Gene X Envioroment (GXE) Qustions reguarding artcle to answer
Genes in Context Gene–Environment Interplay and the Origins of Individual Differences in Behavior Frances A. Champagne and Rahia Mashoodh
Columbia University
ABSTRACT—Interactions between genes and the environ-
ment are a critical feature of development. Insights into the
dynamic interplay between these factors have come from
laboratory studies exploring experience-dependent chan-
ges in gene function, which illustrate the importance of
environmental factors in determining activity of the genome.
These studies have implications for our understanding of
the origins of individual differences in behavior and may
provide new ways of thinking about the transmission of
traits across generations. Here we will highlight how these
new findings illustrate the importance of putting genes in
context.
KEYWORDS—epigenetic; gene–environment; DNA methyl-
ation; inheritance; individual differences
Historically, the question of the origins of individual differences
in personality, aptitudes, and even physical features has led
to debates over nature versus nurture. However, it is becoming
increasingly clear that creating a division between genes and
environment limits our understanding of the complex biological
processes through which individual differences are achieved.
The reality that the interaction between genes and environment
is a critical feature of development is emerging as a central
theme in laboratory studies and longitudinal analyses in human
populations. However, appreciating the existence of this inter-
action is simply the first step in broadening our theoretical ap-
proach to the study of behavior. To move forward, we must ask
‘‘What do genes do?’’ and ‘‘How do genes and environments
interact?’’ Recent studies combining molecular biology with the
study of behavior may provide insight into these issues and
perhaps even call into question our current understanding of
mechanisms involved in the transmission of traits across gen-
erations. Here we will highlight these new findings and illustrate
the importance of putting genes in context.
LABORATORY AND LONGITUDINAL APPROACHES TO
GENE–ENVIRONMENT INTERACTIONS
Though recentadvances in our ability to detect genetic variations
have led to rapid progress in the study of gene-by-environment
(G � E) effects, clues that G � E was critical in considering the origins of behavior have been available for a long time. In 1958,
Cooper and Zubek published a report in which rats selectively
bred to be either ‘‘maze-dull’’ or ‘‘maze-bright’’ were reared after
weaning in either ‘‘enriched’’ environments containing increased
sensory stimuli or ‘‘impoverished’’ environments containing
limited sensory stimuli (Cooper & Zubek, 1958). In the rats
reared under standard conditions, stable and heritable group
differences in cognitive ability were observed in adulthood.
However, maze-dull animals reared in an enriched environment
showed a significant improvement in learning ability, and maze-
bright animals reared under impoverished conditions showed a
significant decline in performance. This study provides evidence
that, even when considering a genetically derived characteristic,
our prediction of behavior must incorporate knowledge of the
environmental context of development.
A more recent example of G � E comes from the Dunedin longitudinal study (Caspi et al., 2003), which explored the roles
of variation in a gene that alters serotonin levels and exposure to
stressful life events across a 20-year period in determining risk of
depression. Levels of serotonin within neural circuits are altered
by the number of serotonin transporter proteins, and in humans
there aregeneticvariations that leadtoeitherhigh or lowlevelsof
the serotonin transporter. The serotonin system has been impli-
cated in variations in mood, and this system is the target of most
pharmacological interventions in the treatment of depression.
Among individuals within the Dunedin study, risk of depression
was predicted by the interaction of serotonin transporter geno-
type andthe numberofstressful life eventsexperienced.Thus, no
differences in risk of depression emerged as a function of geno-
Address correspondence to Frances A. Champagne, Columbia Uni- versity, Department of Psychology, 406 Schermerhorn Hall, 1190 Amsterdam Avenue, New York, NY 10027; e-mail: fac2105@colum- bia.edu.
CURRENT DIRECTIONS IN PSYCHOLOGICAL SCIENCE
Volume 18—Number 3 127Copyright r 2009 Association for Psychological Science at WALDEN UNIVERSITY on March 23, 2016cdp.sagepub.comDownloaded from
type when the number of stressful life events was low. However,
when an individual had experienced a high frequency of stressful
events, genotype effects were observed, with individuals pos-
sessing the low-serotonin-transporter-level gene variant being at
greater risk of depression. Though certain genetic variations can
lead to risk or resilience to psychological disorder (see Kim-
Cohen & Gold, 2009, this issue), this ‘‘potential’’ may not be
observed unless variation in the environment is considered.
CONTEXTUAL DETERMINANTS OF GENE FUNCTION
Empirical findings from G � E studies raise an important question: ‘‘If the effects of genetic variation can vary depending
on characteristics of the environment, then what are environ-
ments doing to genes to alter their impact?’’ To address this
question, we must first address the following question: ‘‘What do
genes do?’’ Historically, gene was a term used to describe a unit
of heritable material. Since the discovery of DNA, the study of
genetics has come to mean the study of DNA, with gene defined
as a particular sequence of DNA. Due to the complex nature of
DNA, it is perhaps easier to employ an analogy that conveys the
basic notions of gene function. Think of an individual’s DNA as
books in a library that have been ordered and arranged very
precisely by a meticulous librarian. These books contain a
wealth of knowledge and the potential to inspire whoever should
choose to read them. Asking what DNA does is like asking what a
book in this library does. Books sit on a shelf waiting to be read.
