article crtique #7

G Model A

E a

S S N (

a

A R R A A

K B B M S

1

f i c o n

i r

0

ARTICLE IN PRESSNIFEE-13525; No. of Pages 8 Animal Feed Science and Technology xxx (2016) xxx–xxx

Contents lists available at ScienceDirect

Animal Feed Science and Technology

journal homepage: www.elsevier.com/locate/anifeedsci

ffect of dietary prebiotic inulin on growth, body composition nd gut microbiota of Asian seabass (Lates calcarifer)

. Syed Raffic Ali, K. Ambasankar ∗, S. Nandakumar, P. Ezhil Praveena, J. yamadayal utrition Genetics and Biotechnology Division, Central Institute of Brackishwater Aquaculture 75, Santhome High Road, R.A. Puram,

ICAR), Chennai 600 028, India

r t i c l e i n f o

rticle history: eceived 3 June 2015 eceived in revised form 16 April 2016 ccepted 18 April 2016 vailable online xxx

eywords: arramundi iometric indexes icrobial diversity

urvival

a b s t r a c t

A feeding trial was conducted to study the effect of inulin on growth, body composition and gut microbiota of Lates calcarifer fingerlings (average weight: 7.14 ± 0.05 g). Inulin was supplemented at five different concentrations 0, 5, 10, 15 and 20 g kg−1 in the diet (400 g kg1

protein and 90 g kg−1 lipid) of L. calcarifer. The results of the 60 days feeding trial revealed that dietary inulin supplementation had a significant effect on specific growth rate (SGR) (linear, P = 0.029; quadratic, P = 0.022) and feed conversion ratio (FCR) (linear, P = 0.033; quadratic, P = 0.003) between control and treatments. However, the final body weight (FBW) (quadratic, P = 0.0138) and weight gain (WG) (quadratic, P = 0.0150) followed a quadratic pattern. Supplementation of inulin did not affect whole body moisture and lipid. How- ever, crude protein increased both linearly (linear, P = 0.001) and quadratically (quadratic, P = 0.001) in fish fed with 20 g kg−1 inulin supplemented diets and a quadratic pattern in ash (P < 0.05) was recorded. Similarly hepatosomatic index (HSI) significantly increased (linear, P = 0.008; quadratic, P = 0.048) in fish fed 15 g kg−1 inulin. Polymerase chain reaction and denaturing gradient gel electrophoresis (PCR-DGGE) analysis of gut samples from inulin supplemented diet revealed the change in the gut microbial community of Asian seabass. It could therefore be inferred that inulin supplementation is beneficial in the diet of Asian seabass and supplementation at 15 g kg −1 level is optimal for enhancing growth.

© 2016 Elsevier B.V. All rights reserved.

. Introduction

Asian seabass (Lates calcarifer) commonly known as bhetki or barramundi, is an economically important candidate species or brackishwater aquaculture and it is widely cultured in Southeast Asia and Australia under extensive or intensive system

Please cite this article in press as: Raffic Ali, S.S., et al., Effect of dietary prebiotic inulin on growth, body composition and gut microbiota of Asian seabass (Lates calcarifer). Anim. Feed Sci. Tech. (2016), http://dx.doi.org/10.1016/j.anifeedsci.2016.04.011

n fresh, brackish and marine water resource. In India, it is being considered as a potential alternate candidate species for oastal aquaculture (Nandakumar et al., 2013). Diseases are one of the primary limiting factors for large scale propagation f aquaculture. Prebiotics have recently attracted extensive attention in aquaculture (Ringo et al., 2010) because of their atural origin and reduced influence on natural environment compared to antibiotics. However, prebiotics are often used

Abbreviations: CF, condition factor; DGC, daily growth coefficient; DGGE, denaturing gradient gel electrophoresis; DNA, deoxyribonucleic acid; IBW, nitial body weight; FBW, final body weight; FCR, feed conversion ratio; HSI, hepatosomatic index; NFE, nitrogen free extract; PCR, polymerase chain eaction; SGR, specific growth rate; SEM, standard error of the means; VSI, viscerosomatic index. ∗ Corresponding author.

E-mail address: [email protected] (K. Ambasankar).

http://dx.doi.org/10.1016/j.anifeedsci.2016.04.011 377-8401/© 2016 Elsevier B.V. All rights reserved.

ARTICLE IN PRESSG ModelANIFEE-13525; No. of Pages 8 2 S.S. Raffic Ali et al. / Animal Feed Science and Technology xxx (2016) xxx–xxx

Table 1 Formulation and proximate composition of experimental diets: I 0 = 0 g kg−1 ; I 5 = 5 g kg−1 ; I 10 = 10 g kg−1 ; I 15 = 15 g kg−1 ; I 20 = 20 g kg−1 of inulin.

