Nancy carole
Thi Lan Phuong Nguyen 42777982
1
Contents I. Abstract ................................................................................................................................................ 3
II. Introduction ........................................................................................................................................ 3
2.1. Plant – microbial interaction ........................................................................................................ 4
2.2 Lectin protein ................................................................................................................................ 5
2.3. Arabidopsis plant ......................................................................................................................... 8
2.4. Metagenomics ............................................................................................................................. 9
III. Research objective ........................................................................................................................... 10
IV. Material and methods ..................................................................................................................... 11
4.1. Plant growth conditions, chemical treatment and rhizosphere soil sampling .......................... 11
4.1.1. Germinating Arabidopsis thaliana seeds ................................................................................ 11
4.1.1.1. Germinating Arabidopsis thaliana seeds on soil .................................................................. 12
4.1.1.2. Germinating Arabidopsis thaliana seeds in sterilize conditions .......................................... 13
4.1.1.3. Checking homozygous seeds ............................................................................................... 15
4.1.2. Preparation of E.coli for inoculation around plant roots ........................................................ 16
4.1.2.1. Growth of E.coli on LB (Luria-Bertani) agar plate ................................................................ 16
4.1.2.2. Growth of E.coli on LB Broth. ............................................................................................... 16
4.1.2.3. Wash LB Broth by PBS (Phosphate Saline Buffer) to get the pellet of E.coli ....................... 16
4.2. Sample DNA, RNA extraction, PCR amplification, Real time PCR and data processing. ............ 17
4.2.1. Plant genomic DNA and RNA extraction. ................................................................................ 17
4.2.1.1. Plant genomic DNA extraction by CTAB (Cetyl Trimethyl Ammonium Bromide) ................ 17
4.2.1.2. Plant RNA extraction. ........................................................................................................... 19
4.2.2. Bacterial genomic DNA extraction. ......................................................................................... 20
4.2.4. Measure DNA concentration and checking the quality of DNA. ............................................ 23
4.2.4.1. Quantification of DNA concentration .................................................................................. 23
4.2.4.2. DNA quality confirmation .................................................................................................... 24
4.2.5. DNA amplification by PCR (Polymerase Chain Reaction). ....................................................... 25
4.2.6. Clean up PCR products ............................................................................................................ 25
4.2.8. Quantitative RT – PCR (qRT-PCR) ............................................................................................ 27
V. Results ............................................................................................................................................... 28
5.1. Screening and selecting homozygous lectin-1-overexpressing Arabidopsis plants ................... 29
5.1.1. Response of lectin-1-overexpressing Arabidopsis plants to Basta herbicide. ........................ 29
5.1.2. Measurements of RNA concentrations from Arabidopsis plants ........................................... 31
Thi Lan Phuong Nguyen 42777982
2
5.1.3. Quantification of Lectin 1 gene expression by qRT-PCR ......................................................... 32
5.2. Evaluation of survival bacteria around Lectin-1–overexpressing Arabidopsis thaliana. ........... 33
5.2.1. Quantify the concentration of DNA extracted from root and rhizosphere ............................ 34
5.2.2. Quantification of E.coli 16S copies using ER-F2 and ER-R2 primers. ...................................... 35
5.2.3. Quantification of E.coli 16S copies using Univesal E.coli 16S primers (906F and 1062R) ....... 36
VI. Discussion ........................................................................................................................................ 36
VII. Conclusion ....................................................................................................................................... 38
Thi Lan Phuong Nguyen 42777982
3
I. Abstract The rhizosphere soil is an environment where different plant-microbe interactions occur.
Beside beneficial interactions that result in plant growth promotion or disease resistance,
plants also usually face a variety of pathogen and diseases. The protein Lectin belongs to a
group of carbohydrate-binding proteins and can be synthesized in various organs,
particularly in roots, tubers and seeds [1]. This protein plays a role in the recognition of
rhizobia by legume plant species and is related to different pathogen defence activities. This
research using lectin-1-overexpressing Arabidopsis thaliana was undertaken to investigate
whether lectins had ability to increase or decrease populations of rhizoshere bacteria. An
experiment for checking if the lectin-1-overexpressing transgenic line is homozygous was
also initially performed.
II. Introduction Activities of microbial communities are key elements to determine biogeochemical
transformations in nature. They, therefore, can play an important role in managing and
engineering ecosystems [2]. The soil environment influenced by root is called rhizosphere. It
harbours the microbial diversity that affects plant health and nutrient [3]. However, the
mechanisms underlying these plant-microbe interactions are currently not well understood.
Improving methods to perform the whole community level characterisation of microbe
genome as well as the gene expression is an essential task which facilitates a comprehensive
profiling of rhizosphere communities [4].
Thi Lan Phuong Nguyen 42777982
4
2.1. Plant – microbial interaction
Plants and microorganisms become involved in a close interaction in soil environments. In
such relationships, it can be seen that plants play a role as a part of the microbial residence
environment and provide nutrient released from exudates as a substrate for microbe
growth, and microorganisms probably interact directly with plants via altering their
environment. For instance, saprophytic fungi play a role in decomposing complex organic
compounds and consequently plants can acquire readily available nutrients [5] [6]. On the
other hand, production of organic acids and/or proton extrusion can lead to a drop in pH in
soils. This change results in solubilisation of phosphate from precipitate form into the soil
solution and subsequently phosphate becomes available for plant uptake [6]. In addition,
locating with a large number in soil environment, once microbe die, the carcasses become
also a source of nutrient for plants. Bacterial rhizosphere microflora is also related to plant
health as it plays an important role in suppression soil borne plant diseases relied [7]. The
processes associated with such suppression that are involved in systemic acquired
resistance (SAR) or induced systemic resistance (ISR) could be antibiosis, lytic activity,
competition for substrates, or competition for iron caused by siderophores [7, 8]. In regard
to self-defence, due to the sessile lifestyle that consequently leads to the invasion of more
pathogen than other mobile eukaryotes, plants tend to secrete a wide range of chemical
defences against biological attacks. They can be antibiotics, or antibiotic precursors that
collectively called phytoanticipins [9]. Some of the best known group of phytoanticipins are
the saponins, steroid and terpenoid glycosides [10]. When the antibiotics are absent or
present with a very low concentration, phytoanticipins can be performed secondary
metabolites with antimicrobial activity [11]. Hence, it can be said that the characteristics of
plants as well as exudates released by roots definitely play the role in shaping the
composition of rhizosphere microbial community [12, 13]. It is also obvious that
maintenance of plant defences is costly. As a result, the mechanisms utilised by plants that
determine allocation of resources to defence microbial threats or growth have been
attracting scientists’ interest.
The major endogenous low molecular weight signal molecules involving in regulating the
plant defence signaling are the plant hormones salicylic acid (SA), jasmonic acid (JA),
ethylene (ET), and abscisic acid (ABA) [14, 15]. These hormones activate specific pathways
and can act individually, antagonistically or synergistically depending on the pathogen
Thi Lan Phuong Nguyen 42777982
5
involved [15]. In addition to local resistance, many of these phytohormones can also induce
defence responses in systemic tissues. An example is the ISR, which is triggered upon root
colonization by some non-pathogenic rhizobacteria. Meanwhile, SAR is induced in distal
tissues upon pathogen infection and generates a long-lasting resistance to secondary
infections caused by a broad spectrum of pathogens [15]. Furthermore, ISR is triggered by
application of methyl jasmonate while salicylic acid is an important phenolic compound for
establishment of SAR. Using Arabidopsis thaliana as a model plant, a complex interplay of
signal molecules in various defence-signaling pathways could be determined. Of them, JA is
a key member in the jasmonate family that plays a role in regulating plant defence to both
biotic and abiotic stresses. As other signalling pathways, the JA pathway includes the
perception of stress stimulus leading to local and systemic signal transduction, perception of
specific signal, followed by synthesis of jasmonic acid, and subsequently, responsiveness to
JA involving induction of subsequent downstream effects [15]. A study involving JA-
biosynthesis mutants showed that the triple mutant fad3 fad7 fad8 is deficient in the JA-
precursor leading to an inability in accumulating JA and consequently higher susceptibility to
infection by insect larvae [16]. Further experiments showed that the fad3 fad7 fad8 mutant
line is hypersusceptible to root rot caused by Pythium mastophorum. Alternatively, an
exogenous application of methyl jasmonic acid confers less susceptibility to soil-borne
pathogens [17]. Thus, both production of JA in wounded tissues as well as perception of JA
in distal tissues are vital for activation of systemic responses. In other words, JA molecules
function as a signal of ISR [18].
It can be seen that plant and microbe are involved in a consistent interaction that play a
vital role in natural balance in an ecosystem. In which, a numerous beneficial
microorganisms even have been described for plants. However, negative impacts of
soilborne bacteria is also considerable [19, 20]. Hence, studies of increasing the ability of
defending against plant pathogens need to be attentions for further researches.
