ABout sicence one paper essay
oopsta
lilice.pdf
Genotyping of Human Lice Suggests Multiple Emergences of Body Lice from Local Head Louse Populations Wenjun Li1¤, Gabriel Ortiz1, Pierre-Edouard Fournier1, Gregory Gimenez1, David L. Reed2, Barry
Pittendrigh3, Didier Raoult1*
1 URMITE, UMR CNRS 6236, IRD 198, Université de la Méditerranée, Faculté de Médecine, Marseille, France, 2 Florida Museum of Natural History, Dickinson Hall, University
of Florida, Gainesville, Florida, United States of America, 3 Department of Entomology, University of Illinois at Urbana-Champaign, Urbana, Illinois, United States of
America
Abstract
Background: Genetic analyses of human lice have shown that the current taxonomic classification of head lice (Pediculus humanus capitis) and body lice (Pediculus humanus humanus) does not reflect their phylogenetic organization. Three phylotypes of head lice A, B and C exist but body lice have been observed only in phylotype A. Head and body lice have different behaviours and only the latter have been involved in outbreaks of infectious diseases including epidemic typhus, trench fever and louse borne recurrent fever. Recent studies suggest that body lice arose several times from head louse populations.
Methods and Findings: By introducing a new genotyping technique, sequencing variable intergenic spacers which were selected from louse genomic sequence, we were able to evaluate the genotypic distribution of 207 human lice. Sequence variation of two intergenic spacers, S2 and S5, discriminated the 207 lice into 148 genotypes and sequence variation of another two intergenic spacers, PM1 and PM2, discriminated 174 lice into 77 genotypes. Concatenation of the four intergenic spacers discriminated a panel of 97 lice into 96 genotypes. These intergenic spacer sequence types were relatively specific geographically, and enabled us to identify two clusters in France, one cluster in Central Africa (where a large body louse outbreak has been observed) and one cluster in Russia. Interestingly, head and body lice were not genetically differentiated.
Conclusions: We propose a hypothesis for the emergence of body lice, and suggest that humans with both low hygiene and head louse infestations provide an opportunity for head louse variants, able to ingest a larger blood meal (a required characteristic of body lice), to colonize clothing. If this hypothesis is ultimately supported, it would help to explain why poor human hygiene often coincides with outbreaks of body lice. Additionally, if head lice act as a reservoir for body lice, and that any social degradation in human populations may allow the formation of new populations of body lice, then head louse populations are potentially a greater threat to humans than previously assumed.
Citation: Li W, Ortiz G, Fournier P-E, Gimenez G, Reed DL, et al. (2010) Genotyping of Human Lice Suggests Multiple Emergences of Body Lice from Local Head Louse Populations. PLoS Negl Trop Dis 4(3): e641. doi:10.1371/journal.pntd.0000641
Editor: Genevieve Milon, Institut Pasteur, France
Received September 4, 2009; Accepted February 8, 2010; Published March 23, 2010
Copyright: � 2010 Li et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: The authors received no specific funding for this paper.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: [email protected]
¤ Current address: Department of Molecular Genetics and Microbiology, Duke University Medical Center, Research Drive, Durham, NC, 27710, USA.
Introduction
Lice are extremely well-adapted ectoparasites that are usually
host-specific [1]. Three recognized taxa of lice feed on humans:
head lice (Pediculus humanus capitis), body lice (Pediculus humanus
humanus), and pubic lice (Pthirius pubis), feed on humans. As one
of the most intimate parasites of humans, lice have been widely
used as a genetic model to infer host evolutionary history by
providing genetic date independent of host data [1,2]. Several
nuclear and mitochondrial DNA sequences have previously
been used in population genetic studies of human lice. Of these,
the nuclear DNA sequences, EF-1a and 18S rDNA, discrimi- nated lice into two subgroups, lice from Sub-Saharan Africa and
lice worldwide[3]. In each subgroup, the head lice were
genetically different from the body lice [3]. However, Leo
et al. suggested that 18S rDNA phylogeny was concordant with
the phylogenies from mitochondrial genes, but the EF-1a phylogeny was concordant neither with the mitochondrial
phylogenies nor with the 18S rRNA phylogeny [4]. Further-
more, the mitochondrial DNA markers, partial COI and cytB
classified the lice into three deeply divergent clades (Clades A,
B, and C), and each having unique geographical distribution.
Clade A includes both head and body lice and is worldwide in
distribution. Clade B consists only of head lice from America,
Australia and Europe, and Clade C consists only of lice from
Ethiopia and Nepal [5].
www.plosntds.org 1 March 2010 | Volume 4 | Issue 3 | e641
More variable genetic markers, such as internal transcribed
spacers (ITS) of ribosomal DNA and microsatellite DNA, were also
used to deduce the louse phylogeny. However, the ITS that was
chosen was not useful to study the populations structure of human
lice because some of the lice had more than one copy of ITS2 in
their genome [6]. A subsequent microsatellite DNA-based study
has suggested that human head and body lice are genetically
distinct [7], however recent studies contradict this hypothesis [5,8].
Taken together, the population structure of human lice is complex
and still unclear. The previously used genetic markers were mostly
mitochondrial and nuclear genes that were too conserved to
generate more information of genetic diversity of studied louse
isolates. So far, no genetic marker has been found that can
discriminate among individual human lice.
While being used as a suitable genetic model to study the
evolutionary history of humans, lice have long been associated
with infectious diseases. Of the three types of lice associated with
humans, body lice can be a serious public health problem because
they are known vectors of Rickettsia prowazekii, Bartonella quintana,
and Borrelia recurrentis, which cause epidemic typhus, trench fever
and relapsing fever in humans, respectively [9]. However, medical
interest in louse-borne diseases had waned for more than 30 years
until 1997, when an outbreak of infection of louse-transmissed R.
prowazekii and B. quintana occurred among the displaced population
of Burundi [10,11].