Diets I 0 I 5 I 10 I 15 I 20 Ingredients

Fish meala 400 400 400 400 400 Soya 250 250 250 250 250 wheat 130 130 130 130 130 Rice 50 50 50 50 50 Maize 50 50 50 50 50 Fish oila 40 40 40 40 40 Lecithin 20 20 20 20 20 Vitamin Mineral mixtureb 30 30 30 30 30 Binderc 10 10 10 10 10 Cellulose 20 15 10 5 0 Inulind 0 5 10 15 20

Proximate composition(g kg−1 ) Moisture 78.6 78.3 78.0 78.3 75.1 Crude protein 401.2 404.3 403.5 402.1 402.4 Crude lipid 88.1 88.3 88.6 88.7 88.6 Crude fiber 23 26.3 26.4 26.8 26 Total ash 131.1 143.8 144.5 145.1 145.9 Nitrogen free extract 278 259 259 259 262

a Sardine fishmeal and fish oil. Bismifisheries, Mayiladuthurai, Tamil Nadu, India. b Commercially sourced premix and each kg contains: Vitamin A, 2000000IU; Vitamin D, 400000 IU; Vitamin E, 300 U; Vitamin K, 450 mg; Riboflavin,

800 mg;Panthothenic acid, 1 g;Nicotinamide, 4 g; Vitamin B12, 2.4 mg; Choline chloride, 60 g; Ca, 300 g; Mg, 11 g; I, 400 mg; Fe, 3 g; Zn, 6 g; Cu, 800 mg; Co,

180 mg. Sarabhai Zydus Animal Health Ltd, Vadodara, Gujarat, India.

c Pegabind, BentoliAgri nutrition Asia Pvt., Ltd., Singapore. d Inulin (Himedia, Mumbai).

more as a prophylactic rather than a curative measure as they reduce the need for antibiotics. Prebiotics are non-digestible food ingredients that are beneficial to the host by selectively stimulating the growth and/or activity of one or a limited number of bacteria in the colon. Manipulation of microbial population in the intestinal tract of aquatic animals through the use of prebiotics is a novel approach to improve the health and growth of the animal (Gibson et al., 2004). Inulin is a group of naturally occurring polysaccharides produced by different plants, such as bananas, barley, chicory, garlic, Jerusalem artichoke, leeks, onions and wheat (Roberfroid, 2005). Inulin has been reported to play an important role in improving health condition and immune function in fishes (Mahious et al., 2006; Cerezuela et al., 2008; Akrami et al., 2009; Burr et al., 2010; Blanca Partida-Arangure et al., 2013).

Fructooligosaccharides (FOS), mannanoligosaccharides (MOS), galactooligosaccharides (GOS), xylooligosaccharides (XOS), inulin and other related carbohydrates which are prebiotics established in fish to date (Ringo et al., 2010), have received considerable attention because of the health benefits they are believed to confer to the host. The intestinal micro- biota plays an important role in the nutrition and health of the host organism. Potential pathogenic bacteria are part of the intestinal microbiota of every healthy organism (Ringo et al., 2010) and if the conditions within the intestine become favorable (i.e. when the host is stressed or malnourished) for the bacterium then there exists a potential for pathogenic proliferation, translocation leading to infection of the host organism. Consequently, the present study investigated the effect of supplementation of inulin in the diet of Asian seabass, on growth, body composition and gut microbiota.

2. Materials and methods

2.1. Preparation of experimental diets

Inulin was supplemented in a standard commercial diet at five different concentrations viz., 0, 5, 10, 15 and 20 g kg1. The ingredients and proximate composition of the experimental diets are depicted in Table 1. Dry solid feed ingredients were ground in an electrical grinder and passed through a 0.5 mm sieve. They were mixed along with additives and homogenized thoroughly in an electrical blender. The diet mix was made into soft dough by adding water at 400 mL kg1 of diet mix. The dough was then steam cooked (at atmospheric pressure) for 5 min, cooled and pelletized in a hand pelletizer using a 2.0-mm die. The experimental diets were prepared in the feed mill located at the Muttukadu experimental station of Central Institute of Brackishwater Aquaculture (CIBA), Chennai. The pellets were dried in a hot air oven at 50 ◦C till the moisture content was well below 10%. The oven-dried experimental feeds were packed in air tight containers and stored in refrigerator for future use.

Please cite this article in press as: Raffic Ali, S.S., et al., Effect of dietary prebiotic inulin on growth, body composition and gut microbiota of Asian seabass (Lates calcarifer). Anim. Feed Sci. Tech. (2016), http://dx.doi.org/10.1016/j.anifeedsci.2016.04.011

2.2. Chemical analysis

The proximate composition of the ingredients, experimental diets and whole body composition of experimental animals were analyzed following standard procedures (AOAC, 2012). At the termination of the experiment 4 fish from each tank

ARTICLE IN PRESSG ModelANIFEE-13525; No. of Pages 8 S.S. Raffic Ali et al. / Animal Feed Science and Technology xxx (2016) xxx–xxx 3

Table 2 16S rRNA primers used in this study.

