Bio hw
6.4 Enzymes Direct Energy Flow
· What is an enzyme?
· How does an enzyme catalyze a chemical reaction?
· What happens to reactants within the structure of an enzyme?
· How do enzymes control the metabolism of a cell?
6.5 Energy Flow in Reaction Pathways: Metabolism
· What is a metabolic pathway?
· How is the flow of product from a metabolic pathway controlled?
· How can an enzyme's structure contribute to control of a metabolic pathway?
6.6 Energy Pools in the Cell: ATP
· Where does the cell get energy to run its endergonic reactions with?
· What does an ATP molecule look like?
· Where is energy stored within an ATP molecule?
6.7 Energy Flow from Carbohydrates to ATP: Respiration
Why are carbohydrates considered to be "energy-rich"?
What is the purpose of aerobic respiration?
What substances enter glycolysis, and what substances leave it? What is its contribution to respiration?
What substances enter the Krebs cycle, and what substances leave it? What is the cycle's contribution to respiration?
What substances enter the electron transfer system? What substances leave it? What is the system's contribution to respiration?
· What process immediately generates the energy used to make ATP?
· How much ATP is produced from one carbohydrate molecule?
6.8 Energy Flow from Carbohydrates to ATP: Fermentation
· How is fermentation different from respiration? How are they the same?
· How much ATP results from fermentation?
6.9 Energy Flow from Photons to Carbohydrates: Photosynthesis
· How do photons become energy within a cell?
·
What does chlorophyll actually do in photosynthesis?
· How are the chemical reactions of photosynthesis ordered/organized?
· Where in the plant cell do the stages of photosynthesis take place?
· What carbohydrates are produced by photosynthesis?
6.10 Energy Flow: An Integrated Picture
· How do photosynthesis and respiration work together to support life?
· How did photosynthesis and respiration originate? What came first?
· What is the functional result or value of having photosynthesis limited to just some life-forms?
Concentration
|
|
|
|
|
|
|
|
|
|
|
|
+ +++ + + ++ ++++ +++ |
H+
Q Electrical potential
0 Heat
Figure 6.2 Five major categories of energy change in the cell are shown here. (a) synthetic work
is demonstrated by the making of daughter cells from a parent cell, (b) movement is represented by the streaming movement of the cytoplasm, (c) concentration of a substance within a cell is effected by active transport, (d) electrical potential is generated by ion movement across a membrane,
(e) heat energy is generated by increasing the rate of respiration in the cell.
Standing in the middle of our Elodea cell and glancing around, the first change we would observe is that vast amounts of membrane and molecular machinery have been built up from simpler molecules. Biosynthesis of organic monomers, and their subsequent assembly into polymers and then into supramolecular structures, requires considerable energy.
But were we the size of a carbon dioxide molecule, our observation of synthesized structures would be made "on the run." The cytoplasm and many organelles within the cell are in constant motion, not the result of slow diffusional forces based on thermal energy of particles. Rather, the cell is investing energy to move its cytoplasm
biosynthesis—the building up of biomolecules about by bulk flow—a streaming process that allows molecules and
or biological structures within a living cell; a pro- materials important to cellular reactions to be quickly circulated to
cess that requires energy. where they need to go. Indeed, as we adjust the fine focus knob
of our microscope to better observe the Elodea cell, muscle cells in our fingers and eyes are also contracting, a form of movement that also requires energy.
Another change often required within cells is the movement of materials across membranes both into and within cells. If the molecules of a substance coming into a cell are in higher concentrations outside the cell, then the thermal energy of random motion will cause the molecules to diffuse into the cell either through the membrane or through special gates within the membrane (see Figure 6.3). But suppose the substance is a nutrient of great value to the cell. It is to the cell's advantage to bind to and take in that nutrient even if it is already in higher concentration inside the cell. As night approaches and sugar production in Elodea leaf cells subsides, cells in the stem of the plant will take in the last few circulating molecules of sugar even though its concentration is already higher within the cell. This pumping of substances against the diffusional forces that would carry them the other way requires energy: the energy of concentration of substances.
Figure 6.3 Cells are designed to invest chemical energy to move carbohydrate molecules into their cytoplasm even against a concentration difference. Respiration of the carbohydrate will yield far more energy than that expended to acquire it
Sometimes a cell must move ions across a membrane. Often it moves them to the side where they are already more concentrated. Later in this chapter we will see how concentrating ions on one side of a membrane is a powerful way to generate large amounts of ATP in cell respiration. However, pushing ions to one side of a membrane not only requires energy for concentrating things: These ions are charged. So an electrical potential is building up across our membrane as well. The cell needs energy to push together charged particles that are repelling each other. Indeed, later on, release of this electrical potential across a membrane can be used to make ATP. The cell needs energy to do this electrical work.
Finally, although Elodea cells can live acceptably at a wide variety of temperatures, your cells cannot. Their processes require an internal temperature of 37°C. Sometimes outdoor temperatures are considerably below this value. You discover that your muscle cells are contracting, not in order to lift a weigh or move food forward in your intestines, but simply to shiver. Shivering uses cellular energy to generate the metabolic heat needed to retain your body temperature close to the 37°C level at which it's designed to work. So sometimes cells need energy just to help maintain an optimal operating temperature.
A wide variety of kinds of cells, then, need energy for a variety of changes they are constantly making. Will there be a correspondingly wide variety of forms in which energy comes to these cells and in which it is handled by these cells? No. An elegantly unified process, governed by a few basic laws, describes energy conversions all across the living world. We'll now explore that unity.
|
energy of concentration—the work of moving molecules or ions against a concentration gradient, that is, moving them from where they are less concentrated to where they are already more concentrated. electrical potential a difference in charge across a mem‑ brane based on a difference in the concentration of positive and/ or negative ions across the membrane. |
IN OTHER WORDS
1. Cathedrals and cells both require energy for their construction.
2. Energy is the ability to make specific changes occur within a cell.
3. Energy is needed within cells for biosynthesis, movement, concentration of substances, generation of electrical potentials, and heat.
4. The generation of cellular energy is a unified process across the living world.
NERGY FLOW IN THE LIVING WORLD
Life Is Energy-Driven. Wonderful structural products are the result. But where does the energy come from to generate those products? Most of it comes from the sun. And as it flows through living systems, two very basic laws govern its behavior. The first law is called the law of conservation of matter and energy. The law is simply diagramed and simply stated: Energy is freely convertible from one form to another, but energy can never be created or destroyed in normal processes. (The fire can't continue when the cardboard of the match is consumed.) Energy from the sun flows through nature obeying this basic law and finds its way into the living cell in the form of C–O–H and C–H bonds within the glucose molecule.
Energy: the ability to make specific changes occur.
Energy (form #1) 4 * Energy (form #2)
The second law that governs the behavior of energy in the living world can be stated as follows: Systems that convert energy from one form to another are not 100% efficient. In each conversion event, the total amount of useful energy decreases because some energy becomes useless, typically in the form of heat (the random motion of individual particles of matter). These relationships are easily seen in the exchanges occurring in an automobile engine (see Figure 6.4). The chemical energy in the gasoline is converted to movement energy within the cylinders in the engine block. Why, then, is a water pump necessary for the engine to continue operating? More than half the energy resulting from the combustion of the octane is lost to the engine block as heat energy. This energy is useless. This same useless heat energy is felt in a crowded
Figure 6.4 Photograph of an automobile engine while running. Taken
with a thermal camera. Yes, the crankshaft is turning, but that represents the minority of the energy given off by the combustion of octane. The combustion of glucose in our bodies has the same effect.
classroom at the end of the lesson period—and for much the same reason. The students burn glucose to maintain cell life and take notes. But the exchange isn't even 50% efficient. The rest of glucose's energy is lost to the room as heat.
Energy, then, flows from the sun through living systems. Eventually it all ends up in the form of heat (see Figure 6.5). It travels through organisms that are energetically classified as producers or consumers (like us). Producers convert solar energy to chemical energy—the energy of C–H and C–O–H bonds. When we ingest producer tissues—broccoli or sugared cereals—that chemical bond energy then gets us
consumers going in the morning and takes us through our day. Since energy spends most of its time in the living world flowing within and between chemical bonds, we need to examine more closely the chemical reactions that break and form those bonds.
Figure 6.5 Energy flow through the living world is a one-way process. The vast majority of energy enters the living world as sunlight and departs as heat. By contrast, matter does not flow through the living world, it cycles around and back to where it started.
IN OTHER WORDS
1. Energy is freely convertible from one form to another, but energy can never be created or destroyed in normal processes.
2. In all energy conversions in living systems, some of the energy given off fails to be conserved as useful energy. It is lost as heat.
3. Energy flows from the sun into the chemical reaction pathways of living things and ends up as heat.
G OWS IN CHEMICAL REACTIONS
Energy in C—OH and C—H bonds can be removed and then utilized in biosynthesis only through chemical reactions. This means breaking existing bonds between atoms in a molecule called the reactant (or substrate) and forming new bonds between different atoms creating a product molecule. For example, some bacteria use the following reaction to gain energy:
Reactants Products
4 hydrogen atoms
4 hydrogen atoms
+ 2 oxygen atoms + 2 oxygen atoms
Notice in the diagram that atoms are simply shuffled around. No new atoms or electrons just appear or quietly disappear. Matter is conserved. But in this shuffle, energy is flowing. How does that happen? A chemical reaction has three characteristics we want to notice:
1. Chemical reactions proceed with energy changes. Whenever chemical bonds are broken, energy is required. Whenever chemical bonds are formed, energy is given off. Chemical reactions can be classified according to which is greater: the requirement for energy to break initial bonds or the energy generated when new bonds form. In the reaction pictured above, less energy is required to break initial bonds than is given off when the new bonds form. We term this sort of reaction exergonic (Gk. ex- = out or away from; Gk. -gonic = energy) because the extra energy given off comes out of the reaction and is available to do work for us. In fact, the energy from this single reaction is what the bacterium lives off of!
If greater energy is required to break initial bonds than is generated in forming the new ones, we call the reaction endergonic (Gk. end- = in or into) because outside energy must be
added in to drive the reaction forward. Suppose, for example, we wished to hydrolyze water in the reverse reaction to the one shown above.
|
Products |
|
Reactants |
||
|
2 H2 |
+ |
|
|
|
|
|
|
02 |
|
2 H2O |
|
(hydrogen) |
|
(oxygen) |
|
(water) |
co co ••
4 hydrogen atoms + 2 oxygen atoms
(Photosynthesis begins with a reaction similar to this one.) Here, more energy is required to break initial bonds in the water molecules than is given off in the formation of new bonds between two hydrogen atoms and two oxygen atoms. Photosynthesis is endergonic: You have to invest solar energy to split those stable water molecules.
2. Chemical reactions are reversible. Suppose we begin our reaction with high levels of reactants A and B and little or no C and D. The reaction will generally proceed in the forward
(1)
direction as written. But reaction rates depend on the relative concentrations of the reactants
|
chemical reaction -a process in which bonds are broken in one kind of molecule (the reactant) and new bonds are formed to produce a product; energy change accompanies any chemical reaction. reactant—an initial substance that absorbs energy and enters into a chemical reaction in which it is changed in structure. product—a substance that is formed during a chemical reaction. exergonic—descriptive of a chemical reaction in which free energy is given off; a spontaneous reaction. endergonic—descriptive of a chemical reaction in which free energy must be added in order to get the reaction to take place. |
and products. As the concentrations of C and D become higher compared with those of A and B, then the reaction will begin to run in the reverse direction.
C + D (2)
Eventually, if no additional amounts of either A, B, C, or D are added to the system, the forward reaction will equal the reverse reaction in rate. The system will now be at equilibrium.
C + D (3)
Most cellular reactions run under non-equilibrium conditions in which products are being removed (used or discarded) such that the reaction continues in the forward direction as in reaction (1) above.
3. Chemical reactions are relatively uncommon and slow in the nonliving world. Consider the dead cellulose in the page you are now staring at or the dead cashews in the box on your desk. They could sit there for 100 years and seldom participate in a chemical reaction. For most reactant molecules in nature, the amount of energy required to break their bonds—to start a reaction—is simply not present in their environment. You could strike a match under either the page or the cashew (see Figure 4.14) and supply the initial energy to break a few of those bonds. Then an exergonic reaction would get going and liberated energy would spontaneously keep it going. (It could become a house fire if we don't meddle.) The energy needed to get a chemical reaction going is called its activation energy. In a diagram (see Figure 6.6) that shows the energy state of the
Time
Figure 6.6 In an energy diagram (note the y axis) for a chemical reaction, how shall we represent the fact that energy must be invested to break bonds in the reactants? We use a small"hill"called the activation energy. That hill will prevent this reaction from running at temperatures common in living things.
reactants and their products through time, the activation energy looks like a hill to be got over. And while the size of the activation energy is different for every kind of reaction in nature, most of these energy hills are prohibitively high given the energy available at temperatures common on our planet. This is a good thing. It explains the stability of wood in houses and food on shelves. The world's forests would be aflame without these energy hills. No reaction can ever get going unless there's enough energy available to break bonds somewhere in the reactant molecules.
activation energy an amount of energy necessary to break
bonds in a reactant thus getting a chemical reaction started.
IN OTHER WORDS
1. In chemical reactions, energy changes occur when covalent bonds in reactant molecules are broken and
new bonds in product molecules are formed.
2. If more energy is required to break old bonds than is given off when new bonds form, the reaction is endergonic.
3. If less energy is required to break old bonds than is given off when new bonds form, the reaction is exergonic.
4. Chemical reactions are reversible. The direction in which the reaction runs depends on the relative concentrations of reactants and products already in place.
5. A chemical reaction will never begin unless there is enough energy present to begin breaking bonds in reactant molecules. This amount of energy is termed the activation energy.
ENZYMES DIRECT ENERGY FLOW
Perhaps you are now wondering how our bacterial cells harvest energy from molecular hydrogen (H2) when hydrogen gas floats all around them in the atmosphere "doing nothing." For that matter, you burn glucose for energy. Yet glucose sits around inside of grapes on vines all over the world doing nothing. Like the breakdown of hydrogen or glucose, most important cellular reactions do not proceed spontaneously at any significant rate when they are apart from the cells they normal occur in. But inside of cells are some very amazing protein molecules called enzymes. Enzymes catalyze chemical reactions. When we say, "George is a catalyst for change," what do we mean? We mean the changes we are seeing were possible before George showed up, but they just didn't occur at any significant rate until he did show up!
Consider the reaction diagram in Figure 6.7a. Of the two lines, focus on the brown one. The reaction—the breakdown of glucose—won't go at any significant rate at body temperature because its activation
glucose
energy is too great. How does an enzyme help with this? The enzyme is a rather complicated molecule—usually a protein—that has within its structure an active site (see Figure 6.7b). The active site is highly selective for the specific shape of the reactant molecule it is designed to bind to. And it binds the reactant in such a way as to stress just the bond that needs to be broken to get the product that is desired! How in the world is such bond-breaking specificity
|
enzyme—a type of protein molecule that serves as an organic catalyst in solution. It reproducibly converts one specific sort of molecule into another—a specific reactant into its product. active site—a precise three-dimensional space within the structure of an enzyme where a specific reactant or reactants selectively bind and are there converted to a product or products. |
0
Figure 6.7 Enzymes and activation energy. (a) a chemical reaction diagrammed to show the energy of the reactants and products over the time course of the reaction. The height of the energy hill shown in brown is such that, at cellular temperatures, no bonds in the substrate will be energetically unstable enough
to break. The green (enzyme catalyzed) energy hill is low enough that ordinary thermal energy within the cell will allow bonds in the reactant molecules to break freely. (b) Space-filling models showing how an enzyme combines with the reactant glucose to stress just the bond that needs breaking in order for glucose to begin the energy-yielding process of respiration.
achieved? When the reactant lodges within the active site, the precise internal shape of the site sets up weak attractions here and there with atoms in the reactant. But which atoms? The ones participating in precisely the bond to be broken! So that bond becomes weaker. But wait! How does stressing a bond in the reactant molecule help us to get over the energy hill in the diagram in Figure 6.7? By putting some stress on just the bond that needs breaking, the energy hill is greatly lowered (see the green line in Figure 6.7a). The thermal energy present in the cell is now sufficient to cause the bond to break. The reaction goes forward! In the case of glucose breakdown, that is how the whole process of cell respiration begins. In the case of hydrogen breakdown mentioned above, lots of useful energy is given off. The bacterium's metabolism—its life—is driven by this catalyzed breakdown or "burning" of hydrogen.
