2000 words method for paper

profileGEORGE99
mymethod.pdf

Dear writer this is the method which I used and I attached to u my friend master project report ,she had different project

but it will help u because we work in the same lab and we did some similar technics.u can also look to here references and

use it 

The method:

First of all I germinate Arabidopsis seeds in autoclaved soil, then keep watering the plants until its flowering then I start preparing the Agrobacterium bacteria broth to start dip the plant flowers in that broth by using floral dip method, after the dipping I kept that plant in room temperature for 24 h then I but it back in 25C and keep watering until full flowering then start drying that plant by stop watering them until it's become yellow then collect the seeds.

second : germinate the collected seeds (which I collected from last step and its already treated with Lectin 2 gene): germinate the seeds in autoclaved soil and watering it until day 15 start spray the plant with Basta(its chemical herbicide) and after 4 days spray it again with basta ,then again 4 days and spry it for last time .after that I choose the resistance leaves only (the green leaves only )it was 8 plant only and transfer it to growth in new soil ,in 24 c

Third after a month when the plant leaves grow well, I extract RNA from the leaves (8 RNA extract sample), then I measure the concentration of RNA by 2 methods, first Nano drop, second the qubit kit

Fourth: Inoculate the plant with pseudomonas syringe, by using syringe on the leaves

and then direct after the inoculate I extract DNA from 3 leaves of each plant ,and after 24 hours i extract DNA from other 3 leaves from each plant ,then I measure the DNA concentration by using Nano drop technique ,after that I did real time PCR to check gene expression ,

Fifth: I converted RNA sample to DNA sample then I did real time PCR.

Finally I repeated the steps above with canola gene.

1. Germinating Arabidopsis thaliana seeds on soil

2. Agrobacterium bacteria broth: Preparing the bacteria need to : LB liquid: 10 g tryptone 5g yeast extract 10 g NACL Water LB agar: 5g tryptone 2.5g yest extract 5g nacl 5g agar Then autoclave all of LB agar and liquid Then add 2 different antibiotics to LB agar: 1-100 ul of tet 15 mg/ml 2-100 ul of kan 50 mg/ml Then devided the liquid to 4 party dishes ,next growth Agrobacterium tumefaciens by using 16 strek way on the agar plate. Preparing LB proth: 5 ml of LB liquid which I already prepared above 5 ul of tet 15 mg/ml 5 ul of kan 50 mg/ml Little of Agrobacterium which is growth already on the plate above. Then keep it 24 h in 28c When its become cloudy I will take : 2 ml of this broth + 200 ml of LB liquid 200 ul of tet 15 mg/ml 200 ul of kan 50 mg/ml Then keep it for 24 h in 28c

Next: after 24 hours Divided the broth into 4 50 ml tubes Then measuring the concentration of this broth Then centrifuges this 4 tubes after that throw the pure liquid of 4 tubes to flask(don’t need it ,I only need to the bacteria in the bottom of 4 tubes) Prepared the Sucrose: 5g of sucrose 200 ml water Mix it then divided it into the 4 tubes ,which contain in the bottom the bacteria Then Centrifuge the 4 tubes and next collect the broth of this 4 tubes into clean flask and add 500 ul of Silwet 0.05% and start dipping

3. Floral dip method 4. Collect the seeds:

Harvest dry seeds from 25c after 8 days of last watering.

5. Germinate the collected seeds (which I collected from last step and it's already treated with Lectin 2 gene

6. Spray the plant with Basta(its chemical herbicide(

Basta keep the plant green, so I spray the plant with Basta for 4 times then check which leaves has high resistance against Basta and does not become yellow.

I prepared Basta spray by add 50 ml of water and 100 ul of Basta

7. Choose the resistance leaves only (the green leaves only

I found 8 plant was green, I transfer them to keep grow in new soil

8. Extract RNA from the leaves I used SV total RNA isolation system (Kit protocol)

9. Measure the concentration of RNA by 2 methods, first Nano drop, second the Qubit kit

10. Preparing pseudomonas syringe

The same steps of preparing Agrobacterium above

11. Inoculate the plant with pseudomonas syringe 12. Extract DNA from leaves

(2 times) first time direct after inoculated and the second after 24 Hours of Inoculated. I used CTAB protocol

13. Measure the DNA concentration: I used Nano drop

14. Real time PCR: (this primers which I used) real time PCR using the iASK primers on all samples and the HRPZ primers on all samples. Primer name and Sequence rt_iASK_at5g2675F GAGCTCCTGTTAATTTAACTTGTACATACC rt_iASK_at5g2675R CTTATCGGATTTCTCTATGTTTGGC pst_HRPZ_A TACCAAGACCACCACCCGAC pst_HRPZ_B GCAACAAGGTGATGCCAGTG rt_at3g16530_F GCCTTCATCATAACCCCGGAA rt_at3g16530_R AATTCGATAGCCAAGATGTGGTTC