Primer Sequence (5′ –3′ ) Reference

w h c b g g d p b

2

C t w s t t c m ( 6 w

2

p p p

t i 9 7 A g ( g u E f s b p D a

2

l

357f CCTACGGGAGGCAGCAG Muyzer et al. (1998)

357f-GC GCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGCCTACGGGAGGCAGCAG 907rM CGTCAATTCMTTTGAGTTT

ere collected and killed by over dose of anesthesia for determination of whole body composition. The fish samples were omogenized and dried at 105 ◦C for 24 h. The dried samples within a tank were pooled and analyzed per tank. Moisture ontent was estimated by gravimetric analysis after oven drying at 105 ◦C for 12 h. Crude protein (CP) was determined y Kjeldahl method (N × 6.25) after acid hydrolysis (Kjeltec 2100, FOSS, Tecator, Sweden). Crude lipid (CL) was calculated ravimetrically after extraction with petroleum ether in a soxhlet system (SOCS, Pelican, India). Total ash was determined ravimetrically by ignition at 600 ◦C for 6 h in muffle furnace. Crude fiber was estimated gravimetrically after acid and alkali igestion and loss in mass by combustion at 600 ◦C for 3 h. Nitrogen free extract (NFE) was calculated from 1000 − (crude rotein + crude lipid + crude fiber + total ash). All the chemical analyses were done in triplicate and reported on a dry matter asis.

.3. Fish rearing and experimental design

Hatchery-bred and farm-reared Asian seabass fingerlings were procured from a commercial farm in Pulicat village near hennai, India and transported to the wet-laboratory. Experimental animals were acclimatized for two weeks during which hey were fed with CIBA- Bhetkiahar. Each dietary treatment was in triplicate with 15 fish each. The fingerlings (average eight: 7.14 ± 0.05 g) were randomly distributed into fifteen oval 1000 L fiber reinforced plastic (FRP) tanks which were

upplied with sand-filtered seawater having a provision for continuous aeration through air diffuser stones. Throughout the rial, water in the tanks (about 80%) was exchanged twice daily, in the morning and evening. Fishes were fed ad libitum wice daily (10.00 and 16.00 h) and after 30 min, unconsumed feed was siphoned out and dried to determine the actual feed onsumption. The experiment lasted 60 days. Fish were weighed individually at the start and end of the experiment whereas ass weighing was carried out every fortnight to ascertain the weight gain. Fish were maintained under a natural photoperiod

12 h L: 12 h D). Water quality parameters viz. temperature: 26–29 ◦C; salinity: 28–31 g L−1; pH: 7.4–8.2; dissolved oxygen: .0–7.3 mg L−1 and total ammonia nitrogen: 0.08–0.11 mg L−1 was recorded using conventional methods (APHA, 1998). It as observed from the recorded values that there were optimal for Asian seabass (Biswas et al., 2010).

.4. Polymerase chain reaction and denaturing gradient gel electrophoresis (PCR-DGGE)

At the end of the experiment, two fish were randomly picked up from each tank, anaesthetized immediately with 2- henoxyethanol at a dose of 0.3 mL/L before sacrifice and thereafter the digestive tract of each fish dissected aseptically and rocessed for PCR-DGGE analysis. The DNA was extracted from fish gut samples using DNA-Xpress kit (Himedia, India) as er the manufacturer’s instructions.

The DNA from fish gut samples was used as a template to amplify the variable V3–V5 region of the 16SrRNA gene using he universal primers 357f-GC and 907rM as described by Muyzer et al. (1998). The details of the primers used are depicted n Table 2. The protocol followed was: initial denaturation at 95 ◦C for 4 min and 10 touchdown cycles of denaturation at 5 ◦C for 30 s, annealing at 65 ◦C for 30 s (with the annealing temperature decreasing by 1 ◦C in each cycle), extension at 2 ◦C for 1 min followed by 20 cycles of 95 ◦C for 30 s, 55 ◦C for 30 s, 72 ◦C for 1 min and a final extension at 72 ◦C for 5 min. mplification was carried out using an iCycler (BioRad, USA). Amplified products were electrophoresed on a 1.5% agarose el in 0.5 × TBE buffer at 50 V for 45 min, stained with ethidium bromide and visualized using a Gel Documentation system BioRad, USA). The PCR products (∼100 ng) from the gut samples were subjected to DGGE analysis in a 6% polyacrylamide el (acrylamide: bis-acrylamide, 37.5:1.0) with a denaturant gradient of 20–80% (with 100% denaturant consisting of 7 M rea and 40% formamide). The DGGE was performed after Muyzer et al. (1998) using a DCode apparatus (BioRad, USA). lectrophoresis was carried out in 1 × TAE buffer at 100 V for 17 h at a constant temperature of 60 ◦C. The gel was stained or 20 min with SYBR gold nucleic acid stain (1:10,000×) in 1 × TAE buffer and visualized using the Gel Documentation ystem. All bands were excised, eluted, re-amplified and checked for purity and migration patterns in DGGE as described y Ponnusamy et al. (2008). Re-amplified products showing single bands in DGGE were amplified using GC clamp-free rimers. The amplicons were then purified using HiYield PCR Clean-up kit (RBC, Taiwan) and sequenced using automated NA sequencer (1st Base, Malaysia). The sequences were initially checked for chimera using DECIPHER (Wright et al., 2011) nd identified by comparing with the sequences available in GenBank using the BLASTN tool.