Body lice have long been recognized as human parasites and
although typically prevalent in rural communities in upland areas
of countries close to the equator, high incidence of louse-borne
infections are also increasingly found in the homeless in developed
countries [9,12,13]. In contrast, head lice represent a major
economic and social concern throughout developed nations,
because head louse infestations are often associated with school-
aged children.
Faster evolving molecular markers are needed in order to
epidemiologically survey the vectors of these bacterial infections and
to address more recent population-level questions, [8,14]. Among
these fast-evolving genetic markers, intergenic spacers are promising
for individual discrimination of lice because they are under less
evolutionary pressure, and are more variable than coding genes.
These factors make intergenic spacers useful for understanding the
population genetics of lice. Highly variable intergenic spacers are
useful for strain-typing many bacteria, including louse-transmitted
R. prowazekii and B. quintana [15,16] as well as other pathogenic
bacteria [17]. Additionally, intergenic spacer sequences for
individual discrimination of lice, are now publicly available [14].
In this study, we used four highly variable intergenic spacers that
were selected from the genomic sequence to study the genotypic
distribution of a large collection of lice of worldwide origins.
Methods
Louse collection and DNA preparation Two hundred and eighty-four human lice collected from Russia,
France, Portugal, Mexico, USA, UK, Morocco, Algeria, Peru,
Thailand, Australia, Rwanda, and Burundi were included in this
study. Lice were collected by experienced entomologists from
patients who had only one type of infestation (head or body) and
classified according to the site where they were found. Among
them, only 97 lice were tested with four nuclear intergenic spacers,
other 110 and 77 lice were tested with two intergenic spacers,
respectively, due to limited DNA quantity. The strain information,
including origin, the body part where they were removed (body or
head), and the year when it was collected are given in Figure 1 and
Figures S1 and S3. In addition, to estimate the utility of multi-
spacer typing (MST) of louse populations, we also studied two
body lice from our laboratory colony (Culpeper strain) per year,
collected in 1998, 1999, 2000, 2003, 2004 and 2009. From 1998 to
2009, our louse colony went through 132 generations.
All lice were stored at 220uC until processed further. Before DNA isolation, each louse was rinsed twice in sterile water for 15
minutes and cut lengthwise in half. Then, total genomic DNA of
each half louse was extracted using the QIAamp Tissue kit
(QIAGEN, Hilden, Germany) as described by the manufacturer.
The extracted genomic DNA was stored at 220uC until PCR amplification.
Selection of nuclear intergenic spacers as typing markers and primer design
The nuclear intergenic spacers were randomly selected from the
genomic sequence of Pediculus humanus humanus UDSA strain
(http://phumanus.vectorbase.org/index.php) and were identified
with flanking genes which exhibited .40% sequence identity with
homologous genes in the Vectorbase [14,18]. Primers used for
amplification and sequencing of these intergenic spacers were
chosen from the flanking genes using the Primer 3.0 software
(http://frodo.wi.mit.edu/cgi-bin/primer3/primer3_www.cgi) and
are listed in Table 1. All Primers used in this project were obtained
from Eurogentec (Seraing, Belgium).
As the testing of all intergenic spacers on all louse samples was
labor intensive, a panel of 16 lice from a wide range of origins was
first used to test for the validity and the presence of polymorphisms
for each of the intergenic spacers. Subsequently, the intergenic
spacers with successful amplification and sequencing from the 16
tested louse samples, were finally used as markers in order to
genotype the remaining strains.
Amplification and sequencing of intergenic spacers PCR amplification of each intergenic spacer was carried out in a
PTC-200 automated thermal cycler (MJ Research, Waltham, MA,
USA). 1 ml of each DNA preparation was amplified in a 20 ml reaction mixture containing 10 pM of each primer, 2 mM of each nucleotide
Author Summary
While being phenotypically and physiologically different, human head and body lice are indistinguishable based on mitochondrial and nuclear genes. As protein-coding genes are too conserved to provide significant genetic diversity, we performed strain-typing of a large collection of human head and body lice using variable intergenic spacer sequences. Ninety-seven human lice were classified into ninety-six genotypes based on four intergenic spacer sequences. Genotypic and phylogenetic analyses using these sequences suggested that human head and body lice are still indistinguishable. We hypothesized that the phenotypic and physiological differences between human head and body lice are controlled by very limited mutations. Under conditions of poor hygiene, head lice can propagate very quickly. Some of them will colonize clothing, producing a body louse variant (genetic or phenetic), which can lead to an epidemic. Lice collected in Rwanda and Burundi, where outbreaks of louse-borne diseases have been recently reported, are grouped tightly into a cluster and those collected from homeless people in France were also grouped into a cluster with lice collected in French non-homeless people. Our strain-typing ap- proach based on highly variable intergenic spacers may be helpful to elucidate louse evolution and to survey louse- borne diseases.
Head and Body Lice
www.plosntds.org 2 March 2010 | Volume 4 | Issue 3 | e641
(dATP, dCTP, dGTP and dTTP), 4 ml of Phusion HF buffer, 0.2 ml of Phusion polymerase enzyme (Finnzymes, Espoo, Finland) and 12.4 ml of distilled water. The following conditions were used for the
amplification: an initial 5 min of denaturation at 95uC, followed by 35 cycles of denaturation for 1 min at 94uC, an annealing time of 30 sec at 56uC, and an extension cycle for 1 min at 72uC. The amplification was completed by an extension period of 5 min at 72uC.
PCR products were purified, using the MultiScreen PCR filter
plate (Millipore, Saint-Quentin en Yvelines, France), as recom-
mended by the manufacturer. PCR products were then sequenced
in both directions, with the same primers used for PCR
amplification, using BigDye Terminator version 1.1 cycle
sequencing ready reaction mix (Applied Biosystems, Foster City,
CA). Sequencing products were resolved using an ABI 3100
automated sequencer (Applied Biosystems). Sterile water was used
as a negative control in each assay.