2.2 Lectin protein
Lectins are carbohydrate-binding proteins that reversibly bind to specific mono or
oligosaccharides with high affinity [21]. Such proteins have been found in plants, animals
and microorganisms and are widely implicated in immune responses as pharmaceuticals
[20]. Lectins from about 80 species have been characterized to identify structures and
Thi Lan Phuong Nguyen 42777982
6
specific biological functions. Lectin-like proteins work as plant agglutinins and are involved
in plant’s defence against variety of plant-eating organisms [21]. They can be found in
different parts of various plants such as legume, cereals (eg. rice, wheat), solanaceae (eg.
tomatoes, potatoes) and particularly in tissues or organs that need extra protection such as
seeds or storage organs. A possible reason for extra protection is that they are susceptible
to attack by foreign organisms including conventional parasites and predators [21]. Based
on the structure, lectins are classified into three major types, including merolectins,
hololectins, and chimerolectins [21]. Merolectins are single polypeptide and contain
exclusively one single carbohydrate-binding domain, for example Hevein from rubber tree
[22] or monomeric Man-binding proteins of orchids [21]. Meanwhile, hololectins include
two or more carbonhydrate – binding domains and such domains are either identical or very
homologous [21]. However, the majority of well-known lectins are chimerolectins which
contain one carbonhydrate-binding domain arrayed tandemly with other unrelated domain
which acts independently on such carbonhydrate-binding domain. The pathogen defence
activity of lectin varies depending on its familiarity with the environment. For instance,
lectins that work as ribosome inactivating protein type 2 (type 2 RIPs) belong to the lectin
major type of chimerolectins and are extremely toxic to all eukaryotes when they reach the
cytoplasm [21]. There isevidence that type 2 RIPs which critically affect on higher animals
involving humans have been found since ancient times [21]. One kind of type 2 RIPs called
Ricin exhibits toxicity to the coleoptera Callosobruchus maculates and Anthonomus grandis
[23]. Another lectin which comes from winter aconite (Eranthis hyemalis) is highly toxic to
the larvae of the insect Diabrotica undecimpunctata, which is known to attack maize) [24].
Though type 2 RIPs are also toxic to fungi, deleterious effects due to invasion are normally
prevented since the presence of a rigid and thick cell wall. As a result, type 2 RIPs cannot
penetrate the cytoplast [21]. Although the evidence of antiviral activity of plant lectin is not
obvious, some plants expose indirectly antiviral action. For example the existence of
insecticidal lectin results in preventing or decreasing the spread of insect-transmitted viral
diseases. Meanwhile, the understanding about antibacterial activity of plant lectin seems to
be more convincing. In a research in 1977, Sequeira and Graham showed that potato lectins
that exist as cell wall proteins have the ability to immobilize avirulent strains of
Pseudomonas solanacearum when they attack the cell wall [25]. Because of the presence of
Thi Lan Phuong Nguyen 42777982
7
cytoplast, the mechanism of plant’s defence against bacteria must be indirect through
interactions of the protein lectin with extracellular glycans or carbonhydrates exposed on
the cell wall. Another example of such indirect defence is the interaction of thorn apple
(Datura stramonium) seed lectin with normal motile bacterial community around the air-
water interface resulting in blocking the movement of such bacteria [21]. The lectin-
mediated block of bacterial motility in the experiment expressed correlatively with the
highly specific release of lectin from the seed coat and the seed epidermis during
imbibitions [21]. Thus, by suppressing the chemotactic motility of soil bacteria toward
germinating seed, the protein lectin can protect seedling roots from harmful bacteria [21].
Brieftly, it can be concluded that most plant lectins are reported to be involved in plant
defences. From this viewpoint, the preferential accumulation of lectins in storage organs
has been the focus of attention for further research. Furthermore, lectins in plants are
typically present in large amounts and therefore also behave as storage proteins, as plants
can accumulate them as a nitrogen reserve [21]. Recently, by using microarray screening
and a subtractive cDNA library from Alternaria brassicicola-inoculated Arabidopsis thaliana
plants, Prof Schenk’s research team discovered a gene (At3g15356) that encoded a lectin-
like protein [20]. The gene was named Protectin 1 and particularly responds to methyl
jasmonate signal and is up-regulated by all common plant defence pathways as well as by
the attack of pathogens and nematodes [20, 26]. Protectin 1 gene expresses one of the most
abundant transcripts during defence response against pathogen. Quantitative real-time PCR
(qRT-PCR) revealed an increase of 10% in gene expression of Protectin 1 when Arabidopsis
plants were exogenously treated with methyl jasmonate. Furthermore, the increase in
Lectin expression was also observed in treatments that included other defencedefence
signaling hormones, such as ethylene (ET) and salicylic acid (SA) (up to 13.1-fold and 11.1-
fold, respectively) [20]. However, such gene was suppressed by the compound abscisic acid
(ABA), which is a stress signaling compound. A clear repression of 5.6-fold of Protectin in
Arabidopsis was revealed after a 24-hour treatment with ABA [14]. Utilizing SDS-PAGE and
mass spectrometry, P. Schenk et al. envisaged two isoforms of Protectin-1, an
unglycosylated (29.989 kDa) and a heavily glycosylated (31.175 kDa) protein. The fully-
formed glycosylate harbours six or seven sugar residues binding to protein while the hypo-
glycosylated form consisted of just one sugar residue attached [20]. Plant expression studies
Thi Lan Phuong Nguyen 42777982
8
with fusion proteins that accumulate a green fluorescent protein (GFP) indicated that the
protein Protectin 1 is expressed in the root cell wall and may be able to act as a defence
barrier to the plant [20]. Lectin-overexpressing plants showed higher resistance against
bacteria possibly by immobilising them at the root surface. The present study aimed to
investigate whether the same mechanism of immobilising bacteria may also enable plants to
obtain nutrients by direct uptake of bacteria.
2.3. Arabidopsis plant
Since the research time is short, we used Arabidopsis thaliana which has a short life cycle. In
addition, Arabidopsis thaliana is an excellent model for investigating plant biotechnology
[27]. Although it has no major agronomic significance, Arabidopsis facilitates basic research
in genetics and molecular biology because these plants harbour a simple genome, short life
time, and a large number of mutant lines and genomic resources [28]. As rhizosphere and
plant roots are colonised by soil bacteria that are attracted by rhizodeposits, roots possibly
manipulate the microbial flora when they need to allocate resources for plant defence [29,
30]. Results shown by Hein et al. (2008) indicated that the diversity of rhizosphere microbes
is different between Arabidopsis thaliana salicylic acid-mediated systemic resistance mutant
and the wild-type. This insight opened the door towards a thorough understanding as well
as application of inducible plant as a control force in shaping soil bacterial assemblages [31].
As a first step to gain a further understanding about how Arabidopsis thaliana can
manipulate their soil environment via inducible defence mechanism, we attempted to
quantify Escherichia coli cells in the rhizosphere and roots of a lectin over-expressing line
and wild-type Arabidopsis thaliana. In nature, the Lectin gene is expressed in some plant
species including the wild-type Arabidopsis. A Lectin over-expressing line was generated by
transforming Arabidopsis plants with the 35S overexpressing promoter upstream the Lectin-
encoding gene. [26]. In order to facilitate the convenient selection of successful transgenic
plants, an anti-herbicide gene was inserted to the synthetic vector simultaneously.
Therefore, before conducting a germinating experiment, a step of checking homozygous
lectin-overexpressing Arabidopsis plants was performed by spraying basta, an herbicide that
Thi Lan Phuong Nguyen 42777982
9
should select for transgenic plants co-expressing the basta-resistance (BAR) gene. A 100%
survival rate indicated that mother plants are homozygous [32]. The 35S lectin
overexpression line at the 2 nd
day and the 5 th
day of post infection showed a lower amount
of bacteria Pseudomonas expression compared to the T-DNA/knock out line and the wild
type. Furthermore, less nematode eggs were also found in the rhizosphere of lectin
overexpressing plants in comparison to wild type. Surprisingly, none of these independent
overexpressing transgenic lines showed any discernible morphological phenotype [20].
2.4. Metagenomics
Metagenomics is the culture-independent genomic analysis to study potential functions of
microbial communities directly from their natural environments [33]. This term is combined
between the statistical concept of meta-analysis (a process of statistically combining
separate analyses) with genomics (the comprehensive acknowledge of an organism’s
genetic material) [34].
The soil microbial community is considered to have a highest level of microbial diversity
compared with other environments [35, 36]. The number of bacterial species per gram of
soil is estimated to vary between 2000 and 8.3 million [36]. This soil species pool confers a
gold-mine for genes servicing in applications in industry, such as pharmaceutical products as
well as in biodegradation of human-made pollutants [37, 38]. However, it is estimated that
only less than 1% of this diversity can be cultured by traditional techniques [39]. Thus,
culture-independent approaches including a variety of methods to extract DNA from soils
have been developed [40, 41] and if coupled to next generation sequencing, this approach
can significantly improve our access to these communities [35]. Metagenomics has recently
been advanced in microbial genomics, in polymerase chain reaction (PCR) amplification and
in cloning of genes that share a sequence which is similar to the 16S rRNA directly from
environmental samples [39]. In bacteria, archaea, chloroplasts, and mitochondria, a small
ribosomal subunit possesses the 16S rRNA (letter S in “16S” stands for Svedberg unit) while
the large one contains two rRNA species which are the 5S and 23S rRNAs. All of the bacterial
16S, 23S, and 5S rRNA genes are typically organized as a co-transcribed operon [42] and
generally, the rRNA genes are the most conserved (least variable) in all cells. So, portions of
the rDNA sequences from distantly-related organisms are very much alike and sequences
from such organisms can be precisely aligned. They generate the true differences for an
Thi Lan Phuong Nguyen 42777982
10
easy measurement. Consequently, the rRNA-coding genes are typically used to determine
taxonomy, evolutionary relationship, and the rate of species divergence among bacteria
[42]. Currently new deep sequencing methods confer a convenient platform to characterise
efficiently the composition of microbial communities [43, 44]. 16S rRNA pyrosequencing
that is used for quantification of bacteria presence recently has been become one of the
most striking means to tackle that issue. The 16S rRNA gene consists of highly conserved
regions which are interspersed with variable regions. Therefore, the PCR primers were
designed to be complementary to universally conserved regions and to flank variable
regions [45]. The results that are acquired from amplification and sequencing then are
compared to databases to allow the generation of bacterial lineages and proportions in their
community [46, 47]. Un-cultured rhizosphere bacteria have been also studied extensively
using 454/Roche pyrosequencing to identify the 16S rRNA gene sequence, and multiple
studies then have been conducted to optimise the method [45]. In briefly, this new and
potential technique can also become a powerful mean to evaluate the effect of plants to the
diversity of rhizophere bacteria.