Please cite this article in press as: Raffic Ali, S.S., et al., Effect of dietary prebiotic inulin on growth, body composition and gut microbiota of Asian seabass (Lates calcarifer). Anim. Feed Sci. Tech. (2016), http://dx.doi.org/10.1016/j.anifeedsci.2016.04.011

.5. Growth performance

On termination of the experiment, fish were anaesthetized using 2-phenoxyethanol at a dose of 0.3 mL/L and the total ength and weight of each fish recorded. Three fish from each experimental group were randomly selected to measure the

ARTICLE IN PRESSG ModelANIFEE-13525; No. of Pages 8 4 S.S. Raffic Ali et al. / Animal Feed Science and Technology xxx (2016) xxx–xxx

Table 3 Growth performance and survival of Asian sea bass fed experimental diets supplemented with varying levels of inulin for 60 days. Values are means of three replicates.

Parameters I0 I5 I10 I15 I20 SEM P values

Linear Quadratic

FBW (g) 39.6b 41.7ab 43.3a 43.9a 41.1ab 0.55 0.110 0.013 WG (g) 32.4b 34.6ab 36.1a 36.8a 34.1ab 0.55 0.091 0.015 Survival (%) 82.2 86.6 91.1 93.3 91.1 2.58 0.258 0.531 SGR (% d−1 ) 2.84b 2.95ab 2.99ab 3.04a 2.95ab 0.02 0.029 0.022 DGC (% d−1 ) 3.28 3.42 3.55 3.24 3.2 0.07 0.538 0.298

a ab b b ab

FCR (g feed/g gain) 1.80 1.77 1.63 1.62 1.72 0.03 0.033 0.003

I 0 = Control; I 5 = 5 g kg−1 inulin; I 10 = 10 g kg−1 inulin; I 15 = 15 g kg−1 inulin; I 20 = 20 g kg−1 inulin. SEM, standard error of the means; FBW, final body weight; WG, weight gain; SGR, specific growth rate; DGC, daily growth coefficient; FCR, feed conversion ratio.

biometric indexes. Liver and viscera of fish were dissected out and weighed for computation of hepatosomatic index (HSI) and viscerosomatic index (VSI) (Nandakumar et al., 2013). Growth parameters were calculated as below.

Weightgain(g) = FBW(g) − IBW(g)

Survival(%) = (finalcountoffish/initialcountoffish) × 100

Specificgrowthrate(SGR, %/day−) : = [(LnFBW − LnIBW)/60days] × 100

Dailygrowthcoefficient(DGC, %/day) : = [(FBW1/3 − IBW1/3)/60days] × 100

Feedconversionratio(FCR) = feedconsumed(g, dryweight)/weightgain(g)

Conditionfactor(CF, g(cm3)−1) = [(liveweight, g)/(length, cm)3] × 100

Hepatosomaticindex(HSI, %) = (liverweight, g/bodyweight, g) × 100

Viscerosomaticindex(VSI, %) = (visceralweight, g/bodyweight, g) × 100

2.6. Statistical analysis

All treatments were replicated three times and the experimental unit was a tank with 15 fish. Polynomial contrasts were used to detect linear and quadratic effects of various dietary inulin levels on the observed response variables. All the data were subjected to ANOVA to find out the significant difference among treatments. Significant treatment effects were considered at P < 0.05. All the data were analyzed using SAS version 9.3 software.

3. Results

3.1. Growth performance and survival

The growth performance and survival of Asian seabass fed with inulin-supplemented diets are presented in Table 3. Dietary inulin supplementation had a significant effect on specific growth rate (SGR) (linear, P = 0.029; quadratic, P = 0.022) and feed conversion ratio (FCR) (linear, P = 0.033; quadratic, P = 0.003) between the fish fed inulin-supplemented diets and control. However final body weight (FBW) (quadratic, P = 0.0138) and weight gain (WG) (quadratic, P = 0.0150) revealed a quadratic pattern. There was no significant effect of inulin supplementation on survival and daily growth coefficient (DGC) of Asian seabass among various treatments.

3.2. Biometric indexes and whole body composition

The biometric indexes of Asian seabass fed with inulin-supplemented diets are presented in Table 4. There was no dis- cernible effect of inulin supplementation on CF and VSI of Asian seabass. However HSI of Asian seabass exhibited a tendency to increase (linear, P = 0.008; quadratic, P = 0.048) in response to enhanced dietary inulin levels. Whole body composition of

Please cite this article in press as: Raffic Ali, S.S., et al., Effect of dietary prebiotic inulin on growth, body composition and gut microbiota of Asian seabass (Lates calcarifer). Anim. Feed Sci. Tech. (2016), http://dx.doi.org/10.1016/j.anifeedsci.2016.04.011

Asian seabass fed with inulin-supplemented diets is presented in Table 5. Crude protein content of Asian seabass exhibited a tendency to increase linearly and quadratically (linear, P = 0.001; quadratic, P = 0.001) while the ash content showed a quadratic pattern (quadratic, P = 0.001) in response to increased dietary inulin. The moisture and lipid levels did not differ significantly in the treatments.

