help me on these questions

profilelulsab
2.docx

Instructions: Respond to the following questions by circling or bolding the text of the correct answers. Type an explanation when prompted. You are allowed to use your book, your notes, and your classmates as sources to answer any question, but written responses must be in your

own words.

1. Match the following genotypes with the β-galactosidase expression you would expect from the lac operon. Write your matches inTable 1. The table from the text is provided for your reference.

Table 1. β-galactosidase expression in bacteria

genotype

(letters a-e)

- lactose

+lactose

1

240

240

1

1

100

1

100

1

1

Genotypes:

a. I+ O+ β- P+

b. I- O+ β+ P+/ I+ O+ β+ P+

c. I- O- β+ P+/ I+ O+ β+ P+

d. I+ O+ β+ Pe.

I- O+ β+ P+/ I- O- β+ P+/ I- O+ β+ P+

2. Use the sequence of DNA and mRNA codon table below to answer the question that follows:

5’ TAATCGGATGGAATTTATCCCGATTACCCTACTACTCTGAA 3’

There is a complete (albeit short) coding gene contained somewhere within the section of DNA shown above. Find the gene and write the amino acid sequence (use 1-letter abbreviations, e.g. L for leucine) that you would expect to be translated from this gene.

3. Perform a Google search (if necessary), use the information below, and Table 2., to answer the question below:

Information: Peptidases are enzymes that hydrolyze peptide bonds. Peptidase inhibitors prevent peptidases from hydrolyzing peptide bonds.

Table 2. The production of enzymes dependent on the presence of an ingredient. Name of enzyme refers to an enzyme that scientists want to enzymes total). The presence (+) or absence (-) of an ingredient is seen on the table for each enzyme, respectively.

C:\Users\Sarah\Downloads\20150912_154820_resized.jpg

Question to answer: There are 6 enzymes that may be produced. This is dependent upon the presence/absence of an ingredient (Table 2). Please indicate which enzymes will be made, or not made, and include an explanation for each based on the evidence seen in Table 2.

4. Answer the question below by using the information from Table 3., and what you have learned in lecture to answer the question below:C:\Users\Sarah\Downloads\20150912_160002_resized.jpg

Question to answer: You are a scientist working in a lab late one night. There are 4 bacterial species you are working with, and your goal is to have growth in each the next day (Table 3). Each bacteria is given lactose, glucose, or lactose & glucose. Your bacteria are growing overnight in the lab. You come back the next day and notice some bacterial species have died, and some have lived. Please indicate which bacterial species from Table 3., survived or died, and an explanation for each.