Once read, the information in those books can have limitless
consequences. Likewise, DNA sits in our cells and waits to
be read by an enzyme called RNA polymerase, leading to the
production of messenger RNA (mRNA)—a process referred to as
transcription (Fig. 1a). The mRNA transcript is a copy of the
DNA sequence that can further be ‘‘translated’’ into protein. The
reading, or expression, of DNA can, like the books in our library,
have limitless consequences. However, without the active pro-
cess that triggers such expression, this potential may never
be realized. Importantly, it is the environment around the DNA
that contains those critical factors that make it possible to read
the DNA (Fig. 1b; also see Cole, 2009, this issue, for extended
discussion of the regulation of gene expression).
The control of gene expression is ultimately determined by
how accessible the sequence of DNA is to factors within the cell
that are involved in transcription. Influences that determine the
expression of DNA without altering the sequence of DNA are
referred to as epigenetic, meaning ‘‘in addition to genetic.’’ One
particular epigenetic mechanism that may have consequences
for long-term changes in gene activity is DNA methylation (Fig.
1c). DNA can become modified through the addition of a methyl
chemical group to particular sites within the gene sequence.
DNA methylation typically reduces the accessibility of DNA and
can lead to ‘‘silencing’’ of the gene (Razin, 1998). In the library
analogy, one can think of multiple factors that will influence the
likelihood a book will or will not be read. Even books containing
very valuable information may sit undisturbed and unread,
gradually collecting dust. This may be particularly true if the
book is hard to get to. It may be located on a shelf that is par-
ticularly difficult to reach or blocked by some piece of furniture.
DNA methylation reduces the likelihood of transcription much
in the same way that shifting furniture in a library can reduce the
likelihood that a book will be read. The gene is there, but sits
unread, collecting dust.
ENVIRONMENTAL INFLUENCES ON GENE ACTIVITY
A recent breakthrough in our understanding of gene–environ-
ment interplay comes from studies exploring the epigenetic
processes that are altered by an individual’s experiences during
development. Based primarily on studies in rodents, these par-
adigms address the question raised by G � E research: ‘‘What are environments doing to genes to alter their impact?’’ In ro-
dents, variations in maternal care lead to individual differences
in the expression of genes that alter the stress response. Low
levels of glucocorticoid receptors (GR) within the hippocampus,
a brain region critical for learning and memory, result in a pro-
longed response to stress. Analysis of DNA methylation within
the regulatory region of the GR gene indicates that low levels of
ACTAGGCTAGATTCAGGATCTTAG “Active” Gene
ACTAGGCTAGATTCAGGATCTTAG
M
M
M
M M
M
Transcription a
b
c
ACTAGGCTAGATTCAGGATCTTAG MM M M M x “Silent”
Gene
Fig. 1. Illustration of the epigenetic control of gene expression and the environmental context of DNA. As shown in the top panel (A), genes consist of a sequence of DNA consisting of ‘‘C,’’ ‘‘T,’’ ‘‘A,’’ and ‘‘G’’ nucleotides preceded by a promotor region of DNA (the black bar). The promoter region responds to factors that control the likelihood of transcription (reading of the DNA). In order for transcription to occur, enzymes that ‘‘read’’ the DNA (the gray oval) must bind to the promotor region of the gene. When this occurs, the gene is ‘‘active’’ and can alter the function of the cell. The environmental context of the gene, shown in the middle panel (B), includes factors that increase gene activity (i.e., enzymes that read the DNA, shown as gray ovals) and factors that decrease gene activity (i.e., methyl groups, illustrated as circles labeled ‘‘M’’); these factors will determine the likelihood that a gene will be expressed. When a methyl chemical group attaches to the promotor region, as shown in the bottom panel (C), the enzymes that transcribe DNA are blocked and the gene becomes ‘‘silent’’; this is referred to as DNA methylation.
128 Volume 18—Number 3
Genes in Context
at WALDEN UNIVERSITY on March 23, 2016cdp.sagepub.comDownloaded from
maternal care are associated with elevated levels of DNA
methylation, which epigenetically silence this gene (Weaver
et al., 2004). Moreover, the epigenetic status of the GR gene can
be targeted pharmacologically in adulthood. Treatment with a
drug that promotes increases in accessibility of DNA results in
decreased GR methylation and a dramatic shift in the phenotype
of adult offspring who received low levels of maternal care
(Weaver et al., 2004). Conversely, when adult offspring who
experienced high levels of care are treated with a drug that in-
creases the availability of methyl groups within the brain, they
become indistinguishable from offspringwho received low levels
of maternal care (Weaver et al., 2005). These dynamic altera-
tions in DNA methylation in adulthood have also been observed
in studies of learning and memory (Miller & Sweatt, 2007). The
experience of learning is associated with rapid changes in
methylation of genes within the hippocampus, and if DNA
methylation is inhibited there will be impairment in memory for
the experience. These studies illustrate the role of epigenetic
mechanisms in shaping the activity of the genome in response
to environmental cues and demonstrate the plasticity that is
possible through shifts in DNA methylation.
