas as well. A factor not included in this model is financial resources, a factor that can facilitate or impede change or can be a change in its own right.
4 Forces for change
4.2 The challenge of change in health care
(Author: Jeni Grubb, with revisions by Ingrid Brooks)
The transformation of healthcare delivery creates contextual alterations in change situations, requiring planning, decision making and information. Uncertainty in the changing workplace challenges nurse managers and change agents to communicate more extensively and perhaps differently than in more stable climates.
As discussed in previously, planned health care system reforms in Australia and countries such as the USA will require innovation and change management. Other forces are escalating costs of healthcare; workforce shortages; aging populations; and the technology to continue to be forces for changes. Much of the change is being economically driven, with the government, insurance companies, consumers, employers, and unions exerting pressure to control spending and to redistribute health care to more cost-effective care.
Given that change processes are influenced by organisational culture, it may be necessary to change the organisational culture in order to make progress. Marquis and Huston (2009) claim that healthcare organisations lag behind trends in American corporations that demonstrate that investments in developing the organisational culture translate into high performance. Does this apply in Australia/your country?
The organisational culture is largely set by the leadership and a constructive organisational culture is essential characteristic of a healthy organisation (Marquis & Huston, 2009). Changing the underlying culture to facilitate change can be difficult but, if the goal is important enough, worthwhile.
In every probability the pace of change will continue to accelerate, affecting every part of our life including our personal values and work practices. And yet people often don’t like to change, especially if their current situation feels comfortable. When events move too quickly, individual and organisational long-term stability can be threatened. The people and the organisation may exhibit signs of stress and resistance to change may strengthen. The success or otherwise of an organisation may well depend on how well leaders/managers initiate and manage change.
All too often changes in health care have occurred without adequate input from clinical nurses and nurse managers. The challenge is that these changes will continue to occur with or without nurses’ input. Nonetheless, opportunities do exist for nurse managers to participate in changes to the system about which they complain.
Remember: It is not enough to just survive the change. This is true for all levels of change: the system, organisation, work unit, for the nursing profession and for you individually.
Reflection: The challenge of change
List the major changes in health care in your state/country over the past few years.
How has your organisation managed within this environment?
How well does the organisational culture assist in the achievement of effective change?
How have you coped with the challenge of change, both professionally and personally?
5 Response to change
(Author: Jeni Grubb, with revisions by Ingrid Brooks)
The response to change depends on many factors, including the type of change; the degree of stability in the organisation; the pace of change. For example, if the organisation is very stable and the change considered threatening, it may require considerable force to implement the change. Resistance is the expected response to any change and, rather than attempting to eliminate opposition, the change agent can identify and implement strategies to reduce and manage the resistance to change.
According to Marquis and Huston (2009), the level of resistance can depend on the type of change proposed. For example, the introduction of new technology (such as a new intravenous pump) will encounter less resistance than a change in established customs and norms (e.g. a change in who is able to administer a certain type of intravenous medication). If self-esteem or personal security is threatened, there is apt to be greater resistance to the change.
The main sources of resistance to change, both individual and organisational, are identified by Robbins, et al. (2008) as:
Individual sources:
· habit: people rely on programmed responses to cope with life and when confronted with change they respond in their accustomed ways;
· security: those with a high need for security are more likely to feel threatened and resist change;
· economic factors: changes in work practices can arouse fears that we will not be able to perform the new tasks or routines to our previous standards, especially if productivity and pay are linked;
· fear of the unknown: change substitutes uncertainty and ambiguity for the unknown; and
· selective information processing is used to keep perceptions intact; people may hear what they want hear and ignore what information that challenges the world that they have created.
Organisational sources:
· structural inertia: the organisation has built in mechanisms (such as formalised regulations) to produce stability which act as a counterbalance to sustain stability;
· limited focus of change: because organisations are made up of interdependent subsystems, change in one affects the others. Therefore limited changes in a subsystem may be nullified by the larger system or may impact on the whole organisation;
· group inertia: group norms may act as a restraint, even if some individuals favour behavioural change;
· threat to expertise: changes in practices may threaten the expertise of specialist groups;
· threat to established power relationships: a redistribution of decision-making authority can threaten established power relations in the organisation; and
· threat to established resource allocations: change can be a threat to groups in the organisation with control over sizable resources.
Within any organisation there are a range of individual attitudes towards change. Individual response to change usually falls into particular patterns of behaviour: innovators, early adopters, early majority, late majority, laggards and rejectors (Rogers as cited in Marquis & Huston, 2009).
Innovators thrive on change, may participate in change involving opposing sides and may effect change in the midst of controversy. Early adopters are open and receptive to new ideas, supporting and facilitating change. The early majority prefer the status quo but, after careful thought, usually adopt the change. The late majority are followers who frequently express their resistance to the change until most others have adopted it. Laggards are the last people to adopt the change. They are traditionalists who are sceptical of change and innovators. Rejectors oppose innovation and actively encourage others to also oppose the process. Rejectors may covertly seek to undermine the change process and the change agent.
The change agent should seek to recognise these behaviours, capitalising on the willingness of early adopters and the early majority to facilitate the change process. As they threaten the success of the change process, both laggards and rejectors pose a challenge to the manager/change agent (Rogers as cited in Marquis & Huston, 2009). The change agent’s challenge is to provide opportunities to channel the various responses of workers into actions that are supportive of the change process.
Staff members often go through an emotional grieving process resulting from the loss of their former work situation. As this can impact on their attitudes, energy levels and ability to engage in the change process, the change agent should be sensitive to the stages of loss and employ appropriate interventions such as problem solving, active listening and informing (Kubler-Ross as cited in Carlopio & Andrewartha, 2008).
The change agent should assess the organisational climate for change. How has the organisation coped with change in the past? If recent changes have been relatively few or traumatic, more preparation will be required. Do the employees have the knowledge and skills to implement the changes? What is the level of trust between management and employees and amongst the employees themselves?
Lack of trust between management and employee is probably the greatest factor contributing to resistance to change. Marquis and Huston (2009) believe that this trust depends on the employee’s desire for predictability and security. Trust is eroded when the status quo changes; when the employer-employee “contract” changes. The proposed change may be assessed more in terms of the affect on the employee’s career, personal life and status than on the welfare of the organisation. There needs to be trust in the capability of both management and employees to successfully achieve the proposed change. Roles and responsibilities of those involved in the change process need to be negotiated and accepted before such trust can be established.
Overcoming the inevitable resistance to change can be aided by involving employees or their representatives in planning groups; maintaining empathy with resisters; assessing potential and actual problems; and consistently and honestly informing people about how the change will affect them personally.
Robbins et al. (2008) suggest a number of tactics for change agents, including communicating and educating staff; encouraging participation; building support and commitment; negotiating; selecting people who will support the change; and manipulating and coopting; coercing resisters. The last two tactics are relatively easy and inexpensive but the change agent will lose credibility and employee trust.
Reflection: Recognising response of change
Recall a recent change within your organisation or workplace. Identify the players in the situation.
Who were the innovators, early adopters, early majority, late majority, laggards and rejectors?
Analyse how these individuals influenced the change process.
Which pattern dominated and how did they affect the final outcome?
What pattern of behaviour did you demonstrate?
Is this usual for you in change?
Can you capitalise on this attribute in your role as a change agent?
In some instances managers are too keen to impose change for change sake. Listening to insightful objections to change may enable the organisation to maintain its stability while the value of the proposed changes is carefully evaluated.
It may be about time for you to take a nice break and then come back to explore change theories.
6 Change theories
(Author: Jeni Grubb, with revisions by Ingrid Brooks)
The theory and practice of change management draws on several social science disciplines and traditions. For Burnes (2009), the theories of change fall into two main approaches: a planned change approach and the emergent approach to change. If you examine the current nursing leadership and management texts, most start with Lewin’s (1951), classic force-field model of change. Other authors divide the theories into linear approaches to planned change and non-linear change theories.
6 Change theories
6.1 Classical and linear models of planned change
Kurt Lewin coined the term, planned change, as an alternative to unplanned change and his theory has been influential since the early 1950’s. His classical theory of change comprises of four parts: field theory, group dynamics, action research and a three step model.
Lewin (1951) recognised that individuals experience two major obstacles to change. Firstly, people have great difficulty in altering well established behaviours and attitudes. They may be unable to change because they lack the ability or skills required or they may not want to change because they can see no personal benefit in effecting the change. Secondly, Lewin found that change often lasts for a short period only. After a brief period of trying to do things differently, people often return to their established pattern of behaviour. His model is an attempt to overcome these obstacles.
Lewin (1951) saw behaviour as a dynamic balance of forces working in opposing directions within a field such as an organisation. Driving forces push participants in the direction of the desired direction thus facilitating change whilst restraining forces lead participants in the other direction and impede change. Change is accomplished by analysing these forces and shifting the balance in the direction of the desired change though the three step process: unfreezing, moving and refreezing. This process is an iterative, cyclical process that involves diagnosis, action, reflection and evaluation, and further action and reflection and evaluation. It recognizes that, once implemented, the change needs to be self-sustaining and that staff do not regress to old behaviours.
In the unfreezing stage, motivation is created for some form of change to occur. The change agent identifies a problem, decides that change is required and makes others aware of the need for change. The role of the change agent is to analyse and then disrupt the forces which are maintaining the status quo. As people become unsettled or discontent, awareness of the need for change develops.
The force field analysis should take into account factors in the external environment (such as changes in policy or consumer demand) and internal environment (such as people, financial resources; technology, structures and tasks). According to Lewin (1951), the analysis may identify many factors but some will be more significant than others and it is there that the most energy will be required. For example, let’s say the change agent is aiming to improve communication processes by introducing a new computer information system within an aged care facility. The analysis may reveal that, whilst the available technology, the support from upper management and adequate financial resources are the factors driving change, a major source of resistance could be that the staff don’t want to change because they lack the computer skills.
Whilst both forces are important, Lewin (1951) advocates more emphasis on reducing the forces resisting the change rather than on increasing driving forces. Active participation of staff in identifying the problem and generating options for action can help prepare people for change. Readiness for change increases if the level of dissatisfaction is high. So if the level of dissatisfaction is low the change agent needs to increase it by introducing new ideas or new information. This is the time to “rock the boat” by making people uncomfortable with the status quo.
The moving stage involves detailed planning and actually initiating the change, or moving to the desired situation. This includes identifying, planning and implementing using appropriate strategies. At this point the driving forces should exceed the restraining forces.
In recognition of the complexity of change, the timing of the change should be appropriate and the change implemented as gradually as circumstances allow. Once implemented, the change should be evaluated and modified if necessary.
During the refreezing stage, the change agent assists in stabilising the change so that it becomes integrated into the new status quo. Permanency should be cultivated – for example, through formal structures, such as establishing written policies, by monitoring staff actions and by providing positive reinforcement. Personnel should be supported until the change is fully accepted, usually for about three to six months. Refreezing does not eliminate future improvements. As they say, “the proof of the pudding is in the eating” and the success of the change should be evaluated when the change agent terminates the supportive relationship by delegating the responsibility to target system members.
Reading
It is time to return to the Carlopio and Andrewartha (2008) reading. Please read pages 505 to 530
William Bridges (as cited in Gratetz et al., 2002) developed a model of transition, arguing that change is situational: a new boss, a new site, new policy, or new team roles. He also argues that people go through a transition; i.e. a psychological process through which they come to terms with the new situation. For him, change is external and transition is internal. The three stages in the process of transition are: endings, the neutral zone and new beginnings. As with all psychological stage theories, there is a degree of overlap between stages.
Endings: the first stage of the transition involves assessing what will be lost in the change process and accepting this loss. For example a new breakthrough technology may mean that existing knowledge will become obsolete and other people become the “expert”. Bridges (1991) proposes that the biggest single problem encountered by organizations in transition is the “failure to identify and be ready for the endings and losses” (p.5). The neutral zone: the second stage of transition is a period when old habits, beliefs and attitudes are extinguished because they are deemed no longer appropriate. New patterns are learned, practiced and adjusted to by staff. It is a period of discontinuity and discomfort. Anxieties will be high; motivation may be problematic; and productivity can suffer. On the positive side, opportunities for creativity exist in this period.
New beginnings: the third stage of the transition occurs only when and if the staff have made an ending and have spent some time in the neutral zone. Bridges points out that, while it is the last stage of the change process, managers and change agents sometimes mistake it for the first stage. Unlike the first two stages, it is a psychological rather than a situational stage and is open ended. There is not manageable timetable that can be devised.
6 Change theories
6.2 Non linear approaches to change in organisations
More contemporary change theorists argue that the linear approach is suited to the industrial era where change was more predictable, infrequent and the environment more stable. Today’s health care organisations are likely to experience intense transformation, followed by periods of stability. As change is ever present and unforeseeable, non-linear change theories are now influencing the thinking of many leaders (Marquis & Huston, 2009). Daly et al. (2004) agree and explain that the nonlinear models” are based on the premise that change occurs naturally from self-organising patterns. These newer theories include chaos theory, learning organisations and complex adaptive systems theory.
Chaos theory is one of the main complexity theories and works on the assumption that organisations are open systems operating in a “complex, unpredictable, and orderly disorder in which patterns of behaviour unfold in irregular but similar forms” (Burnes, 2004, p.597). From this perspective, organisations are in a state of flux and the periods of stability are a departure from the norm that requires explanation. Emphasising policies and rules is short-sighted and waste time (Yoder-Wise & Menix, 2007).
Learning organisation theory is a related approach. Learning organisations organisations place emphasis on flexibility and responsiveness. By using a learning approach, leading organisations try to survive in an unpredictable healthcare environment by using a learning approach. The aim is to be more responsive and adaptive to external and internal influences. For Senge (as cited in Marquis & Huston, 2009), an organisation achieves this learning organisation status when all of the critical elements are present, interacting and linked. These are identified as five disciplines:
1. Systems thinking
2. Personal mastery
3. Mental modes
4. Shared vision
5. Team learning.
Please now read a chapter from Burnes (2009). He critiques the planned theory approach, discusses and critically evaluates emergent approaches to change, including complexity theories, and the role of the manager as change agent. In the process he draws together a number of related topics in this unit, including organisational structure, managerial behaviour, and power and politics.
Reading
Burnes, B. (2009). Managing change: a strategic approach to organisational dynamics (4th ed.). Essex: Financial Times Prentice Hall. Chapter 9: Development in change management: the emergent approach and beyond, pp. 392-398.
A key point of the emergent approach is that organisational change is messy, unpredictable, open-ended and political process. From this perspective, top managers can no longer be expected to be able to identify and implement all of the changes necessary to successful align the organisation to its environment. Therefore, from this perspective, the change process should be bottom-up, emergent and responsive to events.
7 Change strategies
(Author: Jeni Grubb, with revisions by Ingrid Brooks)
The change agent and those supporting the change employ various strategies to facilitate both planned and non-linear changes processes. Some of these have been featured in your readings. The aim is to promote movement towards integrating the change and to minimise harmful resistance to the change. The choice of strategies for planning and implementing change depends on many factors, but may include the type of problem, the environment, the type of organisation, and the values of the organisation. To be successful, the chosen strategies should be congruent with such factors and should be chosen collaboratively by organisational representatives and the change agent.
Kotter and Schlesinger (as cited in Yoder-Wise & Menix, 2007) advocate the selective use of various strategies to overcome resistance, to promote the involvement of those affected by the proposed change, and to facilitate the overall change process. These include: participation and involvement; facilitation and support; education and communication; negotiation and agreement; manipulation and co-optation; and coercion and can be used individually and in combination with each other. Chaos theory and learning organisation theory support the use of vision development, information management strategies and relationship building (Yoder-Wise & Menix, 2007).
Three classic strategies for effecting change in others have been proposed by Bennis, Benne and Chinn (as cited in mainstream nursing management texts such as Sullivan & Decker, 2009; Marquis & Huston, 2009). These are: rational-empirical strategies, normative-reeducative strategies, and power-coercive strategies. The choice of strategy will be influenced by the power of the change agent and the amount of resistance anticipated.
Rational-empirical strategies work on the assumption that people act in rational self-interest and are rational beings who will accept the change if provided with factual information which convinces them of the need for change. These strategies are usually most successful when there is little resistance to the proposed change and the change is considered reasonable (Sullivan & Decker, 2009; Marquis & Huston, 2009).
Normative-re-educative strategies utilise group processes to socialise and influence people so that the change will occur. The change agent uses collaboration and is focused on non-cognitive determinants of behaviour, such as people’s attitudes, feelings, roles and relationships to increase acceptance of the proposed change (Sullivan & Decker, 2009; Marquis & Huston, 2009). As these strategies enable the creative problem-solving and emphasise a human relations approach, they are generally most suitable for planned change in nursing and health care (Sullivan & Decker, 2009).
Power-coercive strategies are based on the application of “power by legitimate authority, economic sanctions, or political clout” of the change agent (Sullivan & Decker, 2009, p.71). Such strategies are useful when time is short, the survival of the organisation is at stake and/or significant resistance to the change is anticipated. There is little participation by the target group and resistance is managed by authoritative measures. If employees don’t like it they can leave (Sullivan & Decker, 2009). Of course the employees may choose to adopt this strategy also, perhaps by taking industrial action.
Whilst normative-re-educative strategies may be considered most appropriate, the change agent may opt to use all three types of strategies to increase the chances of successful change.
8 Concluding comments
(Author: Jeni Grubb, with revisions by Ingrid Brooks)
If we accept that change is a constant, has always been with us and will continue to dictate reality, it behoves the nurse leader/manager to be knowledgeable and skilled in initiating and managing different types and levels of change. The skilled change agent fulfils a leadership and management function in the organisation, identifying areas where change is appropriate and needed, or is perhaps already occurring. Intelligence, skill and experience are essential for survival in the continuously changing work context. The change agent has to be knowledgeable about models of both planned change and non linear approaches to change and the different strategic approaches to change. The leader/manager must maintain an awareness of the big picture of change in healthcare organisations, whilst sensitively managing each part of the system, including staff members’ responses to the change. Change is an opportunity for growth and progress but it can be disruptive and traumatic for some. The range of skills required by the leader/change agent is broad but includes being able to share a vision and to creatively solve problems. The change agent should be a good communicator, trustworthy and a role model for change.
9 References
Alexander, J. (2000). The changing role of clinicians: their role in health reform in Australia and New Zealand. In A.L. Broom (Ed.), Health reform in Australia & New Zealand (pp.161-175). Oxford: Oxford University Press.
Bartol, K.M., Martin, D.C., Tein, M., & Matthews, G. (1995). Management: a pacific rim focus. Sydney: McGraw-Hill Book Company.
Beerel, A. (2009). Leadership and change management. Los Angeles: Sage.
Bridges, W. (2009). Managing transitions: making the most of change (3rd ed.). Philadelphia: Da Capo Lifelong.
Burnes, B. (2009). Managing change: a strategic approach to organisational dynamics (5th ed.). Harlow: Financial Times Prentice Hall.
Cameron, E., & Green, M. (2009). Making sense of change management: a complete guide to the models, tools & techniques of organizational change (2nd ed.). Philadelphia: Kogan Page.
Carlopio, J., & Andrewartha, G. (2008). Developing management skills: a comprehensive guide for leaders (4th ed.). Frenchs Forest, NSW: Pearson Prentice Hall.
Cohen, D.S. (2005). The heart of change field guide: tools and tactics for leading change in your organisation. Boston Massachusetts: Harvard Business School Press.
Daly, J., Chang, E., Hancock, K., & Crookes, P. (2004). Leading and managing change in nursing. In J. Daly, S. Speedy, & D. Jackson (Eds), Nursing leadership (pp.183-196). Marrickville: Elsevier Australia.
Duckett, S.J. (2007). The Australian health care system (3rd ed.). South Melbourne: Oxford University Press.
Hernandez, S.R., & Kaluzny, A. (1994). Organizational innovation and change. In S.M. Shortell, & A.D. Kaluzny (Eds), Health care management: organization and behavior (3rd ed., pp.294-313). New York: Delmar Publications Inc.
Herold, D.M., & Fedor, D.B. (2008). Change the way you lead change: leadership strategies that really work. Stanford, California: Stanford Business Books.
Johnstone, P.L., Dwyer, J., & Lloyd, P.J. (2006). Managing and leading change. In M.G. Harris (Ed.), Managing health services: concepts and practice (2nd ed., pp.159-178). Marrickville, NSW: Mosby Elsevier.
Craetz, F., Rimmer, M., Lawrence, A., & Smith, A. (2002). Managing organisational change. Milton, Qld: John Wiley & Sons Australia, Ltd.
Lewin, K. (1951). Field theory in social sciences. New York: Harper & Rowe.
Marquis, B.L., & Huston, C.J. (2009). Leadership roles and management functions in nursing: theory and application (6th ed.). Philadelphia: Wolters Kluwer Health/Lippincot Williams & Wilkins.
Pugh, D.S., & Mayle, D. (Eds) (2009). Change management. London; Thousand Oaks, Calf: Sage.
Yoder-Wise, P.S., & Menix, K.D. (2007). Leading change. In P.S. Yoder Wise (Ed.), Leading and managing in nursing (4th ed., pp.321-340). St. Louis: Mosby Elsevier.
Mickan, S.M., & Boyce, R.A. (2006). Organisational adaptation and change in health care. In M.G. Harris (Ed.), Managing health services: concepts and practice (2nd ed., pp.59-82). Marrickville, NSW: Mosby Elsevier.
Sare, M.V., & Ogilvie, L. (2010). Strategic planning for nurses: change management in health care. Sudbury, Mass.: Jones and Bartlett, Chapter 7, pp.117-143.
Sullivan, E.J., & Decker, P.J. (2009). Effective leadership and management in nursing care (7th ed.). Upper Saddle River, New Jersey: Pearson Prentice Hall.
Tappen, R.M. (2003). Nursing leadership and management: concepts and practice (4th ed.). Philadelphia: F.A. Davis.
1.1 ,,5.6Mento Change management theories.pdf
avoiding major errors in the change process. It is best viewed as a vision for the change process. It calls attention to the key phases in the change process. Two key lessons learned from the model are that the change process goes through a series of phases, each lasting a considerable amount of time, and that critical mistakes in any of the phases can have a devastating impact on the momentum
MODELS OF THE CHANGE PROCESS Three models have stood as exemplars in the change management literature. The first model is Kotter’s (1995) eight-step model for transforming organisations. Kotter’s model was developed after a study of over 100 organisations varying in size and industry type. After learning that the majority of major change efforts failed, Kotter couched his model as a way of
� Henry Stewart Publications 1469-7017 (2002) Vol. 3, 1, 45–59 Journal of Change Management 45
A change management process: Grounded in both theory and practice Received (in revised form): 30th May, 2002
Anthony J. Mento is a professor of Organizational Behavior at the Sellinger School at Loyola College. Dr Mento has taught in executive programmes at such institutions as Aegon, Deutsche Bank and the US Government as well as at Loyola.
Raymond M. Jones is a professor of Organizational Strategy at the same university. Prior to academic life, he was an executive at Occidental Petroleum Corporation. Dr Jones helped design and taught in the executive programmes of this paper’s anonymous corporation.
Walter Dirndorfer is a graduate of Loyola’s executive MBA programme. He is a project manager at a defence contractor who requested anonymity as a result of increased security measures after the events of 11th September.
KEYWORDS: change management, lessons learned, mind mapping, project management, storytelling, metaphors
ABSTRACT There exists in the literature a number of change models to guide and instruct the implementation of major change in organisations. Three of the most well known are Kotter’s strategic eight-step model for transforming organisations, Jick’s tactical ten-step model for implementing change, and General Electric (GE)’s seven-step change acceleration process model. This paper introduces a framework that draws from these three theoretical models but is also grounded in the reality of the change process at a Fortune 500 defence industry firm. The purpose of the paper is to provide guidance to the practitioner leading an organisational change process. This guidance is grounded in both theory and practice. The guidance is further enriched by the demonstrated use of such methodologies as mind mapping, lessons learned, storytelling and metaphors.
Anthony J. Mento Professor of Organizational Behavior, Sellinger School, Loyola College, 4501 North Charles Street, Baltimore, MD 21210, USA
Tel: �1 410 617 1507; Fax: �1 410 617 2005; e-mail: [email protected]
accessible, ensuring that all essential steps are followed. Discipline, not discovery is the goal of the checklist.
The three models of the change process are configured in Figure 1 as a Mind Map. Mind mapping is a creativity and productivity enhancing technique that can improve the learning efficiency and capability of individuals and organisations (see eg Buzan, 1989; Mento et al., 1999). The Mind Map visually shows the intellectual roots upon which we drew. Three plus years of practical experiences, however, further shaped these theoretical constructs with change management at an anonymous defence contractor (ADC). Because of increased security measures after the events of 11th September, the defence firm requested anonymity after the write-up of the projects had commenced. Thus drawing lessons learned from both the theoretical literature and a practitioner’s experience, this paper provides guidance to the leader of an organisational change process. This guidance is grounded in both theory and practice. Furthermore, it demonstrates and is enriched by the use of such methodologies as mind mapping, lessons learned, storytelling and metaphors.
COMPANY BACKGROUND In the 1990s, the defence industry was greatly affected by a shrinking defence budget after the collapse of the former Soviet Union. The reduced defence expenditures caused a consolidation of firms within the industry. The division under study was acquired and became a core business area for the acquiring firm in the mid-1990s. Additional acquisitions created a de facto market of internal engineering organisations, all vying for the same corporate resources to fund both product improvements and new product development. A critical
of the change process. Kotter’s model is aimed at the strategic level of the change management process.
Jick (1991a) developed a tactical level model to guide the implementation of major organisational change. His ten-step approach serves as a blueprint for organisations embarking on the change process as well as a way to evaluate a change effort already in progress. He notes that implementing change is an ongoing process of discovery, with thoughtful questions continually being asked throughout the change journey. Jick states that implementation is a blend of both art and science. How a manager implements change is as important as what the change is. How well one does in implementing a particular change depends ultimately on the nature of the change, on how sensitive the implementers are to the voices in the organisation, and on the recognition that change is a continuous, not a discrete process.
The seven-step change acceleration process used at GE (Garvin, 2000: 131) follows closely Lewin’s (1947) notion of unfreezing, movement and refreezing as the essential components of the change process. In essence, the model focuses on the leader’s role in creating urgency for the change, crafting and communicating the vision, leading the change, measuring the progress of change along several dimensions, and institutionalising the change. Institutionalising the change, or the refreezing, involves changes in the organisational design factors, ie creating a fit of systems and structures to enable change. Kerr (quoted in Garvin, 2000), one of the developers of the model, refers to the series of seven steps as a pilot’s checklist. According to Garvin (2000) checklists are used by even the most experienced pilots; yet they offer no new insights. Instead, they make existing knowledge more visible and
46 Journal of Change Management Vol. 3, 1, 45– 59 � Henry Stewart Publications 1469-7017 (2002)
Mento et al.
� Henry Stewart Publications 1469-7017 (2002) Vol. 3, 1, 45– 59 Journal of Change Management 47
Figure 1 Three models of the change process
A change management process
48 Journal of Change Management Vol. 3, 1, 45– 59 � Henry Stewart Publications 1469-7017 (2002)
Figure 2 Visual metaphors
Mento et al.
leading a change effort around ideas developed through creative tension as opposed to implementing fixes to current organisational problems. When one focuses on problem solving, the energy to change comes from the desire to escape an unpleasant status quo. With creative tension, the energy for the change comes from the vision, of what one wants to create, juxtaposed with the current reality. With problem solving, the energy for the change diminishes as the problems become less pressing and the situation is improved. Senge notes that the energy for change that drives the problem-solving process is extrinsic because it represents a way to escape from the status quo. Change driven by creative tension tends to be intrinsic. The extrinsic/intrinsic orientation can have a significant impact on the consequences of the change effort. In the context of a learning organisation, extrinsic motivation for change produces adaptive learning, whereas change driven by creative tension yields generative or new learning. Recognising change (the need for, the idea of, and the context thereof) is just the first step.
Step 2: Define the change initiative Defining the change initiative tracks closely with Jick’s step 1 of analysing the organisation and its need for change. It is useful at this point to define the roles of the key players in all change efforts: Strategists, implementers and recipients (Jick, 1991a). Change strategists are responsible for the initial work: Identifying the need for change, creating a vision of the desired outcome, deciding what change is feasible, and choosing who should sponsor and defend it. The vision creation assists in the formation of creative tension that can yield generative learning. Change implementers are the ones who make it happen. Their task is
imperative for the divisions internally, and the company externally, was to learn how to adapt more quickly to this changing environment. The munificent environment of the 1980s was being replaced by a more parsimonious context in the 1990s. Given this environmental shift, it became imperative for ‘our’ division to have an effective change management programme. Two of the authors became involved with this project, one very directly and one in a consultative capacity.
The paper will explicate 12 steps that are recommended when one wants to implement change. These 12 steps are based on lessons learned from the change models discussed above filtered through the actual experience that occurred throughout the late 1990s. These 12 steps are shown holistically as visual metaphors (Morgan, 1998; Davenport, 1999) in Figure 2. They are detailed in what follows.
A FRAMEWORK FOR CHANGE
Step 1: The idea and its context It is important as the starting point of a change effort to highlight the idea for what needs to be changed or what new product should be introduced or what particular innovation might bring a significant lead over competitors. A source for ideas for improving the organisation can arise through creative tension (Senge, 1990). Senge notes that creative tension evolves from clearly seeing where we want to be, our vision, and telling the truth about where we are now, our current reality. The gap between the two generates a natural tension. In an interview (Tichy and Charan, 1989), Jack Welch similarly notes a key characteristic of any leader is to first face reality.
There is a key distinction between
� Henry Stewart Publications 1469-7017 (2002) Vol. 3, 1, 45– 59 Journal of Change Management 49
A change management process
to be repeated. In such situations, a gradual non-threatening, and more participative process is advocated to break the failure syndrome.
The authors’ tactical radio project experience reinforced the need for assessing the company’s readiness to support a change initiative. Two indices were utilised to evaluate the readiness of a company to change. One measure evaluates the current organisational stress of the company (see Beer’s matrix for assessing the impact of a change effort; Beer, 1980: 58). No product development or improvement ever occurs without someone else’s effort being hindered. There is the stress of everyone competing for the same common resources — money, people and sponsorship. A non-trivial hurdle for any new initiative is not the competitor from outside your company, but rather the one you face down the hall. The second measure is historical readiness to perform new projects. Scepticism is very natural when the change is a Big Hairy Audacious Goal (the BHAG components of a vision of effective companies, as defined by Collins and Porras, 1996). Patterns of the past are often hard to break. It is helpful to champion a concerted effort of using lessons learned (Daudelin, 1996). Learning from past development efforts will avoid making errors in the planned change. Executives and managers will continue with familiar patterns of operations unless they are taught a more retrospective approach. The lessons learned methodology is further discussed in step 12.