What elegantly designed pieces of machinery enzymes are! Do you understand their significance for cell metabolism? By their presence, enzymes control which reactions go at significant rates within the cell at normal temperatures. Now think: By controlling which enzymes are produced, the cell controls which reactions will occur. There are 24 covalent bonds in a glucose molecule—all of them breakable. If you burn crystalline glucose with a match, they all do break! And all the useful energy is lost as heat. But only one particular bond must be broken if we want to slowly degrade glucose in an orderly way so as to extract discrete amounts of useful energy from it (see Figure 6.8). So a Genius, familiar with cell chemistry and reactant molecules,
It
H\ /H H H /
\ / '
C—O—H C-0—H
H i H
\,.,1 _ \,_,1 _
H ' ,-,"---u H ,---t-)
/ \c/ H\c/ \c/ H
\C IN*
H-0/ \C—C/ \0—H H-0 \ c_c/ \0—H
/1 I \ /I I \
H H H H
0 0 0 0
I I I I
H H H H
O 0
Figure 6.8 (a) Glucose has 24 different covalent bonds that, with energy input, could be broken. To degrade it in the orderly fashion described in Section 6.7, only the bond indicated by the arrow can be broken. (b) So, "happily"an enzyme exists whose active site holds glucose perfectly, and stresses just the bond that needs to be broken. At cellular temperatures, the available thermal energy will break this bond.
has to design an enzyme that will (1) selectively bind to just glucose and not some other molecule and (2) stress just the bond in glucose needed to produce its first orderly breakdown product. And this glucose degrading enzyme is just one small part of a much larger project in which the Designer surveys the entire set of reactions needed to run a cell. Thousands of enzymes are needed to specifically catalyze them. He then invents the enzymes, the information to code for them, and the system that will access that information at the correct time to generate all the enzymes as needed. It is nothing short of glorious!
IN OTHER WORDS
1. Most chemical reactions in nature do not proceed at any significant rate because the amount of energy present is less than the activation energy for these reactions.
2. An enzyme binds to a specific reactant when the reactant diffuses into the enzyme's active site.
3. Enzymes lower the activation energy hill for specific chemical reactions, enabling them to proceed at significant rates at low cellular temperatures.
4. Activation energy for a reaction is lowered when the bond in the reactant that initially needs breaking is stressed in some way by the active site of an enzyme.
5. The existence of many kinds of enzymes in a cell allows molecules to be transformed in orderly ways within cells, slowly generating useful free energy and useful structures.
GY FLOW IN REACTION PATHWAYS: METABOLISM
As we implied earlier, it is rare that an energy-containing molecule can be utilized completely (or a cell structure constructed completely!) in a single step. Chemical reactions exist in sequences—metabolic pathways—within cells. Most of the cell's chemical reactions are arranged into this or that series of exergonic (energy yielding) or endergonic (energy requiring) reaction pathways. Consider Figure 6.9, which represents a metabolic pathway that has both linear and cyclical parts to it. Reactants A and B are converted into product C, which is itself a reactant for another enzyme that converts C to product D, and so on—and on and on I Notice that products D and I are combined by some enzyme to make product E. Product G is split into products H and I, and H is polymerized into product J.
Is all of this controlled? Does the cell ever have too little of A or make too much of J for the cell to use? Do enzymes, glorious as they are, simply rush forward, converting every reactant molecule that comes their way into product? Biochemists have been amazed at both the intricacy and the variety of control mechanisms that govern these pathways. Consider a few ways in which traffic through a pathway like this can be controlled.
First, recall the principle of reversibility. If substance J (see Figure 6.9) at the end of the process is continually used up, making a cell part, for example, it will always be in low concentration. Even though
the reactions in all the pathways are reversible, this low level of J will pull the entire set of reactions in the diagram in the forward direction to make more of J. By this same property of chemical reactions, too much of J will slow the entire pathway down.
But elegance of control rises above the level of simple availability of reactant or use of product. Most metabolic pathways in the cell have an enzyme near the beginning of the pathway that has a second binding site on it—an allosteric site (Gk. allo = other, different; Gk. stere = site; see Figure 6.10). This site is
|
metabolic pathway—a series of chemical reactions in a sequence in which the product of one reaction is the reactant of the next reaction. allosteric site —a three-dimensional groove, pocket, or surface on or within an enzyme molecule; when a specifically shaped regulatory substance binds the site, the enzyme's active site is altered structurally. |
Allosteric inhibition
Enzyme in high-affinity state
Figure 6.9 Metabolic Pathways. Each block represent a reactant for the reaction (arrow) ahead of it while simultaneously being the product from the reaction (arrow) before it. The molecule "J" is a polymer composed of many monomers "H".
Figure 6.10 An Allosteric Enzyme. This enzyme possesses an active site that is alterable in shape as a result of binding an inhibitor molecule at a second site on the enzyme's surface.
physically distinct from the active site where reactants bind and products depart. The allosteric site is designed to bind very specifically to regulatory molecules from other strategic points within the cell's metabolic world. Binding of the regulatory molecule to the allosteric site changes the shape of the enzyme so that its active site is now deformed and reactant is no longer converted to product! Thus an entire metabolic pathway can be shut down by a specific kind of regulatory molecule. One obvious approach is to design the allosteric site into the first enzyme of a pathway such that it specifically binds to the product of the last enzyme in the pathway. Neat! Now, too much final product to be used up by normal means causes the product to accumulate. Extra product molecules start binding to the first enzyme's allosteric site, shutting down the whole pathway. We call this process feedback inhibition (see Figure 6.11). Of course, this causes reactant molecules at the beginning of the pathway to begin to accumulate. However, they may, in turn, be useful in some other pathway.
But the regulatory molecule that precisely fits an enzyme's allosteric site often turns out to be
the product of some other metabolically related pathway or even an intracellular signal molecule arriving from the cell surface. Sometimes a cell needs to respond to a major change in its environment or its role in an organism. One strategy is to design a single regulatory protein that recognizes a carefully chosen set of enzymes, each of which begins a metabolic pathway that needs to be shut down—or started up. The regulatory protein then attaches a phosphate group to each enzyme altering the receptivity of its active site to reactant molecules (see Figure 6.12). Evidently, the control of metabolic pathways is elegant and finely tuned. You should be wondering at this point about the genius reflected in the design and linking together of these amazing things called metabolic pathways.
feedback inhibition—a form of rate regulation in metabolic pathways in which the product of some late reaction in the pathway controls the rate of catalysis by an enzyme earlier in the pathway.
Figure 6.11 Feedback Inhibition. This metabolic pathway converts the amino acid threonine into the amino acid isoleucine by five sequential reactions. The end product, isoleucine can be used (removed) in protein sythesis. But if it begins to accumulate, it binds as an allosteric inhibitor to the first enzyme in the pathway, shutting down production of itself.
Initial Enzymes for Four Separate Metabolic Pathways
Inactive
0— = Phosphate group
Figure 6.12 Pathway Inhibition by Enzyme Phosphorylation. Control of cell metabolism on a grand scale is sometimes effected by adding a phosphate group (-P03) to the first enzyme in a wide variety of metabolic pathways. The enzyme's active sites are all altered so as to shut down all of the pathways.
IN OTHER WORDS
1. Single chemical reactions make small changes in reactant molecules. Significant changes require a sequence of chemical reactions: a metabolic pathway.
2. Some metabolic pathways yield free energy as a product; they are exergonic. Others are endergonic.
3. Metabolic pathways can be linear or circular. A circular pathway regenerates one of the original reactants the pathway started with.
4. Removal of the end product of a metabolic pathway causes the entire pathway to be pulled in the direction of generating more of that end product.
5. Often an enzyme at the beginning of a metabolic pathway will have an allosteric site, which, when it binds a small, specific regulatory molecule, causes the enzyme's activity to be altered.
6. Often the regulatory molecule is the end product of the pathway and its binding to the allosteric site results in a deformed active site that is no longer catalytic; this is called feedback inhibition.
7. Sometimes, a single regulatory molecule phosphorylates initial enzymes in a variety of related metabolic pathways, altering their active sites so as to shut them all down or enhance their activity all at once.
OLS IN THE CELL: ATP
We have seen that metabolic pathways are of two fundamental types energetically. Exergonic ones go forward spontaneously and useful energy flows out of them. Endergonic ones (usually the ones that build cell parts) go forward only if energy flows into them and drives them forward. There is an obvious question here. Is there some way that we can harness the energy-releasing pathways to drive the biosynthetic ones? Could we have exergonic pathways depositing their free energy into a pool somewhere from which the endergonic pathways could draw out energy for bringing about all the needed changes outlined at the beginning of this chapter?
Consider Figure 6.13. The cell's metabolism is arranged such that the energy-requiring pathways are nicely driven by the energy-generating pathways (exergonic) shown to the right in the figure. But what is the energetic point of connection between these two types of reactions? Can any biosynthetic enzyme pick up energy from any exergonic reaction? No, that would be horribly complicated, both chemically and
Energy source
spatially within the cell. Instead (this is so brilliant), a few very common exergonic pathways work together to produce a single kind of transient, high-energy bond within an energy-storage molecule called ATP (adenosine triphosphate; see Figure 6.13). And the biosynthetic endergonic pathways are all designed to use ATP bond energy to drive their reactions forward! Isn't that neat?
Endergonic pathways, then, are driven forward by energy liberated by breaking the high-energy bond between the last two phosphates on ATP. That bond is easily broken (little energy is required) and lots of energy is given off when the new bonds form. ATP is the ultimate molecular connection between eating and working! You get out of bed at 6:00 a.m. because your cellular ATP pools allow you to.
ATP (adenosine triphosphate)—the major energy-storage compound in most cells; energy is given off following the breaking of a covalent bond between the second and third phosphate groups.
ATP Structure
ribose
cietadenine
(4)46
. ( three phosphate
groups
lL
adenine AMP ADP ATP
ribose P P P
0
1. The exergonic reactions within a cell provide free energy for driving the endergonic reactions in the cell.
2. The medium of exchange between exergonic reactions and endergonic reactions is energy stored in the phosphate bonds of ATP molecules.
GY LOW FROM CARBOHYDRATES TO ATP: RESPIRATION
If they are to generate ATP, all organisms on Earth need stable energy-rich molecules: They must either find them or produce them. These energy sources—molecules that are rich in C–H, N–H, and S–H covalent bonds—are the starting point for the exergonic pathways that generate cellular ATP pools (see Figure 6.13). Higher plants and animals, including humans, use three interrelated exergonic pathways and oxygen to efficiently generate large amounts of ATP from small numbers of energy-rich glucose molecules. We call this process aerobic respiration. Figure 6.14 represents the entire process: Glucose is degraded all the way to water and carbon dioxide (CO2) with the use of oxygen at the final step. Energy liberated from stable glucose molecules is neatly captured within the last phosphate
glucose bond in ATP molecules. Aerobic respiration is actually about 30 individual, sequential chemical reactions, which Figure 6.14 summarizes as just three metabolic pathways. We can further summarize the process into one simple chemical reaction showing only initial reactants and final products (see Figure 6.15). This summary reaction is highly useful for seeing the overall process of respiration. It takes us quickly from the energy of glucose to the energy
aerobic respiration—a metabolic pathway in which energy-rich molecules are degraded chemically with the generation of phosphate bond energy in ATP molecules; electrons from the energy-rich initial reactant end up combining with oxygen to form water.
Aerobic Respiration
Cytoplasm
A The enzymes that carry out glycolysis are found in the cell's cytoplasm. Glucose molecules are degraded to pyruvate molecules. Two ATPs are generated. Two molecules of NAD (electron carriers) receive electrons to be used later in the pathway.
Figure 6.14 Aerobic Respiration within the Cell. The blue parts of this diagram outline the process of respiration itself. The orange sector contains the parts of the process that occur within the mitochondrion.
Aerobic Respiration Summarized
ATP
|
J |
|
31)C |
|
|
|
602 |
ADP 36 |
6CO2 |
6H20 |
36 ATP |
|
|
|
|
|
|
|
Oxygen |
ADP |
Carbon |
Water |
ATP |
|
(energy poor) |
(energy poor) |
dioxide |
(energy poor) |
(energy rich) |
|
|
|
(energy poor) |
|
|
Figure 6.15 Aerobic Respiration Summarized
of ATP. But the brilliance of energy manipulation can't be adequately appreciated unless we delve into the process in a bit more detail. Keep referring to Figure 6.14 while we look more closely at the first of the three stages in this process.
Aerobic Respiration: Stage 1 Glycolysis
For most organisms, extracting energy from C–H bonds commences with the sugar molecule glucose, which has seven such bonds. The first stage of the extraction process is an enzyme-catalyzed metabolic pathway termed glycolysis (see Figure 6.14). This pathway occurs in the cell cytoplasm and uses no oxygen. It's similar in some respects to a variety of pathways that are used by bacteria and yeast growing under anaerobic conditions (see Section 6.8). In glycolysis, each six-carbon glucose molecule is degraded and its parts rearranged to form two 3-carbon molecules of pyruvate. What makes this pathway exergonic? It's the tendency of electrons to be attracted out of bonds where they are less stable (like C–H bonds) and into bonds involving oxygen (like C-0 bonds) where they will be more stable. More stability means less kinetic energy—the energy of motion. The kinetic energy lost to the electrons along the pathway is used to create the energy-rich phosphate bonds in ATP molecules. For each molecule of glucose degraded within glycolysis, the cell gains the energy of two ATP molecules while conserving some energy that remains in the bonds within two pyruvate molecules (see Figure 6.14). Also, two energetic electrons get transferred from glycolysis pathway reactants into more stable bonds on special diffusible carrier molecules called NADH. These carrier molecules
matter because later in respiration, in a pathway where oxygen is directly involved, they will release these electrons to still more stable molecules, resulting in additional ATP production.
Aerobic Respiration: Stage 2—The Krebs Cycle
The second stage of aerobic respiration (see Figures 6.14, 6.16) is the Krebs cycle (named for Sir Hans Krebs, a German biochemist who identified it in 1937). The Krebs cycle begins with the products of glycolysis: 2 molecules of pyruvate, both of which have considerable potential energy remaining in their molecular structure. Pyruvate molecules diffuse from the cell cytoplasm into the mitochondrion, where the second and third stages
glycolysis—the initial degradation of glucose molecules to pyruvate molecules with the generation of two molecules of ATP per molecule of glucose processed.
anaerobic—any environment or process in which oxygen is absent.
pyruvate—a three-carbon carbohydrate product of glycolysis whose continued degradation generates two-carbon fragments that serve as reactants in the Krebs cycle.
NADH (nicotinamide adenine dinucleotide)—a biomolecule that accepts electrons from reactants in glycolysis and the Krebs cycle and transports them in solution to an electron transfer system. The system accepts the electrons and uses them to generate ATP for the cell.
Krebs cycle—a metabolic pathway in which acetyl groups are stripped of energetic electrons and degraded to carbon dioxide; an integral part of aerobic respiration.
· Pyruvate enters the mitochondrion and loses one of its carbons in the form of 002. The remaining 2-carbon acetyl fragment is carries into the cycle by a coenzyme called CoA. At this point an electron is also conserved on an NADH carrier molecule.
The two carbon fragment adds onto a 4 carbon compound to form the six carbon citrate molecule.
0 Atoms rearranged on the reactant citrate cause another carbon to be lost as CO2 (breathe out right now!) and again an
electron is captured on another NADH.
G Further rearrangements on the reactant molecule cause another carbon to be lost as carbon dioxide and another electron to be captured in NADH.
iD In rearrangements at the bottom of the cycle enough energy becomes available to phosphorylate an ADP directly to form an ATP molecule.
· Further electrons are captured and transferred to carrier compounds NADH and FADH2.
· The four carbon product of the cycle at this point is prepared to be the reactant in a second turn of the cycle.
Figure 6.16 The Krebs Cycle Summarized
of aerobic respiration take place. Once inside the mitochondrion, each pyruvate molecule loses one of its carbon atoms, which, along with two oxygen atoms, becomes carbon dioxide (see Figure 6.16). The remaining two-carbon fragment, called an acetyl group, is shown entering the cyclic pathway as part of a complex known as acetyl-CoA (see the top of Figure 6.16). Since glucose degradation in glycolysis gave us two molecules of pyruvate, the Krebs cycle reactions run twice for each glucose molecule degraded in glycolysis. Thus four of the carbon atoms that begin glycolysis in glucose end up entering the Krebs cycle.
The Krebs cycle, like glycolysis, is exergonic. What drives all these reactions forward, generating energy, is the tendency of electrons to jump from atoms in molecules like isocitrate. where they are less stable, to atoms in molecules like NADH. where they become more stable. Again, the electrons now on the NADH carrier molecules still contain considerable potential energy for generating ATP molecules, as we shall soon see.