Amplification and sequencing of partial cytB gene In order to compare the discriminatory power of intergenic
spacers with genes, as well as to compare their phylogenetic
organizations, the mitochondrial gene, cytB (cytochrome b) was
amplified and sequenced from those louse samples when there was
DNA to perform the PCR experiments. The primers used for this
experiment were CytbF1 (59-GAGCGACTGTAATTACTAATC-
39) and CytbR1 (59-CAA CAA AAT TAT CCG GGT CC-39) [19].
Sequence analysis and phylogenetic analysis Nucleotide sequences were obtained using Sequencher 4.8 (Gene
codes Corp, Ann Arbor, MI, USA). The primers used to amplify
intergenic spacers were selected based on flanking gene sequences.
The sequences from the coding sequence fragments were not used
in the analyses. For each intergenic spacer, and cytB, a genotype was
defined as a sequence exhibiting a unique mutation. Each genotype
was confirmed to be unique by BLASTn search in all the obtained
sequences [20]. Multiple sequence alignments were carried out
using the Clustal W software [21]. Phylogenetic analysis of the lice
that were studied was obtained using the neighbor-joining and
maximum parsimony methods within the MEGA 3.1 software with
complete deletion [22] and using the maximum likelihood method
in PhyML 3.0 with SH-like approximate likelihood-ratio test and
HKY85 substitution model [23,24]. For this purpose, sequences of
the selected intergenic spacers were concatenated.
Comparison of discriminatory power intergenic spacers with cytB
The discriminatory power (D) of each intergenic spacer, and
cytB, was calculated with the Hunter and Gaston’s formula [25].
D~1{ 1
N N{1ð Þ Xs
j~1
xj xj {1 � �
Accession numbers DNA sequences obtained from the S2 and S5 spacers, the PM1
and PM2 spacers and the cytB gene were deposited in GenBank
under accession numbers EU928781-EU928862, EU913096-
EU913223, and GU323324-GU323334respectively.
Figure 1. Phylogenetic organization of 97 human lice based on concatenation of four nuclear intergenic spacers, PM1, PM2, S2, and S5, using the neighbor-joining method. doi:10.1371/journal.pntd.0000641.g001
Head and Body Lice
www.plosntds.org 3 March 2010 | Volume 4 | Issue 3 | e641
Results
Four nuclear intergenic spacers, S2, S5, PM1, and PM2, were selected as typing markers
Twenty-two nuclear intergenic spacers were initially selected
from the genomic sequences and preliminary tested on 16 louse
samples (Table 1). However, due to non-specific amplification, or
low sequencing quality, 18 intergenic spacers were removed from
this study. Finally, four intergenic spacers, hereafter termed S2, S5,
PM1, and PM2, were used as typing markers in this study (Table 1).
Through amplification and sequencing, 165–185 bp of S2 and
156–189 bp of S5 were obtained from 207 louse samples and133–
155 bp of PM1 and 323–328 bp of PM2 were obtained from 174
louse samples. Sequences from the different genotypes of the four
intergenic spacers have been deposited in the EMBL/GenBank
database with access numbers: EU928781-EU928862 for S2 and
S5 and EU913096-EU913223 for PM1 and PM2.
Genotypic distribution of studied lice based on intergenic spacers
Two hundred and seven lice were differentiated into 84 and 49
genotypes based on intergenic spacers S2 and S5, respectively.
Concatenation of S2 and S5 sequences differentiated the 207 lice
into 148 genotypes.
One hundred and seventy-four lice were differentiated into 25
and 62 genotypes based on intergenic spacers PM1 and PM2,
respectively. Concatenation of PM1 and PM2 sequences differen-
tiated the 174 lice into 77 genotypes.
Further concatenation of S2, S5, PM1, and PM2, discriminated
a panel of 97 lice into 96 MST genotypes. Except for two lice
collected from French homeless people which shared the MST
genotype 89, the other 90 lice exhibited unique MST genotypes
based on the concatenation of four intergenic spacers.
Sequences from each of the four intergenic spacers S2, S5,
PM1, and PM2 were identical among the 12 body lice from our
laboratory colony collected over 12 years. The genotypes obtained
were: 8, 6, 18, and 39 for S2, S5, PM1 and PM2, respectively.
Genotypic distribution of lice based on the mitochondrial gene cytB
A partial cytB gene sequence was amplified and sequenced from
170 lice. A 316 bp fragment was obtained from each louse after
sequence correction and assembling. The cytB sequences were used
to classify the 170 lice into 11 genotypes. The body lice sampled
from our laboratory colony over 132 generations exhibited
identical cytB sequences (genotype 4).
Discriminatory power of each marker The discriminatory power (D) of the intergenic spacers, PM1,
PM2, S2, and S5 was respectively 0.6988, 0.8406, 0.9677, and
0.8913. The D value of cytB was 0.6445. The D value of
concatenation of intergenic spacers varied from 0.9123 for
concatenation of PM1 and PM2 to 0.9945 for concatenation of
S2 and S5. A D value of 0.9998 was reached by combined use of
the four intergenic spacers.
Phylogenetic organization of lice based on intergenic spacers and partial cytB
The dendrograms of studied lice inferred by the methods of
neighbor-joining, maximum parsimony, and maximum likelihood
Table 1. The name, position on supercontig, size, and primers used for amplification of 22 intergenic spacers.