Compatibility of change goals with the company’s Long-Range Strategic Plan (LRSP) is a significant plus. To gain support for the previously mentioned radio project, it was important to tie into ADC’s LRSP goal of expanding into commercial airborne radars. The division’s efforts were sold internally as
to help shape, enable, orchestrate and facilitate successful progress. Change recipients represent the largest group of people that must adapt to the change. In the case of a new product development, the end user is also a recipient who must be convinced that the change will be beneficial to them. If the initiative lacks credibility with any of the targeted audiences, the initiative is dead before it even begins.
The actual case was a late-1990s project that involved the development of a tactical radio system for the military. The idea was that the revolution in the cellular market would allow for the development of one radio whose software could be reprogrammed to mimic any of the military’s current inventories of radios. The change management team was successful in defining the change and getting the target audience behind them.
Step 3: Evaluate the climate for change This step is similar to Jick’s step 1 (analyse the organisation and its need for change) but with further elaboration. Both change strategists and implementers must implicitly understand how the organisation functions in its environment, how it operates, and what its strengths and weaknesses are. Such understanding will assist in developing alternative scenarios that could be created by the proposed changes. This will facilitate crafting an effective implementation plan. As part of this analysis, change masters need also study the company’s history with previous change. Although failures of the organisation in implementing previous change efforts do not forever doom an organisation to future failure, Dalziel and Schoonover (1988) suggest that these patterns of resistance are likely
50 Journal of Change Management Vol. 3, 1, 45– 59 � Henry Stewart Publications 1469-7017 (2002)
Mento et al.
to discover what seeds will be most fruitful or whether the ground needs to be broken apart forcefully (the hammer) before anything will take root and grow. Many times, the approach also depends on the needed speed of implementation. Short-term pressures usually involve the hammer, but this does not win people for a long-term project. Listening to and actively seeking the involvement of the recipients of the change will prove fruitful in performing many of the later steps in the process. Getting people to see a future return on their personal investments today (carrot) is a successful method in long-term projects. FOR involves more than just deciding ‘Pay me now or pay me later’. Rather, the proper balance must be reached between the use of power to ensure order compliance and the use of time to build commitment.
Hill (1994) offers insights on these issues when discussing power dynamics in organisations. She notes that the existence of organisational politics is a way of life. Political conflict can be viewed as a function of three variables — diversity, interdependence and competition for scarce resources. According to Hill, both precipitating and prevention factors exist in all organisations with respect to political conflict. The use of both positional and personal power is needed to successfully manage the interdependence between various stakeholders in the modern network organisations. Being cognisant of the change time frame and one’s power sources segues to the most critical decision in implementing change with the tactical radio project, the sponsorship step.
Step 5: Find and cultivate a sponsor This stage corresponds to both Kotter’s (1995) notion of developing a powerful guiding coalition and Jick’s (1991a) step
being part of an integrated avionics sales pitch. Most aircraft vendors want only one company to install the avionics, of which the radios and radar are the major components. This programme was sold on the idea that either the division could continue to buy the radios from the people against whom it was competing or could build its own in-house radio. This radar alliance created a silent partner rather than a vocal opponent. Three words to follow are to prioritise, focus and align your efforts such that you build an internal alliance(s) to support your efforts.
Step 4: Develop a change plan This step tracks closely with Jick’s step 7 — craft an implementation plan. At a minimum, the plan should include specific goals and provide detailed and clear responsibilities for strategists, implementers and recipients. A plan that does not solicit input with respect to both the content of the change as well as the process of the change will surely prove to be non-optimal. A proper balance between specificity and flexibility is key; too much specificity can lead to a plan that does not mesh well with evolving organisational needs.
When developing a plan for implementation, one must tailor the approach to the frame of reference (FOR) of the individual participants. A change will require the efforts of people at many levels in the company with many diverse roles. Each person will have their own FOR that will affect how resistant or open to the effort they will be. Some of the basic framing methods to consider are the hammer, the carrot, the challenge and the prestige (often useful with researchers). In all instances, creating the implementation plan is very much like planting seeds in a garden. Groundwork needs to be done
� Henry Stewart Publications 1469-7017 (2002) Vol. 3, 1, 45– 59 Journal of Change Management 51
A change management process
organisation to whom all the change recipients report is often a good choice. Implementation of the change occurs from the top down, but the content for the change must be developed from the bottom. A sponsor at too high a level may introduce unnecessary risk due to a lack of direct involvement.
A second ADC project involved a missile development programme. The authors’ goal was for the sponsor to support the replacement of the current seeker portion of the missile with their own department’s version. A sister department within their division was responsible for integrating the missile and was presently purchasing the seeker section from the major competitor. The VP responsible for the entire division was recruited as a sponsor. He had influence over the current Program Manager (PM). More importantly, the VP changed how success was to be measured for the PM. The measurement for success was changed from the number of units produced to the profit per unit produced for the firm as a whole. Without the actions of this sponsor, the PM would have, most likely, resisted change because there would have been little reward for the increased risk for making such a change. The sponsor expressed, modelled and reinforced the initiative. It was successful. In contrast, difficulty with sponsorship occurred on the AMC’s radio project. Sponsorship was never secured high enough in the organisation to obtain an alignment of changing goals. While initially viewed favourably, the new product development activities were frozen when a potential large-scale merger was announced. It was never possible to change the FOR of the negative risk/reward ratio engendered by the proposed change at the time of the proposed merger. The sponsor was not sufficiently powerful to prevent the freeze on activities.
7 — line up political sponsorship. Kotter is referring to the support of powerful line executives who can help create a critical mass of support for the change. Jick tends to offer more specific guidance. He urges the recruitment of influential informal leaders and the development of a commitment chart. The commitment chart should help one to: Identify target individuals or groups whose commitment to the change is needed; define the critical mass needed to ensure the effectiveness of the change; develop a plan to gain the commitment of the critical mass; and create a monitoring system to assess the progress.
In the radio project, a single individual played the role of the sponsor. The sponsor is to be viewed as the person that will legitimise one’s cause. The strategy used to win and keep a sponsor must be defined in the FOR. It must emphasise the needs, expected levels of pain for the organisation, clear goals and a time frame. Points for possible exit along the way must be indicated. Sponsorship is easier to win and maintain when the person believes their decision is not irreversible. If the sponsor does not show a real commitment, however, the resistance from the recipients will be significant, and one’s ability to acquire the required resources will be more complex. The sponsor needs to be informed frequently and regularly of progress in order to adapt their talk or their walk to push the effort. He/she must possess a sufficient amount of organisation power and influence to obtain the resources required for success. The sponsor must express, model and reinforce the initiative for the maximum effect. He/she should be pushing to generate strategic convergence both vertically down and horizontally across the organisation. Recruiting the individual at the lowest level in the
52 Journal of Change Management Vol. 3, 1, 45– 59 � Henry Stewart Publications 1469-7017 (2002)
Mento et al.
Hultman (1979) states: ‘Without resistance to change, we are skeptical of real change occurring. Without real questioning, skepticism, and even outright resistance, it is unlikely that the organisation will successfully move on to the productive stage of learning how to make the new structure effective and useful.’ Resistance to change should have previously been considered at Step 3, ‘Evaluating the climate’.
Step 7: Create the cultural fit — Making the change last During the evolution of any change effort, the change must became rooted to the existing culture. In essence, organisation members need to accept and understand the fact that change is in reality ‘how things are done around here’. In Kotter’s step 8, failure to anchor the change initiative with the corporate culture is a grievous error. Step 5 in the GE change model deals with getting change started with concrete actions and developing long-term plans to ensure that change persists. ‘Changing systems and structures’ (step 7 in the GE change model) is concerned with altering staffing, training, appraisal, communication and reward systems, as well as roles and reporting relationships, to ensure that they complement and reinforce change. A strategic initiative that is congruent with the established organisational culture has a high probability of success. When a disconnect exists between the corporate culture and the change, culture can diminish the potency of the change initiative. If a conflict is expected, it should be discovered during the climate evaluation and the development of change plans steps. An adaptation plan can be created through a consistent vision, BHAGs and development of clear linkage between
Step 6: Prepare your target audience, the recipients of change This stage of the change process is best understood from the perspective of the recipients of the change. This issue is not clearly dealt with in any of the other three models of the change process. Jick (1991b) argues that change is not possible unless, at the very least, the change recipients accept the change. Change is not possible unless people are willing to change themselves. Jick makes the cogent points that change can be ‘managed’ internally by those who decide when it is needed, and how it ‘should’ be implemented. Actual implementation, however, occurs only when employees accept the concept of change, generally, and of the specific change, internally.
It has been observed that it does not matter whether the change is perceived as being a positive or a negative. Resistance is generated because the status quo will be affected. People are comfortable with knowns. The introduction of a change, even for the better, is an unknown. It adds stress to people. Specific strategies for dealing with resistance as well as the advantages and disadvantages of each approach can be found in Kotter and Schlesinger (1979). They advocate the use of focus groups, surveys and suggestions to bring the issues of resistance to the surface. Resistance to change efforts is directly related to how the situation is framed (Gabarro and Kotter, 1993). Speaking with the audience most affected by the change gives immediate feedback and allows the target to express their FOR. Resistance is a natural emotion that must be dealt with and not avoided. If one can look at the positive aspects of resistance to change, by locating its source and motives, it can open further possibilities for realising change.
� Henry Stewart Publications 1469-7017 (2002) Vol. 3, 1, 45– 59 Journal of Change Management 53
A change management process
people who did the necessary design, marketing and fieldwork. Team members had to rely and trust that their counterparts were equally committed to the change goal. They did have highly visible sponsorship. The sponsor would drop by the development lab and check the progress. He would bring sandwiches for dinner as the team worked late at night. He was available continually to listen to their concerns. He knew they all were motivated by the challenge (no carrot or hammer) of creating a new business area for the company. In all change efforts, timing is critical. Unfortunately, new business creation ceased to be a high priority when the LRSP shifted, owing to a proposed large-scale merger. When anti-trust issues subsequently killed the merger, new business creation again became a part of the LRSP. By that time the team was no longer together. Nor were they anxious to reassemble. They were no longer motivated by the thrill of the challenge.
Step 9: Create small wins for motivation Creating short-term wins as a way to motivate employees is critical during a long change effort (Kotter, 1995). One must plan for and create visible performance improvements. Employees involved in those improvements should be recognised. Without specific important and visible short-term wins, people may give up and default to change resister status. A change team may be working on a BHAG that requires a multi-year effort. It is very difficult to keep the change leader team self-energised if they do not see any tangible benefits corresponding to their level of effort. The longer and more drastic the change, the more necessary it is for small victories to be celebrated. The further the goal is in the future, the
strategic direction, core competencies and corporate culture. When this occurs and when the cultural changes are viewed as an investment over time rather than a quick fix or a change de jour, the likelihood of success is significantly enhanced.
Step 8: Develop and choose a change leader team In his ten-step tactical model for implementing change, Jick (1991a) makes the observation that, in large-scale change, the leader plays a critical role in creating the corporate vision. The leader both inspires the employees to embrace the vision, and crafts an organisational structure that consistently rewards people who focus their efforts on pursuing the vision. In step 5 of the model, which deals with supporting a strong leader role, Jick takes the view similar to the one learned in the change process at AMC. A change leader team can better provide the necessary leadership role than can a single individual. A team can be carefully assembled to maximise the appropriate skill sets. Billington’s (1997) review of the team literature found that there are three essentials of an effective team: Commitment, competence and a common purpose. Commitment refers to the achievement of specific performance goals. Core competencies of team members are a critical determinant of how effective a team can be. The best teams invest the time and the effort to explore, shape and agree on their purpose that is to be internalised both individually and collectively. The team must be self-energising and self-motivating in believing they are the agents of change. Diversity of skills and opinions makes a team strong as long as all share the vision. (Katzenbach and Smith, 1993).
In our radio project, there were seven
54 Journal of Change Management Vol. 3, 1, 45– 59 � Henry Stewart Publications 1469-7017 (2002)
Mento et al.
At ADC, the focus was on communication with the sponsor and the strategists and implementers who held needed resources. Effective communication with the sponsor had been a recurring theme. The tides in a company will constantly be changing and so will the needs of the programme. As an effort becomes larger, often the resource power of the sponsor will be exceeded, and the sponsor either needs to draw additional support or to obtain sponsorship themselves. Communicating the message in the same way will not have the desired affect at the different levels of the organisation. It is important to tailor each communication to the FOR of the audience. The radio project sponsor failed to communicate strategically in his efforts to obtain higher-up sponsorship at the time of the proposed merger. The sponsor failed to recognise that the proposed merger had changed his superiors’ FORs. His communication was no longer effective, as it was not couched in terms of how it would impact the merger.
Step 11: Measure progress of the change effort This step is in concurrence with step 6 of GE’s Change Acceleration Process, which is Monitoring Progress. This involves creating and installing metrics to assess programme success and to chart progress, using milestones and benchmarks. The notion of assessing the effects of change goes hand in hand with developing a small wins strategy (step 7) in order to motivate sustained effort for the change effort. Schaffer and Thompson (1992) caution companies to avoid the ‘rain dance’ of change improvement programme measurement that entails a concentration on activities, as opposed to tangible, measurable results. They recommend focusing on
more important are the achievable goals that must be built as part of the roadmap to success. It is human nature to work on what we are measured against.
The constant battle for resources and the continual need to update the sponsor also drive the need for small victories. Often, the sponsor is in fear of over-commitment and must feel that positive progress is occurring. The small victories can be as simple as meeting a design milestone and having a special lunch or happy-hour event. The display of appreciation by the sponsor goes far in spawning more teamwork and opening the lines of communication. It is often through the informal small win celebrations that new ideas will surface. The authors’ project experience has shown this to be true. New opportunities originated from ideas that were first surfaced at these informal gatherings. In essence, the small win events are transformed into brainstorming events. The more informal setting frequently results in the better mixing and generation of ideas.
Step 10: Constantly and strategically communicate the change The concept of constantly communicating the change throughout the organisation is adapted from Jick’s step 9 — ‘Communicate, involve people, and be honest’. From the very beginning of the change effort, effective communication is critical. The process by which the change is introduced can set the tone among recipients with respect to acceptance or rejection. The goals of the communication effort should be: To increase the organisation’s understanding and commitment to change to the fullest extent possible; to reduce confusion and resistance, and to prepare employees for both the positive and negative effects of the change.
� Henry Stewart Publications 1469-7017 (2002) Vol. 3, 1, 45– 59 Journal of Change Management 55
A change management process
similar manner, many people measure success on winning a contract. If the contract win is done at a price too low or under the assumption of too great a technological risk, however, the contract in actual financial terms is a loss with subsequent cost over runs and late deliveries.
Step 12: Integrate lessons learned No other model of the change process directly deals with the process of generating a set of lessons learned through reflection. At the root of lessons learned is reflection. Reflection is a personal cognitive activity that requires stepping back from an experience to think carefully and persistently about its meaning through the creation of inferences (Baird et al., 1997; Kleiner and Roth, 1997; Seibert, 1999). Reflection, using a set of techniques first suggested by Daudelin (1996), brings to light insights and learning themes (concepts) by directing and guiding change strategists and implementers to think actively about the learning that is going on during the change process itself. Reflection then connects learning directly to job performance and yields more relevant personal learning. Reflection is an extremely powerful way to learn from experience. It is a major component of individual learning, and individual learning is the building block for organisational learning. At the heart of the reflection process is the use of carefully thought out trigger questions. Research has shown that people are generally poor reflectors unless provided with questions about their experience as stimuli (Seibert and Daudelin, 1999). Very useful is a set of questions developed by the US Army in their After Action Review Process (AAR), as documented by Garvin (2000).
results-driven programmes that bypass lengthy preparations, and instead aim for quick measurable gains within a few months. The key is to measure often only those variables believed to be logically related to important milestones in the change effort. In psychometrics, the idea is to avoid criterion deficiency, ie assessing the wrong or a deficient measure of the true concept one wants to assess.
Change progress needs to be measured at all stages of the programme, not merely at the end. In a recent Business Week article (Burrows, 2001), Hewlett Packard’s CEO Carly Fiorina comments that business planning is similar to sailing in that ‘you are going to need to tack at times’. Tacking is highly dependent upon knowing in what direction the winds are blowing. In creation of the cultural fit and in creation of the proper motivation when building the team, it was recognised that the proper measurements and reinforcements are critical to keeping the programme on track. Measurement is also concerned with all members involved in the change effort being crystal clear with respect to roles, goals and expectations. It has been observed that organisations too often forget to have the proper tools or information available to measure the amount of progress achieved. Using an example from the HP article, implementers were successful in changing the business into four organisations instead of 83 business units. This, however, required a new cost accounting system that lagged the changes. The company was claiming a certain level of financial benefit but was not measuring the proper characteristics to support this result. As the measurement system came on-line, managers were shocked to discover that the system was suffering a lack of financial accountability and transition costs were somewhat out of control. In a
56 Journal of Change Management Vol. 3, 1, 45– 59 � Henry Stewart Publications 1469-7017 (2002)
Mento et al.
like when one intends to begin the journey (Evaluate the climate for change). Prior to departure, one must have an accurate set of nautical charts and sailing plans that will help to overcome obstacles and barriers in the person of pirates and rocks (Develop a change plan). Similar to Columbus, before embarking on the long voyage, one needs to line up a powerful and benevolent sponsor (Find and cultivate a sponsor). A sound step to take next would be to work with the selected crew in clarifying roles, goals and expectations that they need to be aware of during the duration of the voyage (Prepare the target audience, the recipients of the change). A further step is to make sure that the ship is capable of accomplishing the task and that the route chosen, given the expected storms and bad weather, is not beyond the structural integrity of the ship itself (Create the cultural fit — making the change last). Along these lines, one of the most important preparatory steps is to make sure the carefully chosen crew are committed, competent and share the same goal of a safe and exciting journey. People should work together like a well-oiled piece of machinery (Develop and choose a change leader team). There must be specific milestones or goals to reach during the journey to provide feedback with respect to how well and how fast one is sailing toward the objective. Also one should stop in various ports of call to celebrate one’s good fortune in arriving safely and to let off steam after being at sea and alone for great lengths of time (Create small wins for motivation). It is important to let one’s sponsor know on a regular basis how well one is doing, and to share with the crew why one is taking the actions one is taking, as well as taking the time to listen and learn from the suggestions of the crew (Constantly and strategically communicate the change). As the voyage
These questions are: (1) What did we set out to do? (2) What actually happened? (3) Why did it happen? and (4) What are we going to do next time?
‘Those who forget the past are condemned to repeat it’ is the quote that often comes to mind with respect to change efforts. At all times, not just at the end of a project, effort needs to be expended on a retrospective look at what works and what did not. These efforts allow for the continuous refinement of the evolving process. Many of the lessons learned should concentrate on the problems and solutions of dealing with both the formal and the informal organisation. Organisation design factors such as policies, procedures, compensation and organisational structure are just the tip of an iceberg when evaluating your organisation. Documenting the cultural norms, unwritten rules of work, the political system and informal leaders will serve you well in your use of lessons learned. The best companies are learning organisations that will not forget, but rather learn from the past.
CONCLUSION The use of metaphorical storytelling (Botkin, 1999; Jensen, 2000) based on the theme of a ship embarking on a perilous journey facilitates the summation of the change stages encountered at the authors’ firm. While preparing to embark on the challenging voyage, one needs to do certain things to improve the chances of success. It has to be clear in one’s mind why one is taking this trip (The idea and its context). Next, one needs to have a fairly good understanding of exactly what one intends to accomplish by taking this voyage (Define the change initiative). It is always necessary to have some idea of what the weather will be
� Henry Stewart Publications 1469-7017 (2002) Vol. 3, 1, 45– 59 Journal of Change Management 57
A change management process
the company. Hopefully, the authors’ change model will provide some much-needed guidance along these lines and will help to ensure that their voyage will be successful.
REFERENCES Baird, L., Henderson, J. C. and Watts, S.
(1997) ‘Learning from Action: An Analysis of the Center for Army Lessons Learned’, Human Resources Management, 36(4), 385–395.
Beer, M. (1980) Organization Change and Development: A Systems View, Goodyear, Santa Monica.
Billington, B. (1997) ‘The Three Essentials of an Effective Team’, Harvard Management Update, Reprint No. U9701A, Harvard Business School Press, Boston.
Botkin, J. W. (1999) Smart Business: How Knowledge Communities can Revolutionize your Business, Free Press, New York.
Burrows, P. (2001) ‘The Radical: Carly Fiorina’s Bold Management Experiment at HP’, Business Week, cover story, 19th February.
Buzan, T. (1989) Use Both Sides of Your Brain, 3rd edn, Plenum, New York.
Collins, J. C. and Porras, J. I. (1996) ‘Building your Company’s Vision’, Harvard Business Review, 74(5), 65-77 (Reprint No. 96501).
Dalziel, M. M. and Schnoover, S. C. (1988) Changing Ways: A Practical Tool for Implementing Change Within Organizations, American Management Association, New York.
Daudelin, M. W. (1996) ‘Learning from Experience Through Reflection’, Organizational Dynamics, 24(3), 36–48.
Davenport, T. (1999) Human Capital, Josey-Bass, San Francisco.
Gabarro, J. J. and Kotter, J. P. (1993) ‘HBR Classic — Managing your Boss’, Harvard Business Review, 72(3), 150–157.
Garvin, D. (2000) Learning in Action: A Guide to Putting the Learning Organization to Work, Harvard Business School Press, Boston.
Hill, L. (1994) Power Dynamics in Organizations, Note 9-494-083, Harvard Business School Press, Boston.
continues over months and years, it is necessary to consider the progress made, whether one is indeed going in the right direction or whether one has been blown off course. It is necessary to ensure also that the morale of the crew is positive and that the route and plan are flexible enough to accommodate changes in sponsors, and in the weather (Measure progress of the change effort). Finally, at the end of the journey, an after action review should be conducted so that knowledge gained through reflection is captured and disseminated among other ship captains and crews throughout the organisation who might be embarking on similar perilous journeys through the unforgiving environment (Integrate lessons learned).
All 12 steps are not to be regarded only sequentially, but also as an integrated, iterative process to enable change. Business and engineering are about growing, changing, adjusting and improving the accepted norms and procedures today to make the future brighter. Engineering is often referred to as turning dreams into reality. But one fails to realise that miracles often do not occur overnight and that there is actually a progression that must be painfully followed. The thought for the 21st century change leaders is that they must be astute decision makers and marketers, trusted innovators, agents of change, preachers of difficulties, master integrators, enterprise enablers, technology stewards and knowledge handlers. They will need first-rate managerial, technical, interpersonal and scientific skills. Complex systems and issues will need to be embraced and they must reach the decisions about the amounts of time, money, people, knowledge and technology they are willing to commit to meet what should be a common end goal that was well communicated and accepted all around
58 Journal of Change Management Vol. 3, 1, 45– 59 � Henry Stewart Publications 1469-7017 (2002)
Mento et al.
and E. Hartley (eds) Readings in Social Psychology, Holt, Rinehart & Winston, New York.
Mento, A. J., Martinelli, P. and Jones, R. M. (1999) ‘Mind Mapping in Executive Education: Applications and Outcomes’, Journal of Management Development, 18(4), 390–407.
Morgan, G. (1998) Images of Organization, Berrett-Koehler, San Francisco.
Schaffer, R. H. and Thompson, H. A., (1992) ‘Successful Change Programs Begin with Results’, Harvard Business Review, 70(1), 80–90.
Seibert, K. W. (1999) ‘Reflection in Action: Tools for Cultivating On-the-job Learning’, Organizational Dynamics, 27(3), 54–65.
Seibert, K. W. and Daudelin, M. W. (1999) The Role of Reflection in Managerial Learning: Theory, Research, Practice, Quorum, London.
Senge, P. (1990) ‘The Leader’s New Work: Building a Learning Organization’, Sloan Management Review, 32(1), 7–24.
Tichy, N. and Charan, R. (1989) ‘Speed, Simplicity, and Self-confidence. An Interview with Jack Welch’, Harvard Business Review, 65(5), 112–118.
Hultman, K. (1979) The Path of Least Resistance, Learning Concepts, Austin, TX.
Jensen, W. (2000) Simplicity, Perseus, Cambridge, Mass.
Jick, T. (1991a) Implementing Change, Note 9-191-114, Harvard Business School Press, Boston.
Jick, T. (1991b) Note on the Recipients of Change, Note 9-491-039, Harvard Business School Press, Boston.
Katzenbach, J. R. and Smith, D. K. (1993) The Wisdom of Teams, Harvard Business School Press, Boston.
Kerr, S. (2000) Quoted in Garvin, D. Learning in Action: A Guide to Putting the Learning Organization to Work, Harvard Business School Press, Boston, 131.
Kleiner, A. and Roth, G. (1997) ‘How to Make Experience your Company’s Best Teacher’, Harvard Business Review, 75(5) (Reprint No. 97506).
Kotter, J. P. (1995) ‘Why Transformation Efforts Fail’, Harvard Business Review, 74(2) (Reprint No. 95204).
Kotter, J. P. and Schlesinger, L. A. (1979) ‘Choosing Strategies for Change’, Harvard Business Review, 55(2), 4–11.
Lewin, K. (1947) ‘Group Decision and Social Change’, in E. E. Maccoby, T. Newcomb
� Henry Stewart Publications 1469-7017 (2002) Vol. 3, 1, 45– 59 Journal of Change Management 59
A change management process
2.Book1 organisations.docx
The lectures have covered quite a bit of organisational theory, introduced you to the concept of culture and introduced leadership and management theory.
In building on these topics, this book provides both an opportunity to provide new content and allow you to explore further some of the concepts covered in the lectures.
To start with in the first chapter I have included a short video on Weber and bureaucratic organisations which you can access on the next page.
In the second chapter, we look at the Australian Healthcare context. So far we have only dealt with the theory, yet we need to understand the environment in which we work, as it will of course shape our organisations and our roles. So there is some reading for you to cover and also a couple of short videos for you to look at as well on that topic.
At the end of that chapter, I will ask you to engage with your peers by answering some of the questions I pose about the healthcare setting we work in. It will be interesting to hear the views of our international students!
The last two chapters explore organisations and culture and the mission, vision and values statements that all of our healthcare organisations have.
I hope you enjoy the activities
2 Learning Outcomes
By the end of this book and with further reading and research, you are expected to be able to:
· explain the essentials of Weber's bureaucratic organisations;
· describe the Australian health system in broad terms and the characteristics of the Australian health system that influence organisational development and management
· discuss theories of organisational culture; and
· explain the purpose of vision, mission and value statements.
· 3 Max Weber
· The following YouTube video provides a nice and succinct discussion of Weber's bureaucracy. It provides a description of the ideal bureaucracy together with pros and cons.
·
4 The Australian Health System
(Author: Jeni Grubb, with revisions by Kylie Ward and Ingrid Brooks)
A thorough understanding of changes in healthcare systems over past decades is essential for those professionals who wish to participate effectively in maximising the provision of optimum healthcare for their people.
Australia, like many other countries, has undergone massive corporate restructuring precipitated by macro economic change. Healthcare provision in particular has been greatly affected by these changes. In the decades following the Second World War, healthcare and hospitals in Australia were dominated by large bureaucracies, and characterised by stability, growth and clear professional boundaries. Most health care debate over this time was about private health care provision versus universal public health cover. The Labor Government of the 1980’s introduced a universal health care system – Medicare – and we have seen many changes to this system over time, particularly with an increasing role of the private sector during the decade of the conservative Liberal-National Howard Government (Gardner & Barraclough, 2002). Medicare is based on a philosophy of all Australians having equal access to the healthcare they require, thus contributing to social cohesion. Duckett (2007) argues that the more Medicare is abandoned in favour of private health services, the more universal cover and social cohesion is threatened. The interplay of private and public healthcare systems is a very complex and contemporary issue, and a key election issue at almost every Federal election in recent years.
The other distinctive aspect of the Australian health care system is the Federal – State funding split. The Federal Government allocates funding to the States under the Council of Australian Governments (COAG) and much lobbying occurs between these levels of government through such avenues as the Australian Healthcare Agreements. The Federal Government directly pays the General Practitioner (GP) through the Medicare System and the State Governments are responsible for running hospitals and some community health services. One can see the tensions played out, when for example, an acute hospital opens a GP clinic alongside the emergency department – and the subsequent arguments about whether this is for the benefit of the patient or just cost-shifting.
The main features of Australia’s health system are:
· Universal access to benefits for privately provided medical services under Medicare, which are funded by the Australian Government, with co-payments by users when the services are not bulk-billed.
· Eligibility for public hospital services, free at the point of service, funded jointly by the states and territories and the Australian Government.
· Private hospital activity largely funded by private health insurance, which in turn is subsidised by the Australian Government through the 30–40% rebates on members’ contributions to private health insurance.
· The Australian Government, through schemes such as the Pharmaceutical Benefits Scheme (PBS), subsidises a wide range of pharmaceuticals outside public hospitals for the public.
· The Australian Government provides most of the funding for health research.
· State and territory health authorities are primarily responsible for public hospitals, mental health programs, the transport of patients, community health services, and public health programs and activities (for example, health promotion and illness prevention).
· Individuals primarily spend money on medications, dental services, aids and appliances, medical services, other health practitioner services and hospitals (AIHW, 2009, p.13).
· Duckett (2007, p.xvii) suggests that healthcare in Australia remains “in part, a contested domain characterised by conflict over values and policy choices” and no agreement on structure and functioning of health care institutions.
It is of value to take a look at an article by Stephen Duckett at this point - it is the first reading on your reading list.
Here is the link to the unit reading list
http://readinglists.lib.monash.edu/lists/1342F4C7-30D1-7D09-17C4-9F0A561E2CCD.html
4 The Australian Health System
4.1 The politics of health
(Author: Jeni Grubb, with revisions by Kylie Ward and Ingrid Brooks)
Duckett (2007, p.xvii) suggests that healthcare in Australia remains “in part, a contested domain characterised by conflict over values and policy choices” and no agreement on structure and functioning of health care institutions.