The carbon atoms remaining from glucose that go into the Krebs cycle on acetyl-CoA leave the Krebs cycle one after the other in the form of CO2 (see Figure 6.16). Review the summary equation for respiration given in Figure 6.15. The Krebs cycle is where
much of the CO2 comes from that you breathe out all day long! "Does that mean I'm breathing out the carbons I ate in my oatmeal this morning?!" Yes, you've got it! The carbon atoms from your breakfast cereal are within the carbon dioxide you exhale each moment. If you see that, you are catching onto a major feature of the carbon cycle in nature.
What then are the products of the Krebs cycle? Two 3-carbon molecules of pyruvate have become six energy-poor, 1-carbon molecules of carbon dioxide. "Energy-poor? Well then, where is the energetic value in the Krebs cycle?" Notice in Figure 6.16 that for each turn of the cycle, enough energy is released in one of the reactions to generate an ATP molecule directly. All the rest of the cycle's energetic value is in the electrons bound to eight carrier molecules of NADH and two of FADH2.
|
acetyl-CoA—a two-carbon fragment resulting from degradation of pyruvate; the fragment is attached to a large cofactor molecule that transfers the acetyl fragment onto a reactant in the Krebs cycle. FAN!, (flavin adenine dinucleotide)—a biomolecule that accepts electrons from reactants in the Krebs cycle and transports them in solution to an electron transfer system. The system accepts the electrons and uses them to generate ATP for the cell. |
The matter and energy yield of the Krebs cycle is summarized in Figure 6.14.
Aerobic Respiration: Stage 3—Electron Transfer Phosphorylation
Also within the mitochondrion, anchored within its inner membrane, is a series of proteins that receive and transfer electrons (see Figure 6.17b). Electrons are all that connect glycolysis and the Krebs cycle to the electron transfer system—just electrons. The little NADH and FADH, "electron
dump trucks" pull electrons from substrates around the Krebs cycle and travel (are soluble) to the electron transfer system, where they then lose their electrons to membrane-bound proteins that hold them even more tightly! Amazing. The whole system remains wonderfully exergonic as long as each electron "destination" attracts the electron more strongly than the molecule that currently holds it! Some Designer must have had fun seeing all of this! Aren't you? (Perhaps your brain is fun-fatigued.. .. )
This last stage of aerobic respiration is the most ingenious of all (see Figure 6.17)! As electrons
|
0 Electron carriers transfer electrons from glycolysis and the Krebs Cycle to the Electron Transfer proteins in the mitochondria! membrane. |
As electrons are pulled forward by each successive transfer protein, the energy given off pumps protons across the inner mitochondria! membrane. |
A strong positive charge (potential energy) begins to develop outside the membrane. |
CO ATP synthase relieves this electrical potential by allowing protons to flow back into the organelle's interior. The energy of this flow is used to phosphorylate ADPs creating ATPSs—the desired product of the entire respiratory process. |
Figure 6.17 Aerobic Respiration in relation to Mitochondrial Structure. Details of the electron transfer chain are represented.
transfer from protein to protein, each succeeding protein captures and holds the electrons more tightly than the previous protein. So with each step the electrons are held more stably and energy is given off as a result. This energy is used to pump protons (H+ ions) from one side of the inner mitochondrial membrane to the other. Since the outer membrane keeps all of those protons from wandering away, the electrical potential across that inner membrane starts to rise until there's a 200-millivolt (mV) difference in charge across the membrane. There's a net positive charge on the outside—and a net negative charge on the inside (see Figure 6.17c). And the fatty acid interior of the phospholipid bilayer of the inner membrane insulates the inside from the outside; it doesn't allow protons back across. So the charge just builds.
Once it builds to the level of about 200 mV, the protons do cross back over the membrane—but not by escaping through the lipid bilayer. No! There exist these wonderful proteins called ATP synthases (see Figure 6.17d). They sit like gates across that membrane. They allow the protons to respond to their mutual repulsion by racing back into the inner compartment again—but at a price. Every time about three of those protons sail through the gate, enough energy is extracted by that movement to add a phosphate group onto an adenosine diphosphate molecule (ADP), making it a triphosphate (ATP)! So here is how our mitochondrion powers the cell: It generates about three ATP molecules for each pair of electrons that "ride down" the electron transfer system.
Notice which molecule is waiting at the very end to receive and retain the electrons: It's oxygen, the substance you constantly breathe in and transport to this site. Molecular oxygen attracts electrons more forcefully than any molecule from any other point in the entire aerobic respiratory system. When oxygen picks up these extra electrons, it also picks up extra protons to balance itself electrically. The result is water (see Figure 6.14). Since the oxygen in the water molecule holds the electrons very tightly, we say that water is energy-poor. But the ATP we generated is energy-rich. Metabolically, a fine exchange has just occurred.
Let's summarize the energetics of the whole of respiration (see Figure 6.14). For each molecule of glucose fuel that we "burn," we have a net return of 2 ATP from glycolysis, 2 ATP from the Krebs cycle, and 32 ATP from the transfer of electrons supplied by the 12 carrier molecules. That's 36 ATPs harvested from the breakdown of a single glucose molecule.
How much energy is that? Energy can be measured in units called calories. One kilocalorie is equal to 1000 calories' worth of energy. When your body degrades 6.5 ounces of glucose in respiration, 686 kilocalories of energy are released. Of that amount, 263 kilocalories are retained in ATP bond energy. According to the second law of energetics (see Section 6.2), what happens to the rest of those calories? If we divide 686 into 263, we discover that your body converts glucose energy into ATP energy at an efficiency of about 38%. This may not appear to be very efficient, but remember, on some days, that extra heat energy is quite useful for helping to maintain our body's operating temperature. That 38% efficiency should be compared to another figure as well. Since the early 1800s, designers and engineers have labored to perfect the internal combustion engine. Now, many decades later, the automobile engine converts the energy of octane to the turning of wheels at an efficiency of about 25%. Let's ruminate carefully on these two numbers before we blithely assume that respiration is the product of an unpredictable sequence of environments operating on a random sequence of mutations.
millivolt—a unit of electrical potential energy equal to 1/1000 of a volt.
ATP synthase—a protein within the mitochondrial membrane; it relieves a proton gradient by allowing protons to flow back across the membrane. It uses the resulting energy production to phosphorylate ADP making energy-rich ATP molecules.
calorie—the amount of energy required to raise the temperature of 1 gram of water by 1°C.
IN OTHER WORDS
1. Aerobic respiration is a metabolic pathway that degrades carbohydrates capturing their stored energy in the phosphate bonds of ATP.
2. In glycolysis, the first stage of respiration, glucose is degraded to pyruvate and some of its energy is stored in the phosphate bonds of two ATP molecules and in electrons on the carrier molecule NADH.
3. In the Krebs cycle, portions of pyruvate molecules are further degraded to carbon dioxide with energy stored in electrons on the carrier molecules NADH and FADH2.
4. Carrier molecules from glycolysis and the Krebs cycle transport electrons to the electron transfer system, where they release their potential energy during the transfer process.
5. The transfer of electrons from compound to compound in the transfer system causes protons to be pumped from the interior of the mitochondria, creating an electrical potential.
6. The electrical potential is relieved by an inward flow of protons through the ATPase enzyme that phosphorylates ADP, generating ATP.
7. Respiration generates 36 ATP from the breakdown of a single glucose molecule; in energy conversion, respiration is 38% efficient at conserving glucose bond energy.
OW FROM CARBOHYDRATES TO ATP: FERMENTATION
In exergonic reaction pathways, electrons are always moving. And they always have to end up stored somewhere on some molecule. In nature, the most stable place for electrons to end up is on oxygen molecules (making water). Water is a highly stable, energy-poor molecule. But there are many places on Earth that have little or no oxygen—the bottoms of ponds, or oceans, or wine vats! Living things or their parts die and decay in all of these areas; their bodies contain many energy-rich molecules, such as glucose in grapes (see Figure 6.18). Shall we just give up on using these nutrients because no oxygen is available to respire (burn) them? That would be a major design flaw in a biosphere where most life-forms die. Dead organisms would simply accumulate in these anoxic zones. Eventually, the world's carbon supply would be tied up in those places. But in principle, life is energy-driven not oxygen-driven. Can't energy be derived from C–H bond–containing molecules even if no oxygen is present? The answer is "yes," and the process is called fermentation.
A variety of microbes inhabit places in the world's environments where there is no oxygen. These bacteria and yeasts use large numbers of energy-rich molecules in short exergonic pathways to generate modest amounts of ATP that they can survive on (see Figure 6.19). Fermentation pathways vary depending on the energy-rich molecules
Glucose
Stable energy source
Figure 6.19 Alcoholic Fermentation. This process requires no oxygen. In the initial decay process, complex carbohydrates are degraded to the glucose shown here. Glucose is
them degraded through glycolysis as in aerobic respiration with a net production of 2 ATP Electrons are pulled off of reactants along the glycolytic pathway and are finally dumped onto the small organic molecule acetaldehyde to generate ethyl alcoholic. The entire baking and brewing industry rest upon this reaction. The bakers run it to get the
carbon dioxide which raises the bread. The brewers run it to get the alcohol.
available for use. Some of these pathways are very much like glycolysis—especially when glucose is available. But what do such pathways end with? If oxygen's not the final electron acceptor (as in aerobic respiration), then where are the electrons "dumped"? One very common molecule that acts as a terminal electron holder in anaerobic energy generation is ethanol (ethyl alcohol, grain alcohol, "juice"!). Yeast cells, of species Saccharomyces cerevisiae, do fermentation at the bottom of wine vats all over Europe and upstate New York (see Figure 6.19).
Ethanol, then, is a major ingredient in a fungal (yeast) waste product that our society concentrates and drinks! If you took a yeast cell and dropped
it into a bottle of bourbon whiskey, it would die marinating in a concentrated form (70% ethanol) of its own metabolic waste. Suppose we were to concentrate urine—human metabolic waste—to that same degree. Many of us, who wouldn't consider drinking such a product, are quite casual about drinking a yeast cell's metabolic waste. Think about that one a bit. (There are bacteria in nature that neatly degrade ethanol to simpler compounds: Our services were never needed for this task.)
ethanol—a two-carbon alcohol formed when electrons on NADH are transferred to a molecule of acetaldehyde; beverage alcohol.
IN OTHER WORDS
1. The Earth has many anoxic (oxygen deficient) environments where respiration cannot take place.
2. Fermentation derives ATP energy from energy-rich carbohydrates in the absence of any oxygen.
3. The final electron acceptor in fermentation is usually a small organic molecule like ethanol or acetic acid (vinegar).
R OW FROM PHOTONS TO
• RATES: PHOTOSYNTHESIS
The flow of energy we have traced out thus far prepares us to take in an even bigger picture: The way in which the sun drives all of life! Many microbes and higher plants are called autotrophs (GK. auto = self; Gk. troph = feed on). Autotrophs need energy-rich molecules containing C–H bonds just as we do and for all the same reasons. But oak trees don't eat the squirrels inside of them, and yet, their ATP supplies are just fine. What is the source of energy-rich molecules for autotrophs? They build their own using solar energy. Then, to meet their own energy needs, they turn round and degrade these molecules, using the same respiration pathway we use. (see Figure 6.5). Autotrophs possess an amazing collection of molecules called chlorophylls, which channel solar energy into the production of high energy carbohydrates in a process called photosynthesis. Like respiration, this process has separate stages and represents something like 30 separate sequential reactions. Once again, the process can be summarized by the single expression in Figure 6.20. The glucose product of this pathway is then degraded by respiratory pathways in the same cell to generate all the ATP needed for biosynthesis, movement, and transport of materials. Just imagine over 300,000 widely differing species of plants—everything from roses to redwood trees—all carrying out photosynthesis and respiration in essentially the
same way using the same enzymes and organellar compartments! A glorious Designer envisioned it all first! Then . . . then . . . we made sense of it!
We slowly discovered that photosynthesis is really two somewhat separate processes. In the first process, called the light-dependent pathway, solar energy is used to split water molecules, generate free oxygen and the temporary energy storage molecules ATP and NADPH (see Figure 6.21a). In the second process, the light-independent pathway (see Figure 6.21b), the ATP energy and the electrons
|
autotroph—any organism capable of taking in carbon dioxide gas from nature and using it to generate energy-rich carbohydrates. chlorophyll—a green pigment biomolecule capable of absorbing solar photons and using the resultant energy to break and form covalent bonds. photosynthesis—a metabolic pathway in which light energy is used to generate carbohydrates from carbon dioxide gas and water. light-dependent pathway—a sequence of reactions within photosynthesis that utilize light energy to generate ATP molecules and to transfer electrons to NADP generating NADPH. light-independent pathway—a cyclical sequence of reactions within photosynthesis that utilize ATP bond energy and electrons from NADPH to generate energy-rich carbohydrates. |
Photosynthesis Summarized
zoc
6CO2 6H20
|
|
|
|
|
|
Carbon dioxide (energy poor) |
Water (energy poor) |
Chloroplasts (chlorophyll) |
Glucose Oxygen (energy rich) (energy poor) |
Figure 6.20 Photosynthesis Summarized.
Suq H2O ri4
Figure 6.21 Photosynthesis Dissected. (a) Light-Dependent Reactions. To the left a chloroplast is shown in a cut-away view that reveals the thylakoids
within. The reactions shown in color take place within the thylakoid and across the thylakoid membrane. (b) Light-Independent Reactions. To the right, a chloroplast is shown in a cut-away view that reveals the stromal fluid and space around the thylakoids. The reactions shown in color take place within the stromal fluid of the chloroplast.
Figure 6.22 Light Energy. (a) The sun emits energy from a broad range of the electromagnetic spectrum, including all the visible wavelengths of light. (b) Visible light is only a small portion of the total electromagnetic spectrum of wavelengths of energy that exist. It is most convenient to measure visible wavelenths of light in nanometers (10—s meters). Radio waves can be as long as 20 kilometers in length.
on NADPH are used to attach carbon dioxide to a small, existing sugar molecule making it larger and generating the additional C—H bonds that make it more "energetic." So the light-dependent pathway converts solar energy into chemical energy. The light-independent pathway uses this chemical energy to "grow" sugar molecules one carbon at a time. Let's dissect these two processes a bit starting with the first.
Photosynthesis: Stage 1Light-Dependent Reactions
Generating energy-rich carbohydrates begins with light. Visible light from the sun can be described either as energetic particles or as waves. If you bend light with a glass prism, it breaks up into its constituent wavelengths, which appear to our eyes in all the colors of the rainbow (see Figure 6.22a). Each wavelength of light has its own energy level. The shortest visible wavelength of light (violet)
consists of particles with almost twice the energy of red light, which has the longest wavelength in the visible spectrum of light.
Life was designed with visible light in mind. Visible light is only a tiny portion of an exceedingly broad electromagnetic spectrum of radiation that extends from ultrashort and highly powerful gamma rays to much longer and lower-powered radio waves that surround us constantly (see Figure 6.22b). What is surprising is that wavelengths of radiation from most parts of this spectrum are minimally felt on the Earth's surface. The chemistry of space and our atmosphere absorb almost all electromagnetic radiation shorter or longer in wavelength than visible light. Yet visible light waves are just the ones that are most useful for transferring energy from light to electrons in organic molecules. Higher-energy wavelengths indiscriminately disrupt the structure and function of organic molecules—degrading the photosynthetic machinery itself. Lower-energy wavelengths increase overall molecular motion in fluids but aren't strong enough to encourage the breaking of specific covalent bonds. How wonderful! Precisely the wavelengths of energy we need for life are the ones that survive space and our atmosphere, arriving safely on the surface . . . of leaves.
Visible light enters the biological world when it is absorbed by pigment molecules (see Figure 6.23). A variety of pigment molecules called chlorophylls are found in plants, many protistans, and many bacteria. They absorb principally violet, blue, and red wavelengths of light. Since they don't absorb green light very effectively, this is reflected to our eyes, causing chlorophylls—and thus plants—to appear green. Much of the light that powers photosynthesis is absorbed by these chlorophylls. Some wavelengths of light are absorbed by other accessory pigment molecules, but their absorbed energy is then channeled toward the chlorophyll molecules, where the actual energy conversion takes place. The result of light absorption by chlorophyll is that an electron within one of its atoms suddenly gains energy and orbits its nucleus at a much higher level. This electron could, after a brief period of time, simply drop back to a more stable orbit, losing its energy in the form of heat or reradiated light (see Figure 6.24). But in photosynthesis that does not happen! Instead, the electron leaves the chlorophyll molecule and is transferred to a nearby electron transfer compound called a quinone. Covalent bonds are
broken and formed. What was previously solar energy has now become chemical bond energy.
