revision (for Nancy)
Hi dear,, u did well in this part BUT a little things I deleted because I did not do it as sterilizing germinate ,,
And please look to the yellow highlighted line which u need to improve and rewriting..
And, where is the references list of writing the methods??? U need to find some sources to complete and improve some parts of the methods.
Don’t use my friend report as a resource, because as u see she have references list in the end
I asked u to look to her report because we use the same protocol, and because I want u to know how u must organize my report :)
The method:
Initially before all the steps I just germinated the Arabidopsis seeds in the autoclaved soil, and then it was followed by an everyday watering process untill its proper growth of flowering. Then I prepared the Agrobacterium broth culture of bacteria’s and dipped the flowers in that broth by the appropriate use of the floral dip method, and kept it in a room temperature for 24 hours then put it back to 25 degree. Until the flowers started flowering then drying until became yellow and dried flower I collected the seeds from those flowers.
Secondly, after collecting the samples of seeds from the previous step which was already treated with Lectin 2 genes, I germinated them again in the autoclaved soil for next 15 days with the routine intervals of watering process along with the spray Basta (chemical herbicide) untill the plant was grown. It was great to view those plants just after 4 days of spray with Basta,then repeated the spray each 4 days for about 4 times .Next I selected those resistance leaves (only the green ones) from my plant I got 8 green plant only and transferred it for the further growth in new soil in 24°C.
After a long month duration, when the plant leaves were grown well, I followed my Third Step to extract the RNA from those leaves. (8 RNA extract sample) followed by the measurement of its concentration with two of the available methods- initially by the first Nano drop and then the Qubit kit.
Next Fourth Step was followed by inoculating the plant with Pseudomonas syringe, by the use of a syringe in those leaves and directly after the inoculating the DNA extracts from 3 leaves of each plant was taken out. And again after 24 hours I extracted the DNA from other 3 leaves of the plant.
Now after having the entire DNA sample again I followed to measure their concentration by using the nano drop technology before performing the real time PCR. To check the gene expression my Fifth Step I converted those RNA samples to a DNA sample and performed the real time PCR, and also repeated the steps with the canola genes.
Now let us examine the proper ways which were executed while performing the above steps in an effective way.
1. Germinating Arabidopsis thaliana wild type seeds on soil:
Arabidopsis thaliana growth can be well favored in several environmental conditions, for instance growth chambers, growth rooms, outdoors or greenhouses. On the other hand Peat moss-based mixes, defined agar media, and other commercial greenhouse mixes all are used as the plant substrates. However the study only reflects the growth of plants in the soil and agar plates in an optimum room temperature. The Arabidopsis seeds were collected and typically stored at 4°C for the three consecutive days after sowing them. Hence all the different containers or pots were enabled to be used for the effective growth of Arabidopsis plants in that soil.
The preparation of pots and planting was conducted in the given following way:
1. Potting soil was autoclaved initially to provide the best growth of plants favored in the environment by killing disease pathogens and weed seeds which might be lingered in soil.
2. Several pots were placed in a tray or in another similar container which was then covered by a piece of mesh fabric to regulate proper humidity of the soil.
3. Soils were humidified with tap water then placed loosely soil in the pots or flat chambers. They were not compressed so as to give a soft and uniform bed. Now at this stage they were ready for getting germinated with the samples.
4. Arabidopsis seed were sowed in the surface of soil pots. Proper caution to prevent the seeds getting covered with soil was applied since they needed light for the germination.
5. Trays were covered by a clear plastic lid to maintain humidity for germination and avoid seed desiccation.
6. The whole tray was covered more by a plastic bag and placed in the dark and cold room at the cooling temperature of (3-4°C) for 3 days to break the dormancy of seeds and improve the rate of germination along with its synchrony. This treatment stage was especially important for the freshly harvested seeds which might had more pronounced dormancy.
7. After the cold storage treatment, they were moved to common room with normal temperature of 24°C and were watered in a periodic manner approximately 2cm of water around seed during germination phase, every day.
Once the seedlings were grown in a growth under the optimal conditions of water supply and proper nutrition, they started to germinate within 3 - 5 days. After germination, plants were needed to avoid water stress. Hence the sub-irrigation was applied only when the soil used to get dried. When plants had got true leaves, watering frequency was obviously decreased.