This is exemplified by recent political history. For example in 2007 following their election victory, the Rudd Labor Government introduced a National Health and Hospitals Reform Commission to review the current health system. Following this review, Rudd in 2010 proposed a new National Health and Hospital Network (NHHN), that essentially proposed the Federal Government as the funder of the majority of funding for the entire public hospital system. (Rudd, 2010). Following Gillard’s succession over Rudd this proposal was replaced with the National Health Reform Agreement of 2011 which deals with sustainable funding arrangements in particular:
· Financial and governance arrangements with states as managers of the public hospital system; and
· The Commonwealth as funding aged care, and lead responsibility for general practice and primary health care.
· Commonwealth and states being jointly responsible for funding public hospital services and developing standards for healthcare
· States being responsible for system management of public hospitals having a lead role in public health
· The Commonwealth being responsible for establishing Medicare Locals and promoting timely and equitable access to primary health care. (Council of Australian Governments, 2011)
The implementation and funding arrangements under this agreement are under threat following the election of the Abbott conservative government and its 2014 Federal budget which indicates a decrease in the commitment to public hospital funding. (Fact Check, 2014)
Debates about health funding will continue to play out during the year as the Australian Government negotiates their budget through a hostile senate.
With this in mind, take a look at a short report from the ABC below
http://www.abc.net.au/7.30/content/2014/s3966528.htm
4 The Australian Health System
4.2 Discussion
Having viewed the ABC report and read the article by Duckett, I will pose a couple of questions:
1. How does the content of the ABC report compare with Duckett's framework of equity, quality (adverse events), efficiency and acceptability?
2. What impact could these reforms have on hospitals?
3. Do we need reform in aged care?
Post your thoughts on the discussion forum - the link is below
http://moodle.vle.monash.edu/mod/forum/view.php?id=2273126
4 The Australian Health System
4.3 Cost of Australia's health care
(Author: Jeni Grubb, with revisions by Kylie Ward and Ingrid Brooks)
In Australia in the 1990’s the cost to the taxpayer of providing a world class healthcare system began to mushroom. For several years until this time, Australian spending had remained steady at approximately 8% of GDP. This placed Australia, in OECD countries’ level of healthcare spending, at about halfway between the United States (at the upper end), and the United Kingdom (at the bottom).
Duckett (2007) suggests that there are two indicators used for measuring trends in expenditure – percentage of GDP spent on health and per capita health expenditure. In 2011-12 health expenditure was 9.5% of GDP, an increase from 6.8% of GDP in 1986-87, (AIHW, 2014).
As an international comparison, Australia’s health expenditure as a proportion of GDP is slightly higher than other Organisation for economic Co-operation and Development (OECD) countries. By comparison, the United States’ health expenditure as a proportion of GDP in 2011 was approx. 176.0% (AIHW, 2014).
During 2001/02, in Australia the estimated per person expenditure on health averaged $4,276, growing to $6,230 in 2011-12. Total expenditure on health is increasing at an average rate of 5.4% each year over the last 10 years (AIHW, 2014).
Another way to view this expenditure is to breakdown costs and usage. In the 2011-12 period, the biggest areas of expenditure are hospitals (53.5 billion or 38.2% of total health expenditure) and primary health care (50.6 billion)(AIHW, 2014). Not surprisingly, most of the total health expenditure is on the elderly, in their final years of life (Duckett, 2007).
The reasons for increasing costs of health care budgets have included population growth; the increased survival rates of infants; and the increased life expectancy of large numbers of chronically ill individuals and others, with both multiple and serious pathologies, all of whom require long term care. At the same time, technical advances in healthcare have created great demand for expensive diagnostic techniques, pharmaceuticals, as well as surgical and radiological procedures.
If you are interested in reading the full report from the AIHW it can be accessed at this link:
http://www.aihw.gov.au/publication-detail/?id=60129547205
4 The Australian Health System
4.4 Technological advances
(Author: Jeni Grubb, with revisions by Kylie Ward and Ingrid Brooks)
Dramatic technical advances have occurred in health care which have led to a revolution in disease management. Developments in medical technology and clinical practice include:
· MRI and CT scanning;
· ‘Phaco’ cataract removal and foldable lenses;
· ACE inhibitors for high blood pressure;
· hip and knee replacement;
· angioplasty to unblock arteries;
· inhaled steroids for asthma;
· statins to reduce cholesterol;
· laparoscopic surgery;
· SSRI and non-SSRI antidepressants;
· Tamoxifen to treat breast cancer (Productivity Commission, 2005).
It is widely recognised that developments in new health technology are major drivers in the growth of health care expenditure. The beneficial results of new technologies may include reduced length of stay and procedural costs; improved quality of life; and enhanced patient outcomes. Technical advances are usually welcomed by medical practitioners, patients and providers. But conversely these developments can diffuse rapidly into the health sector with limited supporting evidence and impact on the health sector; and indeed may increase procedural costs.
It is highly likely that spending pressures will intensify with the ageing of the population. Governments have sought to develop better methods of assessing the costs and benefits of new technologies with processes for evaluating them. In addition, better targeting of some technologies could improve net societal benefits (Productivity Commission, 2005; Department of Human Services, 2007).
In a 2005 review of the impact of advances in medical technology, the Productivity Commission of Australia predicted the technologies likely to have an impact in the next 5-10 years:
· Rational drug design: computer search techniques could reduce the trial and error of random search for identifying likely drug candidates.
· Imaging and diagnostic advances: with an increase in the range of diseases that can be detected using imaging techniques. Miniaturisation of imaging devices could improve portability. There may be a reduced need for surgery to examine the function and structure of organs.
· Minimally invasive surgery, robotics and virtual surgery: particularly for coronary and neurological procedures.
· Genetic testing, gene therapy and pharmacogenomics: testing could allow identification of genetic susceptibility to diseases and more targeted, effective, use of pharmaceuticals (pharmacogenetics); gene therapy could correct the genetic cause of the disease rather than treating the symptoms.
· New vaccines: could prevent cancers and may also offer less intrusive and costly ways to treat some cancers.
· Xenotransplantation and bioengineered organ, joint or tissue replacement: in theory, transplantation from non-human species could provide an increased supply of organs; biomaterials have been used to improve artificial joints; and there has been progress in creating more complex organs, such as artificial pancreas and hearts.
· Stem cell therapies: could be based on adult or embryonic stem cells; possibly used to restore pancreatic function in diabetes patients, patch damaged hearts and to treat people with Parkinson’s Disease.
· Nanotechnologies and nanomedicine: involve the production and application of materials at an atomic scale. Nanodevices could deliver medicines directly to the site of the body in need and reduce required dosages.
· Information and communications technology: even current ICT could be applied to improve healthcare administration.
Consider their predictions in light of time elapsed since the report plus in your own country and organisation’s experience.
4 The Australian Health System
4.5 Collaborative planning and structural change
(Author: Jeni Grubb, with revisions by Kylie Ward and Ingrid Brooks)
Thus it has been essential for hospitals to accurately predict both the number of patients treated and the diagnostic category of patients who will be treated. This requires collaborative planning on behalf of physicians, nurses and management. In order to facilitate this, similar diagnostic groups of patients need to be clustered together in the hospital. It has also meant that particular hospitals concentrate on particular specialty areas.
The advantages are:
· the staff develop greater expertise in their particular area of care;
· treatment methods can be streamlined through a system known as managed care;
· “intermediate products”, supplies, drugs, equipment, and nursing hours, can be more effectively and efficiently used; and
· staff become accountable for the throughput and outcomes of their patients care.
Efficiency, accountability and better patient outcomes are the results for practitioners, while financial viability and a reputation for quality care are the outcomes for the organisation.
It is obvious from the above discussion that there are great advantages to the organisation in creating separate divisions which care for groups of patients with similar diagnoses. These groups have been called amongst other things “Care Groups”, whereby the efficiency of work can be maximised. This has led to several major changes to the way we deliver healthcare, including the team being accountable for:
· improving patients’ health outcomes;
· the revenue they generate by patient throughput; and
· overruns of costs caused by excessive length of stay and excessive use of “intermediate products”, such a pharmaceuticals, radiology and pathology services.
As a result of this accountability, several traditional bases of healthcare have changed. For example, it is possible to have a true focus on patients’ needs, rather than that of the attending practitioners. This is called “patient focused care”.
Another simultaneous change has been the formation of Hospital Networks or Area Health Services, requiring the creation of new structures that gather up particular groupings of health services, often based around a geographic area. Groups might typically provide services in acute care, community care, family care, rehabilitation and aged care.
4 The Australian Health System
4.6 Some reflections
Take a look at this video - it poses some interesting questions:
1. With the cost of healthcare and shortage in rural workforce driving changes to workforce – how could leaders in nursing and other health professions respond to this need in rural health?
2. The advances in medical practice, need for safe and quality care, need to prevent bed block, what does affect does that have on the workforce and by implication for nurse managers?
3. Are private hospitals the answer? Think about Ducketts paper
I have set up another discussion forum for you - here is the link
http://moodle.vle.monash.edu/mod/forum/view.php?id=2288527
5 Organisations and Culture
(Author: Jeni Grubb, with revisions by Kylie Ward and Ingrid Brooks)
As we have seen from the lecture, within any organisation, the culture is evident through the behaviours of staff, and the expectations placed upon them by the guidelines of that organisation. These expectations need to be clear and provide direction when challenges arise.
Assumptions about an organisation’s culture may be drawn from observation of such things as how the staff talk to each other. Organisational consistency is gained when the behaviours match the vision and values statements. For example, if empowerment of nursing staff is part of the vision of a particular unit, but staff are not enabled to take time off for ongoing educational activities, this is an inconsistency.
It is becoming common for hospitals and other organisations to visually demonstrate the culture of their organisation through videos such as those below. Some questions for you to ponder follow after the videos
What feeling to you get from looking at these videos – first as a prospective employee, and secondly as a prospective patient?
What are the organisational values that are demonstrated in these videos?
Of the cultural theories we have visited, in the lecture which is demonstrated in these videos?
In what ways is cultural leadership being demonstrated in these videos?
Post your thoughts on the discussion forum:
http://moodle.vle.monash.edu/mod/forum/view.php?id=2291655
6 Mission, Vision and Values
As a short light-hearted introduction to follow-up the lecture that covered mission, vision and values statements in organisations, take a moment to look at this short clip from Jerry Maguire. Pay attention to the interaction between 2 colleagues right at the end
Warning there is a swear word 1.20mins in!
The following links are examples of mission, vision and values statements from two of our large hospitals in Melbourne.
http://www.alfredhealth.org.au/Page.aspx?ID=25
http://www.cabrini.com.au/about-us/our-mission-and-values/
What do you think? Are they realistic, clear, inspiring…..?
What are your organisations vision, mission, values?
That brings us to the end of this book and week 1, I hope you have enjoyed this start to the unit.
7 References
Australian Institute of Health and Welfare (2014). Australia’s health 2014. Australian health series no.14, Cat.no AUS178 Canberra: AIHW (Retrieved from http://www.aihw.gov.au/publication-detail/?id=60129547205 )
Duckett, S.J. (2007). The Australian health care system (3rd ed.) South Melbourne: Oxford University Press.
Fact Check: Does the federal budget cut $80 billion from hospitals and schools? (3 July 2014) Australian Broadcasting Commission. (Retrieved from: www.abc.net.au/news/2014-07-03/does-the-federal-budget-cut-80-billion-from-schools-hospitals/5562470)
Gardner, H., & Barraclough, S. (2002). Health policy in Australia. 2nd ed. Melbourne, Vic: Oxford University Press.
Maddern, J., Courtney, M., Montgomery, & Nash, R. (2006). Strategy and organisational design in health care. In M.G. Harris, & Associates (Eds), Managing health services: concepts and practice (2nd ed., pp.271298). Marrickville, NSW: Mosby Elsevier.
Council of Australian Governments (2011) National Health Reform Agreement, 13 Feb 2011. (Retrieved from https://www.coag.gov.au/node/96)
Marriner-Tomey, A. (2009). Nursing management and leadership (8th ed.). St Louis: Mosby Elsevier.
Productivity Commission (2005). Impacts of advances in medical technology in Australia: research report. Melbourne: Commonwealth of Australia.
Rudd, K. (2010). Better health, better hospitals: the national health and hospitals network. Prime Minister’s speech to National Press Club, 3 March.
change_management_plan_workbook_and_template.pdf
Change Management PlanChange Management PlanChange Management PlanChange Management Plan Workbook and TemplateWorkbook and TemplateWorkbook and TemplateWorkbook and Template
))
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
TTTTTTTTAAAAAAAABBBBBBBBLLLLLLLLEEEEEEEE OOOOOOOOFFFFFFFF CCCCCCCCOOOOOOOONNNNNNNNTTTTTTTTEEEEEEEENNNNNNNNTTTTTTTTSSSSSSSS
Step 1Step 1Step 1Step 1 Identify the changeIdentify the changeIdentify the changeIdentify the change............................................................................................................................................................................................................................................................................................................................................................................................................ 1111
1.1.1.1.1.1.1.1. Type of changeType of changeType of changeType of change ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 1111
1.2.1.2.1.2.1.2. Reason for the changeReason for the changeReason for the changeReason for the change ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 1111
1.3.1.3.1.3.1.3. Scope the changeScope the changeScope the changeScope the change ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 1111
1.4.1.4.1.4.1.4. Where are you now?Where are you now?Where are you now?Where are you now? ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 1111
1.5.1.5.1.5.1.5. Where do you want to be?Where do you want to be?Where do you want to be?Where do you want to be? ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 3333
1.6.1.6.1.6.1.6. What are the five (5) concept shifts required for this change to occur?What are the five (5) concept shifts required for this change to occur?What are the five (5) concept shifts required for this change to occur?What are the five (5) concept shifts required for this change to occur? .................................................................................................................................................................................................... 3333
1.7.1.7.1.7.1.7. Check organisation change readinessCheck organisation change readinessCheck organisation change readinessCheck organisation change readiness .................................................................................................................................................................................................................................................................................................................................................................................................... 3333
Step 2Step 2Step 2Step 2 Particulars of the changeParticulars of the changeParticulars of the changeParticulars of the change........................................................................................................................................................................................................................................................................................................................................................................ 3333
2.1.2.1.2.1.2.1. How will you get there?How will you get there?How will you get there?How will you get there? ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 3333
2.2.2.2.2.2.2.2. Process ChangeProcess ChangeProcess ChangeProcess Change .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... 4444
2.3.2.3.2.3.2.3. People People People People ChangeChangeChangeChange ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 4444
2.4.2.4.2.4.2.4. Information sharingInformation sharingInformation sharingInformation sharing .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... 4444
2.5.2.5.2.5.2.5. Cost of changeCost of changeCost of changeCost of change ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 4444
2.6.2.6.2.6.2.6. Risk AssessmentRisk AssessmentRisk AssessmentRisk Assessment ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 4444
Step 3Step 3Step 3Step 3 Change ApproachChange ApproachChange ApproachChange Approach ................................................................................................................................................................................................................................................................................................................................................................................................................ 5555
3.1.3.1.3.1.3.1. Stakeholder AnalysisStakeholder AnalysisStakeholder AnalysisStakeholder Analysis............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 5555
3.2.3.2.3.2.3.2. Resistance to changeResistance to changeResistance to changeResistance to change ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 6666
3.3.3.3.3.3.3.3. Role of Change Management TeamRole of Change Management TeamRole of Change Management TeamRole of Change Management Team ................................................................................................................................................................................................................................................................................................................................................................................................................ 6666
Step 4Step 4Step 4Step 4 Implementation strategiesImplementation strategiesImplementation strategiesImplementation strategies ................................................................................................................................................................................................................................................................................................................................................................ 7777
4.1.4.1.4.1.4.1. Action PlanAction PlanAction PlanAction Plan .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... 7777
4.2.4.2.4.2.4.2. Communication PlanCommunication PlanCommunication PlanCommunication Plan ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 7777
4.3.4.3.4.3.4.3. Training PlanTraining PlanTraining PlanTraining Plan............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 8888
4.4.4.4.4.4.4.4. Business Systems PlanBusiness Systems PlanBusiness Systems PlanBusiness Systems Plan ............................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 8888
4.5.4.5.4.5.4.5. Resistance PlanResistance PlanResistance PlanResistance Plan ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 8888
Step 5Step 5Step 5Step 5 Develop implementation packageDevelop implementation packageDevelop implementation packageDevelop implementation package .................................................................................................................................................................................................................................................................................................................... 9999
Step 6Step 6Step 6Step 6 Review change strategyReview change strategyReview change strategyReview change strategy ............................................................................................................................................................................................................................................................................................................................................................................ 9999
6.1.6.1.6.1.6.1. Ongoing Monitor and ReviewOngoing Monitor and ReviewOngoing Monitor and ReviewOngoing Monitor and Review ........................................................................................................................................................................................................................................................................................................................................................................................................................................................ 9999
Appendix AAppendix AAppendix AAppendix A ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 10101010
Appendix BAppendix BAppendix BAppendix B ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 11111111
Appendix CAppendix CAppendix CAppendix C ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 11112222
Appendix DAppendix DAppendix DAppendix D ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 13131313
Appendix EAppendix EAppendix EAppendix E ................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 11114444
AttAttAttAttachment 1achment 1achment 1achment 1 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 16161616
Organisational Change Readiness ChecklistOrganisational Change Readiness ChecklistOrganisational Change Readiness ChecklistOrganisational Change Readiness Checklist ........................................................................................................................................................................................................................................................................................................................................................................................ 11115555
Attachment 2Attachment 2Attachment 2Attachment 2 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 17171717
Risk Assessment MatrixRisk Assessment MatrixRisk Assessment MatrixRisk Assessment Matrix .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... 17171717
Risk Assessment TableRisk Assessment TableRisk Assessment TableRisk Assessment Table .................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................................... 11118888
Attachment 3Attachment 3Attachment 3Attachment 3 ........................................................................................................................................................................................................................................................................................................................................................................................................................................................................................ 20202020
Resistance Assessment SurveyResistance Assessment SurveyResistance Assessment SurveyResistance Assessment Survey .................................................................................................................................................................................................................................................................................................................................................................................................................................................................... 19191919
CCCCHHHHAAAANNNNGGGGEEEE MMMMAAAANNNNGGGGEEEEMMMMEEEENNNNTTTT PPPPLLLLAAAANNNN TTTTEEEEMMMMPPPPLLLLAAAATTTTEEEE ............................................................................................................................................................................................................................................................................................ 22220000
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
Purpose of this documentPurpose of this documentPurpose of this documentPurpose of this document The Change The Change The Change The Change MMMManagementanagementanagementanagement Plan has been developed to assist the Business Process Owner. It is useful when a Plan has been developed to assist the Business Process Owner. It is useful when a Plan has been developed to assist the Business Process Owner. It is useful when a Plan has been developed to assist the Business Process Owner. It is useful when a change is made to a process or system to ensure that it is implemented effectively into the business. It assists change is made to a process or system to ensure that it is implemented effectively into the business. It assists change is made to a process or system to ensure that it is implemented effectively into the business. It assists change is made to a process or system to ensure that it is implemented effectively into the business. It assists in designing and estimating the scale of the changein designing and estimating the scale of the changein designing and estimating the scale of the changein designing and estimating the scale of the change effort, mobilising the will to change and gaining the buyeffort, mobilising the will to change and gaining the buyeffort, mobilising the will to change and gaining the buyeffort, mobilising the will to change and gaining the buy----in.in.in.in. This document is designed to be used alongside or can be incorporated into the proper project plan.This document is designed to be used alongside or can be incorporated into the proper project plan.This document is designed to be used alongside or can be incorporated into the proper project plan.This document is designed to be used alongside or can be incorporated into the proper project plan.
The Change Management ProcessThe Change Management ProcessThe Change Management ProcessThe Change Management Process CChhaannggee mmaannaaggeemmeenntt iiss aa pprroocceessss tthhaatt sshhoouulldd bbee iinncclluuddeedd iinn tthhee ppllaannnniinngg aanndd ddeelliivveerryy ooff aa pprroojjeecctt ffrroomm tthhee vveerryy bbeeggiinnnniinngg.. OOfftteenn ttiimmeess cchhaannggee iiss nnoott ttaakkeenn iinnttoo ccoonnssiiddeerraattiioonn iinn tthhee ddeevveellooppmmeenntt ooff pprroojjeecctt ppllaannss.. IItt iiss ffoorr tthhiiss rreeaassoonn tthhaatt cchhaannggee mmaannaaggeemmeenntt hhaass bbeeeenn aaddddrreesssseedd aass sseeppaarraattee ccoommppoonneenntt ttoo tthhee uussuuaall pprroojjeecctt mmeetthhooddoollooggyy tthhaatt yyoouu mmaayybbee ccuurrrreennttllyy uussiinngg.. OOnnccee tthhee cchhaannggee mmaannaaggeemmeenntt ppllaann hhaass bbeeeenn ddeevveellooppeedd iitt sshhoouulldd bbee iinntteeggrraatteedd wwiitthh tthhee pprroojjeecctt ppllaann aanndd ccaann bbee iinncclluuddeedd aatt aannyy ppooiinntt aafftteerr ssttaarrtt uupp..
TThhiiss cchhaannggee mmaannaaggeemmeenntt ppllaann tteemmppllaattee pprroovviiddeess tthhee nneecceessssaarryy fflleexxiibbiilliittyy rreeqquuiirreedd aanndd iiss ddeessiiggnneedd ttoo mmeeeett tthhee nneeeeddss ooff tthhee pprroojjeecctt iirrrreelleevvaanntt ttoo tthhee pphhaassee ooff tthhee pprroojjeecctt..
TThhee cchhaannggee mmaannaaggeemmeenntt pprroocceessss hhaass tthhrreeee ssttaaggeess,, aanndd sshhoouulldd bbee ccoonnssiiddeerreedd aalloonnggssiiddee tthhee nnaattuurree aanndd mmaaggnniittuuddee ooff tthhee cchhaannggee..
Details of ChangeDetails of ChangeDetails of ChangeDetails of Change
• Identify the changeIdentify the changeIdentify the changeIdentify the change • Particulars of the changeParticulars of the changeParticulars of the changeParticulars of the change • Change approachChange approachChange approachChange approach
Review of ChangeReview of ChangeReview of ChangeReview of Change
AAAAppraisal of changeppraisal of changeppraisal of changeppraisal of change strategystrategystrategystrategy
CCCCCCCCHHHHHHHHAAAAAAAANNNNNNNNGGGGGGGGEEEEEEEE MMMMMMMMAAAAAAAANNNNNNNNAAAAAAAAGGGGGGGGEEEEEEEEMMMMMMMMEEEEEEEENNNNNNNNTTTTTTTT PPPPPPPPLLLLLLLLAAAAAAAANNNNNNNN
•• IIIIIIIImmmmmmmmpppppppplllllllleeeeeeeemmmmmmmmeeeeeeeennnnnnnnttttttttaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn ssssssssttttttttrrrrrrrraaaaaaaatttttttteeeeeeeeggggggggiiiiiiiieeeeeeeessssssss
•• RRRRRRRReeeeeeeelllllllleeeeeeeeaaaaaaaasssssssseeeeeeee SSSSSSSSttttttttrrrrrrrraaaaaaaatttttttteeeeeeeeggggggggyyyyyyyy
OUTPUT
OUTPUT
• Schedule of ActivitiesSchedule of ActivitiesSchedule of ActivitiesSchedule of Activities • Action PlanAction PlanAction PlanAction Plan • Communication PlanCommunication PlanCommunication PlanCommunication Plan • Training PlanTraining PlanTraining PlanTraining Plan • Resistance to Change PlanResistance to Change PlanResistance to Change PlanResistance to Change Plan • Employee Change Readiness PlaEmployee Change Readiness PlaEmployee Change Readiness PlaEmployee Change Readiness Plannnn • Release PlanRelease PlanRelease PlanRelease Plan • Review StrategyReview StrategyReview StrategyReview Strategy
IIIIIIIImmmmmmmmpppppppplllllllleeeeeeeemmmmmmmmeeeeeeeennnnnnnnttttttttaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn ooooooooffffffff CCCCCCCChhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
CHANGE MANAGEMENT PLAN WORKBOOKCHANGE MANAGEMENT PLAN WORKBOOKCHANGE MANAGEMENT PLAN WORKBOOKCHANGE MANAGEMENT PLAN WORKBOOK
HHHHHHHHoooooooowwwwwwww ttttttttoooooooo uuuuuuuusssssssseeeeeeee tttttttthhhhhhhhiiiiiiiissssssss TTTTTTTToooooooooooooooollllllllkkkkkkkkiiiiiiiitttttttt
TThhee ffoolllloowwiinngg ttoooollkkiitt ttaakkeess yyoouu tthhrroouugghh aa sseerriieess ooff sstteeppss tthhaatt hheellpp ttoo iiddeennttiiffyy eeaacchh ooff tthhee kkeeyy ccoommppoonneennttss ooff tthhee cchhaannggee mmaannaaggeemmeenntt pprroocceessss.. TThhiiss ttooooll wwiillll hheellpp bbuuiilldd aa rrooaaddmmaapp ttoo eeffffeeccttiivveellyy ddeessiiggnn,, ppllaann,, lleeaadd aanndd mmoonniittoorr tthhee cchhaannggee..
TThhee ffoorrmmaatt ooff tthhee ttoooollkkiitt ccoonnssiissttss ooff ttwwoo sseeccttiioonnss::
SSSSSSSSeeeeeeeeccccccccttttttttiiiiiiiioooooooonnnnnnnn OOOOOOOOnnnnnnnneeeeeeee iiss tthhee CCCCCCCChhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt PPPPPPPPllllllllaaaaaaaannnnnnnn WWWWWWWWoooooooorrrrrrrrkkkkkkkkbbbbbbbbooooooooooooooookkkkkkkk wwhhiicchh iiss bbrrookkeenn ddoowwnn iinnttoo tthhee tthhrreeee ssttaaggeess ooff cchhaannggee aanndd pprroovviiddeess gguuiiddeelliinneess,, pprroocceesssseess aanndd cchheecckklliissttss ttoo hheellpp yyoouu aannaallyyssee tthhee cchhaannggee ffoorr ssuucccceessssffuull iimmpplleemmeennttaattiioonn ooff yyoouurr pprroojjeecctt..
SSSSSSSSeeeeeeeeccccccccttttttttiiiiiiiioooooooonnnnnnnn TTTTTTTTwwwwwwwwoooooooo iiss aa tttttttteeeeeeeemmmmmmmmppppppppllllllllaaaaaaaatttttttteeeeeeee tthhaatt ccaann bbee ccoommpplleetteedd wwhhiillsstt wwoorrkkiinngg tthhrroouugghh tthhee wwoorrkkbbooookk aaccttiivviittiieess.. TThhiiss iinnffoorrmmaattiioonn wwiillll pprroovviiddee tthhee bbaassiiss ffoorr tthhee ddeevveellooppmmeenntt ooff aa ssuucccceessssffuull cchhaannggee mmaannaaggeemmeenntt ppllaann..
STAGE A: DETAILS OF THE CHANGESTAGE A: DETAILS OF THE CHANGESTAGE A: DETAILS OF THE CHANGESTAGE A: DETAILS OF THE CHANGE
At the end of this At the end of this At the end of this At the end of this sssstep you will havetep you will havetep you will havetep you will have::::
IIIIIIIIddddddddeeeeeeeennnnnnnnttttttttiiiiiiiiffffffffiiiiiiiieeeeeeeedddddddd tttttttthhhhhhhheeeeeeee ssssssssiiiiiiiittttttttuuuuuuuuaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn tttttttthhhhhhhhaaaaaaaatttttttt hhhhhhhhaaaaaaaassssssss bbbbbbbbrrrrrrrroooooooouuuuuuuugggggggghhhhhhhhtttttttt aaaaaaaabbbbbbbboooooooouuuuuuuutttttttt tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee
IIIIIIIIddddddddeeeeeeeennnnnnnnttttttttiiiiiiiiffffffffiiiiiiiieeeeeeeedddddddd tttttttthhhhhhhheeeeeeee ssssssssiiiiiiiizzzzzzzzeeeeeeee aaaaaaaannnnnnnndddddddd tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaarrrrrrrraaaaaaaacccccccctttttttteeeeeeeerrrrrrrriiiiiiiissssssssttttttttiiiiiiiiccccccccssssssss ooooooooffffffff tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee
DDDDDDDDeeeeeeeeffffffffiiiiiiiinnnnnnnneeeeeeeedddddddd tttttttthhhhhhhheeeeeeee ccccccccuuuuuuuurrrrrrrrrrrrrrrreeeeeeeennnnnnnntttttttt ssssssssttttttttaaaaaaaatttttttteeeeeeee
DDDDDDDDeeeeeeeeffffffffiiiiiiiinnnnnnnneeeeeeeedddddddd wwwwwwwwhhhhhhhhaaaaaaaatttttttt tttttttthhhhhhhheeeeeeee ffffffffuuuuuuuuttttttttuuuuuuuurrrrrrrreeeeeeee wwwwwwwwiiiiiiiillllllllllllllll llllllllooooooooooooooookkkkkkkk lllllllliiiiiiiikkkkkkkkeeeeeeee
IIIIIIIIddddddddeeeeeeeennnnnnnnttttttttiiiiiiiiffffffffiiiiiiiieeeeeeeedddddddd tttttttthhhhhhhheeeeeeee ccccccccoooooooonnnnnnnncccccccceeeeeeeepppppppptttttttt sssssssshhhhhhhhiiiiiiiiffffffffttttttttssssssss
IIIIIIIIddddddddeeeeeeeennnnnnnnttttttttiiiiiiiiffffffffiiiiiiiieeeeeeeedddddddd tttttttthhhhhhhheeeeeeee oooooooorrrrrrrrggggggggaaaaaaaannnnnnnniiiiiiiissssssssaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnaaaaaaaallllllll rrrrrrrreeeeeeeeaaaaaaaaddddddddiiiiiiiinnnnnnnneeeeeeeessssssssssssssss ttttttttoooooooo cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee
11111111........11111111........ TTTTTTTTyyyyyyyyppppppppeeeeeeee ooooooooffffffff cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee
DDeessccrriibbee tthhee ttyyppee ooff cchhaannggee..
WWhhiicchh ooff tthhee ffoolllloowwiinngg ddooeess iitt llooookk lliikkee??