III. Research objective In this study we used the lectin-overexpressing Arabidopsis plants for controlled microbial
inoculation experiments. We aimed to quantify inoculated bacterial cells in the rhizosphere
and roots and to explore whether inoculated bacteria may survive differently around lectin-
overexpressing plants. The following two objectives help to achieve the above-mentioned
aim.
Objective 1: Screening and isolating homozygous lectin-overexpressing Arabidopsis plants.
Objective 2: Using controlled E. coli plant root inoculation experiments coupled with
quantitative PCR (qPCR) in order to evaluate the survival of these bacteria around lectin-
overexpressing plants. This may provide clues whether these plants can increase direct
nutrient uptake from bacteria.
Thi Lan Phuong Nguyen 42777982
11
IV. Material and methods Firstly, plants of Lectin-1-overexpressing Arabidopsis line were cultivated in soil. After 3
weeks when plants achieve 10-leaf-stage, Basta herbicide 1% was sprayed over plants. Since
the BAR gene for Basta resistance was co-transformed with the 35S promoter, survival rates
of plants after spraying were used to evaluate whether plants were offspring of homozygous
or heterozygous lines. The homozygous seeds that showed high percentages of germinating
and low rates of plants depicting any yellowing symptoms were chosen to be utilised in the
next screening step to isolate the best Lectin-1-overexpressing Arabidopsis plant. To
perform this screening, the best Lectin-1 seeds that were isolated from the Basta-spraying
experiment were germinated again and the plant tissues were collected for RNA extraction.
After cDNA synthesis, a qRT-PCR was performed utilising primers (provided by Shenk lab) to
amplify the Lec-1 gene to confirm which over-expressing line contained highest levels of Lec-
1 transcripts.
Other experiments later were carried out to determine differences of bacterial densities in
the rhizosphere of Arabidopsis between the wild type (WT) and the Lec-1 over-expressing
line. One was performed with surface sterilized seeds germinated on sterile solid medium of
Murashige and Skoog (MS) mineral salts. Seedlings were grown under axenic conditions.
After 2 weeks when these plants reached 6-8 leaf-stage, they were transferred to sterilised
vessels containing autoclaved soils and Escherichia coli was inoculated on the soil around
plants. E. coli was chosen since it does not form any kind of association with Arabidopsis
thaliana and is not ordinarily found in soils.
DNA then was extracted from roots and from the rhizosphere soil. qRT-PCR was performed
again using two sets of primers to amplify 16S rRNA gene.
4.1. Plant growth conditions, chemical treatment and rhizosphere soil
sampling
4.1.1. Germinating Arabidopsis thaliana seeds
Arabidopsis thaliana can be grown in various environment conditions, for instance, growth
chambers, growth rooms, window ledges, outdoors, or greenhouses [48]. Peat moss-based
mixes, defined agar media, relatively inert media watered with nutrient solutions and
commercial greenhouse mixes and can all be used as plant substrates [49]. However, this
Thi Lan Phuong Nguyen 42777982
12
study only focused on growth of plants on soil and on agar plates which are placed in
growth rooms. Arabidopsis seeds are typically stored at 4 o C for three days after sowing.
4.1.1.1. Germinating Arabidopsis thaliana seeds on soil
In this study we used the product Real Premium Potting Mix manufactured by J.C. & A.T.
Searle Pty. Ltd, Queensland, Australia. The recipe contains Flourish soluble plant food,
Penetraide, Robust Plus, complete plant food plus trace elements, water crystals & zeolite,
and fully organic compost & peat.
Different containers or pots can be used for the growth of Arabidopsis plants on soil [49].
The preparation of pots and planting can be conducted as follows:
1. Potting soil was autoclaved first to give plants the best growing environment by killing
disease pathogens and weed seeds that might be lingered in soil. Typically, most
commercial products had been already done this step but it should be repeated again.
2. Several pots were placed in a tray or in another similar container which was covered by a
plastic wrap. Additionally, each pot was also covered by a piece of mesh fabric to keep the
soil inside as well as maintain enough humidity.
3. Humidified soil with tap water then place loosely soil in pots or flat chambers. The soil
was not compressed to give a soft and uniform bed. At this stage, pots were ready for
germinating.
4. Sowed Arabidopsis seed to the surface of soil pots. Try not to cover plant seeds by soil
since they needed light for germination.
5. Covered the trays by a clear plastics lid to maintain humidity for germination and avoid
seed desiccation.
6. The whole tray was covered more by a plastic bag and placed in the dark and cold room
at the refrigerator temperature (3-4°C) for 3 days to break dormancy and improve
germination rate and its synchrony. This treatment stage was especially important to freshly
harvested seeds that had more pronounced dormancy [49].
7. After the cold treatment stage, they were moved to the growth room and watered every
one or two days to maintain approximately 2 cm of water around seed during germination
phase.
Thi Lan Phuong Nguyen 42777982
13
Arabidopsis seedlings were grown in a growth chamber at 25°C with a photoperiod of 16
hour light and 8 hour dark. Under optimal conditions of water supply and good nutrition,
seeds started to germinate within 3-5 days [49].
After germination, plants were needed to avoid water stress. So, sub-irrigation was only
applied when the soil begin to dry. When plants had got true leaves, watering frequency
was decreased [49].
4.1.1.2. Germinating Arabidopsis thaliana seeds in sterilize conditions
It is necessary to grow Arabidopsis thaliana axenically for this specific experiment of
determining the survival of bacteria around lectin-overexpressing plants compared to the
wild type. Firstly, we used petri dishes to germinate surface-sterilised seeds and then plants
were transferred to vessels containing soils.
Germinating seed on agar plates
The media that was used for Arabidopsis culture was Murashige and Skoog (MS) mineral
salts added Bacto Agar TM 1.5% with optional 1.5% sucrose [49].
The recipe for 0.5L MS agar media:
- Sugar Sucrose 7.5g
- Agar 7.5g
- MS salt 1.1g
- Distilled water 500ml
Preparation of 500ml media was conducted as follows:
- Added 7.5g of MS salts and 7.5g sugar to 450ml of distilled water, stired to dissolve;
- Checked and adjusted to pH 5.7. Adjustment was supported by 1M KOH;
- Added 7.5g agar and diluted with distilled water to final volume of 500mL;
- Autoclaved for 20 minutes at 121 o C, 15 psi.
The solution was then divided into petri dishes and waited until the agar surface was hard
enough.
Seed sterilization was also required before using as follows:
1. Add ed1ml Ethanol 70% into tube of seed;
2. Vortexed or shaked for 2 minutes;
3. Poured away;
4. Added 1ml Bleach (Hypoclorit) 50%, , repeated every 1 minute in 10 minutes;
Thi Lan Phuong Nguyen 42777982
14
5. Washed at least 4 times with distilled water;
6. Added 1ml distilled water for using.
The stage of placing seeds on media plate was conducted in flow cabinet condition;
sterilized tips and pasteur pipet were also required. Otherwise, contamination can possibly
occur. Exhausted air from the pipet, soaked its tips into the seed tube and used slow release
pressure on bulb to take a single seed into tip. The seed then was dropped at the expected
location on agar surface. Try to design a fair density with about 64 seed per plate. These
seed plates were then covered and sealed with parafilm to prevent desiccation and
contamination and placed in the growth room under condition of 16 hour light and 8 hour
dark photoperiod. This photoperiodic lighting program stimulated the quick growth of
plants.
Transfered plants from the agar plate to soil jars
The agar plate is a nice environment for Arabidopsis growth, however there is not enough
space for plant maturation. Thus, after 2 weeks when these plants got 6-8-leaf stage, they
were transferred to sterilize soil environment with E.coli inoculated in simultaneously as
shown in the figure 1 below. We used 7.5 cm-diameter clear transparent tissue culture jars.
Each one contains:
- University of California mix 25g
- Commercial compost soil 25g
These jars of soil blend then were undergone double sterilize treatment on the same day.
This soil mixture facilitated optimized water drainage for growth of Arabidopsis in tissue
culture jars. For treatment we applied to each jar: Plants taking out from agar plates were
grown into soil. The roots were buried well into medium soils before adding 1.2ml solution
of bacteria inoculation around each plant. Each of jars harboured 3 plants, so, 3.6ml
inoculation solution was added totally per container. Finally, 4.8ml of distilled water was
provided to ensure enough humidity for Arabidopsis growth. Closed tightly cap then placed
jars in growth environment. The environment inside jars currently liked a closed system.
Thi Lan Phuong Nguyen 42777982
15
Figure 1: Arabidopsis thaliana in the process of transferring form agar plate to soil
environment.
(A) Arabidopsis thaliana after two weeks of germination on the MS media
(B) Arabidopsis thaliana were grown in jar of soil
(C) Arabidopsis thaliana in jar of soil after two weeks
4.1.1.3. Checking homozygous seeds
In this research, the transgenic BAR gene against the herbicide BASTA was investigated as a
physiological marker. Each of grown plant was progeny of an independently-derived lectin-
transformed line. Such lectin-transformed plants typically carried one T-DNA insertion
hemizygously at a single locus, since plants harbouring 2 independent in sertions were not
common. As a result, lectin transformants needed to be selected for homozygosity via Basta
resistance, self-pollinated, and harvested individually. Among lectin-transformed lines, we
found the homozygous ones by checking the resistance of them to 1% Basta herbicide.