How does the chlorophyll molecule always have a quinone adjacent to it to pass electrons to? The glorious photosynthetic chemistry is housed in a meticulously arranged set of compartments within the green cells of the lettuce leaves you ate for dinner tonight. Inside each cell (were!) many chloroplasts whose insides were packed with a stacked, convoluted system of (green) membranes called thylakoids. The membranes are green because the chlorophyll we've described is situated within them (see Figure 6.25). Within the thylakoid membranes hundreds of chlorophylls and accessory pigments are held together in clusters called photosystems (see Figure 6.26). The pigment molecules harvest light and channel it to two special chlorophyll molecules within each photosystem. These two molecules actually transfer their excited electrons along to electron-accepting quinones. There are two different kinds of photosystems in the membrane that possess chlorophylls differing in the wavelength of light that excites them. These two kinds of photo-systems cooperate to generate a continuous flow of electrons between them. That flow results in the ATP production needed to drive the growth of sugar molecules.
electromagnetic spectrum—the entire range of radiation extending in frequency from approximately 10-" centimeters to infinity and including cosmic-ray photons, gamma rays, X-rays, ultraviolet radiation, visible light, infrared radiation, microwaves, and radio waves.
pigment molecules—organic compounds that absorb and reflect wavelengths of light selectively such that they appear to the human eye to have a particular color.
accessory pigments—organic compounds such as carotenoids that absorb wavelengths of light not readily absorbed by chlorophyll; they transfer the energy of that absorption to nearby chlorophyll molecules, enhancing their excitation of electrons.
quinone—a class of yellow compounds found in thylakoid membranes; they accept electrons from chlorophyll molecules.
thylakoid—a membrane-enclosed sac within a chloroplast inside of which are the enzymes, pigments, and electron transfer compounds of the light-dependent reactions of photosynthesis.
photosystem—a membrane-bound collection of chlorophylls and accessory pigments that harvest light energy and make it available to the light-dependent pathway of photosynthesis.
CH2
11
CHCH3 /C /F% /% H3C—C\ /
C C C CH2CH3
I I
C—N N =C
/ \Mgr\ % \ HC, ,CH
C—N N—C
II I \
H3C—C/ C C C —CH3
/ \ / \ % \ % H /CI C C
1 1
H CH2 HC C=0
1 1
CH2 C =0
1 1 C=0 0
1 1
0 CH3
CH2 1
CH
11
C — CH3
CH2 1
CH2 1
CH2 1
HC — CH,
CH2 CH2 1
CH2
HC — CH3
1
CH2 1
CH2
CH2
CH / \ H3C CH3
Figure 6.23 Plant Pigments. (a) The molecular structure of chlorophyll a exhibits a long hydrophobic"tail"that anchors it in a thylakoid membrane. The"green" portion of the diagrammed molecule is where solar energy becomes the chemical energy of excited electrons. (b) Because chlorophyll's structure renders it particularly poor at absorbing green light wavelengths, these are reflected and leaves appear a cool green color to our eyes.
(c) Chlorophyll is constantly made and degraded all summer long. In the fall it's production stops and its degradation reveals the presence of other accessory pigments in the leaf that help to absorb some wavelengths of light that chlorophylls don't absorb as well. They also bring to our eyes the glory of fall colors.
O
Positioned right next to one of the photosystems, within the membrane, are the quinone molecules that quickly trap the excited electrons from a chlorophyll molecule. The electrons then enter an electron transfer system similar to the one described for aerobic respiration (see Figure 6.17, right-hand side of the diagram). As the electrons move from one transfer component to the next, they release energy used to pump protons (F1+ ions) from the exterior to the interior of the thylakoid membrane. A charge begins to build up across the membrane. But again that charge is relieved by a membrane-bound ATPase enzyme (see Figure 6.26) that uses the energy to generate ATP.
The first law—the conservation of matter—states that electrons cannot simply come from
The electron may return to 0 The electron may be
its former level giving off accepted by an adjacent
light or heat. receptor molecule.
Figure 6.24 Photon Absorption by an Atom within Chlorphyll. The absorbed light energy promotes an electron to a higher energy level. (a) The electron could simply return to its more stable configuration with the energy given off either as re-emitted light or as heat. (b) If an appropriate acceptor molecule is nearby, the energized electron may jump to the acceptor molecule, resulting in a new energy-rich covalent bond. Light energy has become chemical energy.
nowhere. Once chlorophyll loses its electron to the nearby electron transport system, how does it acquire another electron for the next solar excitation event? An enzyme activity that is closely associated with the photosystem of chlorophyll molecules uses solar energy to drive an otherwise very unfavorable reaction—the splitting of (very stable) water molecules. There are plenty of water molecules around—the roots of the plant are always supplying more of them. The enzyme splits away protons (H+ ions) from two water molecules and captures the now available electrons on behalf of the "wanting" chlorophyll molecule. The enzyme then goes on to combine the two remaining oxygens to form a molecule of oxygen gas (which makes your breathing worthwhile). But what a breath-takingly facile enzyme is this amazing machine that our lives are so entirely dependent upon!
Consider the electrons stolen from water. They take a long but very fast ride, chemically. They get excited by chlorophyll and travel down an electron transfer chain only to be picked up by a second, somewhat different, chlorophyll in the second of the two photosystems mentioned above. In this photosystem they are again excited by solar energy—but to a still higher energy level (see Figure 6.26). With this additional energy they are capable of being transferred to the soluble electron carrier NADPH
Figure 6.25 Finding Photosynthesis in a Leaf. Cells within leaves (a) are arranged in discrete layers or"tissues': Toward the leaf's upper surface is a high density of
cells (b) filled with chloroplasts. In (c) the interior of a chloroplast is diagrammed. The compartments within a chloroplast remind us that Life is Complex.
Figure 6.26 The Light-Dependent Part of Photosynthesis. Two differently designed photosystems convert the energy of light into the energy of electron acceleration. The solid yellow lines represent how that added energy is relieved. The electrons are transferred from compound to compound, all the while their energy is used to pump protons (H± ions) into the thylakoid. The electrons, initially stolen from water molecules (energy poor) finally end up on a molecule of NADPH (energy rich). The ATPase enzyme (shown to the right in the thylakoid membrane) allows the protons back to the exterior. The energy given off in that flow is used to phosphorylate ADP to generate energy rich ATP
which has a role similar to the NADH used in respiration. NADPH carries high-energy electrons to the second stage of photosynthesis where they are used to create energy-rich C-H bonds.
So then, fundamentally, the light dependent reaction of photosynthesis is simply a long flow of electrons. First they are pushed up an energy hill by the "power of the photon!." As they then flow down the energy hill, they pump protons. The displaced protons return across the membrane making ATP. Finally the electrons themselves generate NADPH once their transfer is complete.
You may be thinking, "Wait! Why not just have the light-dependent part of photosynthesis make lots of ATP and be done with it? The plant can get all its ATP from that source (instead of doing respiration), and then I'll get that ATP when I eat the plant tissue" (see Figure 6.27). But there is a design problem here. Many changes required by the cell involve substantial amounts of energy input at specific endergonic reactions. That energy can be made available to those reactions, concentrated into one single bond—if that bond is somewhat unstable. That's what we have with ATP. It delivers, in a single bond, ample free energy to the many endergonic processes that require it. But the price is instability. ATP breaks down almost as soon as it's formed if you don't use it right away. Since it's needed within your individual cells, that's really where you need to produce it. Sugars like glucose are much more stable, absorbable, and transportable energy sources. So a brilliant Designer made photosynthesis complete enough to generate stable sugar molecules that we can then absorb and use at leisure to make unstable but highly useful ATP molecules.
Photosynthesis: Stage 2Light-Independent Reactions
We must therefore invest our ATP and NADPH almost immediately into making stable sugar molecules. This requires the second stage of photosynthesis, the light-independent stage. We call it that because it needs only the products of the light-dependent stage to operate. If we were to supply the second stage of photosynthesis with a continuous
Light-Dependent Reactions Imagined
Changes needed in Plants cells
6H20 602 12H+ 12e + ATP
411110
Chloroplasts (chlorophyll)
Oxygen (energy poor)
ingestion
of plants by animals
Figure 6.27 "If Only". ATP's available energy is highly concentrated in the covalent bond between the last two phosphates. The bond takes very little energy to break and much energy is given off when new bonds form. If only ATP were a more stable molecule, respiration and the light-independent part of photosynthesis would be entirely unnecessary—so much less to learn! It is the diffusely energetic but stable glucose and the highly energetic but unstable ATP molecule that require all the additional chemistry of respiration and photosynthesis. But an infinite Designer saw all of that and chose to use two molecular versions of energy storage—ATP and glucose.
supply of ATP and NADPH, it would generate sugar for us all day long with no input of solar energy whatever.
The light-independent reaction is simply a way of using ATP energy and NADPH's electrons to first add carbon dioxide to the structure of an existing sugar molecule and then to replace some of the energy-poor C-0 bonds with energy-rich C–H bonds on that sugar molecule (see Figure 6.28a). How does this pathway begin? Land plants allow carbon dioxide into their leaves by stomata on the undersurface of the leaf. Algae use carbon dioxide dissolved in the surrounding water.
Carbon dioxide diffuses into the cytoplasm of photosynthetic cells and then into the chloroplast. There in the semifluid matrix of the chloroplastcalled the stroma—the light-independent pathway takes place. The reactions in the pathway take the form of a cycle somewhat like the Krebs cycle, only here, as you might have expected, CO, is added to the substrate molecules rather than being taken off as in the Krebs cycle! The CO, gets added to the five-carbon sugar ribulose 1,5-bisphosphate (RuBP), which is then regenerated by the end of the cycle. The enzyme that catalyzes this reaction, RuBP carboxylase, is believed to be the most abundant protein on the face of the Earth! Why might this be true?
Adding one carbon to a five-carbon sugar creates a six-carbon hexose (sugar) that immediately is split into two 3-carbon sugars within the cycle. These small carbohydrates then receive electrons from NADPH to enrich their structures chemically with C–H bonds. Next, a series of cutting and pasting reactions then occur among three-, four-, five-, and seven-carbon sugars within the cycle in order to regenerate RuBP. The cycle must turn six times, capturing six carbon atoms as CO2, in order to form the equivalent of one 6-carbon glucose molecule. The whole process can be represented with the summary statement shown in Figure 6.28b. Actually, glucose is not present in high concentrations within the cytoplasm of the plant cell. It is quickly combined with fructose to form sucrose, the major transported form of sugar in the plant, or it is polymerized into long molecules of starch, the major storage form of carbohydrate in the plant. Starch can be stored in the chloroplast itself until nighttime
stomata—regulated openings on the undersurfaces of leaves that control the influx of carbon dioxide and efflux of water from internal leaf tissues.
stroma—a syrupy fluid within chloroplasts that surrounds the stacks of thylakoids; the enzymes of the light-independent reaction are found in the stroma.
ribulose 1,5-bisphosphate—a twice-phosphorylated five-carbon sugar that combines with carbon dioxide in the light-independent reaction of photosynthesis to form two 3-carbon sugars.
sucrose—a disaccharide sugar composed of the monomers glucose and fructose; the sugar used for transporting energy throughout the tissues of a plant.
starch—a polymer of glucose molecules; used as a storage form of energy in plant tissues.
Figure 6.28 The Light-Independent Reactions of Photosynthesis. (a) The brown spheres represent carbon atoms. Note that the 6CO2 molecules entering the reaction pathway require six"turns"of the cycle in order to generate one 6-carbon glucose molecule. (b) A summary of the reactants and products of the light-independent metabolic pathway.
0
when it's converted to sucrose and distributed as needed for energy throughout the plant.
Finally, as the preceding summary reaction suggests, more ATP than NADPH is needed to generate our glucose molecule. Continuous operation of the light-dependent pathway as we've described it here would thus lead to a surplus of NADPH. This problem is avoided, however, because a simpler version
Cyclic Electron Flow
of the light-dependent reaction exists that uses only the first photosystem. It is cyclic. Excited electrons leave chlorophyll from the first photosystem, travel an electron transfer sequence, and then return to the same photosystem, their energy spent (see Figure 6.29). The spent energy pumps protons and yields ATP. But because the second photosystem is not involved, no NADPH is generated. The chloroplast can shift freely between the simpler or more prolonged systems keeping the pools of ATP and NADPH is precise balance. Such elegant control!
Figure 6.29 Cyclic Electron Flow. If NADPH supplies in the chloroplast are adequate, solar energy is sometimes used to simply excite electrons in chlorophyll. Their carefully crafted flow back through electron transfer compounds pumps protons into the thylakoid and results in extra ATP production. Only one photosystem is involved and no NADPH is generated.
IN OTHER WORDS
1. Autotrophs are cells or organisms that generate their own energy-rich molecules using energy-poor carbon dioxide from the environment.
2. Many autotrophs generate energy-rich molecules by capturing solar energy using chlorophyll in an energy conversion process called photosynthesis.
3. Essentially similar over hundreds of thousands of plant species, photosynthesis consists of two component parts, a light-dependent pathway, and a subsequent light-independent pathway.
4. The light-dependent pathway uses solar energy to split water molecules, release free oxygen, generate ATP, and shuttle electrons to the carrier compound NADPH.
5. The light energy used in photosynthesis derives from a very narrow portion of wavelengths of energy in the electromagnetic spectrum.
6. Excited electrons quickly lose their energy either as heat or as reradiated light unless they can be passed to an acceptor molecule that enables them to retain their added energy.
7. Electrons passed to an acceptor molecule flow rapidly through an electron transfer system formally similar to one in respiration with a similar result: ATP production.
8. The electrons leave the electron transfer system, get reexcited in a second photosystem and are finally accepted by a carrier molecule of NADP making NADPH.
9. The chloroplast can use just one photosystem or two of them to generate the products of ATP and NADPH in the proportions needed to serve the light-independent reaction.
10. The ATP molecules generated in the light-dependent reaction are too unstable chemically to serve as an energy source for the heterotrophic (animal) life-forms in the biosphere.
11. The light-independent pathway uses ATP energy and electrons from NADPH to capture energy-poor carbon dioxide and uses it to generate stable energy-rich carbohydrates.
12. In terrestrial plants, carbon dioxide enters the stomata on the underside of leaves; it then diffuses into plant cells, then into chloroplasts, where, in the stroma, it becomes chemically bound to existing carbohydrates.
13. The light-independent pathway is a cyclic series of chemical reactions that rearrange, cut, and paste carbohydrate molecules.
14. The pathway generates free carbohydrate energy sources and regenerates the five-carbon sugar that accepts carbon dioxide at the beginning of the cycle.
Let's conclude our analysis of energy's "driving effect" on life processes by comparing the two processes of photosynthesis and respiration (see Figures 6.15, 6.20). You must have noticed by now that the summary reactions for these two processes are materially precisely the reverse of each other. What does that fact mean functionally and energetically? Photosynthesis and respiration are complementary processes within a global cycle called the carbon cycle. The major reservoirs of carbon in this cycle are atmospheric carbon dioxide, the Earth's water supply with its dissolved carbon dioxide, the organic matter in all of the living things on the surface of the planet, and all the residue of once-living organisms. This last category includes all coal and oil deposits (see Figure 6.30).
Photosynthesis is essentially an endergonic process. It requires the sun's energy to drive the uptake of energy-poor molecules—CO2 and H20—from their respective reservoirs and convert them into energy-rich organic molecules (like glucose) with the elaboration of free oxygen. The energy-rich glucose is then burned by heterotrophs like us.
We can't make our own fuel photosynthetically—we must depend on the autotrophs that can. The free oxygen they provide in photosynthesis can then be the final electron acceptors, pulling electrons off of energy-rich food molecules during the exergonic reactions of respiration.
Now that we've appreciated at least a bit of life's biochemical complexity, we dare to ask: How did all of this glorious machinery originate? Let's suppose, as many have, that metabolism evolved slowly from single chemical reactions to more complex pathways. We must imagine an early version of photosynthesis: just a few membrane-bound compounds that transfer electrons and that somehow learn to generate ATP as a result of electron transfer (see Figure 6.31). We next imagine that a
carbon cycle—the circulation of carbon within the biosphere, sometimes as carbon dioxide, and at other times within organic molecules such as glikose; photosynthesis and respiration are central processes in this circulation.
Figure 6.30 The Big Picture. The energy of the sun drives photosynthesis; the energy of glucose drives respiration. Respiration occurs in all higher plants and animals while photosynthesis occurs only in autotrophic forms. While matter cycles continuously between the two processes, energy flows vertically from light to chemical energy to heat.