PPoolliiccyy cchhaannggee
PPrroocceessss cchhaannggee
SSyysstteemm cchhaannggee
CChhaannggeedd jjoobb rroolleess
SSccaallee ooff tthhee cchhaannggee -- llaarrggee oorr ssmmaallll
SSppeeeedd ooff cchhaannggee -- ffaasstt oorr ssllooww
OOtthheerr
11111111........22222222........ RRRRRRRReeeeeeeeaaaaaaaassssssssoooooooonnnnnnnn ffffffffoooooooorrrrrrrr tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee
DDeessccrriibbee tthhee rreeaassoonn ffoorr tthhee cchhaannggee –– eexxaammppllee:: BBuussiinneessss bbeenneeffiitt
SSSSSSSSTTTTTTTTEEEEEEEEPPPPPPPP 11111111
IDENTIFY THE CHANGEIDENTIFY THE CHANGEIDENTIFY THE CHANGEIDENTIFY THE CHANGE
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
11111111........33333333........ SSSSSSSSccccccccooooooooppppppppeeeeeeee tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee
DDeessccrriibbee wwhhoo iinn tthhee bbuussiinneessss iitt iinncclluuddeess??
HHooww ffaarr rreeaacchhiinngg iinn tthhee oorrggaanniissaattiioonn iiss tthhee cchhaannggee??
DDeeppaarrttmmeenntt
WWoorrkk GGrroouuppss
BBuussiinneessss UUnniitt
DDiivviissiioonn
PPeeooppllee
SSyysstteemmss
OOtthheerr
IIss iitt tthhee ssaammee ffoorr eeaacchh ooff tthhee bbuussiinneessss uunniittss??
11111111........44444444........ WWWWWWWWhhhhhhhheeeeeeeerrrrrrrreeeeeeee aaaaaaaarrrrrrrreeeeeeee yyyyyyyyoooooooouuuuuuuu nnnnnnnnoooooooowwwwwwww????????
DDeessccrriibbee tthhee ssiittuuaattiioonn iinn tthhee oorrggaanniissaattiioonn ccuurrrreennttllyy..
DDeessccrriibbee tthhee pprroobblleemm..
WWhhaatt iiss tthhee ccaauussee??
DDeeffiinnee tthhee ccoonntteexxtt aanndd cchhaalllleennggeess ssuurrrroouunnddiinngg yyoouurr iinniittiiaattiivvee..
11111111........55555555........ WWWWWWWWhhhhhhhheeeeeeeerrrrrrrreeeeeeee ddddddddoooooooo yyyyyyyyoooooooouuuuuuuu wwwwwwwwaaaaaaaannnnnnnntttttttt ttttttttoooooooo bbbbbbbbeeeeeeee????????
DDeessccrriibbee wwhhaatt tthhee ffuuttuurree ssttaattee wwiillll bbrriinngg..
DDeessccrriibbee wwhhaatt iitt wwiillll ffeeeell lliikkee..
DDeessccrriibbee wwhhaatt iitt wwiillll llooookk lliikkee..
DDeessccrriibbee wwhhaatt yyoouu wwiillll sseeee ppeeooppllee ddooiinngg // ssaayyiinngg..
DDeessccrriibbee wwhhaatt wwiillll bbee ddoonnee ddiiffffeerreennttllyy..
DDeessccrriibbee wwhhaatt rroolleess wwiillll bbee aaffffeecctteedd iinn tthhee oorrggaanniissaattiioonn aanndd hhooww..
DDeessccrriibbee wwhhaatt wwiillll iimmpprroovvee..
The SLM Maturity Framework could be used as a benchmarking tool here to articulate the The SLM Maturity Framework could be used as a benchmarking tool here to articulate the The SLM Maturity Framework could be used as a benchmarking tool here to articulate the The SLM Maturity Framework could be used as a benchmarking tool here to articulate the key areas of improvement from the current state to future state. It can be found in the SLM key areas of improvement from the current state to future state. It can be found in the SLM key areas of improvement from the current state to future state. It can be found in the SLM key areas of improvement from the current state to future state. It can be found in the SLM Implementation Toolbox on the QGCIO siImplementation Toolbox on the QGCIO siImplementation Toolbox on the QGCIO siImplementation Toolbox on the QGCIO site te te te SLM Implementation ToolboxSLM Implementation ToolboxSLM Implementation ToolboxSLM Implementation Toolbox.
11111111........66666666........ WWWWWWWWhhhhhhhhaaaaaaaatttttttt aaaaaaaarrrrrrrreeeeeeee tttttttthhhhhhhheeeeeeee ffffffffiiiiiiiivvvvvvvveeeeeeee ((((((((55555555)))))))) ccccccccoooooooonnnnnnnncccccccceeeeeeeepppppppptttttttt sssssssshhhhhhhhiiiiiiiiffffffffttttttttssssssss rrrrrrrreeeeeeeeqqqqqqqquuuuuuuuiiiiiiiirrrrrrrreeeeeeeedddddddd ffffffffoooooooorrrrrrrr tttttttthhhhhhhhiiiiiiiissssssss cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee ttttttttoooooooo ooooooooccccccccccccccccuuuuuuuurrrrrrrr????????
IInn oorrddeerr ttoo bbrriinngg aabboouutt tthhiiss ffuuttuurree ssttaattee iitt wwiillll rreeqquuiirree nneeww wwaayyss ooff tthhiinnkkiinngg.. TThhiiss iiss uussuuaallllyy bbrroouugghhtt aabboouutt bbyy aa ppaarraaddiiggmm oorr mmiinndd sshhiifftt..
DDeessccrriibbee wwhhaatt wwiillll bbee tthhee ggaapp..
DDeessccrriibbee hhooww ppeeooppllee wwiillll nneeeedd ttoo tthhiinnkk ddiiffffeerreennttllyy aabboouutt tthhiiss cchhaannggee..
11111111........77777777........ CCCCCCCChhhhhhhheeeeeeeecccccccckkkkkkkk oooooooorrrrrrrrggggggggaaaaaaaannnnnnnniiiiiiiissssssssaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnaaaaaaaallllllll cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee rrrrrrrreeeeeeeeaaaaaaaaddddddddiiiiiiiinnnnnnnneeeeeeeessssssssssssssss
AA ddeettaaiilleedd rreeaaddiinneessss cchheecckklliisstt mmuusstt bbee ccoommpplleetteedd ttoo eennssuurree aallll eelleemmeennttss ooff tthhee cchhaannggee hhaavvee bbeeeenn aaddddrreesssseedd..
IIddeennttiiffyy pprreelliimmiinnaarryy wwoorrkk ttoo bbee aasssseesssseedd pprriioorr ttoo iimmpplleemmeennttaattiioonn..
TTrraaiinniinngg nneeeeddss aannaallyyssiiss..
WWoorrkkffoorrccee ccaappaacciittyy..
See Attachment 1 See Attachment 1 See Attachment 1 See Attachment 1 –––– Organisational change readiness checklistOrganisational change readiness checklistOrganisational change readiness checklistOrganisational change readiness checklist
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
At tAt tAt tAt the end he end he end he end of this step you will be able toof this step you will be able toof this step you will be able toof this step you will be able to::::
CCCCCCCCoooooooonnnnnnnnssssssssiiiiiiiiddddddddeeeeeeeerrrrrrrr aaaaaaaa rrrrrrrraaaaaaaannnnnnnnggggggggeeeeeeee ooooooooffffffff ooooooooppppppppttttttttiiiiiiiioooooooonnnnnnnnssssssss,,,,,,,, ssssssssoooooooolllllllluuuuuuuuttttttttiiiiiiiioooooooonnnnnnnnssssssss aaaaaaaannnnnnnndddddddd aaaaaaaaccccccccttttttttiiiiiiiioooooooonnnnnnnnssssssss ttttttttoooooooo iiiiiiiimmmmmmmmpppppppplllllllleeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee
EEEEEEEEssssssssttttttttiiiiiiiimmmmmmmmaaaaaaaatttttttteeeeeeee tttttttthhhhhhhheeeeeeee ccccccccoooooooosssssssstttttttt ooooooooffffffff cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee
AAAAAAAAsssssssssssssssseeeeeeeessssssssssssssss tttttttthhhhhhhheeeeeeee rrrrrrrriiiiiiiisssssssskkkkkkkkssssssss iiiiiiiinnnnnnnnvvvvvvvvoooooooollllllllvvvvvvvveeeeeeeedddddddd iiiiiiiinnnnnnnn iiiiiiiimmmmmmmmpppppppplllllllleeeeeeeemmmmmmmmeeeeeeeennnnnnnnttttttttaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn ooooooooffffffff tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee........
22222222........11111111........ HHHHHHHHoooooooowwwwwwww wwwwwwwwiiiiiiiillllllllllllllll yyyyyyyyoooooooouuuuuuuu ggggggggeeeeeeeetttttttt tttttttthhhhhhhheeeeeeeerrrrrrrreeeeeeee????????
TThheerree wwiillll bbee aa nnuummbbeerr ooff aarreeaass iinn tthhee oorrggaanniissaattiioonn tthhaatt wwiillll bbee iimmppaacctteedd oonn aass aa rreessuulltt ooff tthhiiss cchhaannggee aanndd eeaacchh aarreeaa nneeeeddss ttoo bbee ggiivveenn ccoonnssiiddeerraattiioonn..
RRRRRRRRaaaaaaaattttttttiiiiiiiioooooooonnnnnnnnaaaaaaaallllllll
DDoo yyoouu nneeeedd aa nneeww oorrggaanniissaattiioonn ssttrruuccttuurree??
DDoo yyoouu nneeeedd nneeww ssyysstteemmss??
WWiillll yyoouu nneeeedd nneeww pprroocceesssseess??
NNNNNNNNoooooooonnnnnnnn--------rrrrrrrraaaaaaaattttttttiiiiiiiioooooooonnnnnnnnaaaaaaaallllllll
WWhhaatt rreellaattiioonnsshhiippss wwiillll cchhaannggee??
WWiillll tthhee ccuullttuurree eemmbbrraaccee oorr rreejjeecctt tthhiiss cchhaannggee??
HHooww wwiillll tthhee ssttaakkeehhoollddeerrss sshhaarree iinnffoorrmmaattiioonn aanndd ttrraannssffeerr kknnoowwlleeddggee??
22222222........22222222........ PPPPPPPPrrrrrrrroooooooocccccccceeeeeeeessssssssssssssss CCCCCCCChhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee
PPrroocceessss cchhaannggeess tteenndd ttoo bbee mmoorree ccoommpplleexx ssoo yyoouu mmaayy wwaanntt ttoo ccoonnssiiddeerr tthhee ffoolllloowwiinngg qquueessttiioonnss ttoo aadddd mmoorree ccllaarriittyy..
DDooeess tthhiiss cchhaannggee rreepprreesseenntt aa ccoommpplleetteellyy nneeww pprroocceessss ffoorr tthhee oorrggaanniissaattiioonn,, oorr aa ddiiffffeerreenntt aapppplliiccaattiioonn ooff aann eexxiissttiinngg pprroocceessss??
WWhhaatt aarree tthhee mmaajjoorr cchhaannggeess ttoo pprroocceesssseess?? ((YYoouu mmaayy nneeeedd ttoo ‘‘bbrreeaakk tthhiiss ddoowwnn’’ iinnttoo ddiissccrreettee ccoommppoonneennttss ttoo aallllooww ttaannggiibbllee ddeessccrriippttiioonnss..))
WWhhaatt iiss ggooiinngg ttoo bbee ddoonnee ddiiffffeerreennttllyy?? ((YYoouu mmaayy nneeeedd ttoo ‘‘bbrreeaakk tthhiiss ddoowwnn’’ iinnttoo ddiissccrreettee ccoommppoonneennttss ttoo aallllooww ttaannggiibbllee ddeessccrriippttiioonnss..))
22222222........33333333........ PPPPPPPPeeeeeeeeoooooooopppppppplllllllleeeeeeee CCCCCCCChhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee
IInn tthhee pprroocceessss ooff mmaakkiinngg tthhiiss cchhaannggee tthheerree mmaayy bbee aann aaffffeecctt oonn ppeeooppllee’’ss jjoobb rroolleess aanndd rreessppoonnssiibbiilliittiieess.. CChhaannggee wwiillll iinnvvaarriiaabbllyy ccoonnffrroonntt mmaannyy rreellaattiioonnsshhiippss eessppeecciiaallllyy tthhoossee tthhaatt rreeqquuiirree aa sseett ooff nneeww bbeehhaavviioouurrss..
WWhhaatt rroolleess wwiitthhiinn tthhee oorrggaanniissaattiioonn aarree aaffffeecctteedd,, aanndd hhooww??
WWhhaatt pprree--rreeqquuiissiittee kknnoowwlleeddggee oorr ttrraaiinniinngg iiss rreeqquuiirreedd??
WWhhaatt wwoorrkk pprraaccttiicceess wwiillll bbee aaffffeecctteedd??
IIss tthheerree aa nneeeedd ffoorr nneeww rreellaattiioonnsshhiippss ttoo bbee bbuuiilltt?? ((tthhiirrdd ppaarrttyy))
WWhhaatt nneeww bbeehhaavviioouurrss aarree rreeqquuiirreedd??
The Roles and Responsibility Guide from the QGCIO site The Roles and Responsibility Guide from the QGCIO site The Roles and Responsibility Guide from the QGCIO site The Roles and Responsibility Guide from the QGCIO site SLM Implementation Toolbox could be used as a guide for new rolecould be used as a guide for new rolecould be used as a guide for new rolecould be used as a guide for new role descriptionsdescriptionsdescriptionsdescriptions....
SSSSSSSSTTTTTTTTEEEEEEEEPPPPPPPP 22222222
PARTICULARS OF PARTICULARS OF PARTICULARS OF PARTICULARS OF THE CHANGETHE CHANGETHE CHANGETHE CHANGE
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
22222222........44444444........ IIIIIIIInnnnnnnnffffffffoooooooorrrrrrrrmmmmmmmmaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn SSSSSSSShhhhhhhhaaaaaaaarrrrrrrriiiiiiiinnnnnnnngggggggg
TThhrroouugghhoouutt tthhee pprroocceessss ooff cchhaannggee iinnffoorrmmaattiioonn wwiillll bbee ddiissttrriibbuutteedd aanndd iinntteerrpprreetteedd bbyy ssttaaffff iinn mmaannyy ddiiffffeerreenntt wwaayyss.. IItt iiss tthhiiss pprroocceessss tthhaatt wwiillll bbee iimmppoorrttaanntt iinn mmaannaaggiinngg eexxppeeccttaattiioonnss aanndd ddeeaalliinngg wwiitthh tthhee rruummoouurr mmiillll..
WWhhaatt ppoolliicciieess aanndd pprroocceedduurreess nneeeedd ttoo bbee cchhaannggeedd??
WWhhaatt mmeetthhooddss aarree uusseedd ffoorr sshhaarriinngg ccuurrrreenntt aanndd uuppddaatteedd iinnffoorrmmaattiioonn aanndd ddooeess tthheerree nneeeedd ttoo bbee nneeww cchhaannnneellss ddeevveellooppeedd?? ((IInnttrraanneett,, ddaaiillyy mmeessssaaggeess eettcc..))
WWhhaatt pprroocceesssseess aarree iinn ppllaaccee ttoo mmaannaaggee tthhee kknnoowwlleeddggee aabboouutt tthhee pprroojjeecctt??
22222222........55555555........ CCCCCCCCoooooooosssssssstttttttt ooooooooffffffff cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee
UUnnddeerrssttaannddiinngg tthhee rreeaall ccoosstt ttoo tthhee oorrggaanniissaattiioonn iinn iimmpplleemmeennttiinngg aa cchhaannggee iinniittiiaattiivvee iiss oonnee wwaayy ooff oovveerrccoommiinngg kkeeyy bbaarrrriieerrss ttoo ssuucccceessssffuull cchhaannggee.. GGaaiinniinngg tthhee rriigghhtt lleevveell ooff rreessoouurrcciinngg iiss iimmppoorrttaanntt aanndd sshhoouulldd bbee ccoonnssiiddeerreedd uuppffrroonntt..
WWhhaatt wwoouulldd bbee aann eessttiimmaattee ooff tthhee ttoottaall ccoosstt ffoorr tthhee aaccttiivviittiieess rreeqquuiirreedd ttoo ccaarrrryy oouutt tthhee cchhaannggee iinniittiiaattiivvee??
WWhheerree wwiillll tthhee ffuunnddss ccoommee ffrroomm??
HHaass tthhiiss bbeeeenn nneeggoottiiaatteedd wwiitthh tthhee ccuussttoommeerr aanndd ssppoonnssoorr??
22222222........66666666........ RRRRRRRRiiiiiiiisssssssskkkkkkkk AAAAAAAAsssssssssssssssseeeeeeeessssssssssssssssmmmmmmmmeeeeeeeennnnnnnntttttttt
IInn tthhee pprroocceessss ooff ccoonnssiiddeerriinngg tthhee ddiiffffeerreenntt aassppeeccttss ooff tthhee cchhaannggee wwee nneeeedd ttoo ccoonnssiiddeerr wwhhaatt mmiigghhtt hhaappppeenn lleeaaddiinngg uupp ttoo aanndd iimmpplleemmeennttiinngg tthhee cchhaannggee aass wweellll aass wwhhaatt mmaayy bbee tthhee uunniinntteennddeedd ccoonnsseeqquueenncceess ooff tthhee cchhaannggee.. KKeeeepp iinn mmiinndd tthhaatt tthhee llaarrggeerr aanndd mmoorree ddiissrruuppttiivvee tthhee cchhaannggee tthhee ggrreeaatteerr tthhee rriisskk wwhheerreebbyy ssmmaallll aanndd iinnccrreemmeennttaall cchhaannggee wwiillll hhaavvee lleessss rriisskk.. TThhee RRiisskk MMaattrriixx wwiillll aallllooww yyoouu ttoo aasssseessss tthhee lliikkeelliihhoooodd aanndd ccoonnsseeqquueenncceess ooff tthhee cchhaannggee ttoo iinnddiiccaattee wwhheetthheerr tthhee aaccttiivviittyy iiss aa llooww,, mmeeddiiuumm oorr hhiigghh rriisskk ttoo tthhee pprroojjeecctt..
WWhhaatt rriisskkss mmaayy ooccccuurr uuppffrroonntt,, dduurriinngg iimmpplleemmeennttaattiioonn aanndd aafftteerr iimmpplleemmeennttaattiioonn??
WWhhaatt ttaaccttiiccss wwiillll yyoouu ppuutt iinn ppllaaccee ttoo mmiinniimmiissee tthheessee rriisskkss??
The The Risk Assessment TemplateThe The Risk Assessment TemplateThe The Risk Assessment TemplateThe The Risk Assessment Template (GEA) could be use. It can be found in the SLM (GEA) could be use. It can be found in the SLM (GEA) could be use. It can be found in the SLM (GEA) could be use. It can be found in the SLM Implementation Tool box on the QGCIO siteImplementation Tool box on the QGCIO siteImplementation Tool box on the QGCIO siteImplementation Tool box on the QGCIO site SLM Implementation Toolbox....
See Attachment 2 See Attachment 2 See Attachment 2 See Attachment 2 –––– Risk Assessment Matrix and TableRisk Assessment Matrix and TableRisk Assessment Matrix and TableRisk Assessment Matrix and Table
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
DrivingDrivingDrivingDriving
AdvocacyAdvocacyAdvocacyAdvocacy
Active ParticipationActive ParticipationActive ParticipationActive Participation
WillingnessWillingnessWillingnessWillingness
UnderstandingUnderstandingUnderstandingUnderstanding
[List Role][List Role][List Role][List Role]
[List Role][List Role][List Role][List Role]
[List [List [List [List Role]Role]Role]Role]
[List Role][List Role][List Role][List Role]
[List Role][List Role][List Role][List Role]
DDDDiiiiaaaaggggrrrraaaammmm 1111:::: LLLLeeeevvvveeeellllssss ooooffff PPPPaaaarrrrttttiiiicccciiiippppaaaattttiiiioooonnnn
In In In In designdesigndesigndesigninginginging youryouryouryour approach to the change approach to the change approach to the change approach to the change you you you you will be able to:will be able to:will be able to:will be able to:
IIIIIIIIddddddddeeeeeeeennnnnnnnttttttttiiiiiiiiffffffffyyyyyyyy tttttttthhhhhhhheeeeeeee ssssssssttttttttaaaaaaaakkkkkkkkeeeeeeeehhhhhhhhoooooooollllllllddddddddeeeeeeeerrrrrrrrssssssss aaaaaaaannnnnnnndddddddd tttttttthhhhhhhheeeeeeeeiiiiiiiirrrrrrrr rrrrrrrroooooooolllllllleeeeeeeessssssss
IIIIIIIIddddddddeeeeeeeennnnnnnnttttttttiiiiiiiiffffffffyyyyyyyy bbbbbbbbaaaaaaaarrrrrrrrrrrrrrrriiiiiiiieeeeeeeerrrrrrrrssssssss ooooooooffffffff rrrrrrrreeeeeeeessssssssiiiiiiiissssssssttttttttaaaaaaaannnnnnnncccccccceeeeeeee
IIIIIIIIddddddddeeeeeeeennnnnnnnttttttttiiiiiiiiffffffffyyyyyyyy aaaaaaaa cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee mmmmmmmmaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt tttttttteeeeeeeeaaaaaaaammmmmmmm wwwwwwwwiiiiiiiitttttttthhhhhhhh tttttttthhhhhhhheeeeeeeeiiiiiiiirrrrrrrr rrrrrrrroooooooolllllllleeeeeeeessssssss aaaaaaaannnnnnnndddddddd rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnnssssssssiiiiiiiibbbbbbbbiiiiiiiilllllllliiiiiiiittttttttiiiiiiiieeeeeeeessssssss
33333333........11111111 SSSSSSSSttttttttaaaaaaaakkkkkkkkeeeeeeeehhhhhhhhoooooooollllllllddddddddeeeeeeeerrrrrrrr AAAAAAAAnnnnnnnnaaaaaaaallllllllyyyyyyyyssssssssiiiiiiiissssssss PPPPPPPPyyyyyyyyrrrrrrrraaaaaaaammmmmmmmiiiiiiiidddddddd
IIddeennttiiffyyiinngg tthhee lleevveellss ooff ppaarrttiicciippaattiioonn ooff ssttaakkeehhoollddeerrss iinn tthhee cchhaannggee pprroocceessss aalllloowwss yyoouu ttoo mmaakkee ssuurree tthhaatt aa wwiiddee vvaarriieettyy ooff iinntteerreessttss aarree ttaakkeenn iinnttoo aaccccoouunntt.. TThhee iimmppaacctt aasssseessssmmeenntt ooff tthhee cchhaannggee aatt eeaacchh ooff tthhee ppaarrttiicciippaattiioonn lleevveellss wwiillll pprroovviiddee yyoouu wwiitthh vvaalluuaabbllee iinnffoorrmmaattiioonn aass ttoo hhooww ssttaakkeehhoollddeerrss mmaayy rreeaacctt ttoo tthhee cchhaannggee.. TThhiiss iinnffoorrmmaattiioonn wwiillll aallssoo iiddeennttiiffyy aatt wwhhaatt lleevveell ssttaakkeehhoollddeerrss nneeeedd ttoo bbee eennggaaggeedd aatt ii..ee.. aaddvvooccaatteess,, ddrriivveerrss,, oorr ppaarrttiicciippaattoorrss eettcc..
WWhhaatt aarree tthhee ssppeecciiffiicc ttaarrggeett ggrroouuppss//aauuddiieenncceess tthhaatt wwiillll bbee iimmppaacctteedd bbyy tthhiiss cchhaannggee??
WWhhoo mmiigghhtt bbee aabbllee ttoo hheellpp yyoouu tthhee mmoosstt?? ((aaddvvooccaatteess,, eeaarrllyy aaddppootteerrss))
WWhhoo mmiigghhtt pprreesseenntt tthhee mmoosstt rreessiissttaannccee??
WWhhoo wwiillll bbee tthhee cchhaannggee lleevveerrss?? ((ddrriivveerrss))
LLiisstt tthhee rroolleess iinn tthhee ffoolllloowwiinngg ddiiaaggrraamm oorr uussee tthhee ttaabbllee ttoo iiddeennttiiffyy wwhhoo oorr wwhhaatt ggrroouuppss ooff ppeeooppllee wwiillll ppaarrttiicciippaattee aatt eeaacchh ooff tthhee vvaarriioouuss lleevveellss..
IInn tthhee ccaassee ooff tthhee ssppoonnssoorrss rroollee iinn ddrriivviinngg tthhee cchhaannggee yyoouu mmaayy wwaanntt ttoo ccoonnssiiddeerr tthhee sskkiillllss lleevveell tthheeyy mmaayy hhaavvee iinn cchhaannggee mmaannaaggeemmeenntt.. IIff tthhiiss iiss lliimmiitteedd tthheenn aa ccooaacchhiinngg ppllaann sshhoouulldd bbee ccoonnssiiddeerreedd..
SSSSSSSSTTTTTTTTEEEEEEEEPPPPPPPP 33333333
CHANGECHANGECHANGECHANGE APPROACHAPPROACHAPPROACHAPPROACH
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
LLLLLLLLeeeeeeeevvvvvvvveeeeeeeellllllll ooooooooffffffff PPPPPPPPaaaaaaaarrrrrrrrttttttttiiiiiiiicccccccciiiiiiiippppppppaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn
WWWWWWWWhhhhhhhhoooooooo DDDDDDDDeeeeeeeessssssssccccccccrrrrrrrriiiiiiiippppppppttttttttiiiiiiiioooooooonnnnnnnn ooooooooffffffff SSSSSSSSttttttttaaaaaaaakkkkkkkkeeeeeeeehhhhhhhhoooooooollllllllddddddddeeeeeeeerrrrrrrr
DDDDDDDDrrrrrrrriiiiiiiivvvvvvvviiiiiiiinnnnnnnngggggggg
LLLLLLLLiiiiiiiisssssssstttttttt tttttttthhhhhhhheeeeeeee nnnnnnnnaaaaaaaammmmmmmmeeeeeeee ooooooooffffffff
tttttttthhhhhhhheeeeeeee ggggggggeeeeeeeennnnnnnneeeeeeeerrrrrrrriiiiiiiicccccccc rrrrrrrroooooooolllllllleeeeeeee ooooooooffffffff IIIIIIIInnnnnnnnddddddddiiiiiiiivvvvvvvviiiiiiiidddddddduuuuuuuuaaaaaaaallllllllssssssss oooooooorrrrrrrr GGGGGGGGrrrrrrrroooooooouuuuuuuuppppppppssssssss
SSSSSSSSttttttttaaaaaaaakkkkkkkkeeeeeeeehhhhhhhhoooooooollllllllddddddddeeeeeeeerrrrrrrrssssssss aaaaaaaatttttttt tttttttthhhhhhhhiiiiiiiissssssss lllllllleeeeeeeevvvvvvvveeeeeeeellllllll aaaaaaaarrrrrrrreeeeeeee ddddddddiiiiiiiirrrrrrrreeeeeeeeccccccccttttttttllllllllyyyyyyyy iiiiiiiimmmmmmmmppppppppaaaaaaaacccccccctttttttteeeeeeeedddddddd bbbbbbbbyyyyyyyy tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee aaaaaaaannnnnnnndddddddd hhhhhhhhaaaaaaaavvvvvvvveeeeeeee ssssssssoooooooommmmmmmmeeeeeeee rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnnssssssssiiiiiiiibbbbbbbbiiiiiiiilllllllliiiiiiiittttttttyyyyyyyy ffffffffoooooooorrrrrrrr tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee pppppppprrrrrrrroooooooocccccccceeeeeeeessssssssssssssss........ AAAAAAAAddddddddddddddddiiiiiiiittttttttiiiiiiiioooooooonnnnnnnnaaaaaaaallllllllllllllllyyyyyyyy,,,,,,,, tttttttthhhhhhhheeeeeeeerrrrrrrreeeeeeee iiiiiiiissssssss aaaaaaaannnnnnnn eeeeeeeexxxxxxxxppppppppeeeeeeeeccccccccttttttttaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn tttttttthhhhhhhhaaaaaaaatttttttt tttttttthhhhhhhheeeeeeeeiiiiiiiirrrrrrrr rrrrrrrroooooooolllllllleeeeeeee rrrrrrrreeeeeeeeqqqqqqqquuuuuuuuiiiiiiiirrrrrrrreeeeeeeessssssss tttttttthhhhhhhheeeeeeeemmmmmmmm ttttttttoooooooo lllllllleeeeeeeeaaaaaaaadddddddd tttttttthhhhhhhheeeeeeee iiiiiiiimmmmmmmmpppppppplllllllleeeeeeeemmmmmmmmeeeeeeeennnnnnnnttttttttaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn ooooooooffffffff tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee eeeeeeeeiiiiiiiitttttttthhhhhhhheeeeeeeerrrrrrrr aaaaaaaatttttttt aaaaaaaa ssssssssiiiiiiiitttttttteeeeeeee oooooooorrrrrrrr aaaaaaaa ssssssssttttttttrrrrrrrraaaaaaaatttttttteeeeeeeeggggggggiiiiiiiicccccccc lllllllleeeeeeeevvvvvvvveeeeeeeellllllll........ TTTTTTTThhhhhhhhiiiiiiiissssssss uuuuuuuussssssssuuuuuuuuaaaaaaaallllllllllllllllyyyyyyyy ccccccccaaaaaaaannnnnnnn iiiiiiiinnnnnnnncccccccclllllllluuuuuuuuddddddddeeeeeeee tttttttthhhhhhhheeeeeeee ssssssssppppppppoooooooonnnnnnnnssssssssoooooooorrrrrrrrssssssss ggggggggrrrrrrrroooooooouuuuuuuupppppppp........
AAAAAAAAddddddddvvvvvvvvooooooooccccccccaaaaaaaatttttttteeeeeeee
SSSSSSSSttttttttaaaaaaaakkkkkkkkeeeeeeeehhhhhhhhoooooooollllllllddddddddeeeeeeeerrrrrrrrssssssss aaaaaaaatttttttt tttttttthhhhhhhhiiiiiiiissssssss lllllllleeeeeeeevvvvvvvveeeeeeeellllllll aaaaaaaarrrrrrrreeeeeeee ddddddddiiiiiiiirrrrrrrreeeeeeeeccccccccttttttttllllllllyyyyyyyy iiiiiiiimmmmmmmmppppppppaaaaaaaacccccccctttttttteeeeeeeedddddddd bbbbbbbbyyyyyyyy tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee aaaaaaaannnnnnnndddddddd hhhhhhhhaaaaaaaavvvvvvvveeeeeeee ssssssssoooooooommmmmmmmeeeeeeee rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnnssssssssiiiiiiiibbbbbbbbiiiiiiiilllllllliiiiiiiittttttttyyyyyyyy ffffffffoooooooorrrrrrrr tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee pppppppprrrrrrrroooooooocccccccceeeeeeeessssssssssssssss........ TTTTTTTThhhhhhhheeeeeeeeiiiiiiiirrrrrrrr rrrrrrrroooooooolllllllleeeeeeee iiiiiiiinnnnnnnnvvvvvvvvoooooooollllllllvvvvvvvveeeeeeeessssssss ffffffffaaaaaaaacccccccciiiiiiiilllllllliiiiiiiittttttttaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn ooooooooffffffff tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee pppppppprrrrrrrroooooooocccccccceeeeeeeessssssssssssssss tttttttthhhhhhhhrrrrrrrroooooooouuuuuuuugggggggghhhhhhhh ssssssssuuuuuuuuppppppppppppppppoooooooorrrrrrrrtttttttt,,,,,,,, eeeeeeeennnnnnnnccccccccoooooooouuuuuuuurrrrrrrraaaaaaaaggggggggeeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt aaaaaaaannnnnnnndddddddd aaaaaaaabbbbbbbbiiiiiiiilllllllliiiiiiiittttttttyyyyyyyy ttttttttoooooooo iiiiiiiinnnnnnnnfffffffflllllllluuuuuuuueeeeeeeennnnnnnncccccccceeeeeeee ooooooootttttttthhhhhhhheeeeeeeerrrrrrrrssssssss........
