Essays Guru

profilescotchsoda
learning.docx

This is the assignment description:

Access the National Center for Biotechnology Information (NCBI) website: http://www.ncbi.nlm.nih.gov/

Locate two bioinformatics tools.

Determine the identity of two sequences listed in the University of Phoenix Material: Gene Sequences, using BLAST from the NCBI website.

Write a 350- to 700-word summary of the two tools you investigated and your BLAST findings

Everything highlighted is just for reference do not complete entire assignment. Read instructions below:

Note* This is a team assignment Your only job as a team member is to produce only the introduction to what we as a team have found as well as the conclusion based on the information below.

For the introduction and the conclusion, they only need to be 100-150 words.

Here is what the team has come up with so far based on their finding please write an introduction and then conclusion based on findings

Homo-Sapiens Cystic Fibrosis Transmembrane Conductance Regulator

Homo sapiens cystic fibrosis transmembrane conductance regulator is involved in the transport of chloride ions. It can help regulate bicarbonate secretion and salvage in epithelial cells by regulating the SLC4A7 transporter. It can inhibit the chloride channel activity of ANO1 and it plays an important role in the chloride and bicarbonate homeostasis during sperm epididymal maturation and capacitation (UniProt Consortium, 2016). The Catalytic activity is ATP + H2O = ADP + phosphate. It is nucleotide binding in positions 458-465 and 1244-1251.

MetaMiner of GeneGo

In 2007 GeneGo’s MetaDiscovery™ created MetaMiner™ Cystic Fibrosis (CF) for those with CF; showing many “forms cause-effect relationships including; gene-disease, compounds-disease and compound-protein associations” (GeneGo Inc., 2009, Pg. 1). GeneGo Inc. along with Cystic Fibrosis Foundation Therapeutics (CFFT) MetaMiner CF analysis platform designed used by broad range of CF researchers including lab biologists, bioinformatics tacticians, clinicians and chemists, dictate content continuous maintain quarterly updates. The team of scientists and the committee assemble and maintain the cystic fibrosis biological and chemical trial data accessible generating a reference environment. MetaMiner CF produce imagining tools represention major disease contributory and disease advancing mechanisms with pathway maps and network models (GeneGo Inc., 2009).

Homo-Sapiens Breast & Ovarian Cancer Susceptibility Protein 1 (BRCA1)

BRCA1 (Breast and Ovarian Cancer Susceptibility Protein 1) is involved in protein in a part of protein modification called ubiquination. Ubiquination is a pathway protein. E3 ubiquitin-protein ligase activity is required for BRCA1 tumor suppressor function. E3 ubiquitin activity is increased by phosphatase treatment and inhibited by phosphorylation by AURKA. In addition to ubiquination, BRCA1 is involved in regulating centrosomal microtubule nucleation, transcriptional regulation, and DNA damage repair.

References

GeneGo Inc., (September, 2009). White Paper MetaMiner Cystic Fibrosis Report. Retrieved

from https://www.cff.org/GeneGo-MetaMiner-Cystic-Fibrosis-White-Paper-Final-Sept-2009.pdf.

UniProt Consortium. (2016). UniProtKB - P13569 (CFTR_HUMAN). Retrieved from

http://www.uniprot.org/uniprot/P13569

UniProt Consortium. (2016). UniProtKB – P38398 (BRCA1_HUMAN). Retrieved from

www.uniprot.org/uniprot/P38398

University of Phoenix Material

Gene Sequences

Use the following gene sequences for the Bioinformatics assignment in Week Five by entering them in the BLAST tool at the National Center for Biotechnology Information website. After accessing the website, select “Blast” found at the bottom of the page under the “Popular” tab. Then, select a BLAST program to run found under the “Basic Blast” heading. From here, enter the sequences below, and query by selecting “Blast” to determine the identities.

1. ccagagtccagctgctgctcatactactgatactgctggg

2. tctgcaattgcttaggatgtttttcatgaa

3. acctgtagcacaagaggccttaaaaaaggaacttgaaactctaaccaccaactaccagtg

4. gtggtgtttt tatctgtgct tccctatgca ctaatcaaag gaatcatcct ccggaaaata

5. ACTGGCACGCGACGAGGACGCATTCCAAATCATACT

6. gaggcacttggacttcctggacatcctcctctttgccaaaatggagaatgggaagggctt

7. gtccagcattctccaaaggttcaggtttactcccgtcacccagcagagaatggaaagcca