Figure 6.31 Evolutionary Origin
of Photosynthesis and Respiration. Microfossils and layers of rock that show the effects of free oxygen are demonstrable features of sedimentary rocks. Beyond these hard evidences most of the lower portion of this figure is conjectural. It is based on the assumption that evolution takes us from what is simple to what is more complex. The photographs here show both modern cells of the blue-green cyanobacterium, and fossil forms of these bacteria. We can't know what these fossil forms were capable of metabolically.
more complex (non-cyclic) version of photosynthesis developed—one that generated oxygen. Our assumption further forces us to postpone arrival of cells capable of respiration until complex photo-synthesizers fill the atmosphere with this oxygen. It is difficult to force current evidence to require this progression of pathway development. The oldest known fossil microbes look like early members of Phylum Cyanobacteria (see Figure 6.31). Modern cyanobacteria possess the more complex form of photosynthesis although they are capable of running just the simpler version. Since these ancient cyanobacteria exist only as fossils, they can't tell us what their metabolic abilities were. Yet if we assume life must have evolved from simple to complex, then we will assume that cyanobacteria came to have their present appearance well before they were capable of generating oxygen and NADPH since they are practically the earliest fossils we possess. So the simple-to-complex paradigm moves us to assume that respiring forms came far later than early photosynthetic forms even though geologic evidence for early oxygen accumulation begins at about
the same time as unequivocal evidence for the first cyanobacterial cells.
But for a moment, let's stop trying to derive one form from another. Let's turn our attention away from when these early forms began life and ask what a Designer might have had in mind for them. A truly fascinating functional divide in nature is-observed. It is as though a Designer determined that one set of organisms—autotrophic bacteria and plants—would specialize in both energy capture and energy utilization. With their broad enzymatic capabilities, these "servant organisms" would be supremely adept in the whole business of energy handling, generating far more C–H bond energy than they would ever utilize (see Figure 6.32). Then, a whole range of heterotrophs from minimal microbes to the magnificence of man could,
cyanobacteria—prokaryotic cells, often colonial forms, that use chlorophyll to carry out photosynthesis with oxygen as a by-product; blue-green algae.
Figure 6.32 Independence and Dependence. Two highly sophisticated species each supremely adapted to its own role in nature. One is highly efficient at generating excessive amounts of stable chemical energy. The other simply utilizes that excess energy to work and to worship.
with a much simpler energy metabolism, fill either humbler or more exalted roles in the biosphere with stable carbohydrate energy always available
to support them. The one organism that we know has the ability to be proud is, upon study, given the knowledge that it he totally dependent on organisms that are completely independent of him. How fitting.
Each life-form, whether respiring, fermenting or photosynthesizing, complements every other life-form in nature. Each living thing supplies the global carbon cycle with precisely the molecules needed to render each other life-form a dynamic part of the biosphere. Powerful solar energy drives this wonderfully integrated machinery of life! How on earth could such a wondrous set of relationships originate? What would a biologist who knows St. Paul's writings answer to a question like that? There is only one answer—found in Romans 11:
"Oh the depths of the riches of the wisdom
and knowledge of God....
How unsearchable are His judgments
and His (metabolic) pathways beyond tracing out!"
IN OTHER WORDS
1. Photosynthesis uses solar energy and chlorophyll to convert energy-poor water and carbon dioxide to energy-rich carbohydrate with the evolution of free oxygen.
2. Respiration uses energy-rich carbohydrates to build up ATP resources, returning energy-poor water and carbon dioxide to the carbon cycle for photosynthesis to operate on again.
3. Evolutionary theorists believe that electron transport systems were the earliest elements of both respiratory and photosynthetic machinery.
4. The earliest fossil forms are similar to modern cyanobacteria that currently do both photosynthesis and respiration; they are some of the most metabolically capable cells that exist.
5. The contrast between heterotrophic and autotrophic life-forms appears to be one of the most basic distinctions in the mind of the Designer.
6. The man with the greatest faith attributes the wisdom inherent in the carbon cycle to environmental selective forces he is entirely unable to rigorously quantitate.
QUESTIONS FOR REVIEW
1. List some specific examples (from previous chapters if necessary) where movement occurs within a living cell.
2. State the two laws that govern the behavior of energy in living things.
3. Solar energy enters life-forms and most of it is lost as heat energy. How would you describe
where the useful energy is retained within living systems?
4. Bonding two amino acids together while making a protein is an endergonic process. What does this term tell you about the process?
5. Why does glucose accumulate in grape cells but get used up in muscle cells?
6. Glucose can be degraded to energy-poor carbon 17. dioxide and water using either enzymes or a match. If the cell could withstand high temperatures, why would the enzyme approach still be 18. more useful to the cell?
7. What is the purpose of a metabolic pathway? Why must individual chemical reactions be linked together in such pathways?
8. If a product at the end of a pathway accumulates 19. to a high concentration, what effect will that have on the reaction generating the product?
9. How many binding sites does an allosteric enzyme have? What are their functions? 20.
10. Why are you perpetually breathing out carbon dioxide? Where does it originate? 21.
11. Write out a summary equation (reaction) for the whole process of aerobic respiration.
12. In what form does energy emerge from glycolysis? 22.
13. What is the connecting link between the Krebs cycle and the electron transfer compounds?
14. Once protons have been pumped across the inner mitochondrial membrane, what would 23. cause them to tend to flow back to the interior? What would keep them from doing so? What enables them to do so?
15. If respiration is so much more efficient than fermentation at deriving ATP energy from glucose, why does fermentation exist at all? 24.
16. List the reactants and products of the light-dependent pathway of photosynthesis; then do the same for the light-independent pathway.
Of what value are accessory pigments if chlorophyll molecules can themselves absorb photo energy and excite electrons with it? Draw a slice through a chloroplast showing its interior structure. Label the following terms: thylakoid, stroma, photosystem, ATPase, site of light-dependent reaction, and site of light-independent reaction.
Explain in your own words why you and I cannot simply absorb, digest, and utilize ATP generated by the light-dependent reaction of photosynthesis.
Why is the light-independent reaction pathway so named?
How many times must the light-independent cycle of reactions turn to generate one molecule of glucose? Why?
Why would a thylakoid sometimes use just one photosystem and generate only ATP when the electrons involved could simply go on, given sunlight, to generate more NADPH as well?
Draw your own diagram of the carbon cycle using figures from this chapter and the following terms: carbon dioxide, glucose, water, oxygen, mitochondrion, chloroplast, autotrophs, heterotrophs, atmosphere, dissolved carbon dioxide, and fermentation.
Metabolically, which of the following organisms is most independent of any other organism: man, cats, heterotrophic bacteria, eagles, cyanobacteria, or mushrooms? Explain why.
QUESTIONS FOR THOUGHT
1. Consider a membrane within a cell where ions are being moved from one side of the membrane to the other (where they are already in higher concentration). Why would this require more energy than doing the same thing with glucose molecules?
2. Besides the water circulated by a water pump, what other critical substance in an automobile engine reminds us that most of combustion's energy ends up as heat?
3. Large "No Smoking" signs are found on gasoline pumps everywhere. Use the term activation energy to explain why.
4. In terms of atoms, electrons, and covalent bonds, explain how an enzyme's active site lowers a reaction's activation energy.
5. What is the advantage to a cell to have a metabolic pathway that is subject to feedback inhibition?
6. Why do we say that ATP is an energy-rich molecule when energy is actually required to break any covalent bond, including the phosphate bond of the ATP molecule?
7. Is respiration one metabolic pathway or is it three pathways? Explain your choice.
8. The process that causes bread to rise (found within the yeast Saccharomyces) is exactly the same fermentation pathway used to make wine. Why don't we get drunk eating bread?
9. Use an Internet search engine to answer these questions: How can some autotrophs make energy-rich molecules deep in the ocean depths
where no solar energy exists at all? What is their energy source? Hint: They are called chemoautotrophs. Land plants are photoautotrophs.
10. If you believe in evolution, which of the following systems would have evolved first: respiratory pathways, photosynthetic pathways, or proton pumping? Why?
GLOSSARY
accessory pigments—organic compounds such as carotenoids that absorb wavelengths of light not readily absorbed by chlorophyll; they transfer the energy of that absorption to nearby chlorophyll molecules, enhancing their excitation of electrons.
acetyl-CoA—a two-carbon fragment resulting from degradation of pyruvate; the fragment is attached to a large cofactor molecule that transfers the acetyl fragment onto a reactant in the Krebs cycle.
activation energy—an amount of energy necessary to break bonds in a reactant thus getting a chemical reaction started.
active site—a precise three-dimensional space within the structure of an enzyme where a specific reactant or reactants selectively bind and are there converted to a product or products.
aerobic respiration—a metabolic pathway in which energy-rich molecules are degraded chemically with the generation of phosphate bond energy in ATP molecules; electrons from the energy-rich initial reactant end up combining with oxygen to form water.
allosteric site—a three-dimensional groove, pocket, or surface on or within an enzyme molecule; when a specifically shaped regulatory substance binds the site, the enzyme's active site is altered structurally.
anaerobic—any environment or process in which oxygen is absent.
ATP (adenosine triphosphate)—the major energy-storage compound in most cells; energy is given off following the breaking of a covalent bond between the second and third phosphate groups.
ATP synthase—a protein within the mitochondrial membrane; it relieves a proton gradient by allowing protons to flow back across the membrane. It uses
the resulting energy production to phosphorylate ADP making energy-rich ATP molecules.
autotroph—any organism capable of taking in carbon dioxide gas from nature and using it to generate energy-rich carbohydrates.
biosynthesis—the building up of biomolecules or biological structures within a living cell; a process that requires energy.
calorie—the amount of energy required to raise the temperature of 1 gram of water by 1°C.
carbon cycle—the circulation of carbon within the biosphere, sometimes as carbon dioxide, and at other times within organic molecules such as glucose; photosynthesis and respiration are central processes in this circulation.
chemical reaction—a process in which bonds are broken in one kind of molecule (the reactant) and new bonds are formed to produce a product; energy change accompanies any chemical reaction.
chlorophyll—a green pigment biomolecule capable of absorbing solar photons and using the resultant energy to break and form covalent bonds.
cyanobacteria—prokaryotic cells, often colonial forms, that use chlorophyll to carry out photosyn‑ thesis with oxygen as a by-product; blue-green algae.
electrical potential—a difference in charge across a membrane based on a difference in the concentration of positive and/or negative ions across the membrane.
electromagnetic spectrum—the entire range of radiation extending in frequency from approximately 10213 centimeters to infinity and including cosmic-ray photons, gamma rays, X-rays, ultraviolet radiation, visible light, infrared radiation, microwaves, and radio waves.
endergonic—descriptive of a chemical reaction in which free energy must be added in order to get the reaction to take place.
energy—the capacity to do work; the capacity to make changes of importance to a living thing.
energy of concentration—the work of moving molecules or ions against a concentration gradient, that is, moving them from where they are less concentrated to where they are already more concentrated.
enzyme—a type of protein molecule that serves as an organic catalyst in solution. It reproducibly converts one specific sort of molecule into another—a specific reactant into its product.
ethanol—a two-carbon alcohol formed when electrons on NADH are transferred to a molecule of acetaldehyde; beverage alcohol.
exergonic—descriptive of a chemical reaction in which free energy is given off; a spontaneous reaction.
FADH2 (flavin adenine dinucleotide)—a biomolecule that accepts electrons from reactants in the Krebs cycle and transports them in solution to an electron transfer system. The system accepts the electrons and uses them to generate ATP for the cell.
feedback inhibition—a form of rate regulation in metabolic pathways in which the product of some late reaction in the pathway controls the rate of catalysis by an enzyme earlier in the pathway.
fermentation—a short metabolic pathway in which electrons transferred to NADH carrier molecules are finally accepted, not by oxygen but by some organic molecule.
glycolysis—the initial degradation of glucose molecules to pyruvate molecules with the generation of two molecules of ATP per molecule of glucose processed.
Krebs cycle—a metabolic pathway in which acetyl groups are stripped of energetic electrons and degraded to carbon dioxide; an integral part of aerobic respiration.
Life Is Energy Driven—one of 12 principles of life on which this book is based.
light-dependent pathway—a sequence of reactions within photosynthesis that utilize light energy to generate ATP molecules and to transfer electrons to NADP generating NADPH.
light-independent pathway—a cyclical sequence of reactions within photosynthesis that utilize ATP bond energy and electrons from NADPH to generate energy-rich carbohydrates.
metabolic pathway—a series of chemical reactions in a sequence in which the product of one reaction is the reactant of the next reaction.
millivolt—a unit of electrical potential energy equal to 1/1000 of a volt.
NADH (nicotinamide adenine dinucleotide)—a bio‑
molecule that accepts electrons from reactants in glycolysis and the Krebs cycle and transports them in solution to an electron transfer system. The system accepts the electrons and uses them to generate ATP for the cell.
photosynthesis—a metabolic pathway in which light energy is used to generate carbohydrates from carbon dioxide gas and water.
photosystem—a membrane-bound collection of chlorophylls and accessory pigments that harvest light energy and make it available to the light-dependent pathway of photosynthesis.
pigment molecules—organic compounds that absorb and reflect wavelengths of light selectively such that they appear to the human eye to have a particular color.
product—a substance that is formed during a chemical reaction.
pyruvate—a three-carbon carbohydrate product of glycolysis whose continued degradation generates two-carbon fragments that serve as reactants in the Krebs cycle.
quinone—a class of yellow compounds found in thylakoid membranes; they accept electrons from chlorophyll molecules.
reactant—an initial substance that absorbs energy and enters into a chemical reaction in which it is changed in structure.
ribulose 1,5-bisphosphate—a twice-phosphorylated five-carbon sugar that combines with carbon dioxide in the light-independent reaction of photosynthesis to form two 3-carbon sugars.
starch—a polymer of glucose molecules; used as a storage form of energy in plant tissues.
stomata—regulated openings on the undersurfaces of leaves that control the influx of carbon dioxide and efflux of water from internal leaf tissues.
stroma—a syrupy fluid within chloroplasts that surrounds the stacks of thylakoids; the enzymes of the light-independent reaction are found in the stroma.
sucrose—a disaccharide sugar composed of the monomers glucose and fructose; the sugar used for transporting energy throughout the tissues of a plant.
thylakoid—a membrane-enclosed sac within a chloroplast inside of which are the enzymes, pigments, and electron transfer compounds of the light-dependent reactions of photosynthesis.
Information and Its
Expression in the Cell
|
|
|
Let's revisit Ely Cathedral in Cambridgeshire, England. In Chapter 6 we observed its grandeur and perhaps choked a bit considering the amount of energy required to build it. Today we walk the nave eastward to the great octagon and look straight up. Directly above us-142 feet up—is a massive 400-ton work of wood, lead, glass and glory called the lantern. A photograph of it appears on the next page. Sunlight descending through this artistry reveals symmetry in size, shape, and color, all carefully set into the beautiful fan-vaulting of a graceful octagonal ceiling. We are again seeing enormous energy expenditure over decades of years and lives. But a second realization intrudes. We are not seeing the random energy of violent explosion. Rather, the lantern is energy harnessed into myriads of measured activities. We are seeing the results of information expressed. Many hours were spent drawing, designing, and scaling the lantern before construction began. And in construction, information guided the use of tools, the procurement and fashioning of materials, and the movement of component parts into place. The lantern is a triumph of energy-driven information expression.
As is the cell. Imagine climbing into the ocular lens of a microscope focused on the glorious Micrasterias cell also in the illustration on the next page. Were we to become the size of a plant protein—perhaps 70 nanometers in height—we could wander up to the surface of this single-celled algal "cathedral" and be amazed at symmetrical
Circular symmetry pleases the eye. But the architectural masterpiece above is afterthought. It replaces a ceiling once collapsed. In the cellular masterpiece above, symmetry is intricately related to all major elements of cellular function.
patterns in the sculpting and ornamentation of its walls. Instead of saints, these walls are festooned with highly strategic combinations of membrane-bound proteins that regulate the internal biochemical milieu of the cell (see Figure 7.1). Wandering inside we would note the elaborate shaping of its two large chloroplasts, the distribution of its starch-containing bodies, and the precise centrality of its nucleus. Micrasterias, and a thousand million other types of cells in our biosphere, are a triumph of (energy-driven) information expression. Life Is Information Expressed.
starch granules
|
chloroplast |
cell wall |
|
|
|
0
In terms of sheer brilliance, however, Micrasterias has the cathedral lantern entirely trumped. The lantern required the design and efforts of hundreds of human minds. And it happened once. Micrasterias, by contrast, builds itself! And it does so again and again, every day, in countless ponds and bogs the world over! But cells are not only the expression of information cobbled together somewhere in the past. They actually store the information they express within their own structure! They access this information and express it themselves
0
Figure 7.1 Information Expressed. (a) Externally, a wide variety of precisely crafted proteins float two-dimensionally in this phospholipid bilayer"sea" controlling which substances will enter and exit the cell. (b) Internally, organelles are optimally shaped to carry out their roles within the cell.
according to a construction schedule that is also stored within their structure! (Excuse all our exclamation marks!)