The prenatal period is characterized by rapid changes in brain
development and is thus a sensitive time during which the
quality of the environment can exert sustained effects on func-
tioning. In rodents, exposure to chronic variable stress during
the first trimester is associated with increased methylation of the
regulatory region of the GR gene (Mueller & Bale, 2008). This
effect could potentially be mediated by (a) stress-induced de-
creases in postnatal maternal behavior (Champagne & Meaney,
2006), (b) alterations to gene expression in the placenta (Mueller
& Bale, 2008) that may restrict access of the fetus to maternal
resources, or (c) a direct influence of maternal stress hormone on
fetal gene expression. Modification to the fetal ‘‘epigenome’’ can
also be achieved through variations in maternal diet during
pregnancy. A striking example of this phenomenon comes from
work with a mouse model in which a mutation of the Agouti gene
leads to alterations in coat color and metabolism. The severity of
the effects of this mutation depends on the level of DNA meth-
ylation of the Agouti gene; high levels of DNA methylation will
epigenetically silence this mutation and induce a ‘‘pseudo-
agouti’’ mouse that is comparable in phenotype to a mouse
without the mutation. When pregnant female mice with the
Agouti mutation are placed on a diet that is rich in methyl groups,
the methylation status of this gene is altered such that offspring
develop a pseudoagouti phenotype (Dolinoy, 2008). Thus, ex-
perience-dependent change in the epigenetic status of genes is
not limited to the postnatal period.
IMPLICATIONS OF GENE–ENVIRONMENT INTERPLAY
FOR PSYCHOLOGICAL FUNCTIONING
The molecular processes described in laboratory studies may
also be critical in understanding the origins of individual
differences in humans. Analyses of DNA methylation in cells
extracted from fetal cord blood suggest that antenatal maternal
depression and anxiety during the third trimester can lead to
increased levels of DNA methylation of the GR gene promotor
region, having consequences for the stress response of infants at
3 years of age (Oberlander et al., 2008). These effects emerge
even in the absence of depression-induced decreases in post-
natal mother–infant interactions. The stability of DNA methyl-
ation also permits analysis of the epigenetic status of genes in
postmortem brain tissue, which can be correlated to life expe-
riences and psychological functioning. In a recent study, DNA
methylation of ribosomal genes in hippocampal tissue of suicide
victims with a history of abuse and neglect was compared to that
of controls. Elevated levels of methylation were detected in
ribosomal RNA genes among suicide victims (McGowan et al.,
2008), and this effect was found to be specific to the hippo-
campus. Ribosomes are critical for the production of proteins
and thus serve as a critical link between the expression of genes
and the level of protein created.
Studies of monozygotic (MZ) twins also provide important
insights into epigenetic effects in humans. Comparison of the
gene expression of 3-year-old and 50-year-old MZ twins indi-
cates a higher level of discordance in patterns of gene expression
among older twins that is associated with increasing differences
in DNA methylation in older compared to younger twins (Fraga
et al., 2005). Though it is unknown whether concordance in
young twins is due to germ-line (the cells that transmit genetic
material across generations) or prenatal factors and whether the
emerging discordance is random or driven by specific environ-
mental events, there is evidence that epigenetic variation in MZ
twins may account for differential risk of mental illness. Analysis
of methylation patterns within the catechol-O-methyltransferase
(COMT) gene in tissue samples from 5-year-old MZ twins indi-
cates varying degrees of discordance, with some MZ twin pairs
showing a high degree of discordance and others being very
similar in epigenetic status (Mill et al., 2006). COMT is an en-
zyme involved in the inactivation of neurotransmitters such as
dopamine and norepinephrine, and disruptions in these neuro-
transmitter systems have been implicated in many forms of
psychopathology. The divergence in methylation of the COMT
gene within these twin pairs may predict differential risk of
neurodevelopmental disorder in later life. Incorporating epige-
netic analysis into twin studies represents a novel approach to
the study of the origins of individual differences.