ARTICLE IN PRESSG ModelANIFEE-13525; No. of Pages 8 S.S. Raffic Ali et al. / Animal Feed Science and Technology xxx (2016) xxx–xxx 5

Table 4 Biometric indexes of Asian sea bass fed experimental diets supplemented with varying levels of inulin for 60 days. Values are means of three replicates.

Parameters I 0 I 5 I 10 I 15 I 20 SEM P values

Linear Quadratic

CF (k) 1.27 1.31 1.28 1.35 1.33 0.02 0.318 0.896 HSI (%) 1.12b 1.36ab 1.52ab 1.58a 1.47ab 0.06 0.008 0.048 VSI (%) 5.43 6.12 5.97 7.48 7.17 0.26 0.114 0.585

I 0 = Control; I 5 = 5 g kg−1 inulin; I 10 = 10 g kg−1 inulin; I 15 = 15 g kg−1 inulin; I 20 = 20 g kg−1 inulin. SEM, standard error of the means; CF, condition factor; HSI, hepatosomatic index; VSI, viscerosomatic index.

Table 5 Whole body composition (g kg−1 dry matter basis) of Asian sea bass fed experimental diets supplemented with varying levels inulin for 60 days. Values are means of three replicates.

Parameters I 0 I 5 I 10 I 15 I 020 SEM P values

Linear Quadratic

Moisture 685.5 684.9 684.6 684.8 685.1 0.17 0.110 0.094 Crude protein 576.2e 586.3d 591.4c 598.9b 619.3a 3.87 0.001 0.001 Crude lipid 148 148.2 148.4 148.5 148.7 0.18 0.496 0.566 Total ash 213.4 214.6 215.9 216.6 214.7 0.57 0.069 0.001

I 0 = Control; I 5 = 5 g kg−1 inulin; I 10 = 10 g kg−1 inulin; I 15 = 15 g kg−1 inulin; I 20 = 20 g kg−1 inulin. SEM, standard error of the means.

F b 4

3

g s i t A b b u n

4

p

ig. 1. Effect of inulin on the gut microbial community in the intestinal contents of Asian Seabass as evaluated by denaturing gradient gel electrophoresis of acterial 16S rRNA amplicons as revealed by the number of operational taxonomic units. (C and 1 = control diet 0 g kg−1 ), (inulin 2 and 3 = 5 g kg−1 ), (inulin

and 5 = 10 g kg−1 ), (inulin 6 and 7 = 15 g kg−1 ), (inulin 8 and 9 = 20 g kg−1 inulin).

.3. PCR-DGGE analysis

The effect of inulin on the gut microbial community in the intestinal contents of Asian seabass as evaluated by denaturing radient gel electrophoresis of bacterial 16S rRNA amplicons is shown in Fig. 1. The PCR-DGGE analysis of gut samples of inulin upplemented and control groups revealed the change in the gut microbial community of Asian seabass. The number of bands n the PCR-DGGE patterns ranged from 4 to 27 depending on the diet. Prominent bands were subjected to sequencing and a otal of 6 species of bacteria were identified from the gut of all fish, Sphingomonas spp., Novosphingobium spp., Lysobacter spp., quincola spp., uncultured Xanthomonadales and uncultured soil bacterium. The results obtained revealed that most of the acteria were culturable whereas some were not. The bacteria were related to those associated with marine sediments and iofilms. Inulin was found to support the growth of bacterial flora as revealed by the number of OTUs (operational taxonomic nits) in the diet containing inulin at 20 g kg−1. The diets supplemented with 5, 10 and 15 g kg−1 showed variations in the umber of OTUs.

Please cite this article in press as: Raffic Ali, S.S., et al., Effect of dietary prebiotic inulin on growth, body composition and gut microbiota of Asian seabass (Lates calcarifer). Anim. Feed Sci. Tech. (2016), http://dx.doi.org/10.1016/j.anifeedsci.2016.04.011

. Discussion

This is the first report on the effect of inulin on growth, body composition and gut microbiota of L. calcarifer. Growth erformance of Asian seabass fed with inulin supplemented diets indicated that inulin supplementation increased SGR and

G Model

ARTICLE IN PRESSANIFEE-13525; No. of Pages 8 6 S.S. Raffic Ali et al. / Animal Feed Science and Technology xxx (2016) xxx–xxx

FCR in a linear as well as quadratic pattern whereas FBW and WG exhibited a quadratic trend. However, dietary inulin had no beneficial effect on survival and DGC. The beneficial effect of inulin supplementation on growth and survival of fish have been reported by earlier workers (Mahious et al., 2006; Bakke-McKellep et al., 2007; Cerezuela et al., 2008; Burr et al., 2010). Blanca Partida-Arangure et al. (2013) reported a survival of 100% and a decrease of the prevalence of white spot syndrome virus (WSSV) to 22.2% in shrimp fed inulin (8 g kg−1 feed) compared to control. It could therefore be inferred that inulin supplementation at 8 g kg−1 is beneficial to shrimp. On the contrary, Akrami et al. (2009) reported a negative relationship between some performance indices viz. WG, SGR, protein efficiency ratio (PER), energy retention (ER), feed efficiency (FE), protein retention (PR) and survival with the supplementation level of inulin, which indicated that inulin was not appropriate for supplementation in the diet of beluga. Fish fed with diets supplemented with 10 and 30 g kg−1 inulin had lower feed intake than that of fish fed with basal and 20 g kg−1 inulin and there were no significant differences in feed intake. This indicated that the poor growth performance of beluga fed with feeds containing inulin at 20 g kg−1 is not because of feed palatability.