Name Start End Foward primer (59-39) Reverse primer (59-39) Size (bp)
S1 27999 28435 GACCAACCAACCAGCCAATA TTCCAGAAGCCTTGTTACCG 437
S2 665433 665920 ATGATGTGCATTGCGAGTGT AAACTTAACCCGGGCCCTAT 488
S3 44210 44721 GAAAGTGACGACGATGACGA TCCCAATTTTTGTTTCCCTG 512
S4 76618 77129 ACCCGATAAACCGACAGATG TTTGCCCATACAGCAATTCA 512
S5 69159 69650 TCCAAATGAAACCCACACTTT TGGCAGACACTGCTTCCTTA 492
S6 63422 63928 AACAAAACAATTTGACCCGC GCATCTTTAAATCCGACAATTTT 507
S7 188992 189457 ATGATTGCATCACTCCGTCA CGTTGAGGAATCTGGCATTT 466
S8 64865 65355 GGATTTGCAAAAAGCGGATA ATTTGCCGGGTAGGGTACTT 491
S9 292090 292560 AAGTTTTGTGCTCAAAGCG AATTCGCAGACGTAAAGCGT 471
S10 86299 86794 TCTTTAGCAAAACTTGGTGATGAG TGCCTGAAGAGCTTCACATT 496
S11 22923 23408 AGGAATTGGATGAATTGCTCA ATGACTGTGACTTCCAGCCC 486
S12 20812 21327 CCGCTGAACGAATCTTTCTC TCATCCCTTGTTTTTCCACC 516
S13 155485 155887 TGGTTGTTTTTCACCCATTG AAACCCGAGCGAATGTTTT 403
S14 228690 229166 TAATACGGAAAAATGCGTCG CGATCGGAATTGTGAGGTTT 477
S15 279599 280127 CCTGAACAACTTGAAAGAATTGC GGCAAGCCAAAACACCTAAA 529
S16 41948 42461 GGGGAAATAAAACAAGAGGAGG CAACCGGGTGACCACATTAT 514
S17 248360 248834 TGATTTAGGTGGATTTCACGG TTTCCAACGAATTTCGAACC 475
S18 321921 322390 ATCTCTGTTTTCAGTGGCGG TCTGGTTTACAGGTGTCGAAAA 470
S19 204723 205216 AAAACAAACAGACGTAGAAAGCG GGGGGTAAACAAAATGGGTAA 494
S20 603 1045 GGATTTTCTGTTTTGCGTTTT TTGGTTCTGCATGAAATACGTT 443
PM1 538639 538857 GAAATAATATCCAACCTCGTTCA CATTCTTCCTCATCAAGCTGC 217
PM2 115253 115810 CCGAAGGAGCTGATTCTTTT CCACAACGAGTGATGTGAGC 437
doi:10.1371/journal.pntd.0000641.t001
Head and Body Lice
www.plosntds.org 4 March 2010 | Volume 4 | Issue 3 | e641
exhibited similar phylogenetic organizations (Figures 1 – 3, Figures
S1 – S6).
The 148 genotypes of intergenic spacers S2 and S5, were
grouped into 3 clusters, C1, C2, and C3 (Figure S1). Each
cluster included both head and body lice. In addition, genotypes
96 and 101 consisted of two body lice and two head lice,
respectively (Figure S1). A subcluster (Burundi and Rwanda
subcluster) in cluster C3 was comprised of 29 lice from Burundi
and Rwanda and one louse from Russia. The other 24 lice
collected in Rwanda and Burundi were grouped into cluster C2.
The majority of French lice, including those collected from
homeless people, were grouped into a sub-clade within cluster
C1 (Figure S1).
The 77 nuclear intergenic spacer-genotypes, for PM1 and PM2,
were grouped into 2 distinct clusters (Figure S3). Cluster C1
included 148 lice collected from Russia, Mexico, France, UK,
USA, and Portugal as well as one louse from Rwanda (Figure S3).
A subcluster in cluster C1 contained 31 lice from France and 2 lice
from Portugal, which is hereafter referred to as the ‘‘French
subcluster’’. The 19 lice collected from French homeless
individuals were tightly grouped with French lice in cluster C1
(Figure S3). Cluster C2 was comprised of 25 lice collected from
Figure 2. Phylogenetic organization of 97 human lice based on concatenation of four nuclear intergenic spacers, PM1, PM2, S2, and S5, using the maximum likelihood method. doi:10.1371/journal.pntd.0000641.g002
Figure 3. Phylogenetic organization of 170 human lice based on partial cytB gene using using the neighbor-joining method. doi:10.1371/journal.pntd.0000641.g003
Head and Body Lice
www.plosntds.org 5 March 2010 | Volume 4 | Issue 3 | e641
Rwanda and Burundi. Genotypes 6, 29, and 32, were observed in
both head and body lice.
Based on the concatenation of the four intergenic spacers PM1,
PM2, S2, and S5, the 97 lice were discriminated into 96 MST
genotypes and grouped into two clusters (Figures 1 and 2). Cluster
C1 included 75 lice from Russia, France, Mexico, and Portugal,
and Cluster C2, the Burundi and Rwanda cluster, contained 22
lice from Burundi and Rwanda (Figure 1). Lice collected from the
French homeless individuals were tightly grouped with French lice
into two subclusters within C1 (Figure 1).
The 11 genotypes of cytB from 170 lice were grouped into 2
clusters (Figure 3). Cluster C1 included 111 lice from France,
Russia, UK, USA, Mexico, Portugal, Burundi, and Rwanda
(Figure 3), and corresponded to Type A in a study by Light et al
[5]. Cluster C2 included 59 lice from the UK, USA, and Mexico,
and corresponded to the Type B reported by Light et al. [5].
Genotypes 4 and 6 comprised both head and body lice.
Discussion
In this study, MST based on four highly variable intergenic
spacers selected from the genomic sequence of a body louse,
classified 97 lice into 96 MST genotypes. To date, MST appears to
be the most sensitive discriminatory genotyping system of human
lice, allowing for discrimination of individuals. In addition, MST
helped us to address several important debates associated with
human lice. One of the ongoing debates is whether head and body
lice are separate species or two subspecies within Pediculus humanus
[3,4,7,8,26]. To address this issue, most of the previous studies
have used mitochrondrial or nuclear genes to evaluate and
compare the genetic variability of human head and body lice.