TRANSMISSION OF TRAITS ACROSS GENERATIONS:
RETHINKING INHERITANCE
In addition to shaping developmental trajectories within an
individual’s life span, DNA methylation may also have impli-
cations for the transmission of traits from one generation to the
next. There are two distinct pathways through which this
transmission can occur: (a) the behavioral transmission of traits
Volume 18—Number 3 129
Frances A. Champagne and Rahia Mashoodh
at WALDEN UNIVERSITY on March 23, 2016cdp.sagepub.comDownloaded from
through experience-dependent changes in the methylation of
genes, and (b) environmental effects that change DNA methyl-
ation in germ cells and are thus transmitted through the germ
line of subsequent generations. An example of the first pathway
comes from studies of the transmission of maternal care across
generations. Variations in maternal care in rodents have been
demonstrated to alter the epigenetic status of hypothalamic es-
trogen receptors of female offspring (Champagne et al., 2006).
These receptors are critical in regulating maternal behavior and
coordinate the sensitivity of females to hormonal cues. Experi-
ence of low levels of maternal care in infancy is associated with
increased estrogen receptor promotor methylation, decreased
receptor expression, and subsequent decreases in the adult
maternal behavior of these offspring. Thus, there is a behavioral
transmission of individual differences in maternal care across
generations. Interestingly, the quality of environmental condi-
tions experienced by these females at later periods in develop-
ment can alter this transgenerational inheritance. Prolonged
social isolation from peers and prenatal stress can lead to re-
ductions in maternal care that are passed on to subsequent
generations (Champagne & Meaney, 2006, 2007). These studies,
which are conducted in rodents that have limited genetic vari-
ability, suggest that similarities in traits between parental and
offspring generations involve far more than the inheritance
of genes.
Though epigenetic characteristics of DNA are dynamic in
response to environmental cues, these modifications are also
stable and heritable. Thus, both genetic and epigenetic factors
are transmitted down cell lineages with consequences for the
activity of genes within these lineages. However, when consid-
ering the question of inheritance at the level of an individual, we
must know whether epigenetic patterns within the germ line are
correlated to those patterns found within the developing or-
ganism. In rodents, prenatal exposure to endocrine disruptors
lead to abnormal methylation patterns in sperm cells that are
observed several generations beyond the point of initial expo-
sure (Anway, Cupp, Uzumcu, & Skinner, 2005). This germ-line
epigenetic inheritance of environmentally induced effects pro-
vides further support for the notion that the transmission of traits
across generations is not limited in scope to the inheritance of
DNA.
CONCLUSION
Just as a library is more than a collection of books, the genome is
more than just DNA. The challenge for the field of epigenetics is
to determine the origins of the ‘‘uniqueness’’ of each individual’s
library by exploring the relationship between genetic and epi-
genetic variation. Though there are many basic questions to be
addressed regarding the pathways whereby specific experiences
target particular genes, this field of research certainly has
promise in uncovering the nature of experience-dependent
changes in development both within and across generations.
Advances in tools available to study these effects in humans will
be critically important in further exploring the role of epige-
netics within the broad field of psychological science.
Recommended Reading Champagne, F.A. (2008). Epigenetic mechanisms and the transgener-
ational effects of maternal care. Frontiers of Neuroendocrinology, 29, 386–397. Provides a thorough review of the potential role of epigenetic factors in mediating the effects of maternal care within
and across generations.
Jirtle, R.L., & Skinner, M.K. (2007). Environmental epigenomics and
disease susceptibility. Nature Reviews Genetics, 8, 253–262. A review of our current understanding of environmentally induced
epigenetic changes and the influence of these processes on indi-
vidual risk of disease.
Maher, B. (2008). Personal genomes: The case of the missing herita-
bility. Nature, 456, 18–21. An interesting commentary on the relationship between heritability estimates and the biological
processes that determine the relationship between genes and
behavior.
Meaney, M.J. (2001). Maternal care, gene expression, and the trans-
mission of individual differences in stress reactivity across gen-
erations. Annual Review of Neuroscience, 24, 1161–1192. A review of the profound influence of maternal care on gene expression and
behavior of offspring.
REFERENCES
Anway, M.D., Cupp, A.S., Uzumcu, M., & Skinner, M.K. (2005). Epi-
genetic transgenerational actions of endocrine disruptors and male
fertility. Science, 308, 1466–1469.
Caspi, A., Sugden, K., Moffitt, T.E., Taylor, A., Craig, I.W.,
Harrington, H., et al. (2003). Influence of life stress on depression:
Moderation by a polymorphism in the 5-HTT gene. Science, 301, 386–389.
Champagne, F.A., & Meaney, M.J. (2006). Stress during gestation alters
postpartum maternal care and the development of the offspring in a
rodent model. Biological Psychiatry, 59, 1227–1235.
Champagne, F.A., & Meaney, M.J. (2007). Transgenerational effects of
social environment on variations in maternal care and behavioral
response to novelty. Behavioral Neuroscience, 121, 1353–1363.
Champagne, F.A., Weaver, I.C., Diorio, J., Dymov, S., Szyf, M., &
Meaney, M.J. (2006). Maternal care associated with methylation of
the estrogen receptor-alpha1b promoter and estrogen receptor-
alpha expression in the medial preoptic area of female offspring.
