biology manuscript assignment

profilemralmizal
manuscript_assigment_student_example.pdf

1

Invertases’ optimum environment, primary functions, and important role in injury response

XXXXX1, John Doe2, Jane Doe3 Correspondence should be addressed to xxxxxx. Email: [email protected]

1 Department of Biological Sciences, Molecular and Cellular Biology Lab; Eastern Illinois University, Charleston, IL, 61950; United States of America 2 Department of Biological Sciences, Molecular Plant Physiology Lab; Eastern Illinois University, Charleston, IL, 61950; United States of America 3 Department of Biological Sciences, Environmental Biology; Eastern Illinois University, Charleston, IL, 61950; United States of America

2

Summary

Invertase is a vitally important enzyme required to maintain successful

metabolism and energy supply within the plant tissue. Invertase is involved in

every aspect of plant development, growth, and tissue repair and defense. In this

study we perform DNA sequencing and find the optimum pH and temperature at

which invertase cleaves sucrose in the leaf tissue of Arabidopsis thaliana. We

found the optimal temperature and pH for invertase to be 35°C and 7

respectively.

Graphical Abstract: Invertase breakdown of Sucrose into Fructose and Glucose.

3

Highlights

• The invertase gene was found to be 1,656 bp in length.

• Invertase activity peaks when the pH of the cell is 7.

• Invertase activity peaks when the temperature of the cell is 35°C.

Introduction

Invertase is an enzyme found in most plant species. The purpose of

invertase is to cleave sucrose within the plant into the two monosaccharaides

(Sturm and Tang, 1999), glucose and fructose, in an irreversible hydrolysis

(Xiang et al., 2011). The use of sucrose to be cleaved into hexoses (glucose and

fructose) provides carbon and energy to the plant tissues (Sturm, 1999). The

produced hexoses are vitally important to the overall metabolism, development,

growth, and protection of the plant. Energy, in the form of hexoses, is required for

tissue growth and cell elongation in the growing or recovering plant (Sturm,

1999). Invertase provides the sugar resources to the sink tissue of the plant

influencing where energy is used and where growth occurs in the plant (Heyer et

al., 2003). The effect of invertase on development is extends to the endosperm

and seeds, establishing sink strength (Sturm and Tang, 1999). In addition to

normal growth and development, invertase is produced in the areas directly

around plant injury or infection (Zhang et al., 1996) as the plant’s metabolism

drastically increases in response to the injury and hexose is in high demand to

4

meet the energy needs of tissue repair (Herbers et al., 1996). This has been

shown by finding high levels of invertase and the rapid production of hexoses in

the area around tissue wounds and infection (Sturm and Tang, 1999).

The overall function of invertase in the plant shows the presence of

organism-wide regulation of metabolic activity, growth, development, and injury

or infection repair based on the ability to use sucrose to produce energy when

and where it is needed (Smeekens, 1998; Sturm, 1999). In Arabidopsis thaliana,

six invertase genes have been found and are expressed throughout the plant,

including stems, leaves, roots, flowers, and seeds (Sherson et al., 2002). This

study used leaf tissue, isolating the DNA sequence and finding the pH and

temperature optima for invertase found in the leaves of Arabidopsis thaliana.

Results and Discussion

Optimum Temperature

Figure 1 shows a varying result in temperature optimum of invertase. The

peak temperature optimum is found to be 30º C with a glucose/min output of

389.4. As Figure 1 shows, another smaller peak occurs at 55º C and an output of

385.2 glucose/min. This optimum temperature range may correlate to the

internal temperatures of the plant at critical life stages such as: a developing

seed in the ground and the need for increased sucrose cleavage is present, and

in the summer months when environmental temperature, heat of the sun, and

internal metabolism may cause a high internal temperature.

5

Optimum pH

Figure 2 shows the range of pH optimum for invertase in Arabidopsis

thaliana. There is a clear range of optimum glucose activity found between a pH

of 4 and 8. This is consistent with the finding that the optimum curve of

intracellular invertase activity is rather broad (Goetz and Roitsch, 1999). This

range fits into to the finding that vacuolar and cell wall invertases cleave Sucrose

most efficiently between pH 4.5 and 5 (Sturm, 1999). The peak optimum found in

our testing specific to Arabidopis thaliana invertase occurs at a pH of 7 with a

release of 450.3 glucose/min. When invertase is exposed to it’s optimum

temperature of 35°C and pH of 7, it is best able to perform the vitals plant

functions listed in Figure 3.