Now, there are some nonliving things that can do this. Computers store and express internal information and can do so on schedule (see Figure 7.2). Computers and cells excel at this because they are designed things. But cells are uniquely facile here because the information they select and express is useful not only for themselves but for the organisms and biosphere they are a part of! We are bringing small minds to a very big picture here. . . . Where shall we begin?
In this chapter we'll look first at the physical nature of the information itself. We will then consider how it is stored and how it is expressed. Finally, we will consider how we can manipulate this process using recombinant DNA technology. The cell's ability to both possess and express information at the molecular level is amazing. It's like having both a huge library (possession) and a gifted scholar (expression) all in one micrometer-sized package.
Form of
System Information Storage
Architecture Numbers, lines Blueprints
Algal cell DNA bases Chromosomes
Computer Bytes Hard drive
University Words Books
Figure 7.2 Examples of Information Expression. Why does cellular activity fit so neatly into a chart of otherwise human activities?
IN OTHER WORDS
1. Cathedrals and cells both require information for their construction.
2. Information is expressed in cellular structure on the exterior of and within the cell.
3. In cells, this information is stored and expressed from within the cell itself.
4. Information expression in the cell is carefully sequenced and timed.
Biological Information Is Stored in the Base Sequence of DNA
What is biological information? If it's stored inside the cell itself, it must have some physical basis in reality. What substance, what biomolecule is it associated with? Back in 1869, a Swiss physician-biochemist named Friedrich Miescher was collecting samples of human white blood cells (leucocytes) taken from the pus of discarded bandages from a hospital near Tubingen, Germany (see Figure 7.3). Using a variety of salts and precipitation techniques he was able to isolate a chemically novel sort of biomolecule containing phosphorus
Figure 7.3 Friederick Miescher. While studying at the University ofTlibingen, Germany he isolated a crude fraction from the nuclei of pus cells that he named nuclein. It was later shown to be DNA.
and nitrogen but not sulfur (as is found in protein fractions). Since his new fraction was derived from the nuclei of the cells, he called it nuclein. He and his students continued their study of this fascinating substance until his death from tuberculosis at the age of 51. As is typical in scientific study, they had no idea at the time that the major component of nuclein would later be named deoxyribonucleic acid (DNA) and would in time be found to be the informational molecule of life.
If bandage refuse was an odd sort of raw material for discovering the secret of life, understanding DNA's importance began within the highly specialized world of bacterial pathology. Fred Griffith, a British microbiologist working in the Ministry of Health, made a seminal discovery (see Figure 7.4). His experimental system was two strains of bacteria of the genus Diplococcus. One strain (rough) was not virulent. Injecting it into a mouse simply stimulated the mouse's immune system to destroy it. A smooth (encapsulated and highly virulent) strain of the same bacterium, upon injection, quickly killed his mice. Griffith discovered that he could transform his nonvirulent rough strains to virulence by killing his virulent strain with heat and then incubating his nonvirulent cells with the remains of the heat-killed virulent strain. These transformed bacteria now gave rise to virulent bacteria. Whatever they had absorbed from the remains of the dead virulent cells was now hereditary! You could kill
|
phosphorus—an element in nature widely distributed in nucleic acids but seldom found in newly synthesized proteins. sulfur—an element in nature widely distributed in proteins (because of its presence in the amino acids cystine and cysteine) but never found in nucleic acids like DNA or RNA. fraction—a single portion of a biological sample that is being separated into many such portions as part of a purification process. virulent—possessing a highly increased ability to cause disease. transform to change a hereditary characteristic of an organism by introducing new DNA into its genome. |
|
CO Mice injected with live cells of harmless strain R do not die. Live R cells are in their blood. |
Mice injected with live cells of killer strain S die. Live S cells are in their blood. |
Mice injected with heat-killed S cells do not die. No live S cells are in their blood. |
Mice injected with live R cells plus heat-killed S cells die. Live S cells are in their blood. |
Figure 7.4 Transformation in Mice. (a) A non-virulent strain of the diplococcus bacterium injected into mice grows briefly but is soon eliminated by the mouse's immune system. (b) Very small numbers of the virulent strains of the bacterium when injected, multiply rapidly and kill the mouse. (c) Heat-killing the virulent strain renders it non-virulent; when injected, the mouse survives. (d) If a mixture of heat-killed virulent cells and living non-virulent cells is injected into a mouse, the mouse dies, it's blood filled with virulent bacteria.
these virulent offspring and use them to transform still other nonvirulent bacteria of the same genus to virulence.
What was it that the nonvirulent strains were absorbing from the denatured remains of virulent cells? Oswald Avery at the Rockefeller Institute
gene—a segment of (usually) DNA that controls a single characteristic or trait of an organism.
DNase—an enzyme that catalyzes the breakdown of DNA either into smaller segments of DNA or completely down to its nucleotide subunits.
in New York was determined to find out. By the 1940s, a variety of degradative (digestive) enzymes were available in purified forms. One enzyme would degrade proteins. A different enzyme would degrade DNA. Still another degraded RNA. These enzymatic reactions, as you may recall, are highly specific for the class of molecules they degrade. Most biologists of the time believed that the hereditary material—the genes—would prove to be proteins, the biomolecules that were already known to have considerable complexity. To everyone's surprise, the highly purified "transforming factor" taken from virulent cells lost its transforming ability when incubated with the enzyme pancreatic DNase (see Figure 7.5)! The transforming factor
Figure 7.5 DNA theTransforming Principle. The
transforming principle detected in part d) of Figure 7.4, could be destroyed by incubating it with the degradative enzyme Dnase before injecting it into a mouse. Protease or Rnase incubation leaves the transforming factor intact, killing the mice.
survived incubation with proteinase and RNase enzymes. The transforming factor had to be—DNA! DNA from the heat-killed virulent cells had got into the nonvirulent cells and supplemented their hereditary information—their genes—with genes for virulence! By the early 1950s, Dr. Avery at the Rockefeller Institute and Dr. Alfred Hershey, with his viral inheritance studies at Cold Spring Harbor Laboratories (see Figure 7.6), were convincing the scientific community that the nucleic acid DNA was indeed the hereditary material. It was an exciting time to be studying biology—and the power of being able to now focus attention on the nature and behavior of this one molecule has
sustained that excitement in biology right up to the present day!
Biologists' thinking is not bound by their data. They like to speculate beyond it like anyone else. Some scientists were anticipating that DNA might
proteinase—an enzyme that catalyzes the breakdown of protein either into smaller segments of peptides or completely down to its amino acid subunits.
RNase—an enzyme that catalyzes the breakdown of RNA either into smaller segments of RNA or completely down to its nucleotide subunits.
The Hershey and Chase Experiment Demonstrating That DNA Is the Hereditary Molecule Question: Is DNA or protein the genetic material?
Experiment: Hershey and Chase performed a definitive experiment to show whether DNA
or protein is the genetic material. They used the phage T2 virus for their experiment; it consists only of DNA and protein.
1. Infect bacterial cells with viruses in the presence of nutrients containing either radioactive phosphorus
or radioactive sulfur. Phosphorus goes only into DNA. Sulfur goes only into protein.
4. Harvest radioactive viruses and reinfect new cells with them.
3. Once infection is begun, 4. Search in offspring
knock virus particles from viruses for radioactivity.
cell surface using a blender.
Note where radioactivitiy is
found.
Result: No radioactivity Result: No radioactivity in
within cell; 35S in phage coat
Result: 32 P within cell; not Result: 32 P in progeny phages in phage coat
Conclusion: DNA is the molecule that enters the bacterial cell and directs formation of new virus particles.
Figure 7.6 Hershey-Chase Experiment. Is life's informational molecule protein or is it DNA? Information is needed in order for a bacterial cell to construct new viruses from the virus that first infects it. But the T2 bacterial virus consists of only protein and DNA. And it is possible to radioactively label either DNA or protein and then follow the radioactivity during the viral infection.
Figure 7.7 Chargaff's Data Summarized.
turn out to be the informational molecule and had worked to isolate it from cells, purify it and study its properties. At Columbia University in the late 1940's Erwin Chargaff used chromatography techniques (see Section 3.1) to separate the different kinds of nucleotides out of degraded segments of DNA molecules. He was able to show that the four component nucleotides of DNA (adenine, guanine, cytosine, and thymine) were all present but not in equal amounts. The amounts varied from species to species (which would have made sense if DNA were informational). But oddly enough, the amount of the base adenine in any sample was also equal to the amount of thymine, and the amount of cytosine was always equal to the amount of guanine (see Figure 7.7). What could that mean for the structure of DNA?
Scientists had assumed that if DNA were informational in nature, it would have to be some sort of long polymer, and several of them, for example, Francis Crick and James Watson at the Cavendish Labs in Cambridge University, were building speculative models of possible structures. Helical structures were being found in protein molecules. Could DNA be helical? Hard data were needed to help constrain the variations in their models. This was to be supplied by still other workers who had begun to study the structure of DNA using a technique called X-ray crystallography. This process involves firing powerful X-rays at highly purified samples of a protein or nucleic acid and seeing the pattern of rays that get through the structure of the molecule in order to strike photographic film (see Figure 7.8). Some of the best X-ray data were obtained by Rosalind Franklin working at King's College in London. The patterns on the film suggested to her that DNA polymers were in fact helical in nature and that DNA might be double-stranded. She even derived estimates of dimensions for the width of the helix and distance between nucleotides. Dr. Franklin was quite devoted to her work and understandably secretive in regard to her own carefully derived data. On a visit to the crystallography labs in London, Watson was secretly shown her latest data in her absence. It included the famous photograph seen in Figure 7.8. Because he'd spent
X-ray crystallography—a physical technique in which a purified sample of protein or nucleic acid is exposed to high-powered electromagnetic radiation to determine its molecular structure.
0 Rosalind Franklin Q X-ray diffraction analysis of DNA Franklin's DNA diffraction pattern
Figure 7.8 X-Ray Diffraction Studies on DNA Fibers. (a) Rosalind Franklin (b) X-rays are focused on fibers of highly purified DNA. The DNA molecule diffracts the rays in a pattern based on DNA's structure. The X-rays diffracted by the DNA generate patterns on photographic film as seen to the right.
time building models with Crick, Watson quickly saw that Rosalind had the answer to his questions. Within weeks Watson and Crick submitted their now-famous paper to the journal Nature outlining the now generally accepted model for the structure of DNA. A very hard-working lady had supplied the critical data, and two highly intelligent model-builders were given most of the credit for the discovery. Sometimes science works like that.
DNA is a double helix consisting of two intertwined polymers of nucleotides (see Figure 7.9) that is incredibly long. The DNA in just one of your cells would approximate 2 meters—the size of a coffee table—in length! (We had better discuss below how it's folded, had we not!) Within each chain of nucleotides, sugars and phosphates alternate in supporting the strand structurally. One strand is structurally upside down compared with the orientation of the other. The nitrogen-containing bases point inwardly. The two chains are held together by multiple weak hydrogen bonds between these long sequences of bases. The pairing of the bases between the two strands is quite specific. On the first strand, wherever an adenine is present, a thymine will be opposite it on the other strand. Cytosine is always found opposite guanine. These pairing rules, A with T and G with C, form the basis for Chargaff's observations about equality of amount between the bases adenine and thymine on the one hand and between cytosine and guanine on the other. But more than that, these pairing rules mean that the base sequence in one strand determines the sequence of bases in the other strand. The one sequence will always be complementary to the other. Consider the diagram that follows. If the sequence along one helix is TGAGGACTCCTCTT, then, by the base-pairing rule, the sequence on the opposite strand must be ACTCCTGAGGAGAA.
one base -
pair
This was exciting. The hypothetical genes that plant and animal breeders had studied for years
complementary—in nucleic acids, describes the appropriately sized nucleotide bases from opposite strands of a double-stranded DNA (adenine with thymine, guanine with cytosine) that pair via hydrogen bonds, thereby holding the double-stranded nucleic acid together.
Figure 7.9 The Structure of DNA. A single monomer of DNA—a nucleotide—consists of a single 5-carbon sugar, an attached phosphate, and a nitrogenous base (pointing inward). Nucleotide sugars and phosphates linked together form the backbone of each of the two chains. Notice carefully the way the sugars and phosphates are drawn—the one chain is upside‑
down orantiparallel" to the other. At the top of the diagram, individual atoms are represented by space-filling spheres.
now had an actual physical basis in reality. A gene is really a sequence of bases along one strand of a DNA molecule. It was something that in principle could eventually be isolated, studied, and even manipulated (see Section 6.5)! Yes, there were only four different kinds of bases, but the sequences of them could be thousands of bases in length. How many different words could you write given just two vowels, two consonants, and the freedom to use them in sequences up to 3000 letters in length?
And because there are two strands instead of one, Watson and Crick were able to predict how this molecule could be replicated to make identical copies of information for daughter cells. If the two strands are unwound, and new strands built against each parent strand (using the base pairing rule), then the two daughter copies of the double helix would be identical to each other and to the parent double helix (see Figure 7.10). How elegant is that! We'll say more about this replication process in Chapter 8.
Complementary base pairing in the DNA double helix: A pairs with T, G pairs with C.
The two chains unwind and separate.
Each "old" strand is a template for the
addition of bases
according to the
base-pairing rules.
The result is two DNA helices that are exact copies of the parental DNA molecule with one "old" strand and one "new" strand.
Figure 7.10 DNA Replication. The double helix modelled by Watson and Crick is shown in gray. If the helices are unwound, and new nucleotides (in red) are built into new strands following the base pairing rule, two DNA double helices will be generated, each of which has the same precise base sequence at the"parental" gray strands.
IN OTHER WORDS
1. In the late 1860s, Friederich Miescher discovered DNA in leucocyte nuclei from bandages and named it nuclein.
2. Fred Griffith began to isolate DNA based on its ability to permanently transform nonpathogenic cells to pathogenic ones in mice.
3. Oswald Avery began to identify Griffith's transforming substance as DNA by discovering which classes of enzymes would degrade and deactivate it.
4. Erwin Chargaff contributed to our understanding of DNA's structure by studying the relative amounts of each nitrogenous base that were present in his DNA samples.
5. Watson and Crick contributed to our understanding of DNA's structure by building models of what DNA might look like based on information available to them.
6. Rosalind Franklin used X-ray crystallography to infer the secondary structure of DNA: a double helical molecule.
7. Each helical strand of a DNA molecule consists of a "backbone" of sugars and phosphates of adjacent nucleotide subunits, with the base of each nucleotide subunit projecting toward the interior of the double helix.
8. The nitrogenous bases at each position within the double helix are complementary to each other in size and structure. Adenine is always found opposite thymine, and guanine is always found opposite cytosine.
9. Complementarity of base pairing between the two strands makes possible replication of the DNA double helix by simply unwinding the existing strands and building new strands against each original one using the complementarity rule.
Biological Information Is Stored in Chromosomes
The mid to late 1800s in the German universities were highly productive years for biological theory and advances in the understanding of cells in particular. The biologists Ernst Haeckel, August
Weismann, and Theodor Boveri were discovering that the nucleus of the cell was the location of its hereditary instructions (see Figure 7.11). This made good sense, structurally. By sequestering the information in an internal nucleus, it is kept unharmed from many other separate chemical processes that result from the expression of it.
1820 1850 1900 1950
/
1833 1860's 1869 1880 1902 1940's 1952 1970's
|
Brown observes and names |
Haeckel Weismann Boveri: |
Miescher discovers DNA |
Flemming stains, discovers |
Boveri, Sutton argue that |
Avery and Hershey argue that |
Franklin, Watson and Crick |
Dupraw generates electron |
|
cell nucleus |
nucleus is |
("nuclein") |
and names |
chromosomes |
DNA in |
determine |
micrographs |
|
|
locus of |
|
chromatin |
are east of |
chromosomes |
DNA's |
of |
|
|
information |
|
|
cellular information |
is informational |
structure |
chromosomes |
Figure 7.11 Human Understanding of Information Storage
Figure 7.12 Coiling DNA into a Chromosome. In order to
prepare DNA for distribution to a daughter cell, the DNA double helix is wound first around a
collection of protein core particles
(shown in green here) called centromere nucleosomes. These"beads on a
string"are further coiled to form a unit chromatin fiber, which is super-coiled still further to form the visible strands in the arm of a chromosome as seen under
the electron microscope. Other structural proteins are used to maintain the integrity of these higher order fibers.
Staining cells improved their visibility under a microscope and revealed newly observable structures. Walther Flemming, another German biologist, first observed very thin darkly staining material within nondividing cell nuclei that he termed chromatin. As the nucleus progressed toward cell division, it would lose its membrane boundary, and its chromatin appeared to condense into much smaller darkly staining bodies called simply chromosomes (Gk. chromos = color; Gk. soma = body; see Figure 7.12). It soon became apparent that the cells of each species of organism studied had its own characteristic number and size of chromosomes. Working with sea urchin embryos, Theodor Boveri was able to show that a complete set of these chromosomes must be present in each embryo in order to support the normal development of the organism. In 1902, together with Walter Sutton in the United States, he advanced the theory that the chromosomes carry the information of the nucleus into daughter cells (see Figure 7.11). This process will be examined more closely in Chapter 8.