The biometric indexes CF and VSI of Asian seabass were not affected by the treatments. The HSI was highest in the group fed with inulin at 15 g kg−1 diet. Condition factor is used to compare the ‘condition’, ‘fatness’ or ‘well-being’ of fish and was based on the hypothesis that heavier fish of a given length was in better condition (Nandakumar et al., 2013). On the contrary, Akrami et al. (2009) reported that there was no significant difference in the CF and HSI of fish fed with 10–30 g kg−1 inulin. Hepatosomatic index is directly related to metabolism as glycogen and lipids can be stored in the liver (Dimitroglou et al., 2010). The whole body composition of Asian seabass was not affected by the treatments with the exception of protein and ash, which exhibited a quadratic pattern. On the contrary, Akrami et al. (2009) reported that there was no significant difference in the proximate composition in the carcass of beluga fed with the test feeds supplemented with inulin at 10–30 g kg−1 in an 8-week feeding experiment. However, fish fed with the basal feed had higher protein content than those fed with prebiotic inulin 10–30 g kg−1 supplemented diets. Similarly Ortiz et al. (2013) reported that in Oncorhynchus mykiss, the addition of inulin showed no significant difference in protein. The whole body composition of fish is often used as an indicator of fish quality. The value of any food product, including fish is a function of nutritional properties. Fishes, both from fresh water and marine environment exhibit variations in the biochemical composition of whole body as well as individual organs and the variations are attributed to many factors including season, feeding, growth, maturation and spawning etc. (Mumba and Jose, 2005).

Polymerase chain reaction and denaturing gradient gel electrophoresis analysis in the present study suggests that inulin supplementation altered the intestinal microbiota community of Asian seabass. It was observed that dietary supplementation of inulin at 20 g kg−1 resulted in clear distinct banding patterns indicating the beneficial effect of dietary inulin modifying the intestinal bacterial communities in Asian seabass. A significant increase in microbial diversity was observed at 20 g kg−1 inulin supplementation in Asian seabass. We identified the following culturable bacteria viz., Novosphingobium spp., Sphingomonas spp., Lysobacter spp., Aquincola spp. and unculturable bacterium Xanthomonadales and a soil bacterium. The ability of inulin to alter the intestinal microbiota at 0, 5, 10 and 15 g kg−1 did not reveal any particular trend.

Majority of the microflora identified have not been reported in the intestinal tract of Asian seabass and they are usually found in oligotrophic environments such as marine sediments and seawater. However, Sphingomonas spp. has been reported in the intestine of gilthead seabream (Floris et al., 2013) and diverse bacterial composition with high genetic variation has been documented. Li et al. (2007) reported uncultured soil bacterium in the gastrointestinal tract of Litopenaeus vannamei fed with short-chain fructooligosaccharides. The bacteria identified from the intestines of all fish, belonged to the phylum proteobacteria. Ray et al. (2010) reported that proteobacteria found in the gastrointestinal tract of Indian carp were shown to produce amylase, cellulase and protease which indicates that these bacteria can be actively involved in the digestion of food in fishes. The bacterial flora of the digestive tract of aquatic organisms reflects various factors, such as the aqueous environment (temperature, salinity, etc.), seasonal variation, diet, fish species and anatomy of gastrointestinal section (Floris et al., 2013).

The microbial species identified viz., Novosphingobium spp. and Sphingomonas spp. are widely reported to occur in water and wastewater and their role in biodegradation, cellulase, anti-bacterials and exo-polymers production has been well documented (Gan et al., 2013). Though we could not find any direct implication for Novosphingobium spp. and Sphingomonas spp. in Asian seabass gut, it could be assumed that they aid digestion of the complex protein-rich feed through their ability to degrade complex organic compounds and release of other exo-polysaccharides that benefit the host. While Lysobacter spp. is known for production of extracellular enzymes and antibiotics (Sullivan et al., 2003), Aquincola spp. and Xanthomonadales are known for their ability to grow on a wide range of organic compounds, degrade and release exo-polysaccharides (Muller et al., 2008).

Our results are in consonance with those reported by Burr et al. (2008) wherein the DGGE banding pattern of subadult fish revealed that microbial communities of fish fed inulin differed from those of fish fed the basal diet. On the contrary, dietary administration of inulin produced a reduction of the diversity of the intestinal microbiota of Atlantic salmon S. salar L. (Bakke-McKellep et al., 2007) and a lower complexity of the PCR-DGGE patterns from the intestinal microbiota of hybrid striped bass Morone chrysops × Morone saxatilis (Burr et al., 2010). Cerezuela et al. (2013) reported that inulin