Prepare 1% Basta solution:
Basta herbicide: 150µL
Distilled water: 15mL
Thi Lan Phuong Nguyen 42777982
16
4.1.2. Preparation of E.coli for inoculation around plant roots
4.1.2.1. Growth of E.coli on LB (Luria-Bertani) agar plate
* Recipe for 1L LB medium without antibiotic:
- Bacto Tryptone 10 g
- Yeast extract 5 g
- NaCl 10 g
- Agar 15g
This medium was autoclaved on liquid cycle at 15 psi for 20 minutes; cooled to
approximately 55°C and poured into petri dishes. Let harden, and then the plates were
inverted and stored at +4°C in the dark room. These plates were used for 16 streaking with
E.coli then inoculated overnight at 37 o C.
4.1.2.2. Growth of E.coli on LB Broth.
On the following day, these isolated bacteria continued to be inoculated in LB broth within 3
hours before being added into soil jars.
Recipe for 1L LB Broth:
- Bacto Tryptone 10 g
- Yeast extract 5 g
- NaCl 10 g
For this inoculated treatment, we used 2 flasks of 250ml with 100ml of LB Broth inside. One
very full loop of E.coli was added into the media. After 3 hours of inoculation at 37 o C in
shaking machine, the number of bacteria was possibly generated enough for the next
inoculation in rhizosphere Arabidopsis environment.
4.1.2.3. Wash LB Broth by PBS (Phosphate Saline Buffer) to get the pellet of
E.coli
PBS recipe (1L)
1. Dissolved the following in 800ml distilled water;
- 8g of NaCl
- 0.2g of KCl
- 1.44g of Na2HPO4
- 0.24g of KH2PO4
2. Adjusted pH to 7.4;
Thi Lan Phuong Nguyen 42777982
17
3. Added distilled H2O to the final volume 1L;
4. Autoclaved
The procedure was conducted as follows:
1. Divided 200ml LB inoculum into 5 tubes of 50ml;
2. Centrifuged;
3. Discarded suspension;
4. Added 30ml PBS into each tube;
5. Vortexed well;
6. Centrifuged again;
7. Discarded suspension;
8. Added 40ml PBS into each tube;
9. Vortexed well before using.
4.2. Sample DNA, RNA extraction, PCR amplification, Real time PCR and data
processing.
4.2.1. Plant genomic DNA and RNA extraction.
4.2.1.1. Plant genomic DNA extraction by CTAB (Cetyl Trimethyl Ammonium
Bromide)
Essentially, the extraction requires any mechanical means that can break down cell wall and
cell membranes to allow access to nuclear material without damaging DNA. This method
which uses CTAB can give intact genomic DNA from plant tissues.
After harvesting plant leaf, liquid nitrogen was employed in initial grinding stage for
breaking down cell wall material while harmful cellular enzymes and chemical remained
inactivated. The tissues were ground sufficiently then resuspended in CTAB buffer. Soluble
proteins and other material were separated by mixing with chloroform and centrifugation
while insoluble particulates were removed through centrifugation to purify DNA. Such
nucleic acid were then precipitated from aqueous phase and washed thoroughly to remove
contaminating salts.
Material and methods
- CTAB buffer;
- Mortar and Pestle;
- Microfuge tubes;
Thi Lan Phuong Nguyen 42777982
18
- Microfuge;
- Liquid Nitrogen;
- 70 % Ethanol (ice cold);
- Absolute Ethanol (ice cold);
- 7.5 M Ammonium Acetate;
- 55 o C water bath;
- Distilled water;
- Chloroform: Iso Amyl Alcohol (24:1);
- RNase (10mg/mL).
CTAB buffer 100ml
- 2.0 g CTAB (Hexadecyl trimethyl-ammonium bromide)
- 10.0 ml 1 M Tris pH 8.0
- 28.0 ml 5 M NaCl
- 4.0 ml 0.5 M EDTA pH 8.0 (EthylenediaminetetraAcetic acid Di-
sodium salt)
- 1 g PVP 40 (polyvinyl pyrrolidone (vinylpyrrolidine homopolymer)
Molecular weight 40,000)
- 40.0 ml H2O
Adjusted the solution to pH 5.0 with HCL and made up to 100 mL with H2O.
1 M Tris pH 8.0
Dissolved 121.1g of Tris base in 800 ml of H2O. pH was adjusted to 8.0 (by adding HCL). The
solution was allowed to cool down to room temperature before making the final
adjustments to the pH of 8.0. Added more distilled water to the final volume 1L then
sterilized by autoclaving.
Procedure
1. Ground 200 mg of tissue sample to a fine paste with approximately 500 μL CTAB
buffer; 1μL of GFP plasmid was also added at the same time to calculate the PCR efficiency
later.
2. Transfered all extract mixture to a microcentrifuge tube;
3. Incubated for about 15 min in a recirculating water bath at 55 o C;
Thi Lan Phuong Nguyen 42777982
19
4. The CTAB/plant extract mixture was spin at 12000 g for 5 min to spin down cell
debris then the supernatant was transferred to fresh microfuge tubes;
5. To each tube 250 μL of Chloroform: Iso Amyl Alcohol (24:1) is added. The solution
was mixed by inversion then spun at 13000 rpm for 1 min. The upper aqueous phase was
transferred to a clean microfuge tube. This stage was repeated twice;
6. 50 μL of 7.5 M Ammonium Acetate was added to each tube before adding 500 μL of
ice cold absolute ethanol. These tubes were then incubated over night at -20 o C;
7. After incubation, spined to form pellet at 13.2 x 1000g for 30 minutes. Discarded the
supernatant and the DNA pellet was washed by adding two changes of ice cold 70 %
ethanol;
8. The DNA pellet was then formed again by centrifugation at 12000 for 5 minutes;
9. The DNA was let to be dried at room temperature for 15 minutes and then
resuspended in 50 μL ultrapure water followed by adding 1 μL RNase (10 ng/mL) and
incubating at 37 o C for 1 hour to remove RNA in the preparation;
10. The resuspended DNA was then incubated at 65 o
C for 20 minutes to destroy any
contaminated DNase and stored at 4 o
C until using.
4.2.1.2. Plant RNA extraction.
Total RNA from leaves were extracted by SV Total RNA isolation Kit (Promega). All the work
places and pipettes were decontaminated with the solution RNA AWAY (Invitrogen).
The RNA concentration was measured by spectrophotometer (NanoDrop® ND-1000). To
check the quality of the RNA, an agarose gel was run with ethidium bromide. The procedure
was conducted as follows:
1. Samples (leaves) harvesting was placed in centrifuge tube then put in liquid nitrogen
that employs in initial grinding stage. Abrasive sticks were used to break down cell wall and
cell membrane in about 30 seconds before the sample can be defrosted.
2. Added 175 μL SV RNA Lysis Buffer (already added BME) to tubes. Mix through by
inversion.
3. Added 350 μL SV RNA Dilution Buffer. Mix briefly by inverting 3 – 4 times.
4. Centrifuged for 10 minutes then transfered the clear lysate to a clear
microcentrifuge tube.
5. Applied 200 μL Ethanol 100% to clear lysate, mixed well by repeat pipetting.
Thi Lan Phuong Nguyen 42777982
20
6. Transfered the mixture to Spin Basket Assembly then centrifuged for 1 minute.
Eluate was discarded.
7. Added 600 μL SV RNA Wash Solution (already added ethanol) then centrifuged for 1
minute and discard eluate.
- Prepared DNase incubation mix as follows:
Solution Volume x Number of Preps = Total
Yellow Core Buffer
MnCl2 0.09M
DNase I
40 μL
5 μL
5 μL
The solution was mixed well by pipet.
- Added 50 μL of DNase mix to membrane. Incubate for 15 minutes at room temperature.
- Added 200 μL SV DNase Stop Solution (+ethanol) then centrifuged for 1 minute.
- Added 600 μL SV RNA Wash solution (+ethanol), centrifuged for 1 minute
- Added 250 μL SV RNA Wash solution (+ethanol), centrifuged for 2 minute, then transferred
the Spin Basket to Elution Tube.
- Finally, 30 μL of nuclease–free water was added to membrane and centrifuged for 1
minute for eluting RNA and tried to keep immediately in ice or store at -70 o C until using.
4.2.2. Bacterial genomic DNA extraction.
1. Bacteria E.coli was incubated in 5mL of LB Broth overnight.
2. Divided 1.5 mL of culture into microfuge tube then centrifuged for 2 minutes to form
pellet. The supernatant was discarded.
3. The pellet was resuspended in 567 μL TE Buffer by repeat pipetting. 30 μL of 10%
SDS (Sodium dodecyl sulphate) was added to break cell membrane and then 3 μL of
20mg/mL proteinase K was applied to destroy proteins. Mixed well and incubation was at
37 o C for 1 hour
4. Added 100 μL of 5M NaCl and mixed thoroughly.
5. 80 μL of CTAB/NaCl solution was added to dissolve DNA. The tube was mixed
thoroughly and incubated at 65 o C for 10 minutes.
Thi Lan Phuong Nguyen 42777982
21
6. An equal volume (about 0.7 – 0.8 mL) of chloroform/isoamyl alcohol was added then
mixed thoroughly to denature protein. Such mixture was spun for 4 to 5 minutes in
microcentrifuge.
7. The aqueous, viscous supernatant was transferred to a fresh microcentrifuge tube by
pipetting while the interface behind was left. An equal volume of
phenol/chloroform/isoamyl alcohol was added and extracted thoroughly before spinning in
microcentrifuge for 5 minutes.
8. Transferred the supernatant to a new tube. 0.6 mL isopropanol was added to
precipitate nucleic acid. The tube was shaked back and forth until a stringy white DNA
precipitate was invisible clearly. The precipitate can be pelleted by spinning briefly while the
supernatant was removed.
9. Used pipet without touching to the pellet in order to wash DNA with 70% ethanol
which helped to remove remaining CTAB and NaCl then spined for 5 minutes at room
temperature to repellet.