2. Agrobacterium bacteria broth:
Preparing the bacteria we need following things:
LB liquid10 g tryptone, 5g yeast extract, 10 g NaCl, and Water.
LB agar 5g tryptone, 2.5g yeast extract, 5g NaCl, 5g agar.
Then autoclave both the LB agar and liquid, after that 2 different antibiotics are added in LB agar-
1-100 μl of tet 15 mg/ml
2-100 μl of kan 50 mg/ml and then the entire broth is divided in four party dishes, next followed by the growth of Agrobacterium tumefactions by using 16 streak way on the agar plate.
Preparing LB Broth:
5 ml of LB liquid which is already prepared.
5 μl of tet 15 mg/ml
5 μl of kan 50 mg/m.
Some amount of Agrobacterium which has already been grown above in the four different Petri plates. Now after grabbing all the required things we keep them in 28°C for a day when they becomes cloudy, 2ml of this broth is added well with 200ml of LB liquid along with 200 μl of tet 15mg/ml and 200 μl of kan 50mg/ml
Next: after 24 hours the broth are divided into four tubes (50ml) and then measured with their concentration. All the tubes are centrifuged and then only the pallet is required and the liquid above the pallet in the centrifugal tubes are discarded.
Preparing the Sucrose:
5g of sucrose is mixed well in 200 ml water and then equally divided into four different test tubes which contains the pallet filled with bacteria which is extracted above by the proper centrifugation. Now again they are mixed well and centrifuged, now the next broth is collected into the clean flask and 500μl of Silwet (0.05%) and we started dipping.
3. Floral dip method: Please u must find the protocol of floral dip method from internet resources and summaries it as point her
4. Collect the seeds: Harvest dry seeds from 25c after 8 days of last watering.
5. Germinate the collected seeds (which I collected from last step and it's already treated with Lectin 2 gene
6. Spray the plant with Basta (its chemical herbicide) it keeps the plant green, hence it was sprayed in the plant for 4 times then the leaves with highest resistance against Bast was figured out which does not turned yellow.
7. Choose the resistance leaves only (the green leaves were I found only 8 plant was green, and then transferred them to grow in new soil)
8. Extract RNA from the leaves, I used SV total RNA isolation system (Kit protocol)
The procedure is listed below: this good steps but why u didn’t write which references u got it from??
i) Samples (leaves) harvesting was placed in centrifuge tube then put in liquid nitrogen that employs in initial grinding stage. Abrasive sticks were used to break down cell wall and cell membrane in about 30 seconds before the sample can be defrosted.
ii) Added 175 μl SV RNA Lysis Buffer (already added BME) to tubes. Mix through by inversion.
iii) Added 350 μl SV RNA Dilution Buffer. Mix briefly by inverting 3–4 times. iv) Centrifuged for 10 minutes then transferred the clear lysate to a clear micro
centrifuge tube. v) Applied 200 μl Ethanol 100% to clear lysate, mixed well by repeated pipetting. vi) Transferred the mixture to Spin Basket Assembly then centrifuged for 1 minute.
Eluate was discarded. vii) Added 600 μl SV RNA Wash Solution (already added ethanol) then centrifuged for 1
minute and discard eluate. i) Prepared DNase incubation mix as follows:
ii) A pply 50 ul of mix to sampels
iii) Add 200 ul DNASE stop solution and centerfuge for 1 min iv) Add 600 ul of RNA wash solution ,centefuge for 1 min
Solution Volume X Number of Preps = Total Yellow Core Buffer 40 μl Mncl2 0.09M 5 μl Dnase 1 5 μl
v) Add 250 ul of RNA wash solution ,centerfuge for 2 min vi) Add 50 ul of nuclease free water to the sampels,centerfuge for 1 min, then store at -
80c
Measure RNA concentration using Nano Drop® ND 1000 Spectrophotometer:
The UV absorbance based method for the measurements of nucleic acids at 260nm is mostly used and it is quantified with the wide range of samples concentration ranging from 2μg/μl to 15μg/μl. The absorbance ratio being performed at 260/280 reflects the purity of DNA and RNA. However the composition with the ratio of at least 1.8 or 2.0 is widely accepted as pure form. Otherwise the lesser ratio symbolizes the presence of protein, phenol or any other contaminants.