AAAAAAAAccccccccttttttttiiiiiiiivvvvvvvveeeeeeee PPPPPPPPaaaaaaaarrrrrrrrttttttttiiiiiiiicccccccciiiiiiiippppppppaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn
SSSSSSSSttttttttaaaaaaaakkkkkkkkeeeeeeeehhhhhhhhoooooooollllllllddddddddeeeeeeeerrrrrrrrssssssss aaaaaaaatttttttt tttttttthhhhhhhhiiiiiiiissssssss lllllllleeeeeeeevvvvvvvveeeeeeeellllllll aaaaaaaarrrrrrrreeeeeeee ddddddddiiiiiiiirrrrrrrreeeeeeeeccccccccttttttttllllllllyyyyyyyy iiiiiiiimmmmmmmmppppppppaaaaaaaacccccccctttttttteeeeeeeedddddddd bbbbbbbbyyyyyyyy tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee aaaaaaaannnnnnnndddddddd wwwwwwwwiiiiiiiillllllllllllllll bbbbbbbbeeeeeeee rrrrrrrreeeeeeeeqqqqqqqquuuuuuuuiiiiiiiirrrrrrrreeeeeeeedddddddd ttttttttoooooooo cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee ssssssssoooooooommmmmmmmeeeeeeee aaaaaaaassssssssppppppppeeeeeeeecccccccctttttttt ooooooooffffffff wwwwwwwwhhhhhhhhaaaaaaaatttttttt tttttttthhhhhhhheeeeeeeeyyyyyyyy ddddddddoooooooo iiiiiiiinnnnnnnn tttttttthhhhhhhheeeeeeeeiiiiiiiirrrrrrrr rrrrrrrroooooooolllllllleeeeeeee aaaaaaaannnnnnnndddddddd////////oooooooorrrrrrrr hhhhhhhhoooooooowwwwwwww tttttttthhhhhhhheeeeeeeeyyyyyyyy ddddddddoooooooo iiiiiiiitttttttt........
WWWWWWWWiiiiiiiilllllllllllllllliiiiiiiinnnnnnnnggggggggnnnnnnnneeeeeeeessssssssssssssss SSSSSSSSttttttttaaaaaaaakkkkkkkkeeeeeeeehhhhhhhhoooooooollllllllddddddddeeeeeeeerrrrrrrrssssssss aaaaaaaatttttttt tttttttthhhhhhhhiiiiiiiissssssss lllllllleeeeeeeevvvvvvvveeeeeeeellllllll aaaaaaaarrrrrrrreeeeeeee nnnnnnnnooooooootttttttt ddddddddiiiiiiiirrrrrrrreeeeeeeeccccccccttttttttllllllllyyyyyyyy iiiiiiiimmmmmmmmppppppppaaaaaaaacccccccctttttttteeeeeeeedddddddd bbbbbbbbyyyyyyyy tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee hhhhhhhhoooooooowwwwwwwweeeeeeeevvvvvvvveeeeeeeerrrrrrrr tttttttthhhhhhhheeeeeeeeyyyyyyyy mmmmmmmmaaaaaaaayyyyyyyy bbbbbbbbeeeeeeee aaaaaaaasssssssskkkkkkkkeeeeeeeedddddddd ttttttttoooooooo pppppppprrrrrrrroooooooovvvvvvvviiiiiiiiddddddddeeeeeeee ssssssssoooooooommmmmmmmeeeeeeee aaaaaaaassssssssssssssssiiiiiiiissssssssttttttttaaaaaaaannnnnnnncccccccceeeeeeee iiiiiiiinnnnnnnn tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee pppppppprrrrrrrroooooooocccccccceeeeeeeessssssssssssssss........
UUUUUUUUnnnnnnnnddddddddeeeeeeeerrrrrrrrssssssssttttttttaaaaaaaannnnnnnnddddddddiiiiiiiinnnnnnnngggggggg SSSSSSSSttttttttaaaaaaaakkkkkkkkeeeeeeeehhhhhhhhoooooooollllllllddddddddeeeeeeeerrrrrrrrssssssss aaaaaaaatttttttt tttttttthhhhhhhhiiiiiiiissssssss lllllllleeeeeeeevvvvvvvveeeeeeeellllllll aaaaaaaarrrrrrrreeeeeeee nnnnnnnnooooooootttttttt ddddddddiiiiiiiirrrrrrrreeeeeeeeccccccccttttttttllllllllyyyyyyyy iiiiiiiimmmmmmmmppppppppaaaaaaaacccccccctttttttteeeeeeeedddddddd bbbbbbbbyyyyyyyy tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee hhhhhhhhoooooooowwwwwwwweeeeeeeevvvvvvvveeeeeeeerrrrrrrr iiiiiiiitttttttt iiiiiiiissssssss pppppppprrrrrrrreeeeeeeeffffffffeeeeeeeerrrrrrrraaaaaaaabbbbbbbblllllllleeeeeeee tttttttthhhhhhhhaaaaaaaatttttttt tttttttthhhhhhhheeeeeeeeyyyyyyyy hhhhhhhhaaaaaaaavvvvvvvveeeeeeee aaaaaaaa bbbbbbbbaaaaaaaassssssssiiiiiiiicccccccc uuuuuuuunnnnnnnnddddddddeeeeeeeerrrrrrrrssssssssttttttttaaaaaaaannnnnnnnddddddddiiiiiiiinnnnnnnngggggggg oooooooorrrrrrrr aaaaaaaawwwwwwwwaaaaaaaarrrrrrrreeeeeeeennnnnnnneeeeeeeessssssssssssssss ooooooooffffffff tttttttthhhhhhhheeeeeeee cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee ssssssssoooooooo tttttttthhhhhhhhaaaaaaaatttttttt tttttttthhhhhhhheeeeeeeeyyyyyyyy ffffffffeeeeeeeeeeeeeeeellllllll iiiiiiiinnnnnnnnffffffffoooooooorrrrrrrrmmmmmmmmeeeeeeeedddddddd........
33333333........22222222 RRRRRRRReeeeeeeessssssssiiiiiiiissssssssttttttttaaaaaaaannnnnnnncccccccceeeeeeee ttttttttoooooooo cccccccchhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee
RReessiissttaannccee iiss aa nnaattuurraall aanndd uunnaavvooiiddaabbllee ppaarrtt ooff aannyy cchhaannggee pprroocceessss.. IItt iiss aa ssuurrvviivvaall mmeecchhaanniissmm wwiitthhiinn oorrggaanniissaattiioonnss.. TThheerree aa nnuummbbeerr ooff rreeaassoonnss wwhhyy ssttaaffff rreessiisstt cchhaannggee,, ssoo iitt iiss iimmppoorrttaanntt ttoo iiddeennttiiffyy tthhee rroooott ccaauusseess iinn oorrddeerr ttoo ppllaann ssoommee ooff yyoouurr ssttrraatteeggiieess ffoorr iimmpplleemmeennttaattiioonn.. IIddeennttiiffyyiinngg tthhee rroooott ccaauussee ccaann bbee ccaarrrriieedd oouutt iinn aa nnuummbbeerr ooff wwaayyss.. YYoouu ccaann iiddeennttiiffyy rreessiissttaannccee bbyy eemmppllooyyeeee ffeeeeddbbaacckk,, ssuuppeerrvviissoorr iinnppuutt,, pprroojjeecctt tteeaamm iissssuueess,, aanndd ccoommpplliiaannccee aauuddiittss..
AA ggeenneerraall ssuurrvveeyy ttooooll hhaass bbeeeenn pprroovviiddeedd tthhaatt ccoovveerrss aa bbrrooaadd rraannggee ooff aarreeaass tthhaatt aarree uussuuaallllyy bbaarrrriieerrss ttoo pprroojjeeccttss.. TThhiiss iinnffoorrmmaattiioonn ggaatthheerreedd bbyy ssuurrvveeyyiinngg vvaarriioouuss ggrroouuppss iimmppaacctteedd oonn bbyy tthhee cchhaannggee iiss uusseeffuull ttoo ffoorrmmuullaattee yyoouurr ccoommmmuunniiccaattiioonn aanndd rreessiissttaannccee ppllaann iinn tthhee nneexxtt sseeccttiioonn..
See Attachment 3See Attachment 3See Attachment 3See Attachment 3 –––– Resistance Resistance Resistance Resistance AssessmentAssessmentAssessmentAssessment SurveySurveySurveySurvey
33333333........33333333 RRRRRRRRoooooooolllllllleeeeeeee ooooooooffffffff CCCCCCCChhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt TTTTTTTTeeeeeeeeaaaaaaaammmmmmmm
IInn tthhee ddeevveellooppmmeenntt ooff yyoouurr cchhaannggee ssttrraatteeggiieess yyoouu mmaayy wwaanntt ttoo ccoonnssiiddeerr ddeevveellooppiinngg aa cchhaannggee mmaannaaggeemmeenntt tteeaamm wwhhoo ccaann hheellpp ddrriivvee tthhee iimmpplleemmeennttaattiioonn ooff tthhee cchhaannggee..
TThhee tteeaamm mmeemmbbeerrss sshhoouulldd rreepprreesseenntt aa vvaarriieettyy ooff ffuunnccttiioonnss,, ddeeppaarrttmmeennttss aanndd lleevveellss iinn tthhee oorrggaanniissaattiioonn wwhhiillsstt rreepprreesseennttiinngg aa ccrroossss sseeccttiioonn ffrroomm tthhee ssttaakkeehhoollddeerr aannaallyyssiiss ppyyrraammiidd..
TThheeyy nneeeedd ttoo hhaavvee eexxcceelllleenntt ccoommmmuunniiccaattiioonn sskkiillllss,, hhaavvee bbuussiinneessss iinnfflluueennccee,, bbee ccoommmmiitttteedd ttoo tthhee cchhaannggee,, kknnooww tthhee bbuussiinneessss,, bbee aa tteeaamm ppllaayyeerr aanndd ssoommee cchhaannggee mmaannaaggeemmeenntt eexxppeerriieennccee wwoouulldd bbee aann aasssseett..
TThhee tteeaamm ddooeess nnoott hhaavvee ttoo bbee wwoorrkkiinngg oonn yyoouurr pprroojjeecctt ffuullll ttiimmee bbuutt mmuusstt bbee aabbllee ttoo ccoommmmiitt ssoommee ttiimmee ttoo tthhee pprroojjeecctt..
TThhee tteeaamm mmaayy rreeqquuiirree ssoommee tteeaamm ddeevveellooppmmeenntt ttoo pprroovviiddee aa ccoommmmoonn uunnddeerrssttaannddiinngg ooff tthhee bbuussiinneessss iissssuueess tthhaatt mmoottiivvaatteedd tthhee cchhaannggee aanndd tthhee ffuuttuurree ssttaattee ffoorr tthhee oorrggaanniissaattiioonn..
TThhee tteeaamm nneeeedd ttoo iiddeennttiiffyy rroolleess aanndd rreessppoonnssiibbiilliittiieess iinn tthhee iimmpplleemmeennttaattiioonn ooff tthhee cchhaannggee ppllaann..
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
STAGE STAGE STAGE STAGE BBBB: : : : IMPLEMENTATION OFIMPLEMENTATION OFIMPLEMENTATION OFIMPLEMENTATION OF CHANGECHANGECHANGECHANGE
AAAAAAAAnnnnnnnnaaaaaaaallllllllyyyyyyyyssssssssiiiiiiiissssssss ooooooooffffffff tttttttthhhhhhhheeeeeeee iiiiiiiinnnnnnnnffffffffoooooooorrrrrrrrmmmmmmmmaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn ffffffffrrrrrrrroooooooommmmmmmm tttttttthhhhhhhheeeeeeee pppppppprrrrrrrreeeeeeeevvvvvvvviiiiiiiioooooooouuuuuuuussssssss aaaaaaaarrrrrrrreeeeeeeeaaaaaaaassssssss wwwwwwwwiiiiiiiillllllllllllllll pppppppprrrrrrrroooooooovvvvvvvviiiiiiiiddddddddeeeeeeee tttttttthhhhhhhheeeeeeee bbbbbbbbaaaaaaaassssssssiiiiiiiissssssss ffffffffoooooooorrrrrrrr tttttttthhhhhhhheeeeeeee ddddddddeeeeeeeevvvvvvvveeeeeeeellllllllooooooooppppppppmmmmmmmmeeeeeeeennnnnnnntttttttt ooooooooffffffff tttttttthhhhhhhheeeeeeee ffffffffoooooooolllllllllllllllloooooooowwwwwwwwiiiiiiiinnnnnnnngggggggg ppppppppllllllllaaaaaaaannnnnnnnssssssss::::::::
AAAAAAAAccccccccttttttttiiiiiiiioooooooonnnnnnnn ppppppppllllllllaaaaaaaannnnnnnn
CCCCCCCCoooooooommmmmmmmmmmmmmmmuuuuuuuunnnnnnnniiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn ppppppppllllllllaaaaaaaannnnnnnn
TTTTTTTTrrrrrrrraaaaaaaaiiiiiiiinnnnnnnniiiiiiiinnnnnnnngggggggg ppppppppllllllllaaaaaaaannnnnnnn
BBBBBBBBuuuuuuuussssssssiiiiiiiinnnnnnnneeeeeeeessssssssssssssss ssssssssyyyyyyyysssssssstttttttteeeeeeeemmmmmmmmssssssss ppppppppllllllllaaaaaaaannnnnnnn
RRRRRRRReeeeeeeessssssssiiiiiiiissssssssttttttttaaaaaaaannnnnnnncccccccceeeeeeee ppppppppllllllllaaaaaaaannnnnnnn
44444444........11111111 AAAAAAAAccccccccttttttttiiiiiiiioooooooonnnnnnnn PPPPPPPPllllllllaaaaaaaannnnnnnn
LLiisstt tthhee aaccttiivviittiieess,, rreessppoonnssiibbiilliittiieess aanndd ttiimmeeffrraammeess ffoorr tthhee pprroojjeecctt ttoo bbee rroolllleedd oouutt..
AAAAAAAAccccccccttttttttiiiiiiiivvvvvvvviiiiiiiittttttttyyyyyyyy RRRRRRRReeeeeeeessssssssppppppppoooooooonnnnnnnnssssssssiiiiiiiibbbbbbbbiiiiiiiilllllllliiiiiiiittttttttyyyyyyyy TTTTTTTTiiiiiiiimmmmmmmmeeeeeeeeffffffffrrrrrrrraaaaaaaammmmmmmmeeeeeeee
EEEEEEEEgggggggg ........CCCCCCCCoooooooommmmmmmmmmmmmmmmuuuuuuuunnnnnnnniiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn aaaaaaaaccccccccttttttttiiiiiiiivvvvvvvviiiiiiiittttttttiiiiiiiieeeeeeeessssssss
DDeevveelloopp aa sscchheedduullee ffoorr tthhee iinntteeggrraattiioonn ooff aaccttiivviittiieess rreeqquuiirreedd ttoo iimmpplleemmeenntt tthhee cchhaannggee ppllaann..
See Appendix A See Appendix A See Appendix A See Appendix A –––– Action PlanAction PlanAction PlanAction Plan See Appendix B See Appendix B See Appendix B See Appendix B –––– Schedule DetailSchedule DetailSchedule DetailSchedule Detail
44444444........22222222 CCCCCCCCoooooooommmmmmmmmmmmmmmmuuuuuuuunnnnnnnniiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn PPPPPPPPllllllllaaaaaaaannnnnnnn
WWhheenn ddeevveellooppiinngg aa ccoommmmuunniiccaattiioonn ppllaann,, iitt iiss iimmppoorrttaanntt ttoo ccrreeaattee rreeppoorrttiinngg pprroottooccoollss ssppeecciiffiiccaallllyy ffoorr yyoouurr pprroojjeecctt aanndd iiddeennttiiffyy wwhhoo wwiillll bbee tthhee rreessppoonnssiibbllee mmeemmbbeerr ffrroomm tthhee pprroojjeecctt tteeaamm ttoo hhaavvee oovveerraallll rreessppoonnssiibbiilliittyy ffoorr tthhee rroolllliinngg oouutt ooff ccoommmmuunniiccaattiioonn.. MMaakkee ssuurree yyoouu iinncclluuddee aallll ssttaakkeehhoollddeerrss iiee.. OOtthheerr pprroojjeecctt tteeaammss,, ssttaaffff,, ssppoonnssoorrss oorr kkeeyy ssttaakkeehhoollddeerrss..
WWWWWWWWhhhhhhhheeeeeeeennnnnnnn ddddddddeeeeeeeevvvvvvvveeeeeeeellllllllooooooooppppppppiiiiiiiinnnnnnnngggggggg yyyyyyyyoooooooouuuuuuuurrrrrrrr ccccccccoooooooommmmmmmmmmmmmmmmuuuuuuuunnnnnnnniiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn ppppppppllllllllaaaaaaaannnnnnnn aaaaaaaaddddddddddddddddrrrrrrrreeeeeeeessssssssssssssss tttttttthhhhhhhheeeeeeee ffffffffoooooooolllllllllllllllloooooooowwwwwwwwiiiiiiiinnnnnnnngggggggg::::::::
DDDDDDDDDDDDaaaaaaaaaaaatttttttttttteeeeeeeeeeee WWhheenn sshhoouulldd tthhee ggiivveenn mmeessssaaggee bbee ccoommmmuunniiccaatteedd??
WWhhaatt iiss tthhee nneeggaattiivvee iimmppaacctt ooff ccoommmmuunniiccaattiinngg ttoooo ssoooonn oorr ttoooo llaattee??
HHooww ffrreeqquueennttllyy sshhoouulldd yyoouu rreeppeeaatt tthhee mmeessssaaggee??
AAAAAAAAAAAAuuuuuuuuuuuuddddddddddddiiiiiiiiiiiieeeeeeeeeeeennnnnnnnnnnncccccccccccceeeeeeeeeeee
WWhhoo iiss tthhee ttaarrggeett aauuddiieennccee ooff tthhee ppiieeccee ooff iinnffoorrmmaattiioonn??
WWhhaatt aarree tthhee nneeeeddss,, pprriioorriittiieess aanndd ssppeecciiaall iinntteerreessttss ooff tthhee aauuddiieennccee??
HHooww ccaann yyoouu bbeesstt ffrraammee tthhee mmeessssaaggee ssoo tthhaatt iitt aaddddrreesssseess tthhee aauuddiieennccee’’ss iinntteerreessttss??
WWoouulldd yyoouu nneeeedd ttoo ttaaiilloorr aa ssppeecciiaall mmeessssaaggee ffoorr eeaacchh sseeggmmeenntt ooff tthhee aauuddiieennccee??
HHooww mmiigghhtt tthheeyy rreessppoonndd ttoo tthhee mmeessssaaggee aanndd iiff tthhee rreessppoonnssee mmaayy bbee nneeggaattiivvee oorr ooppeenn ttoo mmiissiinntteerrpprreettaattiioonn,, wwhhaatt eellssee nneeeeddss ttoo bbee ssaaiidd??
WWWWWWWWWWWWhhhhhhhhhhhhaaaaaaaaaaaatttttttttttt iiiiiiiiiiiissssssssssss tttttttttttthhhhhhhhhhhheeeeeeeeeeee
rrrrrrrrrrrreeeeeeeeeeeeaaaaaaaaaaaassssssssssssoooooooooooonnnnnnnnnnnn ffffffffffffoooooooooooorrrrrrrrrrrr tttttttttttthhhhhhhhhhhheeeeeeeeeeee
ccccccccccccoooooooooooommmmmmmmmmmmmmmmmmmmmmmmuuuuuuuuuuuunnnnnnnnnnnniiiiiiiiiiiiccccccccccccaaaaaaaaaaaatttttttttttt iiiiiiiiiiiioooooooooooonnnnnnnnnnnn????????????
WWhhaatt aarree yyoouu ttrryyiinngg ttoo aacchhiieevvee aass aa rreessuulltt ooff tthhiiss ccoommmmuunniiccaattiioonn??
WWhhaatt ddoo yyoouu eexxppeecctt tthhee ttaarrggeett aauuddiieennccee ttoo ddoo,, ssaayy,, tthhiinnkk oorr ffeeeell aass aa rreessuulltt ooff tthhiiss ccoommmmuunniiccaattiioonn??
RRRRRRRRRRRRiiiiiiiiiiiisssssssssssskkkkkkkkkkkk WWhhaatt iiss tthhee wwoorrsstt tthhiinngg tthhaatt ccaann hhaappppeenn iiff yyoouu ccoommmmuunniiccaattee tthhiiss iinnffoorrmmaattiioonn??
WWhhaatt iiss tthhee wwoorrsstt tthhiinngg tthhaatt ccaann hhaappppeenn iiff yyoouu cchhoossee nnoott ttoo ccoommmmuunniiccaattee tthhiiss iinnffoorrmmaattiioonn??
SSSSSSSSTTTTTTTTEEEEEEEEPPPPPPPP 44444444
IMPLEMENTATION STRATEGIESIMPLEMENTATION STRATEGIESIMPLEMENTATION STRATEGIESIMPLEMENTATION STRATEGIES
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
HHooww bbaaddllyy ccaann tthhiiss iinnffoorrmmaattiioonn bbee mmiissiinntteerrpprreetteedd??
WWhhaatt ccaann yyoouu ddoo ttoo mmiinniimmiissee tthhee mmiissiinntteerrpprreettaattiioonn aanndd nneeggaattiivvee ppeerrcceeppttiioonnss??
AAAAAAAAAAAAccccccccccccttttttttttttiiiiiiiiiiiivvvvvvvvvvvviiiiiiiiiiii ttttttttttttiiiiiiiiiiiieeeeeeeeeeeessssssssssss WWhhaatt mmeetthhoodd aanndd mmeeddiiuumm wwoouulldd yyoouu uussee ttoo aannnnoouunnccee tthhiiss mmeessssaaggee??
WWhhaatt ccoommmmuunniiccaattiioonn nneettwwoorrkk wwoouulldd yyoouu uussee -- iinnffoorrmmaall oorr ffoorrmmaall??
KKKKKKKKKKKKeeeeeeeeeeeeyyyyyyyyyyyy MMMMMMMMMMMMeeeeeeeeeeeessssssssssssssssssssssssaaaaaaaaaaaaggggggggggggeeeeeeeeeeeessssssssssss WWhhaatt aarree tthhee eesssseennttiiaallss ooff tthhee mmeessssaaggee??
WWhhaatt iiss tthhee mmoosstt ppoossiittiivvee iinntteerrpprreettaattiioonn iitt ccaann rreecceeiivvee??
WWhhaatt iiss tthhee mmoosstt ccyynniiccaall rreessppoonnssee iitt ccaann rreecceeiivvee??
GGGGGGGGGGGGeeeeeeeeeeeennnnnnnnnnnneeeeeeeeeeeerrrrrrrrrrrraaaaaaaaaaaallllllllllll llllllllllllyyyyyyyyyyyy
AArree tthheerree rreessoouurrccee iimmpplliiccaattiioonnss ffoorr yyoouurr ccoommmmuunniiccaattiioonnss ssttrraatteeggyy??
HHooww ddoo yyoouu ggaaiinn ssppoonnssoorrss bbuuyy--iinn ttoo tthhee ccoommmmuunniiccaattiioonn ppllaann??
AArree tthheerree aannyy rreessttrriiccttiioonnss oonn wwhhoo ccaann rreecceeiivvee tthhee ccoommmmuunniiccaattiioonnss??
HHooww wwiillll yyoouu ddeeaall wwiitthh aannggeerr aabboouutt tthhee rreessttrriiccttiinngg ooff ccoommmmuunniiccaattiioonnss dduuee ttoo ccoonnffiiddeennttiiaalliittyy ccoonnssiiddeerraattiioonnss??
See Appendix C See Appendix C See Appendix C See Appendix C –––– Communication PlanCommunication PlanCommunication PlanCommunication Plan
44444444........33333333 TTTTTTTTrrrrrrrraaaaaaaaiiiiiiiinnnnnnnniiiiiiiinnnnnnnngggggggg PPPPPPPPllllllllaaaaaaaannnnnnnn
IIddeennttiiffyy tthhee ccuurrrreenntt lleevveell ooff sskkiillllss aanndd kknnoowwlleeddggee aanndd bbeehhaavviioouurrss ooff tthhee ggrroouupp tthhaatt wwiillll bbee iimmppaacctteedd oonn..
WWhhaatt pprreerreeqquuiissiittee kknnoowwlleeddggee ddoo tthheessee ggrroouuppss nneeeedd??
WWhhaatt aarree tthhee ttrraaiinniinngg ssttrraatteeggiieess??
IIddeennttiiffyy rreeqquuiirreemmeennttss ffoorr aa ttrraaiinniinngg pprrooggrraamm..
WWhhoo wwiillll ddoo tthhee ttrraaiinniinngg??
WWhhoo wwiillll ffuunndd tthhee ttrraaiinniinngg??
WWhhaatt ttiimmee ccoommmmiittmmeenntt wwiillll tthhiiss iinnvvoollvvee??
WWhhaatt wwiillll bbee tthhee pprreeffeerrrreedd mmeetthhoodd ooff ddeelliivveerryy??
See Appendix D See Appendix D See Appendix D See Appendix D –––– Training PlanTraining PlanTraining PlanTraining Plan
44444444........44444444 BBBBBBBBuuuuuuuussssssssiiiiiiiinnnnnnnneeeeeeeessssssssssssssss SSSSSSSSyyyyyyyysssssssstttttttteeeeeeeemmmmmmmmssssssss PPPPPPPPllllllllaaaaaaaannnnnnnn
IIddeennttiiffyy tthhee hhaarrddwwaarree,, ssooffttwwaarree aanndd nneettwwoorrkk nneeeeddeedd ttoo iimmpplleemmeenntt tthhee cchhaannggee..
44444444........55555555 RRRRRRRReeeeeeeessssssssiiiiiiiissssssssttttttttaaaaaaaannnnnnnncccccccceeeeeeee PPPPPPPPllllllllaaaaaaaannnnnnnn
IIddeennttiiffyy tthhee kkeeyy aarreeaass ooff rreessiissttaannccee aanndd ddeevveelloopp aa rreessiissttaannccee mmaannaaggeemmeenntt ppllaann tthhaatt ccaann bbee mmaannaaggeedd bbyy tthhee cchhaannggee mmaannaaggeemmeenntt tteeaamm.. TThhee ddiirreecctt ssuuppeerrvviissoorr iiss uussuuaallllyy tthhee bbeesstt ppeerrssoonn ttoo ddeelliivveerr tthhee ssuurrvveeyy ttoo iiddeennttiiffyy tthhee lleevveell ooff eemmppllooyyeeee rreessiissttaannccee..
TTTTTTTThhhhhhhhiiiiiiiissssssss ppppppppllllllllaaaaaaaannnnnnnn wwwwwwwwiiiiiiiillllllllllllllll bbbbbbbbeeeeeeee rrrrrrrreeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwweeeeeeeedddddddd aaaaaaaassssssss tttttttthhhhhhhheeeeeeee pppppppprrrrrrrroooooooojjjjjjjjeeeeeeeecccccccctttttttt pppppppprrrrrrrrooooooooggggggggrrrrrrrreeeeeeeesssssssssssssssseeeeeeeessssssss aaaaaaaassssssss mmmmmmmmoooooooorrrrrrrreeeeeeee ppppppppooooooooiiiiiiiinnnnnnnnttttttttssssssss ooooooooffffffff rrrrrrrreeeeeeeessssssssiiiiiiiissssssssttttttttaaaaaaaannnnnnnncccccccceeeeeeee mmmmmmmmaaaaaaaayyyyyyyy eeeeeeeemmmmmmmmeeeeeeeerrrrrrrrggggggggeeeeeeee wwwwwwwwhhhhhhhhiiiiiiiillllllllsssssssstttttttt pppppppprrrrrrrroooooooojjjjjjjjeeeeeeeecccccccctttttttt iiiiiiiissssssss bbbbbbbbeeeeeeeeiiiiiiiinnnnnnnngggggggg iiiiiiiimmmmmmmmpppppppplllllllleeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttteeeeeeeedddddddd........
UUssee tthhee iinnffoorrmmaattiioonn ffrroomm tthhee ““RReessiissttaannccee AAsssseessssmmeenntt SSuurrvveeyy”” oorr ggaatthheerr ffeeeeddbbaacckk ffrroomm ootthheerr ssoouurrcceess oorr mmeetthhooddss ttoo iiddeennttiiffyy tthhee aarreeaass ooff rreessiissttaannccee..
IIddeennttiiffyy tthhee mmaaiinn ccaauussee ooff rreessiissttaannccee
PPrroovviiddee ssoommee oonnggooiinngg ccooaacchhiinngg ooppppoorrttuunniittiieess ffoorr tthhee eemmppllooyyeeee oorr mmaannaaggeerrss tthhaatt aarree rreessiissttaanntt ttoo tthhee cchhaannggee..
CCoommmmuunniiccaattee tthhee ccoonnsseeqquueenncceess ttoo ssttaaffff iiff nnoott ssuuppppoorrttiinngg tthhee cchhaannggee..
IImmpplleemmeenntt ssoommee ooff tthhee ccoonnsseeqquueenncceess ffoorr nnoott ssuuppppoorrttiinngg tthhee cchhaannggee..