Studies based on the mitochondrial gene COI [26], the
mitochondrial genes cytB and ND4 and nuclear genes EF-1a and RPII [27], the mitochondrial genes cytB and COI [28], or the
nuclear gene 18S rDNA [4], supported the hypothesis that human
head and body lice are conspecific. Using previously published
sequence data, by reticulated networks, gene flow, population
genetics, and phylogeny analysis, Light et al. [8] also observed that
human head and body lice are conspecific.
However, a recent study performed by Leo et al. [7], in which
microsatellites were used as genetic markers, concluded that
human head and body lice are two distinct species. These studies
made opposite conclusions by using different genetic markers. The
low discriminatory power of previously used markers limited their
ability to provide convincing evidence whether head and body lice
are subspecies of one species or two distinct species.
Our genotypic and phylogenetic analyses using MST did not
support the hypothesis that human head and body lice are
separate species. For instance, genotype 32, which was a
concatenation of the intergenic spacers PM1 and PM2, was
comprised of 44 head lice from the USA and the UK as well as
one body louse from Europe (Figure S3). Genotypes 6 and 29 were
comprised of both head and body lice collected in France (Figure
S3). Genotypes 96 and 101, a concatenation of the intergenic
spacers S2 and S5, also were comprised of both head and body lice
(Figure S1).
Phylogenetic organizations of head and body lice based on each
of the four intergenic spacers, and on concatenation of both,
support the hypothesis that head lice were grouped with body lice
in the same clusters or subclusters (Figure 1, Figures S1 and S2).
The changing tree topography observed among spacers may be
related to differences in selection pressure that their flanking genes
undergo. The genotypic distribution of 170 lice based on partial
cytB gene sequences, and the phylogenetic organization of 11 cytB
genotypes, also demonstrated that head and body lice shared the
same cytB genotypes and were grouped in the same cluster
(Figure 2), which further confirmed the hypothesis that human
head and body lice are conspecific [3,27,28].
In our study, although only two clusters were observed based on
partial cytB gene sequences, cluster C1 contained both head and
body lice from worldwide origins, and cluster C2 included only
head lice from America and Europe (Figure 3). This result did not
contradict the previous observation [19] of three deeply divergent
clades of human lice, as our study did not include lice from either
Ethiopia or Nepal. However, the phylogenetic organization of cytB
sequences was significantly simpler than those based on intergenic
spacers. Three and two clusters were respectively obtained from
the concatenations of the intergenic spacers S2 and S5 (Figure S1),
and the intergenic spacers PM1 and PM2 (Figure S3). Addition-
ally, two clusters were generated from the concatenation of the
four intergenic spacers PM1, PM2, S2 and S5 (Figure 1, Figures
S1 and S2). Each cluster was comprised of several subclusters, such
as the French subcluster, including the majority of French lice, and
the Rwanda/Burundi cluster, which also consisted of lice collected
from sub-Saharan Africa (Figure 1, Figures S1 and S2). This
discrepancy of phylogenetic organizations obtained from interge-
nic spacers and cytB sequences resulted, at least partially, from the
high variability of intergenic spacers, which enabled individual
discrimination of human lice. In addition, these differences may
also be explained by the fact that the louse samples incorporated in
each phylogenetic analysis were different due to limited DNA
available for such experiments. Furthermore, louse genomic DNA
may be highly recombined, which would in turn result in distinct
phylogenetic organization from different markers [8]. Thus,
collecting more louse samples with wide origins, especially lice
from Ethiopia and Nepal, and subjecting them to MST analysis,
would help to further clarify the relationship between head and
body lice.
Human head and body lice are strict obligate human
ectoparasites that differ in several aspects of their morphology,
physiology and life histories. Head lice are mostly found on the
head and attach their eggs to the base of hair shafts, whereas body
lice reside in clothing and attach their eggs to clothing fiber, a life
history strategy that probably arose when humans first began
wearing clothes [27]. By comparison with body lice, head lice have
been described as having shorter and broader antennae, shorter
legs, more marked indentations between successive abdominal
plates, and as being larger and more deeply pigmented [29,30].
However, such morphological differences have been determined
on a small number of lice and may not hold at the species level
[29]. Body lice also take a larger blood meal, lay higher numbers
of eggs and develop faster than head lice [29,31,32]. In addition,
body lice are more resistant to environmental conditions, can stay
alive for longer period of time outside the host, are able of
transmitting infectious diseases, and are mostly found in adults
whereas head lice are essentially found in children [29]. Despite
various genetic differences [1–8], detailed above, head and body
lice have been shown to be able to interbreed [30].
Lice are extremely well adapted ectoparasites, which are usually
host-specific by co-speciation with their host [2,28,33]. Thus, lice
have become a good genetic model for studying specific aspects of
human evolution, including addressing when our human ancestors
began to wear clothing. Very recently, a study based on sequence
analysis of COI and cytB from human head and body lice suggested
direct contact between modern and archaic humans [28]. More
recently, Light et al. [34] verified this hypothesis by using both
nuclear and mitochondrial genes [34]. However, these studies
were based on conserved mitochondrial or nuclear genes, which
Head and Body Lice
www.plosntds.org 6 March 2010 | Volume 4 | Issue 3 | e641
provided limited genetic variability of studied lice. In our study, we
also tested the use of highly variable intergenic spacers for strain-
typing of human lice to explore human evolutionary history.
Concatenation of these highly variable intergenic spacer sequences
classified some lice from Rwanda and Burundi into a basal cluster
or subcluster and grouped other lice collected in Rwanda and
Burundi with lice from North Africa, Europe, USA, and Asia,
which supports the hypothesis that human beings originated in
Africa (Figure 1, Figures S1 and S2). Thus, highly variable
intergenic spacer sequences could be used to study the evolution
history of human lice and its host. It might be argued that, due to
fast evolution and high polymorphism, intergenic spacers may not
be able to fully reflect long-term dynamic changes of populations.