Please cite this article in press as: Raffic Ali, S.S., et al., Effect of dietary prebiotic inulin on growth, body composition and gut microbiota of Asian seabass (Lates calcarifer). Anim. Feed Sci. Tech. (2016), http://dx.doi.org/10.1016/j.anifeedsci.2016.04.011

causes alterations in the intestinal microbiota by significantly decreasing bacterial diversity, as demonstrated by the specific richness. Bacterial diversity and bacterial composition play an important role in the functioning of microbial ecosystems. The intestinal microbiota of fish play an important role as a defensive barrier against pathogens (Ringo et al., 2010) and it can

G Model A

r n

5

o f o

C

A

F I D p A i

R

A A A

B

B

B

B

B

C

C

D

F

G

G

L

M

M

M M

N

O

P

ARTICLE IN PRESSNIFEE-13525; No. of Pages 8 S.S. Raffic Ali et al. / Animal Feed Science and Technology xxx (2016) xxx–xxx 7

egulate the expression of great numbers of genes in the digestive tract implied in the epithelial proliferation, promotion of utrient, metabolism and immune response.

. Conclusion

Results from this study showed that inulin supplementation has got beneficial effect on growth, FCR and gut microbiota f Asian seabass. Supplementation of inulin at 15 g kg−1 was found to be beneficial in the diet of Asian seabass. However, urther studies are required to conclusively ascertain the prebiotic effect of inulin supplementation and to arrive at the ptimal level of inclusion for improving the growth performance and microbial diversity.

onflicts of interest

The authors declare that there are no conflicts of interest.

cknowledgements

The authors are grateful to the Indian Council of Agricultural Research, New Delhi for the project on Outreach activity on ish feeds. Authors express their sincere thanks to Dr. A.G. Ponniah, Former Director and Dr. K.K. Vijayan, Director, Central nstitute of Brackishwater Aquaculture for providing necessary facilities for carrying out this work. They are also thankful to r. G. Gopikrishna, Head, Nutrition Genetics and Biotechnology Division of CIBA and Mr. J. Ashok Kumar, Senior Scientist for roviding necessary help and guidance. The authors are grateful to Dr. S.V. Alavandi, Principal Scientist and Head, Aquatic nimal Health and Environment Division of CIBA and Dr. N. Dineshkumar, Senior Research Scholar for their generous help

n microbial diversity analysis.

eferences

OAC, 2012. Official Methods of Analysis of the Association of Official Analytical Chemists, 19th ed. AOAC, Arlington, VA, USA. PHA/AWWA/WPCF, 1998. Standard methods for the examination of water and waste water, 20th ed. American Public Health Association, New York. krami, R., Abdolmajid, H., Abbas, M., Abdolmohammad, A.K., 2009. Effect of dietary prebiotic inulin on growth performance, intestinal microflora, body

composition and hematological parameters of juvenile Beluga, Huso huso (Linnaeus, 1758). J. World Aquacult. Soc. 40, 771–779. akke-McKellep, A.M., Penn, M.H., Salas, P.M., Refstie, S., Sperstad, S., Landsverk, T., 2007. Effects of dietary soybean meal, inulin and oxytetracycline on

gastrointestinal histological characteristics, distal intestine cell proliferation and intestinal microbiota in Atlantic salmon (Salmo salar L.). Br. J. Nutr. 97, 699–713.

iswas, G., Thirunavukkarasu, A.R., Sundaray, J.K., Kailasam, M., 2010. Optimization of feeding frequency of Asian seabass (Lates calcarifer) fry reared in net cages under brackishwater environment. Aquaculture 305, 26–31.

lanca Partida-Arangure, O., Luna-Gonzalez, A., Jesus Fierro-Coronado, A., Del Carmen Flores-Miranda, M.A., Hector Gonzalez-Ocampo, A., 2013. Effect of inulin and probiotic bacteria on growth, survival, immune response, and prevalence of white spot syndrome virus (WSSV) in Litopenaeus vannamei cultured under laboratory conditions. Afr. J. Biotechnol. 12 (21), 3366–3375.

urr, G., Hume, M., Neill, W.H., Gatlin III, D.M., 2008. Effects of prebiotics on nutrient digestibility of soybean-meal-based diets by red drum (Sciaenops ocellatus). Aquacult. Res. 39, 1680–1686.

urr, G., Hume, M., Ricke, S., Nisbet, D., Gatlin III, D.M., 2010. In vitro and in vivo evaluation of the prebiotics GroBiotic-A, inulin, mannanoligosaccharide, and galactooligosaccharide on the digestive microbiota and performance of hybrid striped bass (Morone chrysops × Morone saxatilis). Microb. Ecol. 59, 187–198.

erezuela, R., Cuesta, A., Meseguer, J., Esteban, M.A., 2008. Effects of inulin on gilthead seabream (Sparus aurata L.) innate immune parameters. Fish Shellfish Immunol. 24, 663–668.

erezuela, R., Fumanal, M., Silvana Teresa, T.P., Meseguer, J., Angel Morinigo, M., Esteban, M.A., 2013. Changes in intestinal morphology and microbiota caused by dietary administration of inulin and Bacillus subtilis in gilthead sea bream (Sparus aurata L.) specimens. Fish Shellfish Immunol. 34, 1063–1070.