SSSSeeeeeeee AAAAppppppppeeeennnnddddiiiixxxx EEEE –––– RRRReeeessssiiiissssttttaaaannnncccceeee MMMMaaaannnnaaaaggggeeeemmmmeeeennnntttt PPPPllllaaaannnn
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
Prior to releasing Prior to releasing Prior to releasing Prior to releasing the implementathe implementathe implementathe implementattttion of the project and toion of the project and toion of the project and toion of the project and to ensure that implementation goes smoothly ensure that implementation goes smoothly ensure that implementation goes smoothly ensure that implementation goes smoothly make certain that the following activities have been make certain that the following activities have been make certain that the following activities have been make certain that the following activities have been checked off and addressedchecked off and addressedchecked off and addressedchecked off and addressed....
ACTIVITYACTIVITYACTIVITYACTIVITY
PolicyPolicyPolicyPolicy YesYesYesYes NoNoNoNo
Procedures ManualProcedures ManualProcedures ManualProcedures Manual YesYesYesYes NoNoNoNo
Communication PlanCommunication PlanCommunication PlanCommunication Plan YesYesYesYes NoNoNoNo
Communication MaterialsCommunication MaterialsCommunication MaterialsCommunication Materials YesYesYesYes NoNoNoNo
Identified the Process OwnerIdentified the Process OwnerIdentified the Process OwnerIdentified the Process Owner YesYesYesYes NoNoNoNo
Training PlanTraining PlanTraining PlanTraining Plan YesYesYesYes NoNoNoNo
Training MaterialsTraining MaterialsTraining MaterialsTraining Materials YesYesYesYes NoNoNoNo
Reporting PlanReporting PlanReporting PlanReporting Plan YesYesYesYes NoNoNoNo
Key Performance IndicatorsKey Performance IndicatorsKey Performance IndicatorsKey Performance Indicators YesYesYesYes NoNoNoNo
Review PlaReview PlaReview PlaReview Plan for ongoing feedback and monitoringn for ongoing feedback and monitoringn for ongoing feedback and monitoringn for ongoing feedback and monitoring YesYesYesYes NoNoNoNo
Organisational Readiness AssessmentOrganisational Readiness AssessmentOrganisational Readiness AssessmentOrganisational Readiness Assessment YesYesYesYes NoNoNoNo
Audit ChecklistAudit ChecklistAudit ChecklistAudit Checklist YesYesYesYes NoNoNoNo
STAGE STAGE STAGE STAGE CCCC: : : : REVIEWREVIEWREVIEWREVIEW OF CHANGOF CHANGOF CHANGOF CHANGEEEE
66666666........11111111........ OOOOOOOOnnnnnnnnggggggggooooooooiiiiiiiinnnnnnnngggggggg MMMMMMMMoooooooonnnnnnnniiiiiiiittttttttoooooooorrrrrrrr aaaaaaaannnnnnnndddddddd RRRRRRRReeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwww
AAsssseessssiinngg yyoouurr rreessuullttss,, iimmpplleemmeennttiinngg ccoorrrreeccttiivvee aaccttiioonn aanndd cceelleebbrraattiinngg ssuucccceessss aarree aallll kkeeyy ppaarrttss ttoo rreevviieeww tthhee cchhaannggee..
GGaatthheerriinngg eevviiddeennccee ttoo sshhooww tthhee ssuucccceessss ooff tthhee iimmpplleemmeennttaattiioonn ccaann bbee ccaarrrriieedd oouutt bbyy::
CCoolllleeccttiinngg ffeeeeddbbaacckk ffrroomm uusseerrss –– aanneeccddoottaall oorr ssuurrvveeyy;;
CCaarrrryyiinngg oouutt ccoommpplliiaannccee aauuddiittss oonn nneeww pprroocceesssseess,, ssyysstteemmss aanndd jjoobb rroolleess;;
RReevviieewwiinngg aarreeaass ooff rreessiissttaannccee aanndd wwoorrkk wwiitthh ssppoonnssoorrss aanndd ddiirreecctt ssuuppeerrvviissoorrss ttoo wwoorrkk tthhrroouugghh aannyy ssttrraatteeggiieess;; aanndd
IIddeennttiiffyyiinngg aarreeaass ooff ssuucccceessss ffoorr tthhee pprroojjeecctt.. MMaakkee tthheessee vviissiibbllee iinn tthhee oorrggaanniissaattiioonn ttoo rreeiinnffoorrccee tthhee cchhaannggee..
SSSSSSSSTTTTTTTTEEEEEEEEPPPPPPPP 55555555
SSSSSSSSTTTTTTTTEEEEEEEEPPPPPPPP 66666666
DEVELOP IMPLEMENTATION PACKAGE FOR DEVELOP IMPLEMENTATION PACKAGE FOR DEVELOP IMPLEMENTATION PACKAGE FOR DEVELOP IMPLEMENTATION PACKAGE FOR PROJECT RELEASEPROJECT RELEASEPROJECT RELEASEPROJECT RELEASE
REVIEW CHANGE STRATEGYREVIEW CHANGE STRATEGYREVIEW CHANGE STRATEGYREVIEW CHANGE STRATEGY
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
Action PlanAction PlanAction PlanAction Plan Appendix AAppendix AAppendix AAppendix A
ActionsActionsActionsActions Responsible PeResponsible PeResponsible PeResponsible Personrsonrsonrson TimeframeTimeframeTimeframeTimeframe
IT ActivitiesIT ActivitiesIT ActivitiesIT Activities
Hardware:Hardware:Hardware:Hardware:
Software:Software:Software:Software:
Network:Network:Network:Network:
Business Unit / Business Unit / Business Unit / Business Unit / Product Group Product Group Product Group Product Group ActivitiesActivitiesActivitiesActivities
Project Team ActivitiesProject Team ActivitiesProject Team ActivitiesProject Team Activities
Communication Communication Communication Communication ActivitiesActivitiesActivitiesActivities
Training ActivitiesTraining ActivitiesTraining ActivitiesTraining Activities
Audit PreparationAudit PreparationAudit PreparationAudit Preparation
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
Schedule Of ActivitiesSchedule Of ActivitiesSchedule Of ActivitiesSchedule Of Activities Appendix BAppendix BAppendix BAppendix B
Name of TName of TName of TName of Taskaskaskask DurationDurationDurationDuration Start DStart DStart DStart Dateateateate End End End End DDDDateateateate ResourcesResourcesResourcesResources
MilestoneMilestoneMilestoneMilestone OneOneOneOne
AAAActivitiesctivitiesctivitiesctivities
Milestone TwoMilestone TwoMilestone TwoMilestone Two
ActivitiesActivitiesActivitiesActivities
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
Communication PlanCommunication PlanCommunication PlanCommunication Plan Appendix Appendix Appendix Appendix CCCC Name of person as point of contact for all project communication:
AudienceAudienceAudienceAudience Key messagesKey messagesKey messagesKey messages Delivery MethodDelivery MethodDelivery MethodDelivery Method DateDateDateDate Length of sessionLength of sessionLength of sessionLength of session (if applicable)(if applicable)(if applicable)(if applicable)
LocationLocationLocationLocation
Example:Example:Example:Example:
Team LeadeTeam LeadeTeam LeadeTeam Leadersrsrsrs Senior ManagersSenior ManagersSenior ManagersSenior Managers
SenderSenderSenderSender Example: Example: Example: Example: Project Project Project Project ManagerManagerManagerManager
EEEExample: xample: xample: xample: StaffStaffStaffStaff UsersUsersUsersUsers
SenderSenderSenderSender Example: Example: Example: Example: SupervisorSupervisorSupervisorSupervisor
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
Training PlanTraining PlanTraining PlanTraining Plan Appendix Appendix Appendix Appendix DDDD
Attach training schedule (if available)
Session ModulesSession ModulesSession ModulesSession Modules Learning OutcomesLearning OutcomesLearning OutcomesLearning Outcomes ObjectivesObjectivesObjectivesObjectives Length of Training sLength of Training sLength of Training sLength of Training sessionessionessionession Target Target Target Target
audienceaudienceaudienceaudience Delivery Delivery Delivery Delivery modemodemodemode
FacilitatorFacilitatorFacilitatorFacilitator
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
Resistance Management PlanResistance Management PlanResistance Management PlanResistance Management Plan Appendix Appendix Appendix Appendix EEEE
(Use with Attachment 3)
Key areas of resistanceKey areas of resistanceKey areas of resistanceKey areas of resistance Actions to address resistanceActions to address resistanceActions to address resistanceActions to address resistance Responsible personResponsible personResponsible personResponsible person
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
Organisation Change Readiness CheckOrganisation Change Readiness CheckOrganisation Change Readiness CheckOrganisation Change Readiness Checklistlistlistlist AAAAttachment 1ttachment 1ttachment 1ttachment 1
Deliverable:Deliverable:Deliverable:Deliverable:
Implementation Team Leader:Implementation Team Leader:Implementation Team Leader:Implementation Team Leader:
Implementation Sponsor:Implementation Sponsor:Implementation Sponsor:Implementation Sponsor:
PEOPLE READINESSPEOPLE READINESSPEOPLE READINESSPEOPLE READINESS Action RequiredAction RequiredAction RequiredAction Required WhenWhenWhenWhen CompletedCompletedCompletedCompleted
Business Unit / Product Group ActionsBusiness Unit / Product Group ActionsBusiness Unit / Product Group ActionsBusiness Unit / Product Group Actions
Have the business unit contacts been selected and notified?Have the business unit contacts been selected and notified?Have the business unit contacts been selected and notified?Have the business unit contacts been selected and notified?
Have theHave theHave theHave the business unit contacts been briefed by the project team?business unit contacts been briefed by the project team?business unit contacts been briefed by the project team?business unit contacts been briefed by the project team?
Has the priority for this project been set by the Business Unit Has the priority for this project been set by the Business Unit Has the priority for this project been set by the Business Unit Has the priority for this project been set by the Business Unit Management Team?Management Team?Management Team?Management Team?
TrainingTrainingTrainingTraining
Has the target training audience been identified and nominated?Has the target training audience been identified and nominated?Has the target training audience been identified and nominated?Has the target training audience been identified and nominated?
Has a Training Needs AnalysiHas a Training Needs AnalysiHas a Training Needs AnalysiHas a Training Needs Analysis been carried out?s been carried out?s been carried out?s been carried out?
Is the Training Information Sheet available?Is the Training Information Sheet available?Is the Training Information Sheet available?Is the Training Information Sheet available?
Has the training provider been established?Has the training provider been established?Has the training provider been established?Has the training provider been established?
Has the Training coHas the Training coHas the Training coHas the Training co----ordinator been provided with the training details ordinator been provided with the training details ordinator been provided with the training details ordinator been provided with the training details and put in place the necessary arrangements?and put in place the necessary arrangements?and put in place the necessary arrangements?and put in place the necessary arrangements?
Will all Field RWill all Field RWill all Field RWill all Field Readiness Criteria have been practically met prior to eadiness Criteria have been practically met prior to eadiness Criteria have been practically met prior to eadiness Criteria have been practically met prior to training rolltraining rolltraining rolltraining roll----out?out?out?out?
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
SYSTEMS READINESSSYSTEMS READINESSSYSTEMS READINESSSYSTEMS READINESS Action RequiredAction RequiredAction RequiredAction Required WhenWhenWhenWhen CompletedCompletedCompletedCompleted
Information & Communications Technology (ICT)Information & Communications Technology (ICT)Information & Communications Technology (ICT)Information & Communications Technology (ICT)
Is the auditing and metering tool configuredIs the auditing and metering tool configuredIs the auditing and metering tool configuredIs the auditing and metering tool configured????
ContentContentContentContent Action RequiredAction RequiredAction RequiredAction Required WheWheWheWhennnn CompletedCompletedCompletedCompleted
Have the approved procedures/policies been Have the approved procedures/policies been Have the approved procedures/policies been Have the approved procedures/policies been published?published?published?published?
Do the proposed users have access to appropriate documentation?Do the proposed users have access to appropriate documentation?Do the proposed users have access to appropriate documentation?Do the proposed users have access to appropriate documentation?
Business ApplicationBusiness ApplicationBusiness ApplicationBusiness Application
Is there a software application relevant to this deliverable?Is there a software application relevant to this deliverable?Is there a software application relevant to this deliverable?Is there a software application relevant to this deliverable?
Is there a support model fIs there a support model fIs there a support model fIs there a support model for this application and are the details or this application and are the details or this application and are the details or this application and are the details available for distribution?available for distribution?available for distribution?available for distribution?
Has Has Has Has the relevant IT business unit the relevant IT business unit the relevant IT business unit the relevant IT business unit been notified of installation and been notified of installation and been notified of installation and been notified of installation and support requirements?support requirements?support requirements?support requirements?
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
Risk Assessment MatrixRisk Assessment MatrixRisk Assessment MatrixRisk Assessment Matrix AAAAttachment 2ttachment 2ttachment 2ttachment 2
LIKELIHOODLIKELIHOODLIKELIHOODLIKELIHOOD
CONSEQUENCESCONSEQUENCESCONSEQUENCESCONSEQUENCES
11111111
IIIIIIIInnnnnnnnssssssssiiiiiiiiggggggggnnnnnnnniiiiiiiiffffffffiiiiiiiiccccccccaaaaaaaannnnnnnntttttttt 22222222
MMMMMMMMiiiiiiiinnnnnnnnoooooooorrrrrrrr 33333333
MMMMMMMMooooooooddddddddeeeeeeeerrrrrrrraaaaaaaatttttttteeeeeeee 4444
MajorMajorMajorMajor
5555
CatastrophicCatastrophicCatastrophicCatastrophic
AAAAAAAA
AAAAAAAAllllllllmmmmmmmmoooooooosssssssstttttttt CCCCCCCCeeeeeeeerrrrrrrrttttttttaaaaaaaaiiiiiiiinnnnnnnn MediumMediumMediumMedium HHHHHHHHiiiiiiiigggggggghhhhhhhh HHHHHHHHiiiiiiiigggggggghhhhhhhh VVVVVVVVeeeeeeeerrrrrrrryyyyyyyy HHHHHHHHiiiiiiiigggggggghhhhhhhh VVVVVVVVeeeeeeeerrrrrrrryyyyyyyy HHHHHHHHiiiiiiiigggggggghhhhhhhh
BBBBBBBB
LLLLLLLLiiiiiiiikkkkkkkkeeeeeeeellllllllyyyyyyyy MediumMediumMediumMedium MediumMediumMediumMedium HHHHHHHHiiiiiiiigggggggghhhhhhhh HHHHHHHHiiiiiiiigggggggghhhhhhhh VVVVVVVVeeeeeeeerrrrrrrryyyyyyyy HHHHHHHHiiiiiiiigggggggghhhhhhhh
CCCCCCCC
PPPPPPPPoooooooossssssssssssssssiiiiiiiibbbbbbbblllllllleeeeeeee LowLowLowLow MediumMediumMediumMedium HHHHHHHHiiiiiiiigggggggghhhhhhhh HHHHHHHHiiiiiiiigggggggghhhhhhhh HHHHHHHHiiiiiiiigggggggghhhhhhhh
DDDDDDDD
UUUUUUUUnnnnnnnnlllllllliiiiiiiikkkkkkkkeeeeeeeellllllllyyyyyyyy LowLowLowLow LowLowLowLow MediumMediumMediumMedium MediumMediumMediumMedium HHHHHHHHiiiiiiiigggggggghhhhhhhh
EEEEEEEE
RRRRRRRRaaaaaaaarrrrrrrreeeeeeee LowLowLowLow LowLowLowLow MediumMediumMediumMedium MediumMediumMediumMedium HHHHHHHHiiiiiiiigggggggghhhhhhhh
RRRRRRRRiiiiiiiisssssssskkkkkkkk iiiiiiiissssssss aaaaaaaasssssssssssssssseeeeeeeesssssssssssssssseeeeeeeedddddddd aaaaaaaassssssss lllllllloooooooowwwwwwww,,,,,,,, mmmmmmmmeeeeeeeeddddddddiiiiiiiiuuuuuuuummmmmmmm,,,,,,,, hhhhhhhhiiiiiiiigggggggghhhhhhhh,,,,,,,, oooooooorrrrrrrr vvvvvvvveeeeeeeerrrrrrrryyyyyyyy hhhhhhhhiiiiiiiigggggggghhhhhhhh,,,,,,,, ddddddddeeeeeeeeppppppppeeeeeeeennnnnnnnddddddddiiiiiiiinnnnnnnngggggggg oooooooonnnnnnnn tttttttthhhhhhhheeeeeeee lllllllliiiiiiiikkkkkkkkeeeeeeeelllllllliiiiiiiihhhhhhhhoooooooooooooooodddddddd ooooooooffffffff tttttttthhhhhhhheeeeeeee rrrrrrrriiiiiiiisssssssskkkkkkkk lllllllleeeeeeeeaaaaaaaaddddddddiiiiiiiinnnnnnnngggggggg ttttttttoooooooo ddddddddaaaaaaaammmmmmmmaaaaaaaaggggggggeeeeeeee aaaaaaaannnnnnnndddddddd tttttttthhhhhhhheeeeeeee ppppppppooooooootttttttteeeeeeeennnnnnnnttttttttiiiiiiiiaaaaaaaallllllll ccccccccoooooooonnnnnnnnsssssssseeeeeeeeqqqqqqqquuuuuuuueeeeeeeennnnnnnncccccccceeeeeeeessssssss ooooooooffffffff tttttttthhhhhhhheeeeeeee ddddddddaaaaaaaammmmmmmmaaaaaaaaggggggggeeeeeeee........ TTTTTTTThhhhhhhheeeeeeee ffffffffoooooooolllllllllllllllloooooooowwwwwwwwiiiiiiiinnnnnnnngggggggg cccccccchhhhhhhhaaaaaaaarrrrrrrrtttttttt tttttttteeeeeeeellllllllllllllllssssssss uuuuuuuussssssss tttttttthhhhhhhhaaaaaaaatttttttt wwwwwwwwhhhhhhhheeeeeeeennnnnnnn aaaaaaaa rrrrrrrriiiiiiiisssssssskkkkkkkk iiiiiiiissssssss aaaaaaaasssssssssssssssseeeeeeeesssssssssssssssseeeeeeeedddddddd aaaaaaaassssssss HHHHHHHHiiiiiiiigggggggghhhhhhhh wwwwwwwweeeeeeee nnnnnnnneeeeeeeeeeeeeeeedddddddd ttttttttoooooooo ddddddddoooooooo ssssssssoooooooommmmmmmmeeeeeeeetttttttthhhhhhhhiiiiiiiinnnnnnnngggggggg aaaaaaaabbbbbbbboooooooouuuuuuuutttttttt iiiiiiiitttttttt iiiiiiiimmmmmmmmmmmmmmmmeeeeeeeeddddddddiiiiiiiiaaaaaaaatttttttteeeeeeeellllllllyyyyyyyy........
Very high RiskVery high RiskVery high RiskVery high Risk
High RiskHigh RiskHigh RiskHigh Risk Do something to control the risk immediatelyDo something to control the risk immediatelyDo something to control the risk immediatelyDo something to control the risk immediately
Medium RiskMedium RiskMedium RiskMedium Risk Do something about these risksDo something about these risksDo something about these risksDo something about these risks
Low RiskLow RiskLow RiskLow Risk These risks do not need immediate attentionThese risks do not need immediate attentionThese risks do not need immediate attentionThese risks do not need immediate attention
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
Risk Assessment TableRisk Assessment TableRisk Assessment TableRisk Assessment Table
Risk No.Risk No.Risk No.Risk No. Date of risk Date of risk Date of risk Date of risk occurringoccurringoccurringoccurring
Brief description of Brief description of Brief description of Brief description of riskriskriskrisk LowLowLowLow MediumMediumMediumMedium HighHighHighHigh Mitigation actionMitigation actionMitigation actionMitigation action Approval of Approval of Approval of Approval of
commencementcommencementcommencementcommencement Date of Date of Date of Date of
commencementcommencementcommencementcommencement
Identify the risk and assess the significance and likelihood of it occurring and plan the contingency.
� What risks may occur upfront?
� Identify the key concepts that may arise along the way.
Identify the risk and assess the significance and likelihood of it occurring and plan the contingency.
� What risks may occur upfront?
� Identify the key concepts that may arise along the way.
Identify the risk and assess the significance and likelihood of it occurring and plan the contingency.
� What risks may occur upfront?
� Identify the key concepts that may arise along the way.
Identify the risk and assess the significance and likelihood of it occurring and plan the contingency.
� What risks may occur upfront?
� Identify the key concepts that may arise along the way.
Change Implementation PlanChange Implementation PlanChange Implementation PlanChange Implementation Plan
Resistance Assessment SurveyResistance Assessment SurveyResistance Assessment SurveyResistance Assessment Survey AAAAttachment 3ttachment 3ttachment 3ttachment 3 BBBBBBBBeeeeeeeelllllllloooooooowwwwwwww iiiiiiiissssssss aaaaaaaa lllllllliiiiiiiisssssssstttttttt ooooooooffffffff ppppppppooooooootttttttteeeeeeeennnnnnnnttttttttiiiiiiiiaaaaaaaallllllll aaaaaaaarrrrrrrreeeeeeeeaaaaaaaassssssss ffffffffoooooooorrrrrrrr rrrrrrrreeeeeeeessssssssiiiiiiiissssssssttttttttaaaaaaaannnnnnnncccccccceeeeeeee tttttttthhhhhhhhaaaaaaaatttttttt yyyyyyyyoooooooouuuuuuuu mmmmmmmmaaaaaaaayyyyyyyybbbbbbbbeeeeeeee eeeeeeeexxxxxxxxppppppppeeeeeeeerrrrrrrriiiiiiiieeeeeeeennnnnnnncccccccciiiiiiiinnnnnnnngggggggg iiiiiiiinnnnnnnn tttttttthhhhhhhheeeeeeee iiiiiiiimmmmmmmmpppppppplllllllleeeeeeeemmmmmmmmeeeeeeeennnnnnnnttttttttaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn ooooooooffffffff tttttttthhhhhhhheeeeeeee SSSSSSSSLLLLLLLLMMMMMMMM pppppppprrrrrrrroooooooojjjjjjjjeeeeeeeecccccccctttttttt........ FFFFFFFFoooooooorrrrrrrr eeeeeeeeaaaaaaaacccccccchhhhhhhh aaaaaaaarrrrrrrreeeeeeeeaaaaaaaa iiiiiiiinnnnnnnnddddddddiiiiiiiiccccccccaaaaaaaatttttttteeeeeeee tttttttthhhhhhhheeeeeeee ddddddddeeeeeeeeggggggggrrrrrrrreeeeeeeeeeeeeeee ttttttttoooooooo wwwwwwwwhhhhhhhhiiiiiiiicccccccchhhhhhhh yyyyyyyyoooooooouuuuuuuu aaaaaaaaggggggggrrrrrrrreeeeeeeeeeeeeeee oooooooorrrrrrrr ddddddddiiiiiiiissssssssaaaaaaaaggggggggrrrrrrrreeeeeeeeeeeeeeee bbbbbbbbyyyyyyyy ppppppppllllllllaaaaaaaacccccccciiiiiiiinnnnnnnngggggggg yyyyyyyyoooooooouuuuuuuurrrrrrrr rrrrrrrreeeeeeeessssssssppppppppoooooooonnnnnnnnsssssssseeeeeeee iiiiiiiinnnnnnnn tttttttthhhhhhhheeeeeeee bbbbbbbbooooooooxxxxxxxx ffffffffrrrrrrrroooooooommmmmmmm tttttttthhhhhhhheeeeeeee ffffffffoooooooolllllllllllllllloooooooowwwwwwwwiiiiiiiinnnnnnnngggggggg ssssssssccccccccaaaaaaaalllllllleeeeeeee........
1 (Strongly disagree)1 (Strongly disagree)1 (Strongly disagree)1 (Strongly disagree) 2 (Disagree)2 (Disagree)2 (Disagree)2 (Disagree) 3 (Neither agree or disagree3 (Neither agree or disagree3 (Neither agree or disagree3 (Neither agree or disagree)))) 4 (Agree)4 (Agree)4 (Agree)4 (Agree) 5 (Strongly agree)5 (Strongly agree)5 (Strongly agree)5 (Strongly agree)
AAAAAAAAsssssssssssssssseeeeeeeessssssssssssssss tttttttthhhhhhhheeeeeeee ssssssssccccccccoooooooorrrrrrrreeeeeeeessssssss iiiiiiiinnnnnnnnddddddddiiiiiiiivvvvvvvviiiiiiiidddddddduuuuuuuuaaaaaaaallllllllllllllllyyyyyyyy aaaaaaaannnnnnnndddddddd hhhhhhhhiiiiiiiigggggggghhhhhhhhlllllllliiiiiiiigggggggghhhhhhhhtttttttt aaaaaaaannnnnnnnyyyyyyyy ssssssssccccccccoooooooorrrrrrrreeeeeeeessssssss tttttttthhhhhhhhaaaaaaaatttttttt aaaaaaaarrrrrrrreeeeeeee ggggggggrrrrrrrreeeeeeeeaaaaaaaatttttttteeeeeeeerrrrrrrr tttttttthhhhhhhhaaaaaaaannnnnnnn tttttttthhhhhhhhrrrrrrrreeeeeeeeeeeeeeee........ TTTTTTTThhhhhhhhiiiiiiiissssssss aaaaaaaarrrrrrrreeeeeeeeaaaaaaaa sssssssshhhhhhhhoooooooouuuuuuuulllllllldddddddd tttttttthhhhhhhheeeeeeeennnnnnnn bbbbbbbbeeeeeeeeccccccccoooooooommmmmmmmeeeeeeee yyyyyyyyoooooooouuuuuuuurrrrrrrr pppppppprrrrrrrriiiiiiiimmmmmmmmaaaaaaaarrrrrrrryyyyyyyy ffffffffooooooooccccccccuuuuuuuussssssss ffffffffoooooooorrrrrrrr tttttttthhhhhhhheeeeeeee ggggggggrrrrrrrreeeeeeeeaaaaaaaatttttttteeeeeeeesssssssstttttttt rrrrrrrreeeeeeeessssssssiiiiiiiissssssssttttttttaaaaaaaannnnnnnncccccccceeeeeeee ttttttttoooooooo yyyyyyyyoooooooouuuuuuuurrrrrrrr pppppppprrrrrrrroooooooojjjjjjjjeeeeeeeecccccccctttttttt........
AreasAreasAreasAreas of Resistanceof Resistanceof Resistanceof Resistance DescriptionDescriptionDescriptionDescription RatingRatingRatingRating
1.1.1.1. Lack of uLack of uLack of uLack of understanding of the purpose nderstanding of the purpose nderstanding of the purpose nderstanding of the purpose and drivers for the changesand drivers for the changesand drivers for the changesand drivers for the changes....
There maybe a lack of understanding ofThere maybe a lack of understanding ofThere maybe a lack of understanding ofThere maybe a lack of understanding of the purpose of the project.the purpose of the project.the purpose of the project.the purpose of the project.
There maybe lack of awareness of the need for the change to occur.There maybe lack of awareness of the need for the change to occur.There maybe lack of awareness of the need for the change to occur.There maybe lack of awareness of the need for the change to occur.
2.2.2.2. Feeling of lFeeling of lFeeling of lFeeling of lososososinginginging controlcontrolcontrolcontrol People support what they have helped to create. If they feel they have not had sufficient input, resistance usually People support what they have helped to create. If they feel they have not had sufficient input, resistance usually People support what they have helped to create. If they feel they have not had sufficient input, resistance usually People support what they have helped to create. If they feel they have not had sufficient input, resistance usually increases.increases.increases.increases.
3.3.3.3. LacLacLacLack of support from various levels in k of support from various levels in k of support from various levels in k of support from various levels in the organisation.the organisation.the organisation.the organisation.
If people perceive that key individuals or groups in their area are not genuinely supportive of the project, their If people perceive that key individuals or groups in their area are not genuinely supportive of the project, their If people perceive that key individuals or groups in their area are not genuinely supportive of the project, their If people perceive that key individuals or groups in their area are not genuinely supportive of the project, their acceptance is difficult to secureacceptance is difficult to secureacceptance is difficult to secureacceptance is difficult to secure
4.4.4.4. Feel there is a rFeel there is a rFeel there is a rFeel there is a real threat toeal threat toeal threat toeal threat to mymymymy existing existing existing existing power, jpower, jpower, jpower, job security or personal and ob security or personal and ob security or personal and ob security or personal and career goals.career goals.career goals.career goals.
Resistance is increased if people believe the change will result greater emotional or career costs relative to what they Resistance is increased if people believe the change will result greater emotional or career costs relative to what they Resistance is increased if people believe the change will result greater emotional or career costs relative to what they Resistance is increased if people believe the change will result greater emotional or career costs relative to what they may gain.may gain.may gain.may gain.
5.5.5.5. Concerns about Concerns about Concerns about Concerns about a lack of a lack of a lack of a lack of skills and skills and skills and skills and knowledgeknowledgeknowledgeknowledge
People may resist change if they bePeople may resist change if they bePeople may resist change if they bePeople may resist change if they believe they do not possess the skills or the ability for optimal performance during and lieve they do not possess the skills or the ability for optimal performance during and lieve they do not possess the skills or the ability for optimal performance during and lieve they do not possess the skills or the ability for optimal performance during and after the change.after the change.after the change.after the change.
6.6.6.6. High level of iHigh level of iHigh level of iHigh level of impact on daily work mpact on daily work mpact on daily work mpact on daily work patternspatternspatternspatterns
Failure to acknowledge and if possible, minimise the impact of project teams activities and changes on peFailure to acknowledge and if possible, minimise the impact of project teams activities and changes on peFailure to acknowledge and if possible, minimise the impact of project teams activities and changes on peFailure to acknowledge and if possible, minimise the impact of project teams activities and changes on peoples work oples work oples work oples work patterns tends to promote distrust and alienation.patterns tends to promote distrust and alienation.patterns tends to promote distrust and alienation.patterns tends to promote distrust and alienation.
7.7.7.7. Lack of time to absorb the changesLack of time to absorb the changesLack of time to absorb the changesLack of time to absorb the changes The ability of staff to assimilate the change and all its consequences must be assessed.The ability of staff to assimilate the change and all its consequences must be assessed.The ability of staff to assimilate the change and all its consequences must be assessed.The ability of staff to assimilate the change and all its consequences must be assessed.
8.8.8.8. High level of High level of High level of High level of uncertaintyuncertaintyuncertaintyuncertainty Sometimes just the uncertainness of the Sometimes just the uncertainness of the Sometimes just the uncertainness of the Sometimes just the uncertainness of the situation can make people react negatively.situation can make people react negatively.situation can make people react negatively.situation can make people react negatively.