However, we observed that MST was a valuable tool for tracing
distinct louse populations, and was not biased by mutations that
might arise within a single population over time, for at least 132
generations. Nevertheless, we recommend using a combination of
coding genes and intergenic spacers because coding genes are
conserved enough to highlight evolutionary relationships, and the
intergenic spacers are variable enough to identify fine-scale genetic
variability.
While lice may present a valuable model to study its host
evolution, human head and body lice cause serious health and
social problems. Head lice are common worldwide, infesting
millions of school children every year and the resistance of Pediculus
humanus capitis to insecticides is spreading [35]. Body lice are less
prevalent parasites, associated mainly with those living in poor
conditions, but are potentially more harmful because they are
known vectors of at least three bacterial pathogens in humans: R.
prowazekii, B. quintana, and B. recurrentis. There have been several
outbreaks of louse-borne R. prowazekii infections in Burundi and
Rwanda jails in 1997 and 2001, and sporadic R. prowazekii
infections were also recently reported [9]. Epidemiological surveys
of these louse-borne diseases are also very important for us to
understand and potentially combat these diseases. In addition,
recent evidence has been brought that head lice are potential
vectors of B. quintana [36,37], and their role in the epidemiology of
epidemic typhus has been questioned [38]. Other studies have
identified two endosymbiotic bacteria that have co-evolved in head
and body lice [39–41]. However, whether these symbionts have
any influence on louse behavior, development and/or competence
as disease vectors is as yet mostly unknown.
Based on phylogenetic analysis of the four intergenic spacers,
S2, S5, PM1, and PM2 as well as a concatenation of them, the
head and body lice collected from Rwanda and Burundi tightly
grouped together to form clusters as well as subclusters (Figure 1,
Figures S1 and S2). In addition, the lice collected from homeless
people in France grouped tightly with those collected in non-
homeless French people, which suggested louse populations
migrate between homeless people and non-homeless people in
France and homeless people are known to be at high risk for louse-
borne diseases [9,11,12].
MST may ultimately be a good tool for performing surveys
associated with louse transmission and louse-borne diseases. In
addition, our MST analysis demonstrated that head and body lice
collected in Rwanda and Burundi in 1997, 2001, 2003, and 2008,
were closely grouped (Figure 1, Figures S1 and S2). Thus, the
outbreak of louse-borne R. prowazekii infection that happened in
1997 and 2001 opens up the possibility that lice in this region may
still pose a risk for the transmission of R. prowazekii to humans.
However, clear separation of African lice (collected from Rwanda
and Burundi) from other lice was not recovered by intergenic
spacers S2 and S5, likely due to recent recombination of nuclear
DNA [8].
As mentioned above, head lice are different from body lice
morphologically and physiologically. It is possible that these
phenotypic differences are controlled by a single mutation or
potentially a regulatory gene (or genes) governing, for example, the
volume of ingested blood. This is the simplest explanation to
understand the genetic data showing that lice have exactly the
same origin. Under certain conditions of low hygiene, a head louse
infestation can transform into a massive infestation (Figure 4).
Certain head lice could colonize clothing (Figure 5), and produce a
body louse variant by purifying selection or allotropism, which can
in turn generate an epidemic of body lice (Figure 6). Several
previous observational studies had also suggested that head lice
could become body lice when raised in appropriate conditions
[42–44]. If this scenario is true, the body louse reservoir is not
autonomous and actually depends upon head lice. Previous work
has shown that all body lice arose from mitochondrial Type A [5],
which suggests that only that genotype has the ability to evolve
into the body louse niche. This also makes it possible to
understand the difficulties to eradicate body lice in a community,
especially when the patients are surrounded by other individuals
that are infested by head lice. In our clinical work in Marseilles,
France, despite 10 years of attempts to minimize human louse
populations, body lice continually reappear and may be due to the
persistence of head louse populations [45,46]. Recent work
demonstrating the presence of B. quintana in head lice [36,37]
suggested that they might also transmit infectious diseases, which
supports our hypothesis presented in Figure 6, giving them a
greater opportunity to ingest circulating bacteria [29,31], and that
head lice are rarely collected and tested, even when present, in
outbreaks of louse-borne infections, may explain why head lice
have long been considered to be free from human pathogens.
In conclusion, by strain-typing of human head and body lice
using both coding sequences and highly variable intergenic
spacers, our data supports the hypothesis that human head and
body lice belong to the same species. Based on genotypic and
phylogenetic analyses, we also hypothesize that head lice may
Figure 4. Heavily infested hair with Pediculus humanus capitis (arrow). The patient gave informed consent for use of this picture. doi:10.1371/journal.pntd.0000641.g004
Head and Body Lice
www.plosntds.org 7 March 2010 | Volume 4 | Issue 3 | e641
Figure 5. Pediculus humanus capitis eggs attached to tissues (A) in a cap (B). The patient gave informed consent for use of this picture. doi:10.1371/journal.pntd.0000641.g005
Figure 6. Proposed scenario for the evolution of head and body lice. (A) Head lice propagate among humans; (B) in heavily infested patients, head lice might lay eggs in clothes, and resulting lice might develop and subsequently spread among humans as body lice. doi:10.1371/journal.pntd.0000641.g006
Head and Body Lice
www.plosntds.org 8 March 2010 | Volume 4 | Issue 3 | e641
transform into body lice [47] and cause outbreaks of louse-borne
diseases. However, more efforts on the genetic studies of head and
body lice are necessary to link their genetic difference with
morphological and physiological diversity. Whole genome se-
quencing of head lice and comparative genomics between head
and body lice would be useful to address these questions. In
addition, due to its high resolution and reasonable phylogenetic
classification, MST based on highly variable intergenic spacer
sequences may be helpful for the epidemiological survey of louse-
borne diseases.