imitroglou, A., Merrifield, D.L., Spring, P., Sweetman, J., Moate, R., Davies, S.J., 2010. Effects of mannanoligosaccharide (MOS) supplementation on growth performance feed utilization, intestinal histology and gut microbiota of gilthead sea bream (Sparus aurata). Aquaculture 300, 182–188.

loris, R., Manca, S., Fois, N., 2013. Microbial ecology of intestinal tract of gilthead sea bream (Sparus aurata Linnaeus, 1758) from two coastal lagoons of Sardinia (Italy). Transit. Waters Bull. 2, 4–12.

an, H.M., Hudson, A.O., Abdul Rahman, A.Y., Chan, K.G., Savka, M.A., 2013. Comparative genomic analysis of six bacteria belonging to the genus Novosphingobium insights into marine adaptation, cell–cell signaling and bioremediation. Genomics 14, 1–14.

ibson, G.R., Probert, H.M., Van Loo, J., Rastall, A.R., Roberfroid, M., 2004. Dietary modulation of the human colonic microbiota updating the concept of prebiotics. Nutr. Res. Rev. 17, 259–275.

i, P., Burr, G., Gatlin III, D.M., Hume, M., Patnaik, S., Castille, L., Lawrence, L., 2007. Dietary supplementation of short-chain fructooligosaccharides influences gastrointestinal microbiota composition and immunity characteristics of Pacific White Shrimp, Litopenaeus vannamei, cultured in a recirculating system. J. Nutr. 137, 2763–2768.

ahious, A.S., Gatesoupe, F.J., Hervi, M.R., Metailler, R., Olivier, F., 2006. Effect of dietary inulin and oligosaccharides as prebiotics for weaning turbot, Psetta maxima (Linnaeus, C. 1758). Aquacult. Int. 14, 219–229.

uller, R.H., Rohwerder, T., Harms, H., 2008. Degradation of fuel oxygenates and their main intermediates by Aquincola tertiaricarbonis L108. Microbiology 154, 1414–1421.

umba, P.P., Jose, M., 2005. Nutrient composition of selected fresh and processed fish species from Lake Malawi. Int. J. Consum. Stud. 29, 72–77. uyzer, G., Brinkhoff, T., Nubel, U., Santegoeds, C., Schafer, H., Wawer, C., 1998. Denaturing gradient gel electrophoresis (DGGE) in microbial ecology. Mol.

Microb. Ecol. 3, 1–27. andakumar, S., Ambasankar, K., Syamadayal, J., Raman, C., Syed Raffic Ali, S., 2013. Fish meal replacement with chicken waste meal in Asian seabass

Please cite this article in press as: Raffic Ali, S.S., et al., Effect of dietary prebiotic inulin on growth, body composition and gut microbiota of Asian seabass (Lates calcarifer). Anim. Feed Sci. Tech. (2016), http://dx.doi.org/10.1016/j.anifeedsci.2016.04.011

(Lates calcarifer) feeds. Indian J. Fish 60, 109–114. rtiz, L.T., Rebole, A., Velasco, S., Rodriguez, M.L., Trevino, J., Tejedor, J.L., 2013. Effects of inulin and fructooligosaccharides on growth performance, body

chemical composition and intestinal microbiota of farmed rainbow trout (Oncorhynchus mykiss). Aquac. Nutr. 19, 475–482. onnusamy, L., Xu, N., Stav, G., Wesson, D.M., Schal, C., Apperson, C.S., 2008. Diversity of bacterial communities in container habitats of mosquitoes.

Microb. Ecol. 56, 593–603.

G Model

ARTICLE IN PRESSANIFEE-13525; No. of Pages 8 8 S.S. Raffic Ali et al. / Animal Feed Science and Technology xxx (2016) xxx–xxx

Ray, A.K., Roy, T., Mondal, S., Ringo, E., 2010. Identification of gut-associated amylase, cellulase and protease-producing bacteria in three species of Indian major carps. Aquacult. Res. 4, 1462–1469.

Ringo, E., Olsen, R.E., Gifstad, T.O., Dalmo, R.A., Amhund, H., 2010. Prebiotics in aquaculture: a review. Aquacult. Nutr. 16, 117–136. Roberfroid, M., 2005. Introducing inulin-type fructans. Br. J. Nutr. 93 (Suppl. 1), 13–25.

Please cite this article in press as: Raffic Ali, S.S., et al., Effect of dietary prebiotic inulin on growth, body composition and gut microbiota of Asian seabass (Lates calcarifer). Anim. Feed Sci. Tech. (2016), http://dx.doi.org/10.1016/j.anifeedsci.2016.04.011

Sullivan, R.F., Holtman, M.A., Zylstra, G.J., White, J.F., Kobayashi, D.Y., 2003. Taxonomic positioning of two biological control agents for plant diseases as Lysobacter enzymogenes based on phylogenetic analysis of 16S rDNA, fatty acid composition and phenotypic characteristics. J. Appl. Microbiol. 94, 1079–1086.

Wright, E.S., Yilmaz, L.S., Noguera, D.R., 2011. DECIPHER a search-based approach to chimera identification for 16S rRNA sequences. Appl. Environ. Microbiol. 78, 717–725.