9.9.9.9. Adverse cAdverse cAdverse cAdverse changes to key workhanges to key workhanges to key workhanges to key workinginginging relationshipsrelationshipsrelationshipsrelationships
Adversely affecting the way they relate to others or who they work withAdversely affecting the way they relate to others or who they work withAdversely affecting the way they relate to others or who they work withAdversely affecting the way they relate to others or who they work with or who they report toor who they report toor who they report toor who they report to....
10.10.10.10. High level of pHigh level of pHigh level of pHigh level of past resentments and ast resentments and ast resentments and ast resentments and dislikesdislikesdislikesdislikes
People may distrust or dPeople may distrust or dPeople may distrust or dPeople may distrust or dislike sponsors or change agents or have had negative experiences around change a lack of islike sponsors or change agents or have had negative experiences around change a lack of islike sponsors or change agents or have had negative experiences around change a lack of islike sponsors or change agents or have had negative experiences around change a lack of acceptance and enthusiasm for the change will quickly materialise.acceptance and enthusiasm for the change will quickly materialise.acceptance and enthusiasm for the change will quickly materialise.acceptance and enthusiasm for the change will quickly materialise.
11.11.11.11. Lack of incentives and rewardsLack of incentives and rewardsLack of incentives and rewardsLack of incentives and rewards
Change involves learning and learning usually involves errors. WheChange involves learning and learning usually involves errors. WheChange involves learning and learning usually involves errors. WheChange involves learning and learning usually involves errors. When people are not given the freedom to make n people are not given the freedom to make n people are not given the freedom to make n people are not given the freedom to make mistakes while learning they become afraid.mistakes while learning they become afraid.mistakes while learning they become afraid.mistakes while learning they become afraid.
People need to be rewarded for accomplishing the change in the form of something they truly value.People need to be rewarded for accomplishing the change in the form of something they truly value.People need to be rewarded for accomplishing the change in the form of something they truly value.People need to be rewarded for accomplishing the change in the form of something they truly value.
CHANGE MANAGEMENT PLANCHANGE MANAGEMENT PLANCHANGE MANAGEMENT PLANCHANGE MANAGEMENT PLAN TEMPLATETEMPLATETEMPLATETEMPLATE
AAAAGENCY AND GENCY AND GENCY AND GENCY AND PPPPROJECT ROJECT ROJECT ROJECT DDDDETAILSETAILSETAILSETAILS
AAAAAAAAggggggggeeeeeeeennnnnnnnccccccccyyyyyyyy NNNNNNNNaaaaaaaammmmmmmmeeeeeeee ((((((((FFFFFFFFuuuuuuuullllllllllllllll))))))))::::::::
PPPPPPPPrrrrrrrroooooooojjjjjjjjeeeeeeeecccccccctttttttt NNNNNNNNaaaaaaaammmmmmmmeeeeeeee::::::::
AAAAGENCY GENCY GENCY GENCY PPPPROJECT ROJECT ROJECT ROJECT CCCCONTACT ONTACT ONTACT ONTACT DDDDETAILSETAILSETAILSETAILS::::
Project ManagerProject ManagerProject ManagerProject Manager Full Name:Full Name:Full Name:Full Name:
Title:Title:Title:Title:
Business DiBusiness DiBusiness DiBusiness Division:vision:vision:vision:
Street Address:Street Address:Street Address:Street Address:
Postal Address:Postal Address:Postal Address:Postal Address: State:State:State:State: QLD Postcode:Postcode:Postcode:Postcode:
Email Address:Email Address:Email Address:Email Address:
Telephone Number:Telephone Number:Telephone Number:Telephone Number: Fax Number:Fax Number:Fax Number:Fax Number:
PPPPROJECT ROJECT ROJECT ROJECT PPPPHASEHASEHASEHASE::::
PPPPPPPPrrrrrrrroooooooojjjjjjjjeeeeeeeecccccccctttttttt EEEEEEEEnnnnnnnnddddddddoooooooorrrrrrrrsssssssseeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt Recommended byRecommended byRecommended byRecommended by PPPPPPPPrrrrrrrroooooooojjjjjjjjeeeeeeeecccccccctttttttt MMMMMMMMaaaaaaaannnnnnnnaaaaaaaaggggggggeeeeeeeerrrrrrrr SSSSSSSSiiiiiiiiggggggggnnnnnnnnaaaaaaaattttttttuuuuuuuurrrrrrrreeeeeeee:::::::: DDDDDDDDaaaaaaaatttttttteeeeeeee
NameNameNameName: : : : Project Manager 00 / 00 / 00
Document Accepted byDocument Accepted byDocument Accepted byDocument Accepted by PPPPPPPPrrrrrrrroooooooojjjjjjjjeeeeeeeecccccccctttttttt SSSSSSSSppppppppoooooooonnnnnnnnssssssssoooooooorrrrrrrr SSSSSSSSiiiiiiiiggggggggnnnnnnnnaaaaaaaattttttttuuuuuuuurrrrrrrreeeeeeee:::::::: DDDDDDDDaaaaaaaatttttttteeeeeeee
NameNameNameName: : : : Project Sponsor 00 / 00 / 00
Document Accepted byDocument Accepted byDocument Accepted byDocument Accepted by PPPPPPPPrrrrrrrroooooooojjjjjjjjeeeeeeeecccccccctttttttt CCCCCCCCuuuuuuuussssssssttttttttoooooooommmmmmmmeeeeeeeerrrrrrrr SSSSSSSSiiiiiiiiggggggggnnnnnnnnaaaaaaaattttttttuuuuuuuurrrrrrrreeeeeeee:::::::: DDDDDDDDaaaaaaaatttttttteeeeeeee
NameNameNameName: : : : Project Customer 00 / 00 / 00
RRRRRRRReeeeeeeevvvvvvvviiiiiiiissssssssiiiiiiiioooooooonnnnnnnn HHHHHHHHiiiiiiiissssssssttttttttoooooooorrrrrrrryyyyyyyy VVVVVVVVeeeeeeeerrrrrrrrssssssssiiiiiiiioooooooonnnnnnnn NNNNNNNNoooooooo DDDDDDDDaaaaaaaatttttttteeeeeeee AAAAAAAAuuuuuuuutttttttthhhhhhhhoooooooorrrrrrrr SSSSSSSSttttttttaaaaaaaattttttttuuuuuuuussssssss RRRRRRRReeeeeeeevvvvvvvviiiiiiiieeeeeeeewwwwwwwweeeeeeeerrrrrrrrssssssss
(add additional rows if required)(add additional rows if required)(add additional rows if required)(add additional rows if required) 1111 00 / 00 / 00 Name Eg: Initial Draft for review Name(s)
2222 00 / 00 / 00 Name Eg: Initial Draft for review Name(s)
KKKKKKKKeeeeeeeeyyyyyyyy SSSSSSSSttttttttaaaaaaaakkkkkkkkeeeeeeeehhhhhhhhoooooooollllllllddddddddeeeeeeeerrrrrrrr EEEEEEEEnnnnnnnnddddddddoooooooorrrrrrrrsssssssseeeeeeeemmmmmmmmeeeeeeeennnnnnnntttttttt
PPPPPPPPoooooooossssssssiiiiiiiittttttttiiiiiiiioooooooonnnnnnnn NNNNNNNNaaaaaaaammmmmmmmeeeeeeee SSSSSSSSiiiiiiiiggggggggnnnnnnnnaaaaaaaattttttttuuuuuuuurrrrrrrreeeeeeee DDDDDDDDaaaaaaaatttttttteeeeeeee
Example: Process or Business Owner
Executive Director / Director 00 / 00 / 00
Example: Information Policy and Planning
Director / Manager 00 / 00 / 00
Example: Learning & Development/Training
Director / Manager 00 / 00 / 00
Example: Communications Project Communications Co-ordinator
00 / 00 / 00
Example: Organisational Development
Director 00 / 00 / 00
CCCCCCCChhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee PPPPPPPPrrrrrrrroooooooojjjjjjjjeeeeeeeecccccccctttttttt TTTTTTTTeeeeeeeeaaaaaaaammmmmmmm NNNNNNNNaaaaaaaammmmmmmmeeeeeeee RRRRRRRRoooooooolllllllleeeeeeee iiiiiiiinnnnnnnn TTTTTTTTeeeeeeeeaaaaaaaammmmmmmm NNNNNNNNaaaaaaaammmmmmmmeeeeeeee ooooooooffffffff BBBBBBBBuuuuuuuussssssssiiiiiiiinnnnnnnneeeeeeeessssssssssssssss UUUUUUUUnnnnnnnniiiiiiiitttttttt ooooooooffffffff MMMMMMMMeeeeeeeemmmmmmmmbbbbbbbbeeeeeeeerrrrrrrrssssssss
(add additional rows if required)(add additional rows if required)(add additional rows if required)(add additional rows if required) Example: John Doe Project Manager
Example: Maryanne West Change Champion
Example: Paul Smyth Communications Officer
1.1.1.1. CCCCHANGE HANGE HANGE HANGE IIIIDENTIFICATIONDENTIFICATIONDENTIFICATIONDENTIFICATION
11111111........11111111 TTTTTTTTyyyyyyyyppppppppeeeeeeee ooooooooffffffff CCCCCCCChhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee ((((((((PPPPPPPPlllllllleeeeeeeeaaaaaaaasssssssseeeeeeee ttttttttiiiiiiiicccccccckkkkkkkk oooooooorrrrrrrr cccccccchhhhhhhheeeeeeeecccccccckkkkkkkk))))))))
Policy Change Process Change Scale of the change - large or small
Speed of change -fast or slow Job roles System change Other:
11111111........22222222 RRRRRRRReeeeeeeeaaaaaaaassssssssoooooooonnnnnnnn ffffffffoooooooorrrrrrrr tttttttthhhhhhhheeeeeeee CCCCCCCChhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee Describe the reason for the change – example: Business benefit
11111111........33333333 CCCCCCCChhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee SSSSSSSSccccccccooooooooppppppppeeeeeeee ((((((((PPPPPPPPlllllllleeeeeeeeaaaaaaaasssssssseeeeeeee ttttttttiiiiiiiicccccccckkkkkkkk oooooooorrrrrrrr cccccccchhhhhhhheeeeeeeecccccccckkkkkkkk))))))))
Department Work Groups Business Units Division
People Systems Other:
Change of Scope Details:Change of Scope Details:Change of Scope Details:Change of Scope Details: Describe who in the business it includes? How far reaching in the organisation is the change?
Is it the same for each of the business units?
11111111........44444444 CCCCCCCCuuuuuuuurrrrrrrrrrrrrrrreeeeeeeennnnnnnntttttttt SSSSSSSSttttttttaaaaaaaattttttttuuuuuuuussssssss Where are you now? Describe the situation in the organisation currently.
Describe the problem.
What is the cause?
Define the context and challenges surrounding your initiative.
11111111........55555555 FFFFFFFFuuuuuuuuttttttttuuuuuuuurrrrrrrreeeeeeee SSSSSSSSttttttttaaaaaaaattttttttuuuuuuuussssssss Where do you want to be? Describe what the future state will bring.
Describe what it will feel like.
Describe what it will look like.
Describe what you will see people doing/saying.
Describe what will be done differently.
Describe what roles will be affected in the organisation and how.
Describe what will improve.
2.2.2.2. CCCCHANGE HANGE HANGE HANGE SSSSPECIFICATIONSPECIFICATIONSPECIFICATIONSPECIFICATIONS
22222222........11111111 CCCCCCCChhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee TTTTTTTTaaaaaaaaccccccccttttttttiiiiiiiicccccccc How will you get there? There will be a number of areas in the organisation that will be impacted on as a result of this change and each area needs to be given consideration.
RationalRationalRationalRational
� Do you need a new organisation structure?
� Do you need new systems?
� Will you need new processes?
NonNonNonNon----rationalrationalrationalrational
� What relationships will change?
� Will the culture embrace or reject this change?
� How will the stakeholders share information and transfer knowledge?
SLM CM_Org Change Readiness Checklist_Attachment 1.doc
22222222........22222222 PPPPPPPPrrrrrrrroooooooocccccccceeeeeeeessssssssssssssss CCCCCCCChhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee Process changes tend to be more complex so you may want to consider the following questions to add more clarity.
� Does this change represent a completely new process for the organisation, or a different application of an existing process?
� What are the major changes to processes? (You may need to ‘break this down’ into discrete components to allow tangible descriptions.)
� What is going to be done differently? (You may need to ‘break this down’ into discrete components to allow tangible descriptions.)
22222222........33333333 PPPPPPPPeeeeeeeeoooooooopppppppplllllllleeeeeeee CCCCCCCChhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee In the process of making this change there may be an affect on people’s job roles and responsibilities. Change will invariably confront many relationships especially those that require a set of new behaviours.
� What roles within the organisation are affected, and how?
� What pre-requisite knowledge or training is required?
� What work practices will be affected?
� Is there a need for new relationships to be built? (third party)
� What new behaviours are required?
22222222........44444444 IIIIIIIInnnnnnnnffffffffoooooooorrrrrrrrmmmmmmmmaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn SSSSSSSShhhhhhhhaaaaaaaarrrrrrrriiiiiiiinnnnnnnngggggggg Throughout the process of change information will be distributed and interpreted by staff in many different ways. It is this process that will be important in managing expectations and dealing with the rumour mill.
� What policies and procedures need to be changed?
� What are current methods of sharing information and does there need to be new ones developed?
22222222........55555555 CCCCCCCCoooooooosssssssstttttttt ooooooooffffffff CCCCCCCChhhhhhhhaaaaaaaannnnnnnnggggggggeeeeeeee Understanding the real cost to the organisation in implementing a change initiative is one way of overcoming key barriers to successful change. Gaining the right level of resourcing is important and should be considered
upfront.
� What would an estimate of the total cost of the activities required to carry out the change initiative?
� Where will the funds come from?
� Has this been negotiated with the customer and sponsor?
22222222........66666666aaaaaaaa RRRRRRRRiiiiiiiisssssssskkkkkkkk AAAAAAAAsssssssssssssssseeeeeeeessssssssssssssssmmmmmmmmeeeeeeeennnnnnnntttttttt Attachment 2 Attachment 2 Attachment 2 Attachment 2 –––– Risk Assessment Matrix and Table Risk Assessment Matrix and Table Risk Assessment Matrix and Table Risk Assessment Matrix and Table –––– completed and attached.completed and attached.completed and attached.completed and attached.
22222222........66666666bbbbbbbb RRRRRRRRiiiiiiiisssssssskkkkkkkk AAAAAAAAsssssssssssssssseeeeeeeessssssssssssssssmmmmmmmmeeeeeeeennnnnnnntttttttt LowLowLowLow MediumMediumMediumMedium HighHighHighHigh Mitigation ActioMitigation ActioMitigation ActioMitigation Actionnnn Brief Description of RiskBrief Description of RiskBrief Description of RiskBrief Description of Risk
SLM CM_Risk Assessment Matrix_Attachment 2.doc
Risk No.Risk No.Risk No.Risk No. Date Risk OccurredDate Risk OccurredDate Risk OccurredDate Risk Occurred Date of CommencementDate of CommencementDate of CommencementDate of Commencement Identify the risk and assess the significance and likelihood of it occurring and plan the contingency.
� What risks may occur upfront?
� Identify the key concepts that may arise along the way.
00 / 00 / 00 00 / 00 / 00
Commencement ApprovalCommencement ApprovalCommencement ApprovalCommencement Approval::::
LowLowLowLow MediumMediumMediumMedium HighHighHighHigh Mitigation ActionMitigation ActionMitigation ActionMitigation Action Brief Description of RiskBrief Description of RiskBrief Description of RiskBrief Description of Risk
Risk No.Risk No.Risk No.Risk No. Date Risk Date Risk Date Risk Date Risk OccurredOccurredOccurredOccurred Date of CommencementDate of CommencementDate of CommencementDate of Commencement Identify the risk and assess the significance and likelihood of it occurring and plan the contingency.
� What risks may occur upfront?
� Identify the key concepts that may arise along the way.
00 / 00 / 00 00 / 00 / 00
CommeCommeCommeCommencement Approvalncement Approvalncement Approvalncement Approval::::
3.3.3.3. CCCCHANGE HANGE HANGE HANGE MMMMETHODOLOGYETHODOLOGYETHODOLOGYETHODOLOGY
33333333........11111111 SSSSSSSSttttttttaaaaaaaakkkkkkkkeeeeeeeehhhhhhhhoooooooollllllllddddddddeeeeeeeerrrrrrrr AAAAAAAAnnnnnnnnaaaaaaaallllllllyyyyyyyyssssssssiiiiiiiissssssss Identifying the levels of participation of stakeholders involved in the change process allows you to make sure that a wide variety of interests are taken into account. This assessment of the change at each of the participation levels will provide you with valuable information as to how stakeholders may react to the change as well as whether you need to engage the stakeholders – attracting and holding their understanding, buy-in, and advocacy.
� What are the specific target groups/audiences that will be impacted by this change?
� Who might be able to help us the most? (advocates, early adopters)
� Who might present the most resistance?
� Who will be the change levers? (drivers)
4.4.4.4. IIIIMPLEMENMPLEMENMPLEMENMPLEMENTATION TATION TATION TATION SSSSTRATEGIESTRATEGIESTRATEGIESTRATEGIES
44444444........11111111aaaaaaaa AAAAAAAAccccccccttttttttiiiiiiiioooooooonnnnnnnn PPPPPPPPllllllllaaaaaaaannnnnnnn ActivityActivityActivityActivity ResponsibilityResponsibilityResponsibilityResponsibility TimeframeTimeframeTimeframeTimeframe
((((ReReReRefer Appendix A)fer Appendix A)fer Appendix A)fer Appendix A)
SLM CM_Action Plan_Appendix A.doc
Activity to be rolled out Project responsibilities Roll-out timeframe
Activity to be rolled out Project responsibilities Roll-out timeframe
Activity to be rolled out Project responsibilities Roll-out timeframe
Activity to be rolled out Project responsibilities Roll-out timeframe
44444444........11111111bbbbbbbb SSSSSSSScccccccchhhhhhhheeeeeeeedddddddduuuuuuuulllllllleeeeeeee DDDDDDDDeeeeeeeettttttttaaaaaaaaiiiiiiiillllllllssssssss TaskTaskTaskTask DurationDurationDurationDuration Start DateStart DateStart DateStart Date End DateEnd DateEnd DateEnd Date ResourcesResourcesResourcesResources
((((ReReReRefer Appendix fer Appendix fer Appendix fer Appendix BBBB))))
SLM CM_Schedule of Activities_Appendix B.doc
Milestone OneMilestone OneMilestone OneMilestone One
ActivitiesActivitiesActivitiesActivities
Milestone TwoMilestone TwoMilestone TwoMilestone Two
ActivitiesActivitiesActivitiesActivities
44444444........22222222 CCCCCCCCoooooooommmmmmmmmmmmmmmmuuuuuuuunnnnnnnniiiiiiiiccccccccaaaaaaaattttttttiiiiiiiioooooooonnnnnnnn PPPPPPPPllllllllaaaaaaaannnnnnnn AudienceAudienceAudienceAudience Key MessagesKey MessagesKey MessagesKey Messages Delivery Delivery Delivery Delivery MethodMethodMethodMethod
DateDateDateDate Length of Session Length of Session Length of Session Length of Session (if applicable)(if applicable)(if applicable)(if applicable)
LocationLocationLocationLocation
((((ReReReRefer Appendix fer Appendix fer Appendix fer Appendix CCCC))))
SLM CM_Communication Plan_Appendix C.doc
Example:
Team Leaders Senior Managers
00 / 00 / 00
SSSSSSSSeeeeeeeennnnnnnnddddddddeeeeeeeerrrrrrrr Project ManagerProject ManagerProject ManagerProject Manager
Example: Staff Users
00 / 00 / 00
SSSSSSSSeeeeeeeennnnnnnnddddddddeeeeeeeerrrrrrrr SupervisorSupervisorSupervisorSupervisor
00 / 00 / 00
44444444........33333333 TTTTTTTTrrrrrrrraaaaaaaaiiiiiiiinnnnnnnniiiiiiiinnnnnnnngggggggg PPPPPPPPllllllllaaaaaaaannnnnnnn � Identify the current level of skills and knowledge and behaviours of the group that will be impacted on.
� What prerequisite knowledge do these groups need?
� What are the training strategies?
� Identify requirements for a training program.
� Who will do the training?
� Who will fund the training?
((((ReReReRefer Appendix fer Appendix fer Appendix fer Appendix DDDD))))
SLM CM_Training Plan_Appendix D.doc
Session ModulesSession ModulesSession ModulesSession Modules Learning OutcomesLearning OutcomesLearning OutcomesLearning Outcomes ObjectivesObjectivesObjectivesObjectives Length of Length of Length of Length of Training Training Training Training SessionSessionSessionSession
Target AudienceTarget AudienceTarget AudienceTarget Audience LocationLocationLocationLocation FacilitatorFacilitatorFacilitatorFacilitator
44444444........44444444 BBBBBBBBuuuuuuuussssssssiiiiiiiinnnnnnnneeeeeeeessssssssssssssss SSSSSSSSyyyyyyyysssssssstttttttteeeeeeeemmmmmmmmssssssss PPPPPPPPllllllllaaaaaaaannnnnnnn � Identify the hardware, software, network to be implemented for the change.
44444444........55555555 RRRRRRRReeeeeeeessssssssiiiiiiiissssssssttttttttaaaaaaaannnnnnnncccccccceeeeeeee PPPPPPPPllllllllaaaaaaaannnnnnnn Key areas of resistanceKey areas of resistanceKey areas of resistanceKey areas of resistance Actions to address resistanceActions to address resistanceActions to address resistanceActions to address resistance Responsible Responsible Responsible Responsible
PersonPersonPersonPerson
((((Refer Appendix ERefer Appendix ERefer Appendix ERefer Appendix E))))
SLM CM_Resistance Management Plan_Appendix E.doc
(Refer Attachment 3)(Refer Attachment 3)(Refer Attachment 3)(Refer Attachment 3)
SLM CM_Resistance Assessment Survey_Attachment 3.doc
Identify main cause of resistance
� Provide some ongoing coaching opportunities for the employee or manager that are resistant to the change.
� Communicate the consequences to staff if not supporting the change.
� Implement some consequences for not supporting the change.
Identify main cause of resistance
(see above or refer 4.5 in Workbook)
Identify main cause of resistance
(see above or refer 4.5 in Workbook)
Identify main cause of resistance
(see above or refer 4.5 in Workbook)
adventist Hospital_case_study.pdf
Change Readiness at Adventist Health System
How Organizational Culture Can Help Hospitals Implement
CPOE Successfully
Carlyle Walton, CEO of Metroplex Health System faced a difficult challenge. As the new CEO of
the 223-bed, multi-campus facility operated by Adventist Health System, Walton walked into an
organization that on the surface, was operating well, but underneath was characterized by silos,
mistrust and resistance. They were also about to embark on a hospital-wide project to implement
a Computerized Provider Order Entry (CPOE) system—a tough challenge for hospitals in the best of
circumstances. As a new CEO still trying to understand his new organization, Walton needed help
to get the hospital team through the transition successfully while continuing their mission to serve
their patients with excellence. Walter certainly had a lot to do. Thankfully, Dr. Philip Smith, MD,
Chief Medical Information Officer at Adventist Health System, and his team were there to help.
Organizational Culture and CPOE: A Process for Implementation
Philip A. Smith, MD, was the Vice President of Information Services and the Chief Medical
Information Officer for Adventist Health System at the time. One of Smith’s first directives in these
roles was to implement Computerized Provider Order Entry Systems (CPOE) in each of Adventist
Health System’s 38 hospitals.
The are several advantages of CPOE:
Reducing errors that can occur with handwritten orders
Improving safeguards for drug interactions and allergies
Reducing lag time between order and delivery to patient
Improving overall quality of the patient experience
Implementation of a CPOE system is not as easy as simply
installing a new program on the hospital’s computer system,
however. Many hospitals and health care facilities
underestimate the vast organizational changes required to
successfully implement this system. Challenges include: new
work for clinicians, changes in workflow, resistance and
negative feelings toward technology, changes in
communication patterns and practices, fear of an
overdependence on technology and a whole host of
adjustments to the organizational structure, culture and roles within the organization. “Most
hospitals are doing it backwards,” states Smith, “they aren’t looking at any kind of organizational
assessment along with the CPOE implementation and addressing the cultural aspects necessary to
make the engagement work. Those hospitals aren’t having the same kinds of successful
implementations that we are having.” To get it right, according to Smith, hospitals must look at the
way the organization works as a part of their CPOE implementation.
“I have found the Denison
Organizational Culture Survey
and the work that Dr. Smith and
his team have done to be
extremely beneficial to our
organization as a whole— I have
thanked Dr. Smith repeatedly for
introducing the process into our
organization because it’s a
whole lot more than
implementing CPOE.”
Carlyle Walton, CEO
Metroplex Health System
Smith and his team of three organizational specialists developed a
multi-faceted approach to implementing CPOE within the hospitals
of Adventist Health System with great success. Through their
Change Management Analysis, they worked with the hospitals to
identify and create changes necessary to make the organization
work effectively. Their approach started with an examination of the
hospital’s organizational culture in order to assess their readiness to
change. The Denison Organizational Culture Survey (DOCS) was
administered to a cross section of employees at each hospital,
which included a sample of the Executive Team, Management
and Medical Staff. Within the DOCS, Smith’s team asked some very
targeted open-ended questions including: “What part of your role
keeps you awake at night?” and “What line of service do you think
needs the most improvement?” They also conducted a series of
interviews with the groups to dig a little deeper into the current
context of the hospital.
The DOCS helped the hospital identify issues they may have had in
terms of communication, trust, mission and vision, customer service,
empowerment, training and development, and workflow
processes—important issues to identify when implementing a
change as far reaching as instituting CPOE. Smith and his team
conducted a half-day workshop with the leader and their team to
debrief the results; helping them understand what their current
organization looked like and what to expect.
In one case, the DOCS results helped reveal that the hospital staff
wasn’t feeling empowered. When Smith and the leadership team
dug deeper, they realized that this was a result of operational
decisions made years prior during a time of crisis that required a
supervisor’s approval for any decision. The hospital then reviewed
that process and realized it wasn’t working for them anymore; they
were able to put changes in place to rebuild trust and
empowerment in the staff. Another hospital group acknowledged
that communication at the leadership level was ineffective. Upon further review, Smith’s team recognized that
all meetings were done in a room that was set up like a classroom. A simple change to reconfigure the
physical setup of the room into a circle or U-shape helped promote active communication within the group.
These are two simple examples that show the effect unproductive beliefs can have on the behaviors of the
organization as a whole. These are important behaviors to address in the early stages to lay the groundwork
for a successful CPOE implementation.
During the course of the next 90 days, ten champions from the Vice President and Director levels were
identified from within the organization. The champions received training in areas such as communication,
workflow and measurement. They were tasked to work on specific issues identified within the culture survey
results in the context of the CPOE implementation. For example, if trust was an issue in the organization, Smith’s
team and the hospital team would tailor their strategies for the CPOE project with that in mind; giving the
champions the knowledge and training they needed to be successful.
Sample Change Readiness Timeline
Month 1
DOCS
Focus Groups
Month 2
Debriefing Leadership Team
Action Planning for Change Readiness
Month 3
Action Planning Implementation Begins
Month 4
Training for Champions in Key Areas of Action
Month 5
Town Hall Meetings on CPOE Communications to Staff
Month 6-7
Training for All Staff on CPOE
Month 8
Launch of CPOE System
This is a sample timeline for using the DOCS
based on the work of Dr. Smith and his
colleagues. This solution first assessed the
hospital’s change readiness and allowed
them to begin to make the necessary
changes to their organizational structure to
implement CPOE effectively.
For the next two months, town hall meetings were held with the hospital staff—from the doctors to the
maintenance staff—to explain CPOE and give them the opportunity to ask questions about the new system.
“Sneak Peek Stations” were set up throughout the hospital to allow personnel to look through the system.
Smith’s team and the champions also gave special focus to high-risk groups including specific doctor groups
and the billing department to give them the extra guidance and support to overcome any apprehension they
may have been feeling. Six weeks of training was then implemented before going live. From start to finish, the
process took about eight months to complete.
Why is Culture Important?
During the process, Smith and the leadership team reflected on the DOCS survey results in the context of other
information they had gathered about the hospital. Oftentimes, Smith had found, there was a very large
disconnect between how different groups saw the hospital. The survey was instrumental in helping them
uncover this. “It’s pretty incredible because when they had this information, they immediately became more
honest with us, it was almost magical,” stated Smith. “It helped us break down any resistance or barriers we
faced because they didn’t reject it. Instead, it really got the conversation going and established our credibility
as a team.” Many times, when looking at the leadership team’s Culture Survey results, the leaders had a very
strong opinions of themselves—in many cases, a full color profile. As you dug down deeper into other levels of
the organization, the color on the profile became much more sparse. Smith’s team used this to their
advantage: “The experience established for us that we knew the leadership team could play the game– they
knew how to take the surveys. We showed them the qualitative data such as the open-ended responses that
they couldn’t argue with and it established our credibility—allowing the façade to fade and real
conversations to take place,” says Smith.
“In many ways, this process was most important for the leadership team,” comments Smith. Helping the
leadership team create a solid business case for implementing CPOE enabled them to respond better when
they met resistance within the hospital. “I’ve seen other implementations where the executive team caves in
when the physicians are resistant,” says Smith, “it’s really hard to recover from that.” Hospitals can’t afford to
underestimate the organizational changes that arise with such an important implementation.
What Happens in Real Life?
No one knew this process and the effects that it had on a hospital organization better than Carlyle Walton.
Walton was privileged to go through this process with Smith not once, but twice: once at Takoma Regional
Hospital in Greeneville, Tennessee and again at Metroplex Health System in Killeen, Texas. In both instances,
the DOCS was utilized as a key tool to gauge the organization’s readiness for change.
Walton found Denison’s ability to segment the data based on different stakeholders to be a key advantage in
the process. Getting a pulse on the different groups and then
tailoring the plans for those groups that may be at risk was
critical for the hospitals at each of the sites. Walton also
immediately saw more to the process than CPOE, “it was clear
to me that the information relayed by the Denison results
transcended the CPOE implementation and we found the
DOCS to be an excellent tool to truly unmask the organization.
It forces you to look into the mirror relative to where you are as
an organization.”
“It was clear to me that the information
relayed by the Denison results transcended
the CPOE implementation”
Challenges at Metroplex Health System
Metroplex took the DOCS survey and completed the CPOE process eight months later. “Coming in as a new
CEO, the Denison survey and interview results presented by Smith and his team were extremely helpful and
also extremely painful, to be honest,” says Walton. The previous two years had been tumultuous for Metroplex.