Measure RNA concentration using Invitrogen Qubit® 2.0 Fluorometer:
For DNA performing quantitative real-time PCR (qPCR), a systematic measurement of concentration was required. The procedure was conducted in the following way:
a. Prepared two Assay tubes (provided) for standards and one tube for each of sample. b. Prepared Working solution based on the volume of sample. c.
Solution Standard Assay tubes Sample assay tubes Working Solution 190 μl 180-199 μl Standard (provided) 10 μl - Sample - 1-20 μl Total Volume in each tube 200 μl 200 μl
d. Did vortex for 2–3 seconds e. Incubated the tubes at room temperature for 2 minutes. f. Inserted standard tubes in Qubit® 2.0 Fluorometer to set new standard followed by
inserting sample tubes to read result.
9. Preparing pseudomonas syringe In this step u need to write the details …I send to u file about preparing the bacteria plus how inoculate the leaves with bacteria it was included photo, Plus please find some sources on the internet to write this part .u don’t need to write allot BUT u need to explain how I insulated the leaves
10. The same steps of preparing Agrobacterium above
11. Inoculate the plant with pseudomonas syringe
12. The DNA is extracted. Please find in the internet the sources that show the CTAB protocol and then summaries it as point not paragraph.
From the leaves twice initially, direct after the inoculation and secondly after a day. In my process CTAB protocol is followed. As we know the extraction process essentially requires any of the vectors or mechanical means for the proper break down of cell wall and cell membranes to gain access over the nuclear materials without causing any damage in the DNA sequence. The method with the use of CTAB gives the intact genomic DNA extracted from the plant tissues.
After harvesting the leaves, liquid nitrogen is applied in the initial stage of grinding for the appropriate break down of its cell wall material along with the disabled harmful action of enzymes and chemicals. Tissues were grounded properly before re-suspending in CTAB buffer. Soluble proteins and other materials were discarded by the use of chloroform and centrifugal technique for the removal of insoluble particulates for the proper purification of DNA. Hence those nucleic acids were precipitated from the aqueous phase and rinsed off thoroughly to remove any contaminating salts if present.
13. Measure the DNA concentration by the used Nano drop
14. iASK primers and HRPZ primers were used on all the samples for the real time PCR.
Procedure for the real time PCR where is the protocol?? I think the one below for DNA extraction
2. All the extract mixture was transferred in a micro centrifuge tube;
3. Incubated for about 15 min in a recirculating water bath at 55oC
4. The CTAB/plant extract mixture was spinned at 12000 rpm for 5 min to bring down cell debris then the supernatant was transferred in a fresh microfuge tubes;
5. In each tubes 250 μl of Chloroform that is Iso Amyl Alcohol (24:1) is added. The solution was mixed well by inversion at spin of 13000 rpm for 1 min. The upper aqueous phase was transferred to a clean microfuge tube and same was repeated twice to acquire more and more purity.
6. 50μl of 7.5 M Ammonium Acetate was added in each tube prior to the addition of (500 μl) ice cold absolute ethanol, followed with the proper night long incubation at 20°C.
7. After 8 hour of incubation, it was spinned to form pellet at 13.2 x 1000rpm for half an hour and then the supernatant was discarded and the DNA pellet was washed adding two changes of ice cold ethanol (70%)
8. The DNA pellet was then formed again by centrifugation at 12000 for 5 minutes;
9. The DNA was left to be dried at room temperature for 15 minutes and then resuspended in 50 μl of ultrapure water followed by adding 1 μl RNase (10 mg/ml) and incubated at 37°C for 1 hour to remove RNA in the preparation;
10. Finally the resuspended DNA was incubated at 65°C for 20 minutes to prevent any contamination of DNase and stored at 4°C till it being used.
Primer name and Sequence
rt_iASK_at5g2675F GAGCTCCTGTTAATTTAACTTGTACATACC rt_iASK_at5g2675R CTTATCGGATTTCTCTATGTTTGGC pst_HRPZ_A TACCAAGACCACCACCCGAC pst_HRPZ_B GCAACAAGGTGATGCCAGTG rt_at3g16530_F GCCTTCATCATAACCCCGGAA rt_at3g16530_R AATTCGATAGCCAAGATGTGGTT