Meantime, as noted above, Miescher had isolated his nuclein from the nuclei of leucocytes. Workers such as Flemming at the University of Kiel,
|
chromatin—fibers within the cell nucleus consisting of DNA periodically stabilized by being wrapped around protein spheres called nucleosomes. chromosome a highly coiled and organized arrangement of a single DNA molecule within the nucleus of a cell; used to transport DNA to a daughter nucleus. |
Edmund B. Wilson at Columbia University, and others, began to suggest that this nuclein was associated with the chromatin strands Flemming had first seen and named. Working in the later decades of the twentieth century, scientists eventually determined that in the cells of higher organisms, a chromosome is a single long, although compacted, DNA double helix, intricately arranged around and within several levels of protein scaffolding (see Figure 7.12).
The first level of folding involves stabilizing the structure and orientation of the DNA double helix by wrapping it around perfectly sized spherical conglomerations of proteins called nucleosomes. Electron microscope pictures of DNA coiled around these protein stabilizers look like beads on a string. This is the form that DNA takes in the relatively diffuse and decondensed chromatin found in the cell's nucleus during cell growth. When it is time to distribute copies of DNA to daughter cells, the nucleosomes are then precisely packaged into a higher-order fiber, which is then coiled to make a still higher-order string that becomes the visible fiber of which a chromosome is composed. One of your cells has 46 of these chromosomes.
In prokaryotic (bacterial) cells, chromosomal organization has both differences and similarities to that of higher cells like our own. As discussed previously, bacterial cells have no membrane-bound nucleus. Their DNA aggregates near the center of the cell in a region called the nucleoid. For many bacteria, the nucleoid contains a single long chromosome that takes the form of a closed circle rather than a linear structure as in eukaryotic chromosomes. These circular chromosomes lack the nucleosome structure that forms the most basic level of chromosome compaction (coiling) in eukaryotes. But bacterial chromosomes do possess the higher-order coiling of DNA seen in eukaryotic chromosomes so that, again, lots of information can be packaged into minimal space (see Figure 7.13). The humble
Bacterial Information Storage Anchoring protein
Figure 7.13 Coiling DNA in a Bacterial Cell. In order to compact long sequences of DNA into small spaces, the double helix is coiled up and stabilized in that state by DNA-binding proteins. The entire nucleoid region is stabilized by proteins that anchor the cell's genome to the membrane of
the cell. DNA-binding protein location is not random within the genome but respects regions of information called domains that are expressed at given times for different purposes.
gut bacterium E. coli is cylindrical and is typically about 0.65 microns wide and 1.7 microns long. Yet its one circular DNA chromosome measures about 1300 microns in length. So if we were to squash that circular chromosome flat, its length would be several hundred times the length of the cell it's in! The fact that this chromosome can be easily unraveled for access to information or tightly coiled again for distribution purposes is a powerful testimony to two things: (1) the DNA of the chromosome is extraordinarily thin (only 0.0025 microns thick), and (2) the aggregation and coiling of the bacterial DNA within the nucleoid must follow a brilliant organizational scheme—though we've yet to unravel that scheme.
nucleosome—a structural repeat unit within chromatin in which 147 base pairs of DNA are wrapped around a spherical protein core for purposes of stability and protection.
micron (or micrometer)—is 1/1000 of a millimeter; the millimeter is the smallest division visible on a metric ruler.
IN OTHER WORDS
1. German scientists in the late 1800s discovered the nucleus, and in particular, chromatin, to be the locus of the hereditary instructions in a cell.
2. Theodor Boveri determined that a complete set of chromosomes was necessary for a sea urchin embryo to develop normally.
3. In eukaryotic chromosomes, DNA is highly coiled in at least two separate levels of complexity and stabilized in these super-coils by nucleosomes and other DNA-binding proteins.
4. Prokaryotic (bacterial) cells also have super-coiled DNA, and proteins are used to stabilize these higher-order fibers.
THE EXPRESSION OF BOO _OGDCA DNFORMA DON
A Context for Understanding Gene Expression
Suppose you live near Philadelphia, Pennsylvania, and need to travel to your sister's home just south of Atlanta, Georgia. What is the fastest route from your home to hers? You drive to the store (by the fastest route) and purchase a global positioning system—a GPS device. Entering two home addresses into its program soon gives you the precise route you need. The next morning the trip begins. The expression of biological information is similar to this process. Just as the GPS stores all the information you could need for any trip, the chromosomes store all the information a cell could need to become any sort of cell in the body. That collection of information—DNA base sequences, or genes—is called the cell's genotype (see Figure 7.14). In the production of an organism, cells divide many times. Each daughter cell needs to get from its initial undifferentiated state to a highly differentiated,
Genotype Phenotype
Normal hemoglobin gene
DNA I X
Mutant
hemoglobin
gene Clumped
hemoglobin
molecules "Sickle cell"
"Information Expressed"
Figure 7.14 Information Expression. The genes that code for the oxygen-transporting protein hemoglobin represent it's genotype. The expression of the genes within a red blood cell—the hemoglobin molecule—is it's phenotype. Mistakes in the base sequence of the DNA-based genotype lead to alterations in the phenotype, such as the clumping of hemoglobin
molecules within the cell. The red cell in the lower panel is from an individual with the disease sickle cell anemia.
ordered state that we can call a bone cell or brain cell or blood cell. This developmental sequence of the expression of particular genes is like the sequence of roads the GPS directs you to drive on to get you to Atlanta. The result of following the GPS is a successful trip to Atlanta. The result of expressing a specific set of genes in a defined sequence is what we call a phenotype—the characteristics that make up the bone cell or brain cell.
But what is the phenotype actually composed of? Yes, a blood cell appears red; a muscle cell appears spindle-shaped. What controls these features? Over half of the biomass of the cell is protein. And the nonprotein parts of the cell—like vast amounts of phospholipids that comprise membranes—are built by enzymatically controlled reactions. And enzymes are proteins. So to control the proteins of a cell is to control the cell! And that is what the genotype of the cell does. It controls the phenotype by retaining the information for all of the proteins the cell employs. Proteins are built from sequences of amino acids. So somehow, according to a code we will examine later, the sequence of bases in the DNA—the genotype—controls or specifies the sequence of amino acids in the cell's proteins: its phenotype.
Consider red blood cells. The red color results from the reflection of light off of molecules of the protein hemoglobin. In the nucleus of the maturing red blood cell, there are two genes that code for the sequences of the two different kinds of polypeptide subunits in the hemoglobin protein of adults. The cell's machinery "reads" the DNA base sequence of each gene and sends messages
genotype—the genetic makeup of—the informational specifications for an organism.
phenotype—the physical appearance of an organism resulting from the expression of the organism's genotype.
hemoglobin—a protein with a quaternary level of structure consisting of four polypeptide chains, 2 a chains, and 2 p chains. It transports oxygen from the lungs to the tissues.
Figure 7.15 The Central Dogma. The flow of information in (a) a prokaryotic (bacterial) cell and (b) a eukaryotic cell is depicted. mRNA in bacterial cells as transcribed is immediately ready for translation into protein. In higher cells, the mRNA undergoes modification before it is translated. The term "polypeptide" refers to a single chain of amino acids or a simple protein.
containing that sequence to the cytoplasm, where the base sequence in the message is used to generate a sequence of amino acids that folds up into a hemoglobin subunit (see Figure 7.15). As the subunits assemble and then aggregate into mature hemoglobin molecules, the cell begins to take on its characteristic red phenotype. Gene expression is essentially the same for all other protein-coding genes. Information is read from the archival DNA molecule in the chromosome. It is built into a transportable molecule—also made up of base sequences—called messenger RNA, or mRNA, or simply message. This reading/building process is termed transcription. The mRNA is then transported to cytoplasmic ribosomes, where its base sequence is decoded into a sequence of amino acids by a process termed translation. The sequence of amino acids, covalently linked together, becomes a protein that contributes to the phenotype of the cell. This flow of information from genes to proteins is termed the central dogma; it
is so basic, so widespread, and so important to biology that we've summarized it in the principle, Life Is Information Expressed. The glory of the human form, the majesty of the eagle's wing span, the vocal cords of a male lion, the intricacy of the spider's web are all the result of that exquisitely controlled flow of information.
mRNA—a class of RNA molecules that code for proteins and serve to direct the process of translation on ribosomes in the cell cytoplasm.
transcription—the process of reading a sequence of bases in DNA and generating from it a complementary sequence of bases in RNA.
translation—the process of reading a sequence of bases in RNA and generating from it an encoded sequence of amino acids that comprise a polypeptide chain or protein.
Information flow poses two serious challenges to biological systems. The first is the problem of selectivity. If we were to use all of the cell's information at the same time in the same place, we'd end up with a blood-nerve-muscle-bone-brain-gland-everything cell! We must have a way to use information selectively and sequentially. The second problem we face is the limitation of space for processing the information. Protein synthesis—information expression—takes many monomers, much energy, and a lot of space. We can't jam all those materials and ribosomes into the cell's nucleus. So those are our two major problems. In the next two sections of the chapter we'll start to solve them.
IN OTHER WORDS
1. A cell's genotype is the information it possesses for building and maintaining its structures. It is a linear sequences of bases in DNA.
2. A cell's phenotype is the quality and features of those structures. It is the genotype expressed in three dimensions.
3. Most of a cell's phenotype is proteins or structures created by proteins.
4. The DNA base sequence is transcribed into mRNA base sequence. The mRNA base sequence is then translated into an amino acid sequence, which is a protein.
5. Information expression in the cell faces two essential problems: expressing information selectively and finding space to express it.
Transcription: Using Some Genes Now and Some Not At All
The term transcription was carefully chosen by biologists to indicate that the first stage of information expression is, from beginning to end, entirely in the "language" of nucleotide bases, whether in DNA or mRNA (see Figure 7.16). But beyond this basic structural similarity, the functional difference between archival DNA and RNA messages is profound. Transcription is a wonderfully conceived process that starts with the entire archival information set of the cell and ends with selected gene-sized segments of information that
Vocabulary of Information Expression
DNA RNA polymerase RNA Ribosomes Protein
"Language" Transcription "Language'
of bases of bases of amino
Translation "Language"
acids
Figure 7.16 Vocabulary of Information Expression. The use of the terms transcription and translation in biology is formally analogous to their use in human language. To transcribe is to rewrite in the same language. To translate is to render the meaning of words from one language into a second language. To translate in biology is to convert biological information from a sequence of bases to a sequence of amino acids.
are needed within the cell at the precise moment in time at which they are made. How is this selectivity achieved?
First, we need an enzyme that can work its way into the DNA double helix to begin reading the sequence of bases along one of the strands. It must make an RNA molecule whose base sequence is complementary to that in the DNA. We call this enzyme RNA polymerase. Then, we need regions of base sequence within the DNA that can "inform" RNA polymerase precisely where to start reading (see Figure 7.17). These sequences are termed promoter sequences. We also need an efficient way of informing RNA polymerase when it has finished copying the needed information from a given site so that it can terminate its copying work precisely. Together, promoter sequences and termination sequences or processes help direct and limit RNA polymerase activity to gene-sized RNA
RNA polymerase—a protein; an enzyme that builds RNA molecules using free ribonucleotides and using a strand of DNA as a sequence template (guide) against which to build.
promoter—a sequence of bases in DNA that guides an RNA polymerase to the precise position where initiation of transcription is to occur.
Transcription unit
Start site for transcription
1
O Initiation
RNA polymerase binds precisely over promoter in DNA
... opens up a "bubble" of single-stranded DNA and inserts the first few ribonucleotides of the mRNA to be produced
Unwinding of
DNA double helix
eVi‘OVA LiTtlavirtdagg
ff Elongation
RNA polymerase moves forward along gene unwinding DNA ahead of itself, adding and polymerizing ribonucleotides in its active site and refolding DNA as it continues on.
11) Termination
Completed message and DNA restored to its native configuration are both released. Polymerase can now be reused.
5' hi' 35
Pre-mRNA transcript 5' 3'
Figure 7.17 Transcription of DNA into RNA. One strand of DNA—the"sense" strand—is transcribed. (The other strand is useful only during replication of DNA.) The process has three stages—initiation, elongation and termination—as shown.
5 AUG Cr"-
' 3j
Ohn,Mn
C
T ACGAGCAGA TGA DNA template strand
|
5' |
|
|
|
|
|
AUGCUC |
RNA transcript is released.
5' AUGCUCGGUCUACU
End of transcript
11.-1111ATI
Figure 7.18 DNA and RNA Complementarity. Ribonucleotides are added according to the same base pairing rules respected by DNA except that the base uracil is substituted in RNA for thymine in DNA.
molecules. Finally, we need a collection of regulatory molecules—mostly proteins—that inform RNA polymerase concerning which promoters to transcribe at and which ones to ignore. Sometimes these regulatory molecules are protein subunits that bind directly to the RNA polymerase. In other cases, they bind specifically to regions of the DNA that need transcription. The result is differential expression of the DNA archives: messenger RNAs that are temporary, reusable copies of a gene whose product is needed just now to build or maintain cell structure.
The cell has no brain. Yet elegance is seen everywhere in the process of transcription. There are structural domains within the RNA polymerase enzyme whose precise three-dimensional shapes enable them to recognize specific base sequences in a DNA promoter region. This recognition enables the RNA polymerase to pause at a given place on the DNA long enough for initiation of transcription to occur. During initiation, RNA polymerase binds to the DNA double helix right over the promoter sequence (see Figure 7.17). The enzyme then opens up or unwinds a small portion of the double helix to form a "bubble" of single-strandedness within the DNA. Now the polymerase can read along a single strand of the DNA molecule. Once a region of about 10 DNA base pairs opens up, the enzyme begins using DNA base sequence as a template against which to begin positioning single
ribonucleotides according to the base-pairing rule. Recall from Chapter 4 that in RNA the base uracil is substituted for the thymine base used in DNA nucleotides. So if the polymerase senses the first 10 DNA bases to be as illustrated in red in Figure 7.18, then the first 10 bases in the message would be as illustrated in the green sequence in the same figure. Once an initial set of RNA nucleotides are in place and covalently bonded together, RNA polymerase moves into an elongation phase, where it pulls away from the promoter and continues "downstream" reading along the DNA molecule.
domain—a structural region of contiguous amino acids within a protein that performs a specific component function within the overall function the protein performs.
initiation (transcription)—the productive binding of RNA polymerase to DNA and the initial alignment of ribonucleotides such that transcription has begun.
ribonucleotide—a subunit of the nucleic acid polymer RNA; within RNA it is composed of a single phosphate attached to a ribose sugar that is attached to one of the nitrogenous bases adenine, cytosine, guanine, or uracil.
elongation (transcription)—the movement of RNA polymerase along the DNA template strand generating a single complementary strand of RNA.
Figure 7.19 RNA Polymerase. This highly simplified diagram represents an enzyme that is actually a collection of polypeptide chains whose precise three-dimensional structures serve several dynamic and related roles.
Elongation is an enzymatic nightmare (see Figure 7.19):
1. The DNA helix must be unwound or opened up ahead of RNA polymerization.
2. The correct ribonucleotides must be sensed and incorporated into the new RNA strand.
3. The RNA strand must be dislodged from its (temporary) pairing with the DNA.
4. The new RNA strand must be proofread to remove and replace any errors made by the copying going on in the enzyme's active site.
5. The double strands of DNA must be reclosed as they were originally.
6. All of this must be done while negotiating around the protein structure of the nucleosomes that the DNA is wound around in chromatin.
Roles 1 through 5 are all deftly handled by the RNA polymerase and its associated subunits. The final role is played by separate proteins that unravel DNA from nucleosomes ahead of the polymerase and reassemble and reemploy the nucleosomes once transcription has passed by.
As RNA polymerase reaches the end of a gene, a termination process occurs (see Figure 7.17). In bacteria, a simple transcription termination sequence is read by RNA polymerase: The DNA is released and transcription stops. But in higher cells like our own, the process requires additional enzyme activity and is poorly understood. Somehow, the RNA transcript is released and has encoded within it a
complete gene sequence complementary—base for base—to the gene sequence in the archival DNA.
The RNA product of transcription has a rather high fidelity with the DNA from which it was copied. Following the polymerase's proofreading function (item #4 above), there is about 1 error per 10,000 nucleotides incorporated. Given that multiple messages are transcribed from a single DNA gene, this error rate proves acceptable. Let us all in our own transcription activities strive for only one spelling error per 10,000 letters written!