10. Removed the supernatant carefully then redissolved the pellet in 100 μL distilled
water. DNA quality was confirmed by running electrophoresis gel. The DNA band appeared
at the top while many other smaller bands perform at the bottom.
TBE buffer recipe (1L)
54 g Tris base
20 ml of 0.5M EDTA (pH 8.0)
27.5 g boric acid
Added more distilled water until the final volume 1L
Prepared CTAB/NaCl solution
1. Dissolve 4.1 g NaCl in 80 ml of water
2. Add slowly 10 g CTAB while heating (65°C) and stirring. This step takes more than 3
hours to dissolve completely CTAB.
3. Adjust to the final volume of 100 mL
4. Sterilize by filter or autoclave.
A range of dilutions of the E.coli 16S amplicon were prepared as templates to produce a
calibration curve in the real time PCR. This curve is used to calculate for determining the
number of copies of a template per gram of soil.
Thi Lan Phuong Nguyen 42777982
22
4.2.3. DNA extraction from soil samples
In this study, PowerSoil ® DNA Isolation Kit (MO BIO) was used to extract DNA from soil
samples. After the extraction, the DNA concentration was measured by spectrophotometer
NanoDrop and Qubit. To check the DNA quality, an agarose gel was run with ethidium
bromide. The protocol provided by the manufacturer was followed:
1. Placed 0.5 grams of soil sample to the PowerBead Tubes provided. 1µL of GFP plasmid
was added immediately after adding soil to quantify efficiency of PCR performance.
2. Mixed gently by vortex 2 to 3 seconds.
3. 60 µL of Solution C1 (without precipitation) was added then vortexed briefly or inverted
several times. If Solution C1 is precipitated, heat solution to 60 o C until dissolved before use.
4. PowerBead Tubes were vortexed at maximum speed for 10 minutes then centrifuged at
10,000 x g for 30 seconds at room temperature.
5. Transferred supernatant to a fresh 2 ml Collection Tube (provided). At this time, the
supernatant may still contain some soil particles but the volume was expected around 400
µL to 500 µL.
6. 250 µL of Solution C2 was added and vortexed for 5 seconds. Incubated for 5 minutes at
4 o C.
7. Centrifuged the tubes for 1 minute at 10,000 x g at room temperature.
8. Avoiding the pellet, transfer up to 600 µL of supernatant to a clean 2 ml Collection Tube
(provided).
9. 200 µL of Solution C3 was added and briefly vortexed before a short incubation at 4 o C for
5 minutes.
10. The tubes were centrifuged at room temperature for 1 minute at 10,000 x g.
11. Avoiding the pellet, transferred up to 750 µL of supernatant to a clean 2 ml Collection
Tube (provided).
12. Shaked to mix Solution C4 then added 1200 µL of such solution to the supernatant and
briefly vortexed for 5 seconds.
13. Loaded approximately 675 µL onto a Spin Filter then centrifuged at room temperature
for 1 minute at 10,000 x g. Discarded the flow through then repeated adding 675 µL
supernatant and repeated centrifugation. The remaining supernatant then was applied onto
Thi Lan Phuong Nguyen 42777982
23
the Spin Filter and centrifuged in the same way. A total of three loads for each sample
processed were required.
14. Added 500 µL of Solution C5 and centrifuged at 10,000 x g for 30 seconds at room
temperature. Discarded the flow through.
15. Centrifuged at room temperature for 1 minute at 10,000 x g.
16. Carefully transferred the spin filter to a fresh 2 ml Collection Tube (provided).
17. 100 µL of Solution C6 was added to centre of the white filter membrane then
centrifuged at 10,000 x g for 30 seconds at room temperature.
18. Discarded the Spin Filter. The DNA collected in the tube was then ready for downstream
applications or stored at -20 o C until use.
4.2.4. Measure DNA concentration and checking the quality of DNA.
4.2.4.1. Quantification of DNA concentration
* Measure DNA, RNA concentration using NanoDrop® ND-1000 Spectrophotometer
The method that was based on UV absorbance measurements of nucleic acids at 260nm is
most commonly used and it can quantify a wide range of sample concentration from 2
ng/μL to 15 μg/μL. The ratio absorbance 260/280 performed the purity of DNA and RNA. A
ratio of at least 1.8 or 2.0 was generally accepted as pure for DNA and RNA, respectively.
Otherwise, lower ratios in either case indicated the presence of protein, phenol or any other
contaminants that can absorb at around 280nm wave length.
* Measure DNA concentration using Invitrogen Qubit® 2.0 Fluorometer
For DNA performing quantitative real-time PCR (qPCR), a precise measurement of
concentration was required.
The procedure was conducted as follows:
1. Prepared two Assay tubes (provided) for standards and one tube for each of sample
2. Prepared Working solution based on the volume of sample
Solution Volume x Number of Preps = Total
Qubit TM
Buffer
Qubit TM
Reagent
199 μL
1 μL
3. Prepared Assay tubes follows below table:
Thi Lan Phuong Nguyen 42777982
24
Solution Standard Assay tubes Sample Assay tubes
Working Solution 190 μL 180 – 199 μL
Standard (provided) 10 μL -
Sample - 1 – 20 μL
Total volume in each tube 200 μL 200 μL
4. Did vortex for 2 – 3 seconds
5. Incubated the tubes at room temperature for 2 minutes.
6. Inserted standard tubes in Qubit® 2.0 Fluorometer to set new standard followed by
inserting sample tubes to read results, refered to instruction on the screen [27].
Figure 2: The flow chart of measuring DNA concentration by Qubit TM
assay
4.2.4.2. DNA quality confirmation
1. Prepared a 1 % solution of agarose by melting 0.5 gram of agarose in 50 mL of 0.5x
TBE buffer in a microwave for approximately 2 minutes.
2. Cooled down for a 2 minutes before adding 2.5 μL Ethidium Bromide, mixed briefly.
3. Applied a comp to a supplied tray then transferred all agar solution including
Ethidium Bromide into.
4. Allowed the gel casted for a minimum of 20 minutes at room temperature.
Thi Lan Phuong Nguyen 42777982
25
5. Carefully removed the comb.
6. Loaded the following into separate wells:
+ 5 μL 1kb ladder
+ 2 μL DNA sample + 1 μL Loading dye
6. Run the gel for 40 min at 100 V, 400 AMP
7. Exposed the gel under UV light. The presence of a highly resolved high molecular
weight band performs good quality DNA, meanwhile, the presence of a smeared band
indicates DNA degradation.
4.2.5. DNA amplification by PCR (Polymerase Chain Reaction).
In PCR tube (25 μL recipe)
PCR buffer with MgCl2 2.5 µL
dNTPs mix 0.5 µL
Forward primers 0.5 µL
Reverse primers 0.5 µL
Taq DNA Polymerase 0.5 µL
DNA sample 0.5 µL
Total 25 µL
Thermo-cycles
94 o C 5 minutes
94 o C 20 seconds
54 o C 30 seconds
72 o C 30 seconds
72 o C 5 minutes
However, in the PCR with E.coli template, the annealing temperature increased to 61.5 o C
instead of 54 o C as above.
4.2.6. Clean up PCR products
Quick PCR clean up system was applied for special downstream application of quantitative
real time PCR. The Wizard® SV Gel and PCR Clean-Up System of Promega can eliminates
unincorporated primers and excessed dNTPs and got 95% recovery PCR product. The
protocol was conducted as follows:
Cycle repeated 40 times
Thi Lan Phuong Nguyen 42777982
26
* Prepare PCR product
An equal volume of Membrane Binding Solution was added to the PCR amplification.
* Binding of DNA
- Applied a SV Minicolumn into a Collection tube.
-Transfered the prepared PCR product to the Minicolumn assembly then incubated for 1
minute at room temperature.
- Centrifuged at 16000 x g for 1 minute and discarded flowthrough then reinserted the
Minicolumn into the Collection tube.
* Washing
- Added 700 µL Membrane Wash Solution (+ethanol) to the Minicolumn. Centrifuge for 1
minute at 16000 x g. Discard the flowthrough then reinserted Minicolumn into Collection
tube. This step was repeated with 500 µL Membrane Wash Solution (+ethanol). The
Minicolumn was centrifuged for 5 minutes at 16000 x g.
- Emptied the Collection tube then centrifuged column assembly with the opened
microcentrifuge lid for 3 minutes for evaporation of residual ethanol.
* Elution
- Transfered carefully the Minicolumn to a fresh microcentrifuge tube.
- Added 20 µL of Nuclease-free water to Minicolumn. Incubated for 1 minute at room
temperature then centrifuged for 3 minutes at 16000 x g.
- Finally, discarded Minicolumn and stored DNA at 4 o C or -20
o C [50].
4.2.7. cDNA synthesis
cDNA synthesis that was performed after RNA extraction was typically served for
downstream applications like RT-PCR. The quantification of RNA concentration was required
and then the RNA needs to be adjusted to 2.5 µg/µL
Prepare Master Mix
5X First – Strand buffer 4 µL
SupperScript TM
III RT (20 u/ µL) 0.5 µL
0.1 M DTT 1 µL
Total 5.5 µL
In 0.2 mL PCR tube:
Thi Lan Phuong Nguyen 42777982
27
Up to 2.5 µg total RNA and MilliQ water 13.2 µL
Oligo dT (for eukaryote only) 0.2 µL
10mM dNTPs 1 µL
Total 14.5 µL
- The tube was mixed and incubated at 70 o C for 5 minutes then quenched on ice for 2
minutes.
- Added Master mix to the tube.
- Kept at room temperature for 5 – 10 minutes before transferring to PCR machine.
Thermo-cycle
55 o C 60 minutes
70 o C 15 minutes
4 o C hold forever
4.2.8. Quantitative RT – PCR (qRT-PCR)
The qRT-PCR was performed by Applied Biosystems 7900HT Fast Real-Time PCR System that
combined 384-well plate compatibility in the building 68, The University of Queensland,
Australia.