Supporting Information
Figure S1 Phylogenetic organization of 207 human lice based
on concatenation of two nuclear intergenic spacers, S2 and S5,
using the Neighbor-joining method.
Found at: doi:10.1371/journal.pntd.0000641.s001 (0.02 MB PDF)
Figure S2 Phylogenetic organization of 207 human lice based
on concatenation of two nuclear intergenic spacers, S2 and S5,
using the Maximum parsimony method.
Found at: doi:10.1371/journal.pntd.0000641.s002 (0.02 MB PDF)
Figure S3 Phylogenetic organization of 174 human lice based
on concatenation of two nuclear intergenic spacers, PM1 and
PM2, using the Neighbor-joining method.
Found at: doi:10.1371/journal.pntd.0000641.s003 (0.04 MB PDF)
Figure S4 Phylogenetic organization of 174 human lice based
on concatenation of two nuclear intergenic spacers, using the
Maximum parsimony method.
Found at: doi:10.1371/journal.pntd.0000641.s004 (0.04 MB PDF)
Figure S5 Phylogenetic organization of 97 human lice based on
concatenation of four nuclear intergenic spacers, PM1, PM2, S2,
and S5, using the Maximum parsimony method.
Found at: doi:10.1371/journal.pntd.0000641.s005 (0.05 MB PDF)
Figure S6 Phylogenetic organization of 170 human lice based
on partial sequence of the cytB gene, using the Maximum
parsimony method.
Found at: doi:10.1371/journal.pntd.0000641.s006 (0.02 MB PDF)
Acknowledgments
The authors are thankful to Herve Tissot-Dupont and Aurelie Veracx for
providing pictures of patients, and to one of the reviewers who providing
constructive comments and suggestions to improve the manuscript.
Author Contributions
Conceived and designed the experiments: DR. Performed the experiments:
WL GO GG. Analyzed the data: WL GO PEF GG DLR BP DR. Wrote
the paper: WL PEF DLR BP DR.
References
1. Barker SC (1994) Phylogeny and classification, origins, and evolution of host
associations of lice. Int J Parasitol 24: 1285–1291.
2. Hafner MS, Page RDM (1995) Molecular phylogenies and host-parasite
cospeciation: gophers and lice as a model system. Phil Trans R Soc Lond B
349: 77–83.
3. Yong Z, Fournier PE, Rydkina E, Raoult D (2003) The geographical segregation
of human lice preceded that of Pediculus humanus capitis and Pediculus
humanus humanus. C R Biol 326: 565–574.
4. Leo NP, Barker SC (2005) Unravelling the evolution of the head lice and body
lice of humans. Parasitol Res 98: 44–47.
5. Light JE, Allen JM, Long LM, Carter TE, Barrow L, et al. (2008) Geographic
distributions and origins of human head lice (Pediculus humanus capitis) based
on mitochondrial data. J Parasitol 94: 1275–1281.
6. Leo NP, Barker SC (2002) Intragenomic variation in ITS2 rDNA in the louse of
humans, Pediculus humanus: ITS2 is not a suitable marker for population studies in
this species. Insect Mol Biol 11: 651–657.
7. Leo NP, Hughes JM, Yang X, Poudel SK, Brogdon WG, et al. (2005) The head
and body lice of humans are genetically distinct (Insecta: Phthiraptera,
Pediculidae): evidence from double infestations. Heredity 95: 34–40.
8. Light JE, Toups MA, Reed DL (2008) What’s in a name: the taxonomic status of
human head and body lice. Mol Phylogenet Evol 47: 1203–1216.
9. Raoult D, Roux V (1999) The body louse as a vector of reemerging human
diseases. Clin Infect Dis 29: 888–911.
10. Raoult D, Ndihokubwayo JB, Tissot-Dupont H, Roux V, Faugere B, et al.
(1998) Outbreak of epidemic typhus associated with trench fever in Burundi.
Lancet 352: 353–358.
11. Roux V, Raoult D (1999) Body lice as tools for diagnosis and surveillance of re-
emerging diseases. J Clin Microbiol 37: 596–599.
12. Brouqui P, Stein A, Dupont HT, Gallian P, Badiaga S, et al. (2005)
Ectoparasitism and vector-borne diseases in 930 homeless people from
Marseilles. Medicine (Baltimore) 84: 61–68.
13. Fournier PE, Ndihokubwayo JB, Guidran J, Kelly PJ, Raoult D (2002) Human
pathogens in body and head lice. Emerg Infect Dis 8: 1515–1518.
14. Pittendrigh BR, Clark JM, Johnston JS, Lee SH, Romero-Severson J, et al.
(2006) Sequencing of a new target genome: the Pediculus humanus humanus
(Phthiraptera: Pediculidae) genome project. J Med Entomol 43: 1103–
1111.
15. Foucault C, La Scola B, Lindroos H, Andersson SG, Raoult D (2005)
Multispacer typing technique for sequence-based typing of Bartonella quintana.
J Clin Microbiol 43: 41–48.
16. Zhu Y, Fournier PE, Ogata H, Raoult D (2005) Multispacer Typing of Rickettsia
prowazekii enabling epidemiological studies of epidemic typhus. J Clin Microbiol
43: 4708–4712.
17. Li W, Chomel BB, Maruyama S, Guptil L, Sander A, et al. (2006) Multispacer
typing to study the genotypic distribution of Bartonella henselae populations.
J Clin Microbiol 44: 2499–2506.
18. Lawson D, Arensburger P, Atkinson P, Besansky NJ, Bruggner RV, et al. (2009) VectorBase: a data resource for invertebrate vector genomics. Nucleic Acids Res
37: D583–D587.