DNA Sequence Analysis

Our DNA sequence analysis found the invertase from leaf tissue of the

Arabidopsis thaliana to be 1656 bp in length. The exact sequence is shown in

Figure 4 below.

Experimental Procedures

DNA Isolation

Sequencing of the DNA was performed with 1 g of fresh leaf tissue. The

selected tissue was ground with a mortar and pestle and the genomic DNA was

extracted using a “Quick DNA” kit from Bio Rad. PCR was utilized to amplify the

gene using primers INV-F and INV-R. The PCR mixture included 22 µL of “Quick

6

PCR Reagent” (Bio-Rad) with 1 µL of genomic DNA and 1 µL of each primer.

Thermocycler conditions were: 94°C for 10 min followed by 35 cycles of [94°C for

30 s, 55°C for 30 s, 72°C for 1 min] and finished with 72°C for 10 min. The

amplified product was sent to TCAG Laboratories for sequencing.

pH Activity

Extraction of the enzyme was performed by grinding 1 g of fresh leaf

tissue with a mortar and pestle using a buffer comprised of 50 mM Tris (pH 7.0),

2 mM EDTA, 2 mM MgCl2. The extract was centrifuged at 13,000 rpm for 10 min

at 4° C, then the supernatant was collected for the activity analyses. Activity was

measured using a glucose oxidase assay kit (Bio-Rad) measuring the amount of

glucose released per minute. The reaction buffer was 40 mM HEPES, 1 M

sucrose, 2 mM EDTA, and 2 mM MgCl2. For the pH studies, the HEPES buffer

was changed from 1 – 14 at 30°C. And for the temperature studies, the pH was

7 and temperature changed from 5 - 70°C.

7

References:

Goetz, M. and Roitsch, T. (1999). The different pH optima and substrate specificities of extracellular and vacuolar invertases from plants are determined by a single amino-acid substitution. Plant J. 20, 707 – 711. Herbers K., Meuwly P., Frommer W.B., Metraux J.P., Sonnewald U. (1996). Systemic acquired resistance mediated by the ectopic expression of invertase: possible hexose sensing in the secretory pathway. Plant Cell 8, 793 – 803. Heyer, A. G., Raap, M., Schroeer, B., Marty, B., and Willmitzer, L. (2004). Cell wall invertase expression at the apical meristem alters floral, architectural, and reproductive traits in Arabidopsis thaliana. Plant J. 39, 161-169. Sherson, S., Alford, H., Forbes, S., Wallace, G., and Smith, S. (2003). Roles of cell-wall invertases and monoscaccharide transports in the growth and development of Arabidopsis. J. Exp. Bot. 54(382), 525 – 531. Smeekens, S. (1998). Sugar regulation of gene expression in plants. Current Op. in Plant Biol. 1(3), 230-234. Strum, A. (1999). Invertases. Primary structures, functions, and roles in plant development and sucrose partitioning. Plant Physiol. 121(1), 1 – 8. Sturm, A. and Tang, G. (1999). The sucrose-cleaving enzymes of plants are crucial for development, growth, and carbon partitioning. Trends in Plant Sci. 4(10), 401 – 407. Xiang, L., Le Roy, K., Bolouri-Moghaddam, M., Vanhaecke, M., Lammens, W., Rolland, F., and Van den Ende, W. (2011). Exploring the neutral invertase- oxicative stress defense connection in Arabidopsis thaliana. J. Exp. Bot. 62(11), 3849-3862. Zhang, L., Cohn, N. S., and Mitchell, J. P. (1996). Induction of a pea cell-wall invertase gene by wounding and its localized expression in Phloem. Plant Physiol. 112(3), 1111 – 1117.

8

Figure Legends Figure 1. The effect of temperature on invertase activity (data are represented as mean +/- SEM). Figure 2. The effect of pH on invertase activity (data are represented as mean +/- SEM). Figure 3. A list of the functions of Cell wall and Vacuolar Invertases. (Sturm and Tang, 1999) Figure 4. DNA sequencing of invertase from Arabidopsis thaliana. Tables

Figure 1.

0

50

100

150

200

250

300

350

400

450

500

0 5 10 15 20 25 30 35 40 45 50 55 60 65 70

In ve

rt as

e A

ct iv

ity (

gl uc

os e/

m in

)

Temperature (ºC)

9

Figure 2.