Recipe for each well
Cyber Green 5 µL
Primer mix (Forward and Reverse primers) 1 µL
DNA template 4 µL
Total 10 µL
The DNA used were PCR products amplified by the corresponding primers summarised as
bellow:
Table1: Primers were used for qRT-PCR
Name Common name Sequence
At1g49240 Beta-actin 8 GAGGATAGCATGTGGAACTGAGAA
At5g09810 Beta-actin 7 GAGGAAGAGCATTCCCCTCGTA
At3g15356 (R) Lec 1 GACCAAACTTTTCTTTTTCCGACTAA
At3g15356 (F) Lec 1 ATGGAAAGTCAGAAAACAACCTCATATT
Thi Lan Phuong Nguyen 42777982
28
rtSGFP_A GFP GGCATGGCGGACTTGAAG
rtSGFP_B GFP CAATGAGTATCTTATCCACAAGATGG
iASK_R (at5g26751) α-Shaggy kinase CTTATCGGATTTCTCTATGTTTGGC [51]
iASK_F (at5g26751) α-Shaggy kinase GAGCTCCTGTTAATTTAACTTGTACATACC [51]
ER-F2 E.coli 16S AGAAGCTTGCTCTTTGCTGA [52]
ER-R2 E.coli 16S CTTTGGTCTTGCGACGTTAT [52]
906F Universal E.coli 16S AGAAGCTTGCTCTTTGCTGA [50]
1062R Universal E.coli 16S CTTTGGTCTTGCGACGTTAT [50]
Firstly, the primers were diluted to the final concentration 0.3 µM, except the universal
primer pair of 906F+1062R that were diluted to 2.5 µM. Then, a mix containing the SYBR
Green and primers for each couple is prepared as mentioned on the recipe above. Three
technical replicates were included during the experiment to account for pipetting errors.
The program used for the thermocycler
94°C for 3 min
94°C for 1 min
60°C for 0.3 min
72°C for 1 min
72°C for 7 min
However, to qRT-PCR that was performed for universal primers, the annealing temperature
was reduced to 54°C as an optimal annealing temperature [50].
V. Results In this project Lectin-1-overexpressing Arabidopsis plants were used to study plant-microbe
interactions. This is based on previous findings that the Lectin-1 protein binds to E. coli and
Pseudomonas syringae. Here we investigated whether rhizosphere bacteria are influenced
by the presence of lectin-1 that is transported and stored in root cell walls and exuded.
Previously, putative Lectin-1 transgenic T2 Arabidopsis plants were produced but plants did
not appear to be homozygous as spraying with Basta led seedlings to die.
Cycle repeated 25 times
Thi Lan Phuong Nguyen 42777982
29
5.1. Screening and selecting homozygous lectin-1-overexpressing
Arabidopsis plants
5.1.1. Response of lectin-1-overexpressing Arabidopsis plants to Basta
herbicide.
Lectin 1 Arabidopsis seeds were named as A1, A2, A3, A4, A5, A6, A7, A9, A10, A11 and were
germinated in separate wells in the same tray. One week later, some seeds begun sprouting
and after 13 days, seeds in all chambers sprouted. The table below shows germination rates
after 3 weeks.
Table2: The number of seed germinating
Overall, the seeds A2, A3, A5, A8, and A11 displayed the highest percentages of germination
with 59%, 26%, 70%, 55% and 70% respectively. However, seed A11 needed a longer time to
start germinating than other seeds.
Basta herbicide 1% was then used to select seeds that were homozygous (see methods).
Table 3 summarised plant survival rates after spraying.
Plant The number of germinated seeds
A1 20
A2 59
A3 26
A4 3
A5 70
A6 25
A7 13
A8 55
A9 13
A10 7
A11 70
Thi Lan Phuong Nguyen 42777982
30
Table 3: Survival rates of Lectin 1-overexpressing Arabidopsis to herbicide Basta
after one week
Plant The percentage of surviving plants The percentage of become-yellow plants
A1 100% 35%
A2 100% 5%
A3 100% 3.8%
A4 100% 33.3%
A5 100% 2.8%
A6 100% 20%
A7 100% 7.6%
A8 100% 12.7%
A9 100% 7.6%
A10 100% 0
A11 100% 11.4%
Then Basta-spraying was repeated and the result observed after two weeks was showed in
table 4 and in figure 2:
Table 4: Survival rates of Lectin 1-overexpressing Arabidopsis to herbicide Basta
after two weeks.
Plant The percentage of
surviving plants
The percentage of die
plants
The percentage of plants
with yellowing symptoms
A1 100% 0 35%
A2 100% 0 5%
A3 100% 0 3.8%
A4 66.67% 33.3% 0%
A5 98.6% 1.4% 2.8%
A6 100% 0 28%
A7 100% 0 15.38%
A8 100% 0 7.2%
A9 100% 0 7.6%
A10 100% 0 14.28
Thi Lan Phuong Nguyen 42777982
31
A11 100% 0 12.85%
Figure 3: Appearance of Lectin 1-overexpressing Arabidopsis to herbicide Basta
after two weeks.
Table 4 shows that 33.3% of plants of A4 died and this percentage can be similar to
percentage of hybridization between heterozygous plants. The results suggest that A4 seeds
belong to a heterozygous plant while all other seeds are likely to be the progeny of
homozygous plants and hence these seeds are also homozygous. Half of Lectin-1 transgenic
T2 Arabidopsis plants were chosen for the next experiments to determine whether Lectin-1
was overexpressed. The seed genotypes that presented the healthiest seedlings after the
Basta sprayings were selected. Therefore, seeds A2, A3, A5, A8 showed the lowest
percentages of plants with yellowing symptoms, namely 5%; 3.8%; 2.8% and 7.2%,
respectively. Although one out of 70 plants of A5 presented 1.4% death rate, the seed A5
was considered homozygous and plants A5 looked overall greener than other ones after
spraying Basta, excepted the die plant that looked much smaller than others. The reason for
the death appeared to source from other factors, such as that those plants could not
compete to others to get enough nutrients and water.
5.1.2. Measurements of RNA concentrations from Arabidopsis plants
The selected genotypes of Lectin1-overproducing lines A2, A3, A5, A8 and wild type (WT)
were then germinated. After 2 to 3 weeks when plants reached 8-10-leaf stage, shoots were
harvested for RNA extraction.
Thi Lan Phuong Nguyen 42777982
32
The concentrations of RNA extracted from shoots were determined with both NanoDrop®
ND-1000 Spectrophotometer and Qubit(Invitrogen) (Table 3).
Table 5: Concentration of RNA extracting from plants
Samples RNA concentration measuring by
NanoDrop (ng/µL)
Ratio
260/280
RNA concentration
measuring by Qubit (ng/µL)
WT1 970.7 2.01 1220
WT2 560.6 2.1 1450
WT3 611.5 2.04 828
A2-1 1458.5 2.13 2060
A2-2 865 2.02 1160
A2-3 1206 2.1 1000
A3-1 596 2.08 460
A3-2 716.6 2.11 516
A3-3 1018.3 2.0 594
A5-1 1113.8 2.12 1550
A5-2 1441.2 2.06 1640
A5-3 1111.1 2.05 1360
A8-1 891.7 2.01 1110
A8-2 1156.6 2.09 1330
A8-3 1523.2 2.08 2180
Overall, the RNA concentrations were rather high. Besides, the ratios of 260/280 from
measuring by NanoDrop® ND-1000 Spectrophotometer were within the acceptable range
(1.8-2.2). Therefore, these RNA samples were utilized for performing cDNA synthesis for
further use in the qRT-PCR to quantify the Lectin 1 gene expression in wild type and Lectin-
1-overexpressing Arabidopsis plants.
5.1.3. Quantification of Lectin 1 gene expression by qRT-PCR
To quantify expression levels of the Lectin 1 gene expressed in Arabidopsis plants, two sets
of primers were used: One for the amplification of the Lectin transcripts and one for Actin
transcripts that played the role as a house keeping gene in Arabidopsis thaliana. Based on
the Ct values and PCR efficiency values from qRT-PCR, relative expression of Lectin 1 gene to
Actin gene was determined (Table 4, Figure 1).
Thi Lan Phuong Nguyen 42777982
33
Table 6: Expression of Lectin 1 gene in Arabidopsis plants
Plant WT A2 A3 A5 A8
Average Biol. Rep. 0.366661 1.921221 1.263823 1.98152 1.808364
Standard Deviation 0.147542 0.08641 0.590564 0.150101 0.078753
Standard Error 0.085183 0.049889 0.340962 0.086661 0.045468
T-test 9.49956.10 -5
0.063117 0.000185 0.000117
Figure 4: Relative expression of Lectin gene to Actin gene
Compared to the wild type, expressions values of Lectin 1 gene with 1.921221; 1.263823;
1.98152; 1.808364 in A2, A3, A5 and A8 plants, respectively were much higher than the
expression of 0.366661 in the wild type. Of them, plants of A5 showed the highest
expression level relative to actin (1.98152, P < 0,05). Hence A5 was chosen as the best
Lectin-1-overexpressing Arabidopsis genotype in this study, and was used in the subsequent
experiments
5.2. Evaluation of survival bacteria around Lectin-1–overexpressing
Arabidopsis thaliana.
To determine whether Lectin affect bacterial densities the rhizosphere or roots, , two
experiments using qRT-PCR to amplify E.coli 16S rRNA gene were conducted., One utilised
the primer pairs of ER-F2 and ER-R2 [52]. The other utilised universal bacterial primers 906F
Thi Lan Phuong Nguyen 42777982
34
and 1062R. Besides, a set of primers that amplify the GFP gene as well as the α-Shaggy
kinase gene (iASK) gene were used for rhizosphere soil and root samples, respectively..