They had merged with long-time competitor, Scott & White. Before the merger was final, news of the deal was
leaked inside Metroplex causing a major erosion of trust between the hospital staff and the administration. The
DOCS results highlighted the divide between the medical staff and the administration and brought to light a
detached perception held by the administration. Walton observed that the Culture Survey results showed that
the leadership team believed that they were highly committed to the Mission of the hospital but they had an
over-inflated opinion of their culture relative to how the rest of the hospital saw it. “When the results say
something you don’t like,” says Walton, “it’s easy to start asking questions about validity of the instrument or
look for excuses. We knew we had to get beyond that and clearly communicate to our team that it wasn’t
about good or bad but about our culture and how we see ourselves. We were telling ourselves through these
results that we needed to be consistent in what we do and how we function.” After the shock of the results, it
was clear to all that they needed to use the CPOE implementation process as an opportunity for
organizational transformation. The challenge was going to be in communicating the results clearly and in
creating actionable plans.
Leadership and Medical Staff Perceptions of Culture at Metroplex Health System
Leadership Team Medical Staff
These circumplexes show the stark divergence between the perceptions of the leadership team at
Metroplex Health System and those of the medical staff regarding the organization’s culture. Philip Smith,
MD. CMIO, and his team from Adventist Health System used these results along with their interviews and
other qualitative data to open up some honest conversations with leaders at the hospital. These culture
results shed light on important issues in empowerment, communication, accountability and trust that were
critical to address in order to ensure a successful CPOE implementation.
The DOCS results were shared by Dr. Smith and his team with the hospital staff, which gave credibility to the
results and offered a secure sense of anonymity and confidentiality to the results. Hospital members were
assured that they were listened to and that their story was told. Results were also shared through a special
edition of the employee newsletter dedicated to sharing the DOCS results. It explained for all hospital
employees the positive results of the survey as well as the opportunities for change.
Before the formal process of implementing CPOE within Metroplex took place, Smith, Walton and the
leadership team began addressing cultural issues in order to lay the groundwork for a successful
implementation. First, they addressed the perception that the administration was in an ivory tower. There was
a widely held perception that leadership was not very approachable or trustworthy. Walton and the other
leaders needed to make themselves more visible throughout their facilities. As a result, the leadership team
dedicated themselves to taking part in daily hospital life by participating in department meetings, having
intentional conversations and being readily available to medical and hospital staff.
Walton himself started having monthly “President's Luncheons” with 25 randomly selected employees. These
luncheons were designed as an opportunity for Walton to listen to the staff answer two key questions: What do
you like about being here? And what can we be doing better? The action items from those meetings were
then communicated back to the participants with timeframes for completion. They consciously began to
create a culture of organizational openness, accountability and responsiveness.
The culture results also highlighted low Empowerment scores. Further
discussion revealed that much of the approval and authority was
centralized at the administration level. “The Denison results were just
screaming this at us,” as Walton puts it. With the help of Smith and his
team, the hospital reviewed their approval process to determine what
needed administrative approval and what could be put back at the
level most suited to make the decision. Low scores in Capability
Development, Organizational Change and Creating Change also
emphasized a need for professional development. The leadership team
and the medical staff understood that they needed to be more
intentional in their professional development plans for all critical staff
members. Feedback from the written verbatim comments and low
scores in the Adaptability trait of the Denison survey promoted the hospital to attend to their Patient
Experience team and redesign their entire service excellence plan. Addressing each of these areas helped
lay the groundwork for the CPOE implementation that was to come.
“For me, it’s about hardwiring excellence into our organization. When our patients and their families come
here, they expect a consistently excellent level of service. Coming in as a new CEO, the Denison
Organizational Culture Survey provided us with a wonderful baseline to evaluate our culture and to debug
some of the issues that were getting in the way of improving ourselves and providing excellence to our
patients.”
“The Denison Organizational
Culture Survey provided us with a
wonderful baseline to evaluate our
culture and debug some of the
issues that were getting in the way
of improving ourselves and
providing excellence to our
patients.”
About Metroplex Health System
Metroplex Health System is part of the Adventist Health System and offers an array of medical and wellness
services to West Bell, Coryell and Lampasas counties in Texas. Metroplex is dedicated to meeting the needs
of its patients by providing quality health care services through its 233 bed, multi-campus facility. The
system employs about 1200 area residents and cares for more than 125,000 patients each year and is the
largest community healthcare provider to the military in the nation. It supports a staff of more than 260
physicians in 43 medical specialties.
About Adventist Health System
Adventist Health System is a not-for-profit healthcare organization. Founded in 1973 to support and
strengthen Seventh-day Adventist healthcare organizations in the Southern and Southwestern regions of
the United States, Adventist Health System has quickly grown to become the largest not-for-profit Protestant
healthcare provider in the nation.
Today, Adventist Health System supports 38 hospitals and employs 50,000 individuals. Adventist Health
System hospitals are comprised of 6,600 plus licensed beds, providing care for 4 million patients each year
in inpatient, outpatient and emergency room visits.
Related Resources
Denison Consulting. (2005). Research Notes: Overview of the
Denison Model. Ann Arbor, MI: Author
Denison Consulting. (2008). Case Study: Using Culture to
Recruit Top Talent: HealthPlus of Michigan. Ann Arbor, MI:
Author
Denison Consulting. (2009). Case Study: Sutter Connect:
Cultivating Culture at the Start. Ann Arbor, MI: Author
Denison Consulting. (2010). Research Notes: Balanced Profile,
Better Organizations: Learning to Balance. Ann Arbor, MI:
Author
All content © copyright 2012 Denison Consulting, LLC All rights reserved. I www.denisonconsulting.com
Copyright Information
Copyright 2012 Denison Consulting, LLC
All Rights Reserved.
Unauthorized reproduction, in any manner, is prohibited. The
Denison Model, circumplex and survey are trademarks of
Denison Consulting, LLC.
Contact Information
Denison Consulting, LLC
121 W. Washington, Suite 201
Ann Arbor, Michigan 48104
Phone: (734) 302-4002
Fact: (734) 302-4023
Email: [email protected]
Change management activity.docx
1 Introduction to task
For the purpose of this activity we will use the hypothetical example of introducing ISBAR handover to the ward you are working on. This topic links directly to your final assignment which also deals with a change to handover. The activity takes you through a planning approach to implementing our hypothetical ISBAR handover initiative. It is designed to get you thinking about what is needed, who is needed, how change should be managed, some of the issues that can get in the way of change and how it can be embedded. Working through this type of activity will immerse you in change and change models and theories which will help you with your final assignment
During this activity think of yourself as the person who will be the change agent. MNP students - you can think of yourselves either as new grads or imagine yourselves as the unit manager. For MN students you can either do this activity from the perspective of your current role or imagine yourselves as the unit manager.
To prepare yourself for this, take a few moments to look at the powerpoint presentation that describes the framework that you will use for this exercise. As you do so, think about how introducing ISBAR handover can fit into this framework
Access the power point presentation HERE
2 Define the case for change
The first step is to define the case for change. Using Toolkit 1: business case for change checklist complete as many of the notes/comments columns as you can. As an example, the first Core Content address the need/drivers for change. A notation against this this element that can be put into the notes/comments column is that improving handover is a key focus of the Australian Commission on Safety and Quality in HealthCare
This activity is where you outline a vision of the future and the benefits of the change initiative
Business Case for Change – Checklist
|
Core Content
|
|
|
|
Content |
Included |
Notes / comments |
|
|
|
|
|
The need / drivers for change (Possible customer comment / market opportunity)
|
|
|
|
Vision – what will it look like after the change – details specific outcomes / outputs
|
|
|
|
How this change supports business strategy / goals
|
|
|
|
The benefits the change will bring
|
|
|
|
What will be the impact of not pursuing the change
|
|
|
|
Costs of change – physical + material resources
|
|
|
|
Overview of change process
|
|
|
|
Indicative timescales
|
|
|
|
|
|
|
|
Optional Content – if required |
|
|
|
Content |
Included |
Notes / comments |
|
|
|
|
|
Project Sponsor
|
|
|
|
Details of project group
|
|
|
|
Stakeholders (+ potential issues)
|
|
|
|
Any assumptions on which the change proposal is based
|
|
|
|
Clarify the precise scope of the change
|
|
|
|
|
|
|
3 Set up the change team
The next step is to establish the team that will implement the change. Think about who you might have on your team and what their roles may be.
Here you will clarify the roles and responsibilities of the team members and what their developmental need may be.
As you go through Toolkit 2: change readiness assessment you won't have all the answers, but it will prompt you to think about what is needed in a change team and what needs to be in place for it to work.
As an example, the first point under Leaders is "Do leaders understand the drivers and vision for the project?" As this is a hypothetical activity, you are likely to put - NO in part A as you are yet to identify your leaders. Under the Comments section you would include some key points you will need to make to help them understand why the change is needed.
A further example is Step 3 under infrastructure "Is the communication plan reaching target audiences?" You have yet to develop a plan so you would again put NO in part A, then in the comments section make some notes about what type of communication may be needed and who will be the target audience. This way the checklist acts as a prompt for action and identifies what yet needs to be done.
As a final example before you have a go, Step 4 under infrastructure asks "Can current HR processes handle impacts when required?" You would make the comment - not applicable as your change strategy would not require any HR intervention.
Now it's time for you to have a look at Toolkit 2: change readiness assessment
|
Change Readiness Assessment
|
|
|
How to Use the Checklist:
1) Answer each question for column A by ticking the status (yes, somewhat, no).
2) If the tick in (A) is in the ‘somewhat’ or ‘no’ box, move onto column B.
3) In column B note any comments or questions you may have.
|
A |
B |
||
|
Status |
Comments |
||
|
Yes |
Somewhat |
No
|
|
A. LEADERS
|
1) Do leaders understand the drivers and vision for the project? |
|
|
|
|
|
2) Do leaders and the project team work well together? |
|
|
|
|
|
3) Is there a communication plan for leaders to deliver?
|
|
|
|
|
|
4) Is this project co-ordinated with all other initiatives/projects etc? |
|
|
|
|
|
5) Can leaders describe the change process?
|
|
|
|
|
|
6) Will the organisation culture support the changes? |
|
|
|
|
|
7) Are leaders demonstrating the necessary commitment to the project, i.e. walking the talk? |
|
|
|
|
|
8) Are leaders’ concerns being identified and addressed? |
|
|
|
|
B. INFRASTRUCTURE
|
1) Have the key business drivers for the project been identified? |
|
|
|
|
|
2) Have all of the impacts on the organisation been identified and considered/addressed? |
|
|
|
|
|
Change Readiness Assessment
|
|
|
|||
|
A |
B |
||
|
Status |
Comments |
||
|
Yes |
Somewhat |
No
|
|
|
3) Is the communication plan reaching target audiences? |
|
|
|
|
|
4) Can current HR processes handle impacts when required? |
|
|
|
|
|
5) Is there a training and education plan?
|
|
|
|
|
|
6) Have we developed performance indicators to reflect/suggest new ways of doing business? |
|
|
|
|
C. INDIVIDUALS
|
1) Do employees have an opportunity to give input? |
|
|
|
|
|
2)Are we getting enough employee buy-in at all levels? |
|
|
|
|
|
3)Are people getting all the support/information they need in a timely way? |
|
|
|
|
D.TEAMS
|
1) Are team members enthusiastic and achieving their personal goals? |
|
|
|
|
|
2) Are we celebrating milestones/wins? |
|
|
|
|
|
3) Are Change Management tasks integrated into the Project work plan? |
|
|
|
|
4 Scope and sell the change
Under this part of the change management approach, you need to scope and sell the change - this involves
Scoping the change and potential challenges: Toolkit 3 allows you to identify whether your change is simple or complex. Take a look at Toolkit 3: Scoping the scale of change The smaller the change the less complex - where would this ISBAR initiative sit?
Prepare a Compelling Vision - what vision would you write?
The aim of this checklist is to help you consider the full impact of the change project you are leading and thereby identify potential difficulties and ensure adequate resourcing.
For each of the criteria listed below identify where your change project sits on the impact continuum. The higher the total value the more complex the change project.
AFFECTED BY CHANGE (amended I Brooks 2015)
|
Ward |
Department |
Hospital |
Whole Health Service |
|
|
1 |
2 |
3 |
4 |
5 |
|
|
|
|
|
|
NUMBER OF IMPACTED EMPLOYEES
|
Less than 10 |
|
|
Over 1000 |
|
|
1 |
2 |
3 |
4 |
5 |
|
|
|
|
|
|
VARIATION IN GROUPS THAT ARE IMPACTED
|
All groups impacted the same |
Wide variety of groups |
|||
|
1 |
2 |
3 |
4 |
5 |
|
|
|
|
|
|
DEGREE OF PROCESS CHANGE
|
No change |
|
|
100% change |
|
|
1 |
2 |
3 |
4 |
5 |
|
|
|
|
|
|
DEGREE OF TECHNOLOGY AND SYSTEMS CHANGE
|
No change |
|
|
100% change |
|
|
1 |
2 |
3 |
4 |
5 |
|
|
|
|
|
|
DEGREE OF JOB ROLE CHANGES
|
No change |
|
|
100% change |
|
|
1 |
2 |
3 |
4 |
5 |
|
|
|
|
|
|
DEGREE OF ORGANISATIONAL RESTRUCTURING
|
No change |
|
|
100% change |
|
|
1 |
2 |
3 |
4 |
5 |
|
|
|
|
|
|
TYPE OF CHANGE
|
Incremental change |
Developmental |
Transformational |
||
|
1 |
2 |
3 |
4 |
5 |
|
|
|
|
|
|
IMPACT ON CULTURE
|
No current change required |
Significant cultural change required to support change |
|||
|
1 |
2 |
3 |
4 |
5 |
|
|
|
|
|
|
REDUCTION IN TOTAL STAFFING LEVELS
|
No change expected |
Significant change expected |
|||
|
1 |
2 |
3 |
4 |
5 |
|
|
|
|
|
|
impact on OTHER human factors – friendships/relatiOSHIPS
|
Limited impact |
Significant impact |
|||
|
1 |
2 |
3 |
4 |
5 |
|
|
|
|
|
|
Identify key stakeholders and develop a stakeholder management plan - who are the people that are going to be involved in this change? They are your stakeholders. Think about the ward and the people within it and then work through Toolkit 4: stakeholder mapping
Secure leadership commitment - formal change requires the support of your leaders/managers. How do you think you might do this in this example? Who are the leaders/managers that you need to get onboard?
Stakeholder Mapping
Step 1 – Identify your main Stakeholders
(Think of anyone, who is affected by the change initiative, has influence or power over it, or has an interest in its successful or unsuccessful conclusion)
· Identify by name / group
Step 2 – Understand Stakeholder needs
· To what extent can they influence the success of the change initiative?
· To what extent are they interested in the change initiative?
· Plot each stakeholder on the full size grid on last page
· Differentiate supporters and detractors
|
POWER |
High |
Keep satisfied |
Manage closely
|
|
|
Low |
Monitor (minimum effort) |
Keep informed
|
Low High Interest
Also consider:
· What are their financial or emotional interests in the change initiative?
· Information needs - what do they need to know and why?
· What is their current opinion of the change initiative? Is this based on an accurate assessment?
· Who else may influence their opinions?
· Who do they influence?
· What motivates them in the workplace?
· What do you need to do to win their support?
· How could you manage their opposition?
Step 3 - Develop a Stakeholder Plan - what do I want from this Stakeholder and how can I achieve this?
Identify what you need from this Stakeholder:
· To understand their needs/interests?
· Get their ideas/input?
· Gain their support/resources?
· Gain approval?
· Gain recognition?
Then consider - how can I best achieve this?
· Actions
· Messages
Step 4 – Deliver the Stakeholder Plan
Step 5 – Get Feedback and Review as you go
· How will you review the progress and success of your Stakeholder Plan?
5 Define the change and develop the implementation plan
The steps in this section require you to:
Engage with Staff - how and where will you do this? How will you capture everyone that needs to be informed?
Agree the baseline ‘As Is’: this is where you would describe the current process of handover and the reason you are implementing the ISBAR handover
Define the detailed ‘To Be’: this is where you would describe what the ISBAR handover would look like - have a go!
Consider the Impact on People, Processes, Infrastructure, Structure and Culture: what effect will this change have on the staff? what change to handover process is required if any? there will be no infrastructure or structure changes, but will implementing an ISBAR handover have any change to ward culture? What do you think?
Prepare a detailed Change Plan with Timescales and Milestones: what are the steps needed to make the change? How long will each step take? Have a go at writing a plan
6 Manage communications
Having a good communication strategy is vital to keep everyone on board and up to date with the change - given you are working in a ward where there are 3 shifts and a lot of staff, having a communication plan is vital.
Develop a detailed Communications Strategy and Plan: how would you go about communicating your change strategy as it evolves?
7 Implementation
Before you start your implementation, you need to revisit the Change Readiness Assessment (toolkit 2) to ensure all is on track and you are ready. The steps here are straightforward, but some steps require some thinking
Implement the change plan
Deliver training and support: did you think about training when you developed your plan in Chapter 5? If you didn't - think about what training and support is needed to implement this change
Manage the emotional cycle of change and anticipate and deal with resistance: how will you manage those that are resistant to the ISBAR handover? How will you stop people slipping back into the old way of doing handover?
8 Sustain the change effort
We are nearly at the end (whew!) only a few more steps to take:
Celebrate short term wins: what will you do to celebrate short term wins? what would constitute for you a short term win?
Recognise and reward new behaviours: how will you reward staff who implement the ISBAR handover? Will you reward individuals? Shifts? Remember motivation theory here
Ensure continued leadership support and promotion of change: how will you continue to ensure that your leaders are on board for the long term?
Measure progress: how will you measure how well this change is progressing and the benefits to members of the nursing staff? What do you think some of the benefits might be?
Elicit feedback on the impact of the change: how are you going to do this?
9 Some final comments
So, how did you go?
Challenging? I expect so. The aim of this activity was to get you to think through some of the key steps and detail required to implement a quality improvement strategy.
If you think about it, the Warwick framework we have used here is similar to Kotter - here is Kotter compared with the steps of the Warwick framework in brackets
1. create sense of urgency (define the case for change)
2. build the guiding team (set up the change team)
3. get the vision right (scope and sell the change)
4. enlist - communicate for buy in (manage communications)
5. enable - empower action
6. create short term wins (sustain the change effort)
7. sustain (sustain the change effort)
8. make the change stick (embed the changes)
The Warwick model provides some additional important steps namely developing a plan and implementation of the plan.
Working through this activity will help you to decide on the type of quality improvement initiative to address in your final assignment - in chapter 4 - scoping the change was a useful activity to highlight to you that the larger the scope of the change, the more complex the management of the change initiative will be. So my advice - Keep it Simple.
10 An additional resource
This article by Mento, Jones and Dirndorfer provides a useful article that provides additional models for implementing change
I have provided it here for you
Stakeholder Map
LOW INTEREST HIGH
|
HIGH
POWER
LOW |
|
|
|
|
|
|
http://www2.warwick.ac.uk/services/ldc/leadership/change/
change_management_framework.pdf
A Framework for
Managing Change
Tim Hunter
Geraldine Mills
Trudie Donnelly
Draft Framework for Managing Change
Strategy,
Values,
& Culture
Draft Framework for Managing Change
Strategy,
Values,
& Culture
Define the Case for Change
Set up the Change Team
Scope and Sell the Change
Define the Change and Develop the
Implementation Plan
Manage Communications
Implementation
Sustain the Change Effort
Embed the Changes
1. Define the Case for Change
• Develop a Business Case for Change (Toolkit 1)
• Outline a Vision of the Future and the Benefits
• Show the Fit to Strategy and the Five Year Plan
Define the Case for Change
Prepare for Change
Set up the Change Team
Prepare for Change
2. Set up the Change Team
• Select the Team Members and assess readiness (Toolkit 2)
• Clarify the Roles and Responsibilities
• Identify Development Needs within the Team
• Agree Team Functioning and Governance
Scope and Sell the Change
Prepare for Change
3. Scope and Sell the Change
• Scope the Change and Potential Challenges (Toolkit 3)
• Prepare a Compelling Vision
• Identify Key Stakeholders Develop a Stakeholder Management Plan (Toolkit 4)
• Secure Leadership Commitment
• Identify the Formal Communication Requirements
Define the Change
Define the Change and Develop the
Implementation Plan
4. Define the Change and Develop the Implementation Plan
• Engage with Staff
• Agree the baseline ‘As Is’
• Define the detailed ‘To Be’
• Consider the Impact on People, Processes, Infrastructure, Structure and Culture
• Plan the Transition and identify the Actions and Support required (Toolkit 5)
• Prepare a detailed Change Plan with Timescales and Milestones
Manage Communications
Define the Change
5. Manage Communications
• Develop a detailed Communications Strategy and Plan
• Identify where Formal Consultation is required
• Elicit and Respond to Stakeholder Feedback
Implement and Sustain Change
Implementation
6. Implementation
• Check the Readiness to Implement (Toolkit 2)
• Work the Change Plan
• Deliver Training and Support
• Manage the Emotional Cycle of Change
• Anticipate and Deal with Resistance
• Introduce New Systems, Processes and Ways of Working
• Review the Change Plan regularly
Implement and Sustain Change
7. Sustain the Change Effort
• Celebrate Short Term Wins
• Recognise and Reward New Behaviours
• Ensure continued Leadership Support and Promotion of Change
• Measure Progress and Track Benefits Realisation
• Deal with Resistance
• Elicit Feedback on the Impact of the Change
Sustain the Change Effort
Embed a Culture of
Positive Change
Implement and Sustain Change
8. Embed the Changes
• Celebrate Successes
• Review and Learn from the Change
• Identify further Opportunities for Change
Draft Framework for Managing Change
Strategy,
Values,
& Culture
Define the Case for Change
Set up the Change Team
Scope and Sell the Change
Define the Change and Develop the
Implementation Plan
Manage Communications
Implementation
Sustain the Change Effort
Embed the Changes
Draft Framework for Managing Change
Strategy,
Values,
& Culture
• http://www2.warwick.ac.uk/services/ldc/lead ership/change/
Assessment details.docx
Assessment title: Assignment 2 Change Management Alignment with learning outcome(s): This assessment aligns with the following learning outcomes:
1. Examine the impact of health policy on nursing management
2. Critique extant theories of power and their application to health care settings
3. Appraise the characteristics of effective organisations through the use of continuous improvement strategies
4. Critically analyse theories of change management and their application to health care settings
Details of task:
This assignment presents an opportunity for you to engage in the current report into the review of hospital safety and quality assurance in Victoria. It requires the learning outcomes of health policy, power, QI/QA and change to be addressed. The review, conducted by Stephen Duckett, will allow you to engage with all of these concepts. See this link: https://www2.health.vic.gov.au/hospitals-and-health-services/quality-safety-service/hospital-safety-and-quality-review
Examine the report as an exemplar when discussing governance, and related quality topics in the unit. For Assignment 2, answer the following questions:
1) Given this review is going to affect all hospital and health services, what are the major deficiencies in health care that are being addressed by this review and which of the NSQHS standards do these relate to?
2) Taking into account recommendation 2.14.1 "low rates of agreement with the questions ‘My suggestions about patient safety would be acted upon if I expressed them to my manager’ and ‘I am encouraged by my colleagues to report any patient safety concerns I may have’ in the People Matters Survey be used as an indicator of a poor reporting culture in a public hospital"
Using change management principles, and considering theories of power, describe how you would implement a plan to improve the culture in your ward around reporting safety concerns.
Link to survey here:
http://vpsc.vic.gov.au/people-matter-survey-core-survey/
(Use 2.5cm margins on each side of the page with double spacing between lines (including the template for your learning contract, this can be presented in ‘landscape’ page layout.
Use 11 or 12 point Arial or Calibri font style.)
|
1. Students embark on inquiry and so determine a need for knowledge/ understanding |
Identify the key concepts within the task, and determine knowledge required to complete task. Total: 15 marks |
☐ Key concepts from the task not addressed ☐ Response to task irrelevant 0-6 marks |
☐ Limited identification of key concepts ☐ Response to task mostly irrelevant 7-8 marks |
☐ Some key concepts from the tasks identified but in a limited capacity ☐ Response to task contains some irrelevancies 9-10 marks |
☐ Most of the key concepts and issues are identified ☐ Appropriate response to task 11-12 marks |
☐ All of the key concepts and issues are identified ☐ Appropriate response to task ☐ Demonstrates insight and ability to apply knowledge gained to other situations 13-15 marks |
|
2. Students find/generate needed information/data using appropriate methodology |
Gather relevant information from a variety of sources including unit textbook and readings Total: 15 marks |
☐ No evidence of research ☐ Irrelevant theories and concepts are used 0-6 marks |
☐ Limited evidence of research ☐ Limited number of sources ☐ Sources are mostly old or out of date ☐ Theories and concepts do not clearly address task 7-8 marks |
☐ Some evidence of research ☐ Satisfactory number of sources ☐ A mix of out of date and contemporary sources ☐ Some theories and concepts are irrelevant 9-10 marks |
☐ Evidence of wide research ☐ Large number of sources ☐ Sources are mostly contemporary ☐ Relevant theories and concepts obtained from sources 11-12 marks |
☐ Evidence of extensive research ☐ A broad range of sources ☐ Contemporary sources used throughout ☐ Highly relevant theories and concepts obtained from sources 13-15 marks |
|
3. Students critically evaluate information/data |
Evaluate information on the bases of academic reliability and credibility, currency, and arguments presented. Total: 10 marks |
☐ No sources used to back up concepts, issues, or theories 0-4 marks |
☐ Sources used to back up concepts, issues, or theories are not credible ☐ Poorly presented or misinterpreted information 5 marks |
☐ Limited use of sources to back up concepts, issues, or theories ☐ Some sources are not credible ☐ Some poorly presented or misinterpreted information 6 marks |
☐ Appropriate use of sources to back up concepts, issues, or theories ☐ Sources are credible ☐ Information appropriate presented and interpreted 7-8 marks |
☐ Excellent use of sources to back up concepts, issues, or theories ☐ Sources are highly credible ☐ Highly effective presentation and interpretation of information 9-10 marks |
|
4. Students organise information |
Structure and argument logically organised according to the appropriate writing genre (style) Arguments must be supported by relevant evidence Total: 20 marks |
☐ Assignment does not conform to the prescribed structure ☐ Assignment lacks introductory, body, and/or concluding paragraphs ☐ Arguments are illogical ☐ Arguments are lack evidence ☐ No concluding statement 0-10 marks |
☐ Assignment does not clearly conform to the prescribed structure ☐ Assignment not clearly organised into paragraphs ☐ Arguments are mostly illogical ☐ Arguments are largely unsubstantiated ☐ Conclusion present but unclear 10-11 marks |
☐ Assignment conforms overall to the prescribed structure ☐ Assignment mostly organised into paragraphs ☐ Arguments are mostly accurate ☐ Arguments do not always flow logically between paragraphs ☐ Arguments are sometimes supported with little or unreliable evidence ☐ Conclusion present but overly long or confusing 12-13 marks |
☐ Assignment conforms to the prescribed structure ☐ Assignment is clearly organised into appropriate paragraphs ☐ Arguments are logical ☐ Mostly clear links between paragraphs ☐ Arguments are adequately supported by evidence ☐ A succinct conclusion present 14-15 marks |
☐ Assignment conforms to the prescribed structure organised according to the appropriate writing genre (style). Arguments must be supported by relevant evidence. ☐ Excellent organisation of ideas into introductory, body, and concluding paragraphs ☐ Arguments presented is logical and convincing ☐ Clear links between paragraphs ☐ Arguments are strongly supported by evidence ☐ A highly developed and succinct conclusion present 16-20 marks |
|
Attribute |
Task |
Fail |
Pass |
Credit |
Distinction |
High Distinction |
|
5. Students synthesise and analyse and apply new knowledge |
Knowledge gained is synthesise, analysed and applied in a cohesive manger which aids the reader’s understanding Total 30 marks |
☐ Analysis of information not present ☐ Evaluation of evidence not expressed ☐ Excessive use of quotations ☐ No application to nursing context ☐ Plagiarism evident 0-14 marks |
☐ Analysis of information rarely present ☐ Evaluation of evidence rarely present ☐ Random or excessive use of quotations ☐ Application to nursing context not clearly used ☐ Paraphrasing skills require development to avoid plagiarism 15 marks |
☐ Some attempt at analysis ☐ Some attempt at evaluation ☐ Lacks writer’s voice ☐ Attempt at application to nursing context with illustrations, but these are sometimes irrelevant ☐ Reasonably ability to paraphrase ideas 16-20 marks |
☐ Reasonable attempt at analysis of information ☐ Reasonable attempt at evaluation of evidence ☐ Writer’s voice mostly present ☐ Use of application to nursing context as illustrations ☐ Good use of paraphrasing 21-24 marks |
☐ Insightful analysis of information ☐ Evaluation of evidence clearly expressed ☐ Writer’s voice clear throughout ☐ Perceptive use of personal experiences as illustrations ☐ Excellent ability to paraphrase ideas 25-30 marks |
|
6. Students communicate knowledge with ethical, social and cultural awareness. |
Appropriate use of discipline specific academic language; accurate spelling, grammar, punctuation; professional presentation; and correct acknowledgement of sources references using APA 6th style Total 10 marks |
☐ Lay language used ☐ Academic tone not demonstrated ☐ Substantial errors in spelling, grammar or punctuation ☐ Incorrect acknowledgement sources ☐ Referencing does not conform to APA 6 referencing 0-4 marks |
☐ Mostly lay language used ☐ Attempted use of academic tone ☐ Several errors in spelling, grammar or punctuation ☐ Partial acknowledgement of sources ☐ Attempted use of APA 6 referencing 5 marks □ |
☐ Mainly discipline-specific language used ☐ Academic tone demonstrated but inconsistent ☐ Few errors in spelling, grammar or punctuation ☐ All sources are acknowledged ☐ Mostly correct use of APA 6 referencing 6 marks |
☐ Discipline-specific language used ☐ Academic tone mostly correctly demonstrated ☐ No errors in spelling, grammar or punctuation ☐ All sources are acknowledged ☐ Correct use of APA 6 referencing 7-8 marks |
☐ A range of discipline-specific language used throughout ☐ Academic tone y correctly demonstrated and consistent ☐ No errors in spelling, grammar or punctuation ☐ All sources are acknowledged ☐ Correct use of APA 6 referencing 9-10 marks |