Endocrinology, 147, 2909–2915.
Cole, S.W. (2009). Social regulation of human gene expression. Current Directions in Psychological Science, 18, 132–137.
Cooper, R.M., & Zubek, J.P. (1958). Effects of enriched and restricted
early environments on the learning ability of bright and dull rats.
Canadian Journal of Psychology, 12, 159–164.
Dolinoy, D.C. (2008). The agouti mouse model: An epigenetic biosensor
for nutritional and environmental alterations on the fetal epigen-
ome. Nutrition Reviews, 66(Suppl 1), S7–S11.
Fraga, M.F., Ballestar, E., Paz, M.F., Ropero, S., Setien, F., Ballestar,
M.L., et al. (2005). Epigenetic differences arise during the lifetime
130 Volume 18—Number 3
Genes in Context
at WALDEN UNIVERSITY on March 23, 2016cdp.sagepub.comDownloaded from
of monozygotic twins. Proceedings of the National Academy of Sciences, USA, 102, 10604–10609.
Kim-Cohen, J., & Gold, A.L. (2009). Measured gene–environment
interactions and mechanisms promoting resilient development.
Current Directions in Psychological Science, 18, 138–142.
McGowan, P.O., Sasaki, A., Huang, T.C., Unterberger, A., Suderman,
M., Ernst, C., et al. (2008). Promoter-wide hypermethylation of the
ribosomal RNA gene promoter in the suicide brain. PLoS ONE, 3, e2085.
Mill, J., Dempster, E., Caspi, A., Williams, B., Moffitt, T., & Craig, I.
(2006). Evidence for monozygotic twin (MZ) discordance in
methylation level at two CpG sites in the promoter region of
the catechol-O-methyltransferase (COMT) gene. American Jour- nal of Medical Genetics B: Neuropsychiatric Genetics, 141, B421– B425.
Miller, C.A., & Sweatt, J.D. (2007). Covalent modification of DNA
regulates memory formation. Neuron, 53, 857–869.
Mueller, B.R., & Bale, T.L. (2008). Sex-specific programming of off-
spring emotionality after stress early in pregnancy. Journal of Neuroscience, 28, 9055–9065.
Oberlander, T.F., Weinberg, J., Papsdorf, M., Grunau, R., Misri, S., &
Devlin, A.M. (2008). Prenatal exposure to maternal depression,
neonatal methylation of human glucocorticoid receptor gene (NR3C1)
and infant cortisol stress responses. Epigenetics, 3, 97–106.
Razin, A. (1998). CpG methylation, chromatin structure and gene si-
lencing-a three-way connection. EMBO Journal, 17, 4905–4908.
Weaver, I.C., Cervoni, N., Champagne, F.A., D’Alessio, A.C., Sharma,
S., Seckl, J.R., et al. (2004). Epigenetic programming by maternal
behavior. Nature Neuroscience, 7, 847–854.
Weaver, I.C., Champagne, F.A., Brown, S.E., Dymov, S., Sharma, S.,
Meaney, M.J., et al. (2005). Reversal of maternal programming of
stress responses in adult offspring through methyl supplementa-
tion: Altering epigenetic marking later in life. Journal of Neu- roscience, 25, 11045–11054.
Volume 18—Number 3 131
Frances A. Champagne and Rahia Mashoodh
at WALDEN UNIVERSITY on March 23, 2016cdp.sagepub.comDownloaded from
<< /ASCII85EncodePages false /AllowTransparency false /AutoPositionEPSFiles true /AutoRotatePages /None /Binding /Left /CalGrayProfile (Dot Gain 20%) /CalRGBProfile (sRGB IEC61966-2.1) /CalCMYKProfile (U.S. Web Coated \050SWOP\051 v2) /sRGBProfile (sRGB IEC61966-2.1) /CannotEmbedFontPolicy /Error /CompatibilityLevel 1.4 /CompressObjects /Tags /CompressPages true /ConvertImagesToIndexed true /PassThroughJPEGImages true /CreateJobTicket false /DefaultRenderingIntent /Default /DetectBlends true /DetectCurves 0.0000 /ColorConversionStrategy /CMYK /DoThumbnails false /EmbedAllFonts true /EmbedOpenType false /ParseICCProfilesInComments true /EmbedJobOptions true /DSCReportingLevel 0 /EmitDSCWarnings false /EndPage -1 /ImageMemory 1048576 /LockDistillerParams false /MaxSubsetPct 100 /Optimize true /OPM 1 /ParseDSCComments true /ParseDSCCommentsForDocInfo true /PreserveCopyPage true /PreserveDICMYKValues true /PreserveEPSInfo true /PreserveFlatness true /PreserveHalftoneInfo false /PreserveOPIComments true /PreserveOverprintSettings true /StartPage 1 /SubsetFonts true /TransferFunctionInfo /Apply /UCRandBGInfo /Preserve /UsePrologue false /ColorSettingsFile () /AlwaysEmbed [ true ] /NeverEmbed [ true ] /AntiAliasColorImages false /CropColorImages true /ColorImageMinResolution 300 /ColorImageMinResolutionPolicy /OK /DownsampleColorImages true /ColorImageDownsampleType /Average /ColorImageResolution 150 /ColorImageDepth -1 /ColorImageMinDownsampleDepth 1 /ColorImageDownsampleThreshold 1.50000 /EncodeColorImages true /ColorImageFilter /DCTEncode /AutoFilterColorImages true /ColorImageAutoFilterStrategy /JPEG /ColorACSImageDict << /QFactor 0.76 /HSamples [2 1 1 2] /VSamples [2 1 1 2] >> /ColorImageDict << /QFactor 0.15 /HSamples [1 1 1 1] /VSamples [1 1 1 1] >> /JPEG2000ColorACSImageDict << /TileWidth 256 /TileHeight 256 /Quality 30 >> /JPEG2000ColorImageDict << /TileWidth 256 /TileHeight 256 /Quality 30 >> /AntiAliasGrayImages false /CropGrayImages true /GrayImageMinResolution 300 /GrayImageMinResolutionPolicy /OK /DownsampleGrayImages true /GrayImageDownsampleType /Average /GrayImageResolution 150 /GrayImageDepth -1 /GrayImageMinDownsampleDepth 2 /GrayImageDownsampleThreshold 1.50000 /EncodeGrayImages true /GrayImageFilter /DCTEncode /AutoFilterGrayImages true /GrayImageAutoFilterStrategy /JPEG /GrayACSImageDict << /QFactor 0.76 /HSamples [2 1 1 2] /VSamples [2 1 1 2] >> /GrayImageDict << /QFactor 0.15 /HSamples [1 1 1 1] /VSamples [1 1 1 1] >> /JPEG2000GrayACSImageDict << /TileWidth 256 /TileHeight 256 /Quality 30 >> /JPEG2000GrayImageDict << /TileWidth 256 /TileHeight 256 /Quality 30 >> /AntiAliasMonoImages false /CropMonoImages true /MonoImageMinResolution 1200 /MonoImageMinResolutionPolicy /OK /DownsampleMonoImages true /MonoImageDownsampleType /Average /MonoImageResolution 300 /MonoImageDepth -1 /MonoImageDownsampleThreshold 1.50000 /EncodeMonoImages true /MonoImageFilter /CCITTFaxEncode /MonoImageDict << /K -1 >> /AllowPSXObjects false /CheckCompliance [ /None ] /PDFX1aCheck false /PDFX3Check false /PDFXCompliantPDFOnly false /PDFXNoTrimBoxError true /PDFXTrimBoxToMediaBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXSetBleedBoxToMediaBox true /PDFXBleedBoxToTrimBoxOffset [ 0.00000 0.00000 0.00000 0.00000 ] /PDFXOutputIntentProfile (None) /PDFXOutputConditionIdentifier () /PDFXOutputCondition () /PDFXRegistryName () /PDFXTrapped /False /CreateJDFFile false /Description << /CHS <FEFF4f7f75288fd94e9b8bbe5b9a521b5efa7684002000410064006f006200650020005000440046002065876863900275284e8e9ad88d2891cf76845370524d53705237300260a853ef4ee54f7f75280020004100630072006f0062006100740020548c002000410064006f00620065002000520065006100640065007200200035002e003000204ee553ca66f49ad87248672c676562535f00521b5efa768400200050004400460020658768633002> /CHT <FEFF4f7f752890194e9b8a2d7f6e5efa7acb7684002000410064006f006200650020005000440046002065874ef69069752865bc9ad854c18cea76845370524d5370523786557406300260a853ef4ee54f7f75280020004100630072006f0062006100740020548c002000410064006f00620065002000520065006100640065007200200035002e003000204ee553ca66f49ad87248672c4f86958b555f5df25efa7acb76840020005000440046002065874ef63002> /DAN <FEFF004200720075006700200069006e0064007300740069006c006c0069006e006700650072006e0065002000740069006c0020006100740020006f007000720065007400740065002000410064006f006200650020005000440046002d0064006f006b0075006d0065006e007400650072002c0020006400650072002000620065006400730074002000650067006e006500720020007300690067002000740069006c002000700072006500700072006500730073002d007500640073006b007200690076006e0069006e00670020006100660020006800f8006a0020006b00760061006c0069007400650074002e0020004400650020006f007000720065007400740065006400650020005000440046002d0064006f006b0075006d0065006e0074006500720020006b0061006e002000e50062006e00650073002000690020004100630072006f00620061007400200065006c006c006500720020004100630072006f006200610074002000520065006100640065007200200035002e00300020006f00670020006e0079006500720065002e> /DEU <FEFF00560065007200770065006e00640065006e0020005300690065002000640069006500730065002000450069006e007300740065006c006c0075006e00670065006e0020007a0075006d002000450072007300740065006c006c0065006e00200076006f006e002000410064006f006200650020005000440046002d0044006f006b0075006d0065006e00740065006e002c00200076006f006e002000640065006e0065006e002000530069006500200068006f006300680077006500720074006900670065002000500072006500700072006500730073002d0044007200750063006b0065002000650072007a0065007500670065006e0020006d00f60063006800740065006e002e002000450072007300740065006c006c007400650020005000440046002d0044006f006b0075006d0065006e007400650020006b00f6006e006e0065006e0020006d006900740020004100630072006f00620061007400200075006e0064002000410064006f00620065002000520065006100640065007200200035002e00300020006f0064006500720020006800f600680065007200200067006500f600660066006e00650074002000770065007200640065006e002e> /ESP <FEFF005500740069006c0069006300650020006500730074006100200063006f006e0066006900670075007200610063006900f3006e0020007000610072006100200063007200650061007200200064006f00630075006d0065006e0074006f00730020005000440046002000640065002000410064006f0062006500200061006400650063007500610064006f00730020007000610072006100200069006d0070007200650073006900f3006e0020007000720065002d0065006400690074006f007200690061006c00200064006500200061006c00740061002000630061006c0069006400610064002e002000530065002000700075006500640065006e00200061006200720069007200200064006f00630075006d0065006e0074006f00730020005000440046002000630072006500610064006f007300200063006f006e0020004100630072006f006200610074002c002000410064006f00620065002000520065006100640065007200200035002e003000200079002000760065007200730069006f006e0065007300200070006f00730074006500720069006f007200650073002e> /FRA <FEFF005500740069006c006900730065007a00200063006500730020006f007000740069006f006e00730020006100660069006e00200064006500200063007200e900650072002000640065007300200064006f00630075006d0065006e00740073002000410064006f00620065002000500044004600200070006f0075007200200075006e00650020007100750061006c0069007400e90020006400270069006d007000720065007300730069006f006e00200070007200e9007000720065007300730065002e0020004c0065007300200064006f00630075006d0065006e00740073002000500044004600200063007200e900e90073002000700065007500760065006e0074002000ea0074007200650020006f007500760065007200740073002000640061006e00730020004100630072006f006200610074002c002000610069006e00730069002000710075002700410064006f00620065002000520065006100640065007200200035002e0030002000650074002000760065007200730069006f006e007300200075006c007400e90072006900650075007200650073002e> /ITA <FEFF005500740069006c0069007a007a006100720065002000710075006500730074006500200069006d0070006f007300740061007a0069006f006e00690020007000650072002000630072006500610072006500200064006f00630075006d0065006e00740069002000410064006f00620065002000500044004600200070006900f900200061006400610074007400690020006100200075006e00610020007000720065007300740061006d0070006100200064006900200061006c007400610020007100750061006c0069007400e0002e0020004900200064006f00630075006d0065006e007400690020005000440046002000630072006500610074006900200070006f00730073006f006e006f0020006500730073006500720065002000610070006500720074006900200063006f006e0020004100630072006f00620061007400200065002000410064006f00620065002000520065006100640065007200200035002e003000200065002000760065007200730069006f006e006900200073007500630063006500730073006900760065002e> /JPN <FEFF9ad854c18cea306a30d730ea30d730ec30b951fa529b7528002000410064006f0062006500200050004400460020658766f8306e4f5c6210306b4f7f75283057307e305930023053306e8a2d5b9a30674f5c62103055308c305f0020005000440046002030d530a130a430eb306f3001004100630072006f0062006100740020304a30883073002000410064006f00620065002000520065006100640065007200200035002e003000204ee5964d3067958b304f30533068304c3067304d307e305930023053306e8a2d5b9a306b306f30d530a930f330c8306e57cb30818fbc307f304c5fc59808306730593002> /KOR <FEFFc7740020c124c815c7440020c0acc6a9d558c5ec0020ace0d488c9c80020c2dcd5d80020c778c1c4c5d00020ac00c7a50020c801d569d55c002000410064006f0062006500200050004400460020bb38c11cb97c0020c791c131d569b2c8b2e4002e0020c774b807ac8c0020c791c131b41c00200050004400460020bb38c11cb2940020004100630072006f0062006100740020bc0f002000410064006f00620065002000520065006100640065007200200035002e00300020c774c0c1c5d0c11c0020c5f40020c2180020c788c2b5b2c8b2e4002e> /NLD (Gebruik deze instellingen om Adobe PDF-documenten te maken die zijn geoptimaliseerd voor prepress-afdrukken van hoge kwaliteit. De gemaakte PDF-documenten kunnen worden geopend met Acrobat en Adobe Reader 5.0 en hoger.) /NOR <FEFF004200720075006b00200064006900730073006500200069006e006e007300740069006c006c0069006e00670065006e0065002000740069006c002000e50020006f0070007000720065007400740065002000410064006f006200650020005000440046002d0064006f006b0075006d0065006e00740065007200200073006f006d00200065007200200062006500730074002000650067006e0065007400200066006f00720020006600f80072007400720079006b006b0073007500740073006b00720069006600740020006100760020006800f800790020006b00760061006c0069007400650074002e0020005000440046002d0064006f006b0075006d0065006e00740065006e00650020006b0061006e002000e50070006e00650073002000690020004100630072006f00620061007400200065006c006c00650072002000410064006f00620065002000520065006100640065007200200035002e003000200065006c006c00650072002000730065006e006500720065002e> /PTB <FEFF005500740069006c0069007a006500200065007300730061007300200063006f006e00660069006700750072006100e700f50065007300200064006500200066006f0072006d00610020006100200063007200690061007200200064006f00630075006d0065006e0074006f0073002000410064006f0062006500200050004400460020006d00610069007300200061006400650071007500610064006f00730020007000610072006100200070007200e9002d0069006d0070007200650073007300f50065007300200064006500200061006c007400610020007100750061006c00690064006100640065002e0020004f007300200064006f00630075006d0065006e0074006f00730020005000440046002000630072006900610064006f007300200070006f00640065006d0020007300650072002000610062006500720074006f007300200063006f006d0020006f0020004100630072006f006200610074002000650020006f002000410064006f00620065002000520065006100640065007200200035002e0030002000650020007600650072007300f50065007300200070006f00730074006500720069006f007200650073002e> /SUO <FEFF004b00e40079007400e40020006e00e40069007400e4002000610073006500740075006b007300690061002c0020006b0075006e0020006c0075006f00740020006c00e400680069006e006e00e4002000760061006100740069007600610061006e0020007000610069006e006100740075006b00730065006e002000760061006c006d0069007300740065006c00750074007900f6006800f6006e00200073006f00700069007600690061002000410064006f0062006500200050004400460020002d0064006f006b0075006d0065006e007400740065006a0061002e0020004c0075006f0064007500740020005000440046002d0064006f006b0075006d0065006e00740069007400200076006f0069006400610061006e0020006100760061007400610020004100630072006f0062006100740069006c006c00610020006a0061002000410064006f00620065002000520065006100640065007200200035002e0030003a006c006c00610020006a006100200075007500640065006d006d0069006c006c0061002e> /SVE <FEFF0041006e007600e4006e00640020006400650020006800e4007200200069006e0073007400e4006c006c006e0069006e006700610072006e00610020006f006d002000640075002000760069006c006c00200073006b006100700061002000410064006f006200650020005000440046002d0064006f006b0075006d0065006e007400200073006f006d002000e400720020006c00e4006d0070006c0069006700610020006600f60072002000700072006500700072006500730073002d007500740073006b00720069006600740020006d006500640020006800f600670020006b00760061006c0069007400650074002e002000200053006b006100700061006400650020005000440046002d0064006f006b0075006d0065006e00740020006b0061006e002000f600700070006e00610073002000690020004100630072006f0062006100740020006f00630068002000410064006f00620065002000520065006100640065007200200035002e00300020006f00630068002000730065006e006100720065002e> /ENU (Use these settings to create Adobe PDF documents best suited for high-quality prepress printing. Created PDF documents can be opened with Acrobat and Adobe Reader 5.0 and later.) >> /Namespace [ (Adobe) (Common) (1.0) ] /OtherNamespaces [ << /AsReaderSpreads false /CropImagesToFrames true /ErrorControl /WarnAndContinue /FlattenerIgnoreSpreadOverrides false /IncludeGuidesGrids false /IncludeNonPrinting false /IncludeSlug false /Namespace [ (Adobe) (InDesign) (4.0) ] /OmitPlacedBitmaps false /OmitPlacedEPS false /OmitPlacedPDF false /SimulateOverprint /Legacy >> << /AddBleedMarks false /AddColorBars false /AddCropMarks false /AddPageInfo false /AddRegMarks false /ConvertColors /ConvertToCMYK /DestinationProfileName () /DestinationProfileSelector /DocumentCMYK /Downsample16BitImages true /FlattenerPreset << /PresetSelector /MediumResolution >> /FormElements false /GenerateStructure false /IncludeBookmarks false /IncludeHyperlinks false /IncludeInteractive false /IncludeLayers false /IncludeProfiles false /MultimediaHandling /UseObjectSettings /Namespace [ (Adobe) (CreativeSuite) (2.0) ] /PDFXOutputIntentProfileSelector /DocumentCMYK /PreserveEditing true /UntaggedCMYKHandling /LeaveUntagged /UntaggedRGBHandling /UseDocumentProfile /UseDocumentBleed false >> ] >> setdistillerparams << /HWResolution [1200 1200] /PageSize [612.000 792.000] >> setpagedevice