Additionally, a range of dilutions of the E.coli 16S amplicon were prepared as templates to
produce a calibration curve in the real time PCR. This curve is used to calculate for
determining the number of copies of a template per gram of soil.
5.2.1. Quantify the concentration of DNA extracted from root and
rhizosphere
Initially, DNA extractions from root sample and soil samples were carried out and the DNA
concentration was measured as below:
Table 7: Concentration of DNA extracted from rhizosphere
Samples DNA concentration
measuring by
NanoDrop (ng/µL)
Ratio 260/280 DNA concentration
measuring by Qubit
(ng/µL)
WT1 18.2 1.77 8.78
WT2 12.1 1.67 6.6.2
WT3 11.8 1.70 5.60
A5-1 15.7 1.67 8.78
A5-2 17.0 1.90 10.6
A5-3 15.2 1.56 8.06
Table 8: Concentration of DNA extracting from roots
Samples DNA concentration measuring
by NanoDrop (ng/µL)
Ratio 260/280 DNA concentration
measuring by Qubit (ng/µL)
WT1 774.8 1.83 77
WT2 1344.7 1.91 123
WT3 904.8 1.86 100
A5-1 809.7 1.78 83
A5-2 686.9 1.70 108
A5-3 532.9 1.69 68.8
Thi Lan Phuong Nguyen 42777982
35
Overall, the DNA extracted from rhizosphere showed quite low concentrations while the
ones from root samples provided much higher yields.
5.2.2. Quantification of E.coli 16S copies using ER-F2 and ER-R2 primers.
CT values of amplifications of DNA templates extracted from rhizosphere could not be
determined with the E. coli-specific 16S primers ER-F2 and ER-R2 that were revealed as the
most optimal ones for PCR of E.coli templates [52]. However, CT values obtained for root
samples were acceptable; hence all calculations were applied only to root DNA templates.
The α-Shaggy kinase plant gene (iASK) was used to measure relative bacterial abundance.
E.coli 16S abundance relative to the plant gene is shown in table 9.
Table 9: Expression of E.coli 16S copies relative to iASK gene
Plants Average Standard deviation Standard Error T-test
WT 68.24825349 15.33935 8.85617566 0.986599
A5 68.42902612 7.660091 4.422555381 0.245585
Figure 5: Relative expression of E.coli 16S sequence to iASK gene
Our results indicate that there was no significant difference in the abundance of E.coli in the
roots of wild type and transgenic plants (P > 0.05). To determine whether the primers could
amplify mitochondria DNA, a control sample of uninoculated axenically grown-root DNA
templates was included in the qRT-PCR. . A high Ct value for this sample (around 30), as
1.0095
11.0095
21.0095
31.0095
41.0095
51.0095
61.0095
71.0095
81.0095
WT LEC
E .
co li
1 6
S r
e la
ti v
e t
o r
o o
t iA
S K
Thi Lan Phuong Nguyen 42777982
36
opposed to 18 from E. coli-inoculated plants indicated that mitochondrial DNA amplification
was negligible.
5.2.3. Quantification of E.coli 16S copies using Univesal E.coli 16S primers
(906F and 1062R)
Similarly to the other set of primers, for the primer pair 906F and 1062R, most of the CT
values for rhizosphere samples were undetermined. Relative abundances of E.coli 16S
copies to α-Shaggy kinase gene are shown in Table 10 and Figure 4.
Table 10: Expression of E.coli 16S sequence relative to iASK gene
Plants Average Standard deviation Standard Error T-test
WT 52.84153 36.05396 50.98801 0.730192
A5 36.56266 7.009206 12.1403 0.967496
Figure 6: Relative expression of E.coli 16S sequence to iASK gene
Similarly to the other set of primers tested, our results indicated that there was no
significant difference in E. coli abundance between the Lectin-1-overexpressing Arabidopsis
and the wild-type.
VI. Discussion Quantification of Lectin-1 gene expression by qRT-PCR enabled the selection of A5 as the
genotype with the highest expression.
0
10
20
30
40
50
60
70
80
90
100
WT LEC
U n
iv e
rs a
l 1
6 S
r e
la ti
v e
t o
i A
S K
Thi Lan Phuong Nguyen 42777982
37
Such proteins have the ability to bind specifically and reversibly to carbohydrates with high
affinity [21]. Thus, lectins present on the root hair and secreted can specifically bind to
certain bacteria and initiate symbioses. Although lectins are found in various plant organs,
they seem to play the most important role in root tissues. The concentration is particularly
higher on the tips of developing root hairs, and they have also been localized in root
precursor cells [1]. Base on this background, the initial hypothesis assumed that the number
of bacteria E.coli in Lectin-1-overexpressing plant might decrease compared to that one
around wild type plants. Additionally, the previous study of Xavier (2012) indicates that
lectins decreases the number of E.coli in the rhizosphere soil [53].
However, comparisons of E.coli abundance in roots of Lectin-1-overexpressing line and the
wild type revealed no difference, although using two independent primer sets, one specific
for 16S from E. coli and another universal for 16S from bacteria in general.
With regard to qRT-PCR with DNA template extracted from rhizosphere, most Ct values
were undetermined even when universal primers were used (906F, 1062R). Thus, results
from previous research which reported that lectins affect the number of rhizosphere
bacteria could not be confirmed. The possible reason for undetermined Ct values can be the
very low DNA template concentration (5.6 ng/µL). Since this amount was not enough to
amplify the DNA template, Ct values were most undetermined or very high (over 40). This
study used DNA extraction Kits with 0.5 gram of soil, instead of RNA extraction method that
used 4 gram of sample as in the previous research of Xavier [53], so the quality of DNA
extracted could be different. Besides, the transgenic line in that study was also different as it
was heterozygous.
Hence, although there is evidence indicating that the significant presence of protein lectin
into the root cell wall can support the defence barrier of plant [20], the interaction between
lectins and bacteria has been a question. The E.coli that were utilized in this study is not an
environmental bacterium and does not naturally interact with Arabidopsis thaliana [54].
Thus, in the next study, other bacteria should be used for the inoculation such as
Pseudomonas aeruginosa that present commonly in variety of environments, especially in
water and soil. In a study, Walker et al. (2004) reported that pathogenic P. aeruginosa
strains PAO1 and PA14 are capable to infect the roots of Arabidopsis thaliana in vitro and in
the soil, and are capable of causing plant mortality of 7 day-postinoculation [55]. So, further
Thi Lan Phuong Nguyen 42777982
38
study with these bacteria can generate clues to answer the question of whether the lectin
protein can be actually plays the role in plant pathogen defence.
In addition, other methods of DNA extraction should also be applied to get higher yields of
DNA from rhizosphere soil. However, it is highly recommend the use of homozygous lectin-
1-overexpressing Arabidopsis thaliana for such study and the longer time of bacteria
inoculation in rhizophore also can be also considered.
VII. Conclusion This study has identified a homozygous line of lectin-1-overexpressing Arabidopsis thaliana.
Moreover, the best lectin-expression line was selected and can be used in downstream
studies.
This study indicated that after two weeks after E. coli inoculation of lectin-1-overexpressing
Arabidopsis thaliana, the number of bacteria E.coli in roots did not decrease compared to
the wild type. Hence, lectins from protein in Arabidopsis thaliana did not appear to
influence E.coli abundance in roots. Thus, further studies should be conducted with others,
particularly pathogen to confirm the role of lectin protein in pathogen resistance in plants.
Thi Lan Phuong Nguyen 42777982
39
References
1. Hirsch, A.M., Role of lectins (and rhizobial exopolysaccharides) in legume nodulation. Current Opinion in Plant Biology 1999. 2: p. 320–326.
2. Konopka, A., What is microbial community ecology[quest]. ISME J, 2009. 3(11): p.
1223-1230. 3. Carvalhais, L.C., et al., Rhizosphere Metatranscriptomics: Challenges and
Opportunities, in Molecular Microbial Ecology of the Rhizosphere. 2013, John Wiley & Sons, Inc. p. 1137-1144.
4. Carvalhais, L.C., et al., Application of metatranscriptomics to soil environments.
Journal of Microbiological Methods, 2012. 91(2): p. 246-251. 5. Andrews, M., S. Hodge, and J.A. Raven, Positive plant microbial interactions. Annals
of Applied Biology, 2010. 157(3): p. 317-320. 6. Schenk, P.M., L.C. Carvalhais, and K. Kazan, Unraveling plant–microbe interactions:
can multi-species transcriptomics help? Trends in Biotechnology, 2012. 30(3): p. 177- 184.
7. Doornbos, R.F., et al., Effects of Jasmonic Acid, Ethylene, and Salicylic Acid Signaling
on the Rhizosphere Bacterial Community of Arabidopsis thaliana. Molecular Plant- Microbe Interactions, 2010. 24(4): p. 395-407.
8. Pieterse, C.M.J., et al., Signalling in Rhizobacteria-Induced Systemic Resistance in
Arabidopsis thaliana. Plant Biology, 2002. 4(5): p. 535-544. 9. Funnell, D.L., C.L. Schardl, and P. Bednarek, Plant Defence against Fungal Attack:
Biochemistry, in eLS. 2001, John Wiley & Sons, Ltd. 10. Armah, C.N., et al., The Membrane-Permeabilizing Effect of Avenacin A-1 Involves the
Reorganization of Bilayer Cholesterol. Biophysical Journal, 1999. 76(1): p. 281-290.
Thi Lan Phuong Nguyen 42777982
40
11. Cruz-Cruz, C., et al., Phytoanticipins from banana (Musa acuminata cv. Grande
Naine) plants, with antifungal activity against Mycosphaerella fijiensis, the causal agent of black Sigatoka. European Journal of Plant Pathology, 2010. 126(4): p. 459- 463.