Functions of Invertases

Cell Wall Invertase

Sucrose partitioning between source and sink organs.

Response to wounding and infection. Control of cell differentiation.

Vacuolar Invertase

Osmoregulation and cell enlargement.

Control of sugar composition in fruits and storage organs. Response to cold (cold sweetening).

Figure 3.

0

50

100

150

200

250

300

350

400

450

500

0 1 2 3 4 5 6 7 8 9 10 11 12 13 14

In ve

rt as

e A

ct iv

ity (

gl uc

os e/

m in

)

pH

10

ATGGAAGGTGTTGGACTAAGAGCTGTAGGATCACACTGTTCTTTATCTGAGATGGATGA TCTTGATTTGACTCGAGCTTTGGATAAACCAAGATTGAAGATCGAAAGGAAGAGATCGT TTGATGAAAGATCGATGAGTGAGCTATCGACTGGTTACAGTAGACATGACGGTATACAC GATTCGCCGCGAGGTAGATCGGTGCTTGATACGCCTCTTTCTTCTGCTAGAAACTCCTTT GAGCCTCATCCTATGATGGCTGAAGCTTGGGAGGCTTTAAGAAGGTCAATGGTCTTCTTC CGTGGTCAACCTGTTGGTACTCTTGCCGCGGTTGATAATACTACCGATGAAGTCTTGAAC TATGATCAGGTGTTTGTGAGGGATTTTGTACCGAGTGCGTTGGCGTTTCTGATGAATGG AGAACCGGATATAGTGAAGCATTTTTTGCTTAAGACACTTCAGCTGCAAGGTTGGGAGA AACGTGTGGATCGGTTTAAGTTAGGAGAAGGTGTGATGCCTGCAAGTTTCAAGGTGCTT CATGATCCTATCCGTGAAACGGATAACATTGTTGCGGATTTCGGTGAGAGTGCTATTGG ACGTGTGGCTCCTGTAGATTCAGGGTTCTGGTGGATTATTCTTCTTCGTGCTTATACCAA ATCTACTGGAGATTTGACTCTCTCTGAGACACCAGAGTGTCAAAAGGGAATGAAACTGA TCTTGTCTTTGTGCTTAGCTGAAGGGTTTGACACGTTTCCTACACTGCTTTGTGCTGATG GATGTTCCATGATTGATCGAAGAATGGGTGTTTATGGGTATCCCATTGAGATCCAAGCG TTGTTCTTCATGGCTTTGAGATCTGCTTTGTCGATGTTAAAGCCCGATGGAGATGGCAGA GAGGTCATTGAGAGGATCGTTAAGCGACTTCATGCCTTGAGCTTCCATATGCGCAATTAC TTCTGGCTTGATCATCAGAACCTCAATGACATTTACAGGTTCAAGACTGAGGAATACTCT CACACGGCGGTGAACAAGTTCAATGTGATGCCTGATTCTATACCCGAGTGGGTTTTCGAC TTCATGCCTCTCCGTGGAGGCTACTTTGTGGGAAACGTAGGACCTGCCCATATGGATTTC CGGTGGTTCGCACTCGGTAATTGTGTCTCCATACTTTCTTCATTGGCCACTCCAGATCAA TCCATGGCCATTATGGACCTCCTTGAGCACCGGTGGGCAGAGCTTGTAGGTGAGATGCCT CTCAAGATTTGTTATCCATGCCTCGAGGGCCATGAGTGGCGCATCGTTACTGGCTGTGAC CCCAAGAACACACGGTGGAGCTACCACAATGGTGGATCTTGGCCAGTTTTGCTGTGGCAG CTAACAGCAGCGTGCATTAAGACAGGGAGACCGCAGATCGCAAGACGCGCGGTTGACCTC ATAGAATCGCGTCTTCACCGAGACTGTTGGCCAGAGTATTACGACGGTAAGCTCGGAAGG TACGTTGGAAAACAGGCAAGGAAATACCAGACTTGGTCAATCGCAGGTTACTTAGTGGC GAAAATGTTGCTAGAAGATCCTTCACACATTGGTATGATCTCTCTTGAAGAAGACAAAC TCATGAAACCAGTCATCAAGCGATCTGCGTCTTGGCCACAACTCTGA

Figure 4.