I need help with my Biology assignment .
soudof
m5_who_shot_ms._hightower_sp14.docxModule #2 Activity: Help solve who attacked Margie Hightower!
DNA samples were collected from the victim, suspects, and from the evidence at the crime scene. Many copies of each DNA sample were made using PCR. But, in order to figure out who attacked Ms. Hightower, you will need to first create a DNA fingerprint for each sample, and then evaluate the differences.
Below are sections of the DNA samples from each.
Step 1. Restriction Enzymes. We will examine differences in to short tandem repeat (STR) sites in the DNA samples. Site #1 has the repeat CCACGT, and site #2 has the repeat CGC. Cut the DNA with the appropriate restriction enzyme, EcoRI. An example of how EcoRI cuts DNA is seen at the right. The first DNA sample (victim) is cut for you. Determine the DNA footprint of sites 1 and 2 for the other collected samples.
(a) Victim:
CCGAGAGAATTCCCACGTCCACGTGAATTCCGCCGCCGCCGCCGCCGCCGCGAATTCTA
GGCTCTCTTAAGGGTGCAGGTGCACTTAAGGCGGCGGCGGCGGCGGCGGCGCTTAAGAT
Answer:
Site 1: (14bp long) Site 2: (23bp long)
AATTCCCACGTCCACGTG AATTCCGCCGCCGCCGCCGCCGCCGCG
GGGTGCAGGTGCACTTAA GGCGGCGGCGGCGGCGGCGGCGCTTAA
(b) Suspect #1:
CCAGAATTCCCACGTCCACGTGAATTCCGCCGCCGCCGCCGCCGCCGCCGCGAATTCTA
GGTCTTAAGGGTGCAGGTGCACTTAAGGCGGCGGCGGCGGCGGCGGCGGCGCTTAAGAT
Answer: Site 1_______ Site #2________
c) Suspect #2
AGAATTCCCACGTCCACGTCCACGTCCACGTGAATTCCGCCGCCGCCGCGAATTCTACTA
TCTTAAGGGTGCAGGTGCAGGTGCAGGTGCACTTAAGGCGGCGGCGGCGCTTAAGATGAT
Answer: Site 1_______ Site #2________
d) Evidence (hair sample)
CGAGAGAATTCCCACGTCCACGTGAATTCCGCCGCCGCCGCCGCCGCCGCGAATTCTAT
GCTCTCTTAAGGGTGCAGGTGCACTTAAGGCGGCGGCGGCGGCGGCGGCGCTTAAGATA
Answer: Site 1_______ Site #2________
e) Evidence (blood sample)
CAGAATTCCCACGTCCACGTCCACGTCCACGTGAATTCCGCCGCCGCCGCGAATTCTAT
GTCTTAAGGGTGCAGGTGCAGGTGCAGGTGCACTTAAGGCGGCGGCGGCGCTTAAGATA
Answer: Site 1_______ Site #2________
Step 2. Gel Electrophoresis. In order to visualize the difference in STRs between the DNA samples, scientists must run the DNA out on an agarose gel, which separates the DNA pieces from one sample based on size. You will run out all your samples on the gel below. *Make sure to draw the DNA bands in the appropriate gel (look at which DNA probe is being used)
( Victim ) ( Blood ) ( Hair ) ( S #2 ) ( S #1 ) ( Blood ) ( Hair ) ( S #1 ) ( S #2 ) ( Victim ) Gel #1 (DNA probe: CCACGT) Gel #2 (DNA probe: CGC)
( 50 bp ) ( 20 bp ) ( 30 bp ) ( 15 bp ) ( 10 bp ) ( 40 bp )
( 5 bp )
Step 3. Analysis. Based on the DNA evidence above, answer the following questions.
a) What conclusions can you make about the DNA collected from the hair sample left at the scene of the crime? How do you know?
b) What conclusions can you make about the DNA collected from the blood sample left at the scene of the crime? How do you know?
c) Which suspect should the police arrest for this crime? Explain.