12. Carvalhais, L.C., et al., Activation of the Jasmonic Acid Plant Defence Pathway Alters
the Composition of Rhizosphere Bacterial Communities. PLoS ONE, 2013. 8(2): p. e56457.
13. Rasmann, S. and A.A. Agrawal, In Defence of Roots: A Research Agenda for Studying
Plant Resistance to Belowground Herbivory. Plant Physiology, 2008. 146(3): p. 875-
880.
14. Jonathan P. Anderson, E.B., Peer M. Schenk, John M. Manners, Olivia J. Desmond, Christina Ehlert, Donald J. Maclean, Paul R. Ebert, and Kemal Kazana., Antagonistic Interaction between Abscisic Acid and Jasmonate-Ethylene Signaling Pathways Modulates Defence Gene Expression and Disease Resistance in Arabidopsis. The Plant Cell, 2004. 16(12): p. 3460-3479.
15. Kachroo, A. and P. Kachroo, Salicylic Acid-, Jasmonic Acid- and Ethylenemediated
Regulation of Plant Defence Signaling, in Genetic Engineering, J. Setlow, Editor. 2007, Springer US. p. 55-83.
16. McConn, M., et al., Jasmonate is essential for insect defence in Arabidopsis.
Proceedings of the National Academy of Sciences, 1997. 94(10): p. 5473-5477. 17. Vijayan, P., et al., A role for jasmonate in pathogen defence of Arabidopsis.
Proceedings of the National Academy of Sciences, 1998. 95(12): p. 7209-7214. 18. Li, C., et al., Resistance of Cultivated Tomato to Cell Content-Feeding Herbivores Is
Regulated by the Octadecanoid-Signaling Pathway. Plant Physiology, 2002. 130(1): p. 494-503.
19. Bouizgarne, B., Bacteria for Plant Growth Promotion and Disease Management, in
Bacteria in Agrobiology: Disease Management, D.K. Maheshwari, Editor. 2013, Springer Berlin Heidelberg. p. 15-47.
20. Schenk, P., A lectin family in Arabidopsis is activated by multiple defence pathways
and confers resistance against nematodes and pathogenic bacteria, 2010, The University of Queensland.
21. Damme, W.J.P.a.E.J.M.V., Lectins as PIant Defence Proteins. Plant Physiol., 1995. 109:
p. 347-352. 22. Parijs, J., et al., Hevein: an antifungal protein from rubber-tree (Hevea brasiliensis)
latex. Planta, 1991. 183(2): p. 258-264.
Thi Lan Phuong Nguyen 42777982
41
23. Czapla, T.H. and B.A. Lang, Effect of Plant Lectins on the Larval Development of
European Corn Borer (Lepidoptera: Pyralidae) and Southern Corn Rootworm (Coleoptera: Chrysomelidae). Journal of Economic Entomology, 1990. 83(6): p. 2480- 2485.
24. Kumar MA, T.D., Neet KE, Owen WG, Peumans WJ, Rao AG., Characterization of the
lectin from the bulbs of Eranthis hyemalis (winter aconite) as an inhibitor of protein synthesis. THE JOURNAL OF BIOLOGICAL CHEMISTRY, 1993. 268(33)(November 25): p. 25176-2518.
25. L. Sequeira, T.L.G., Agglutination of avirulent strains of Pseudomonus solanacearum
by potato lectin. Physiol Plant Pathology 1977. 11(1) p. 43-54. 26. Maria Prihtamala Omega, S.T.-H., Peer Schenk and Bostjan Kobe, A highly abundant
lectin protein Arabidopsis thaliana confers resistance against pathogens. ANNALES BOGORIENSES, 2008. 12(01).
27. Wahl, V., et al., Regulation of Flowering by Trehalose-6-Phosphate Signaling in
Arabidopsis thaliana. Science, 2013. 339(6120): p. 704-707. 28. Hancock, A.M., et al., Adaptation to Climate Across the Arabidopsis thaliana
Genome. Science, 2011. 334(6052): p. 83-86. 29. Lugtenberg, B. and F. Kamilova, Plant-Growth-Promoting Rhizobacteria. Annual
Review of Microbiology, 2009. 63(1): p. 541-556. 30. Dennis, P.G., A.J. Miller, and P.R. Hirsch, Are root exudates more important than
other sources of rhizodeposits in structuring rhizosphere bacterial communities? FEMS Microbiology Ecology, 2010. 72(3): p. 313-327.
31. Hein, J., G. Wolfe, and K. Blee, Comparison of Rhizosphere Bacterial Communities in
Arabidopsis thaliana Mutants for Systemic Acquired Resistance. Microbial Ecology, 2008. 55(2): p. 333-343.
32. Harrison, S., et al., A rapid and robust method of identifying transformed Arabidopsis
thaliana seedlings following floral dip transformation. Plant Methods, 2006. 2(1): p. 19.
33. Ghazanfar, S., et al., Metagenomics and its application in soil microbial community
studies: biotechnological prospects. Journal of Animal & Plant Sciences, 2010. 6(2): p. 611-622.
34. Rondon, M.R., et al., Cloning the Soil Metagenome: a Strategy for Accessing the
Genetic and Functional Diversity of Uncultured Microorganisms. Applied and Environmental Microbiology, 2000. 66(6): p. 2541-2547.
Thi Lan Phuong Nguyen 42777982
42
35. Delmont, T.O., et al., Accessing the Soil Metagenome for Studies of Microbial Diversity. Applied and Environmental Microbiology, 2011. 77(4): p. 1315-1324.
36. Roesch, L., et al., Pyrosequencing enumerates and contrasts soil microbial diversity.
The ISME Journal, 2007. 1(4): p. 283-90. 37. van Elsas, J.D., et al., The metagenomics of disease-suppressive soils – experiences
from the METACONTROL project. Trends in Biotechnology, 2008. 26(11): p. 591-601. 38. Boubakri, H., et al., Development of metagenomic DNA shuffling for the construction
of a xenobiotic gene. Gene, 2006. 375(0): p. 87-94. 39. Schloss, P.D. and J. Handelsman, Biotechnological prospects from metagenomics.
Current Opinion in Biotechnology, 2003. 14(3): p. 303-310. 40. Demanèche, S., et al., Antibiotic-resistant soil bacteria in transgenic plant fields.
Proceedings of the National Academy of Sciences, 2008. 105(10): p. 3957-3962. 41. Courtois, S., et al., Recombinant environmental libraries provide access to microbial
diversity for drug discovery from natural products. Applied and Environmental Microbiology, 2003. 69(1): p. 49-55.
42. Jordan, J.A., A.R. Butchko, and M. Beth Durso, Use of Pyrosequencing of 16S rRNA
Fragments to Differentiate between Bacteria Responsible for Neonatal Sepsis. The Journal of Molecular Diagnostics, 2005. 7(1): p. 105-110.
43. Dethlefsen, L., et al., The Pervasive Effects of an Antibiotic on the Human Gut
Microbiota, as Revealed by Deep 16S rRNA Sequencing. PLoS Biol, 2008. 6(11): p. e280.
44. Huse, S.M., et al., Exploring Microbial Diversity and Taxonomy Using SSU rRNA
Hypervariable Tag Sequencing. PLoS Genet, 2008. 4(11): p. e1000255. 45. Gary D Wu, J.D.L., Christian Hoffmann, Ying-Yu Chen, Rob Knight, Kyle Bittinger,
Jennifer Hwang, Jun Chen, Ronald Berkowsky, Lisa Nessel, Hongzhe Li and Frederic D Bushman, Sampling and pyrosequencing methods for characterizing bacterial communities in the human gut using 16S sequence tags. BMC Microbiology, 2010. 10 (206).
46. Wang, Q., et al., Naïve Bayesian Classifier for Rapid Assignment of rRNA Sequences
into the New Bacterial Taxonomy. Applied and Environmental Microbiology, 2007. 73(16): p. 5261-5267.
47. Ludwig, W., et al., ARB: a software environment for sequence data. Nucleic acids
research, 2004. 32(4): p. 1363-1371.
Thi Lan Phuong Nguyen 42777982
43
48. Shani, E., et al., Gibberellins accumulate in the elongating endodermal cells of Arabidopsis root. Proceedings of the National Academy of Sciences, 2013. 110(12): p. 4834-4839.
49. Center, A.B.R. Handling Arabidopsis plants and seeds 2009 [cited 2013 May 3th];
Available from: http://www.biosci.ohio- state.edu/~plantbio/Facilities/abrc/handling.htm.
50. Bacchetti De Gregoris, T., et al., Improvement of phylum- and class-specific primers
for real-time PCR quantification of bacterial taxa. Journal of Microbiological Methods, 2011. 86(3): p. 351-356.
51. Gachon, C. and P. Saindrenan, Real-time PCR monitoring of fungal development in
Arabidopsis thaliana infected by Alternaria brassicicola and Botrytis cinerea. Plant Physiology and Biochemistry, 2004. 42(5): p. 367-371.
52. Dong Hyuck Lee, J.E.B., Jung Hee Lee, Jeong Sup Shin, In Seop Kim, Quantitative
Detection of Residual E. coli Host Cell DNA by Real-Time PCR. Journal of Microbiology and Biotechnology, 2010 20(10): p. 1463-1470.
53. Xavier, D., The role of lectins in plant-microbe interactions 2011, The University of
Queensland. 54. Paungfoo-Lonhienne, C., et al., Turning the Table: Plants Consume Microbes as a
Source of Nutrients. PLoS ONE, 2010. 5(7): p. e11915. 55. Walker, T.S., et al., Pseudomonas aeruginosa-Plant Root Interactions. Pathogenicity,
Biofilm Formation, and Root Exudation. Plant Physiology, 2004. 134(1): p. 320-331.
- 2