19. Raoult D, Reed DL, Dittmar K, Kirchman JJ, Rolain JM, et al. (2008) Molecular
identification of lice from pre-Columbian mummies. J Infect Dis 197: 535–543.
20. Altschul SF, Madden TL, Schaffer AA, Zhang J, Zhang Z, et al. (1997) Gapped BLAST and PSI-BLAST: a new generation of protein database search
programs. Nucleic Acids Res 25: 3389–3402.
21. Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTAL W: improving the
sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic
Acids Res 22: 4673–4680.
22. Kumar S, Tamura K, Nei M (2004) MEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment. Brief Bioinform 5:
150–163.
23. Dereeper A, Guignon V, Blanc G, Audic S, Buffet S, et al. (2008) Phylogeny.fr:
robust phylogenetic analysis for the non-specialist. Nucleic Acids Res 36: W465–W469.
24. Guindon S, Gascuel O (2003) A simple, fast, and accurate algorithm to estimate
large phylogenies by maximum likelihood. Syst Biol 52: 696–704.
25. Hunter PR, Gaston MA (1988) Numerical index of the discriminatory ability of typing systems: an application of Simpson’s index of diversity. J Clin Microbiol
26: 2465–2466.
26. Leo NP, Campbell NJ, Yang X, Mumcuoglu K, Barker SC (2002) Evidence
from mitochondrial DNA that head lice and body lice of humans (Phthiraptera: Pediculidae) are conspecific. J Med Entomol 39: 662–666.
27. Kittler R, Kayser M, Stoneking M (2003) Molecular evolution of Pediculus
humanus and the origin of clothing. Curr Biol 13: 1414–1417.
28. Reed DL, Smith VS, Hammond SL, Rogers AR, Clayton DH (2004) Genetic
analysis of lice supports direct contact between modern and archaic humans. PLoS Biol 2: e340.
29. Buxton PA (1950) The Louse, an account of the lice which infest man, their
medical importance and control. London: Edward Arnold & Co.
30. An QI, Buxton D, Hendricks A, Robinson L, Shah J, et al. (1995) Comparison of amplified Qb replicase and PCR assays for detection of Mycobacterium tuberculosis.
J Clin Microbiol 33: 860–867.
31. Seki N, Kasai S, Saito N, Komagata O, Mihara M, et al. (2007) Quantitative
Analysis of Proliferation and Excretion of Bartonella quintana in Body Lice, Pediculus humanus L. Am J Trop Med Hyg. pp 562–566.
32. Speare R, Canyon DV, Melrose W (2006) Quantification of blood intake of the
head louse: Pediculus humanus capitis. Int J Dermatol. pp 543–546.
33. Hafner MS, Sudman PD, Villablanca FX, Spradling TA, Demastes JW, et al.
(1994) Disparate rates of molecular evolution in cospeciating hosts and parasites. Science 265: 1087–1090.
34. Light JE, Reed DL (2009) Multigene analysis of phylogenetic relationships and
divergence times of primate sucking lice (Phthiraptera: Anoplura). Mol Phylogenet Evol 50: 376–390.
Head and Body Lice
www.plosntds.org 9 March 2010 | Volume 4 | Issue 3 | e641
35. Heukelbach J, Feldmeier H (2004) Ectoparasites–the underestimated realm.
Lancet 363: 889–891. 36. Bonilla DL, Kabeya H, Henn J, Kramer VL, Kosoy MY (2009) Bartonella
quintana in body lice and head lice from homeless persons, San Francisco,
California, USA. Emerg Infect Dis 15: 912–915. 37. Sasaki T, Poudel SK, Isawa H, Hayashi T, Seki N, et al. (2006) First molecular
evidence of Bartonella quintana in Pediculus humanus capitis (Phthiraptera: Pediculidae), collected from Nepalese children. J Med Entomol 43: 110–112.
38. Robinson D, Leo N, Prociv P, Barker SC (2003) Potential role of head lice,
Pediculus humanus capitis, as vectors of Rickettsia prowazekii. Parasitol Res 90: 209–211.
39. Allen JM, Reed DL, Perotti MA, Braig HR (2007) Evolutionary relationships of ‘‘Candidatus Riesia spp.,’’ endosymbiotic enterobacteriaceae living within
hematophagous primate lice. Appl Environ Microbiol 73: 1659–1664. 40. Perotti MA, Allen JM, Reed DL, Braig HR (2007) Host-symbiont interactions of
the primary endosymbiont of human head and body lice. FASEB J 21:
1058–1066.
41. Sasaki-Fukatsu K, Koga R, Nikoh N, Yoshizawa K, Kasai S, et al. (2006)
Symbiotic bacteria associated with stomach discs of human lice. Appl Environ Microbiol 72: 7349–7352.
42. Sikora H (1917) Zur Kleiderlaus-Kopflausfrage. Archiv für Schiffs- und
Tropenhygiene 21: 275–284. 43. Nuttall GHF (1919) The biology of Pediculus humanus, Supplementary notes.
Parasitology 11: 201–221. 44. Howlett FM (1918) Notes on head- and body-lice and upon temperature
reactions of lice and mosquitoes. Parasitology 10: 186–188.
45. Badiaga S, Raoult D, Brouqui P (2008) Preventing and controlling emerging and reemerging transmissible diseases in the homeless. Emerg Infect Dis 14:
1353–1359. 46. Badiaga S, Foucault C, Rogier C, Doudier B, Rovery C, et al. (2008) The effect
of a single dose of oral ivermectin on pruritus in the homeless. J Antimicrob Chemother 62: 404–409.
47. Levene H, Dobzhansky T (1959) Possible genetic differences between the head
and the body louse (Pediculus humanus L.). Am nat 873: 347–353.
Head and Body Lice
www.plosntds.org 10 March 2010 | Volume 4 | Issue 3 | e641