The RNA products of transcription fall into three broad categories functionally (see Table 7.1). One set, the mRNAs, code for protein and are by far the largest in variety. But a second set of RNAs, the ribosomal RNAs (rRNAs) are transcribed from the nucleolar region of DNA (see Chapter 5, Section 2c). These RNAs are never translated into proteins. As RNAs, they are folded structurally into ribosome subunits, where they play a
|
termination (transcription)—the process by which transcrip‑ tion ends, including the disassociation of RNA polymerase from its DNA substrate and the release of the mRNA or pre-mRNA product. rRNA (ribosomal RNA)—single-stranded nucleic acids composed using ribose sugars and containing the nitrogenous base uracil instead of thymine. They form structural parts of ribosomes assisting with alignment of other RNA classes. |
Table 7.1 Functional classes of RNA molecule in the cell
|
Class Location of RNA Genes in Genome |
Structural Modifications After Transcription |
Role in Cell |
|
mR scattered I. |
in prokaryotes: none in eukaryotes: introns processed out |
translated into protein |
|
rRNAIMI within nucleolus |
nucleotide sequence folds to correct shape for use in ribosome |
incorporated into the structure of large and small ribosomal subunits |
|
tRNA clustered in various places |
many bases are modified, folds to 3-dimensional"12 shape. |
transfer amino acids to ribosome for incorporation into growing peptide chain. |
critical role in helping ribosomes recognize how and where to begin their work. We will examine ribosome function shortly. A third important class of RNA "transcripts" is called transfer RNAs or tRNAs. These RNAs, after some modification, also function directly as RNA molecules by folding up into a three-dimensional L-shape, after which they are attached to specific amino acids. They transfer these amino acids to ribosomes for the translation of mRNA into protein. We will examine this process shortly as well.
Messenger RNA transcripts code for proteins. In bacterial cells, once the mRNA has been transcribed, it is immediately ready for translation into proteins. In fact, the front end of an mRNA is often already being translated before the tail end of the message even exists! One can play these tricks when no nuclear membrane exists to separate transcription from translation. But in higher cells like our own, mRNAs are a bit more complicated and require some processing before they are ready for translation. In your own cells, mRNAs just completing transcription are called pre-mRNAs (see Figure 7.15). At least three processing steps
tRNA (transfer RNA)—single-stranded nucleic acids composed using ribose sugars and containing the nitrogenous base uracil instead of thymine. They attach to and transport amino acids to ribosomes for incorporation into growing protein chains.
pre-mRNA—an RNA molecule that is an immediate product of transcription; it contains introns that must be removed before it can be translated into protein.
cap—a guanine ribonucleotide with three phosphate groups and an additional methyl group that is attached to a pre-mRNA during processing; this structure assists in ribosomal attachment to a mature mRNA.
poly(A) tail—a sequence of adenine ribonucleotides attached to a pre-mRNA following transcription; controls the length of time a mature mRNA will survive degradation in the cell's cytoplasm.
unit of transcription in DNA strand exon intron exon intron exon
transcription into pre-mRNA
ap
snipped out
Figure 7.20 Processing of Pre-mRNA. There are three elements to pre-mRNA processing. (a) A single guanine nucleotide is added as a "cap"to facilitate initial alignment of the message on the ribosome.
(b) a poly-adenine"tail" is added to the message to control its longevity in the cytoplasm. (c) Introns and some exons are excised from the message leaving only the exons that will encode the desired protein product.
are required to convert these RNAs into mature messages ready to be translated (see Figure 7.20). First, a guanine ribonucleotide containing several phosphate groups is attached to the front end of the mRNA. This cap will help the front end of the RNA to get properly aligned on the ribosome for its translation. Second, a long series of adenine ribonucleotides is added to the tail end of the message. The length of this poly(A) tail will determine how long the mRNA will survive for use in translation once it's reached the cytoplasm. The third processing step is more complex—more obviously designed.
Human genes contain interspersed regions of sequence that do not code for and will not contribute to the final sequence of amino acids in
the protein product. These interspersed sequences are called introns. The sequences within the pre-mRNA that directly code for amino acid sequence are termed exons. In humans, most premRNAs have alternating patterns of introns and exons in their sequences. It is thus necessary to have within the nucleus a collection of splicing enzymes and a corresponding processing step to remove all introns from the pre-mRNA, thereby generating a mature mRNA message ready for translation.
Perhaps you are now shouting at your textbook, wondering why on earth such a complicating and seemingly needless step is interposed between transcription and translation. Early workers, who began with a naturalistic bias, considered that the base sequences corresponding to introns were "junk DNA." It was necessary to get rid of these sequences from the pre-mRNA before translation so that a meaningful protein could be built. Soon evidence began to accumulate that the intron sequences were in some way involved in regulating the expression of genes they were found in. How they do this has been, by far, one of the most exciting discoveries since finding that genes are sequences of DNA. Even those whose bias was oriented toward design were amazed. It has been shown that introns and exons make it possible for one gene to code for more than one protein! Consider the example of the a-tropomyosin gene in mammals (see Figure 7.21). This protein has many functions, one of which is in muscle cells, where it helps control muscle contraction. Its premRNA has 12 exons and 11 introns! The splicing machinery is different in cells of different tissues within the same animal. So in each tissue where it is needed, its mRNA is the result of a tissue-specific splicing pattern that produces a protein
uniquely designed for that tissue. In this way, the oc-tropomyosin gene codes for at least six different but related proteins in different tissues! How widespread are intron-containing genes in humans? Recent estimates suggest that as many as three-fourths of all human genes show multiple splicing patterns. This suggests that a human genome containing about 25,000 different protein-coding genes could actually generate over 100,000 different proteins following pre-mRNA processing. We are only now beginning to understand how the pre-mRNA processing proteins are differentially employed in different tissues of the body. Clearly, there is a whole lot more to the control of gene expression than we had ever anticipated! But given the way information flows in the cell, it is efficient to have most of the control of gene expression occurring during this first stage: the transcription of DNA into RNA.
intron—a sequence of nucleotides in DNA that are transcribed into pre-mRNA and that separate protein-coding portions of a gene from each other; removed during processing to form mature mRNA.
exon—a sequence of nucleotides in DNA that are transcribed into pre-mRNA and that represent protein-coding portions of a gene; retained and joined together during processing to form a mature mRNA.
splicing enzyme—small particles composed of protein and RNA that attach to pre-mRNA at junction points between introns and exons; they cut RNA at these sites, remove intron sequences, leaving exon sequences contiguous to each other.
junk DNA—a sequence of DNA believed to have no useful function; some see usefulness for it in the past, other see usefulness for it in the future.
|
Smooth muscle mRNA Pre-mRNA Striated muscle mRNA |
1 2 4 5 6 7 8 9 12 2 3 4 5 6 7 8 9 10 11 1 3 4 5 6 7 8 910 11 |
Figure 7.21 Alternate Proteins from the Same Gene. The protein a-tropomyosin exists in multiple forms in the human body. Here, two different splicing patterns are shown that will result in two distinct mature messages and Exons 12 therefore two distinct proteins for two different 1-12 tissues. Elegant! |
IN OTHER WORDS
1. Transcription converts biological information in the base sequence of archival DNA into the base sequence of the ribonucleic acids mRNA, rRNA, and tRNA.
2. The enzyme RNA polymerase creates these RNAs by aligning and covalently bonding ribonucleotides in a sequence complementary to the DNA base sequence it is reading.
3. The process of transcription occurs in three stages: initiation, elongation, and termination.
4. Transcription begins at one end of a promoter sequence in the template DNA strand and concludes at the tail end of a transcript anywhere from one to several genes in length.
5. During elongation, RNA polymerase unwinds DNA, lengthens an RNA molecule against a DNA template, proofreads the RNA sequence, and then refolds the DNA double helix.
6. In bacteria, termination of transcription is signaled by a sequence of bases in DNA; in higher cells, termination is enzymatically more complicated.
7. In bacteria the product of transcription is a mature mRNA ready to be translated; in higher cells the product of transcription is pre-mRNA, which must be further processed before translation.
8. Pre-mRNA processing in higher cells involves capping the transcript, adding a poly-adenine tail, and removing all introns and a selection of exons from the pre-mRNA message.
9. Tissue-specific processing of pre-mRNA allows genes in higher cells to code for anywhere from two to many different polypeptide chains having related but distinct functional roles in different cells of the same organism.
Translation: Making Proteins
If well over half the biomass of a cell is protein, and if the rest of the cell's biomass is assembled by proteins, then we need to start making proteins! Since this process is a major part of the biosynthetic activity of the cell, and since, following translation, many proteins require considerable processing to reach their final mature form, we need much space for these activities. The nucleus is already filled with archival information and its processing enzymes. Protein synthesis will have to occur out in the cytoplasm; mRNA transcribed in the archives will have to travel to the cytoplasm to be translated (see Figure 7.15). Although in bacterial cells, the information level is lower and processing is simpler, protein synthesis is still largely peripheral to the nucleoid region.
The term translation is used for protein synthesis because the information we work from is a sequence of nitrogenous bases in mRNA, but the information as expressed takes the form of a sequence of amino acids in a protein (see Figure 7.16). Nucleotide bases and amino acids lie within two broadly distinct classes of biomolecules: nucleic acids and proteins. Since we are moving from one language (base sequence) to another (amino acid sequence) we use the term translation.
Using mRNA bases in sequence to specify a sequence of amino acids leads to an immediate coding problem (see Table 7.2). There are only 4 kinds of bases in DNA or mRNA, and there are at least 20 common amino acids found in proteins. Clearly, there cannot be a one-to-one coding correspondence between bases and amino acids.
Table 7.2 Coding for Amino Acids using base sequence.
|
Number of Bases |
Bases per Codon |
Possible |
Possible Number |
Number of |
|
|
|
Combinations of Bases |
of Codons |
Amino Acids needing Coding |
|
4 |
|
4 |
4 |
20 |
|
4 |
2 |
4 X 4 |
16 |
20 |
|
4 |
3 |
4 X 4 X 4 |
64 |
20 |
codon—a sequence of three adjacent nucleotide bases in mRNA that code for a single amino acid in a sequence within a polypeptide chain or protein.
Figure 7.23 Transfer RNA. Shown here are two structural models of a molecule of tRNA carrying the amino acid tryptophan. It's anticodon, -ACC- is complementary (by base pairing) with the codon -UGG- in mRNA that codes for tryptophan. (see Figure 7.22)
2. The adapter molecules are now known to be transfer RNAs. Their existence was predicted and by the 1960s their presence and structure were elucidated as well. Each tRNA is about 85 nucleotides in length (see Figure 7.23). This chain of monomers folds up in solution and because of intrachain hydrogen bonding between matching base pairs, its three-dimensional folded form takes the shape of an L. At one end of the L, each tRNA contains a sequence of three bases called an anticodon. These three bases will be complementary in
sequence to a particular codon within mRNA. Covalently bonded to the opposite end of the transfer RNA molecule is the amino acid corresponding to the codon in the mRNA message!
So the tRNA really is the translator molecule. It has (anticodon) bases on one end and the correct amino acid for the codon on the other. But how does the correct amino acid get attached to its own corresponding tRNA?
3. Here we require the specificity that enzymes possess. There is a set of 20 enzymes called tRNA synthetases. Each synthetase recognizes just one kind of amino acid and only the tRNAs specific for that amino acid (see Figure 7.24). (Some amino acids have more than one codon that calls for them.) We are here seeing an incredible example of design: an enzyme that "walks into the dress shop" of tRNA molecules, tries on many different tRNAs, but binds to—selects—only the ones with the shape that precisely fits the three-dimensional shape of its own active site. It also tries on all the different amino acids but
anticodon—a sequence of three adjacent nucleotide bases in tRNA that are complementary in sequence to an mRNA codon; the tRNA carrying it also carries the correct amino acid corresponding to the mRNA codon.
tRNA synthetase—an enzyme that recognizes the structure of from one to four tRNAs that specify a particular amino acid; the enzyme links them covalently to that correct amino acid.
Figure 7.24 Preparing tRNA for Translation. Tryptophan tRNA Synethase is one of 20 synthetase enzymes that keep the entire collection or"pool" of tRNAs in the cell charged with their respective amino acids. Imagine having to design each of these enzymes such that its active site recognized only one "family"of tRNA and only the amino acid corresponding to that family. Three-dimensional shape of the active site is the key variable in the design of these enzymes.
again binds only to the one that fits another portion of its active site. And, by design, that amino acid is the one that the already-bound tRNA must be attached to—the one that the mRNA code calls for! So these synthetases are covalently loading amino acids onto their corresponding adaptor molecules and doing it such that the bond between the two is a high-energy bond useful for the energy-expensive amino acid polymerization process that follows. The error rate-1 mistake per 1000 tRNAs loaded—is amazing when you consider how similar some of the amino acids appear to each other (see Figure 4.3). So these synthetases are 20 works of art, each one capable of bonding the one amino acid it recognizes to any of the one to four tRNAs whose anticodons complement the correct codon for that amino acid. Amazing.
4. Given the carefully crafted association of correct amino acids with their cognate anticodons, all that remains is for some relatively witless machine to allow codons and anticodons to be matched up in sequence and to then form the resulting sequence of amino acids into a chain. That machine is the ribosome (see Figure 7.25). In higher cells, each ribosome is assembled in the nucleus from 50 proteins and
3 rRNAs. It then travels to the cytoplasm for use. It's a machine large enough to be easily seen with an electron microscope. Its proteins and RNAs are built into two subunits, one large and one small. These two subunits associate to begin translation and dissociate (fall apart) as translation ends. The large subunit has an active site that can bind amino acids to one another forming them into a peptide chain or protein. The small subunit has a decoding area where tRNAs are properly sequenced against mRNA codons such that amino acids get properly sequenced. This wonderful machine contains three separate sites where tRNAs can bind, two of which allow them to bind to the mRNA message. In all of these binding and catalytic sites, it is the rRNAs that play the key structural and catalytic roles. The ribosomal proteins are more or less supportive of the rRNA roles played in ribosomal function. When the two ribosomal subunits are associated together, they create two perfectly crafted channels: one that allows mRNA to enter, be read, and exit and one from which the growing protein chain emerges.
The process of translation occurs in three stages: initiation, elongation, and termination. Sound
Amino acids are added to a growing polypeptide chain in the region between the subunits. The growing polypeptide chain exits the ribosome through the exit tunnel in the large subunit.
CI How a ribosome is shown in this book
Figure 7.25 The Ribosome. (a) a computer-generated image in which three adjacent tRNA binding sites are used while translating the mRNA shown entering from below. The growing polypeptide chain emerges from the top of the large subunit. The mRNA is within the structure of the associated subunits. (b) an icon of an intact ribosome as we will represent it in subsequent figures.
0
Figure 7.26 Translation. (a)The initiation complex is complete and ready for elongation to begin. (b) Elongation, a peptide bond forms between the first two amino acids in our new protein. (c) Elongation, a spent tRNA exits and a new tRNA enters. (d) Elongation, a second peptide bond forms. (e) Elongation, the next tRNA exchange occurs. (f) Elongation, a third peptide bond forms. The process continues. The average polypeptide chain length in yeast cells is 466, so that's 466 elongation steps prior to termination.
familiar? Initiation begins with a mature mRNA getting correctly "into register" on the small ribosomal subunit (see Figure 7.26a). The first codon of every message has the base sequence AUG, which is called the start codon. This sequence codes for the amino acid methionine, which will be the first amino acid in the new protein chain. So the initiation complex waits until a tRNA with the correct anticodon (—UAC—) bearing methionine also finds its way to the small ribosomal subunit. A variety of soluble and attached proteins assist in setting up
this complex. When everything is in its place, the large ribosomal subunit binds the small one and the initiation of translation is complete.
initiation (translation)—the productive binding of mRNA, an initiator tRNA, and a small and large ribosomal subunit into a complex that enables translation to begin.
start codon—the base sequence —AUG- in mRNA that codes for the amino acid methionine. This sequence is the first translated codon in most mRNA molecules.
Elongation now begins. The ribosome will be moving along the mRNA, reading codons, matching them with anticodons on tRNAs, and incorporating the attached amino acids into a growing peptide chain (see Figure 7.26b–f). If the second codon in mRNA is –GUG–, then a tRNA with anticodon CAC will match up with it using the second tRNA binding site on the ribosome. It carries the amino acid valine, which, according to the code, should be the second amino acid in the peptide chain. The large ribosomal subunit now forms a peptide bond (see Chapter 4, Section 5a) between methionine and valine, and our peptide chain is now two amino acids in length. This dipeptide remains attached to the second tRNA, leaving the first tRNA free of any amino acid. The first tRNA is moved to an exit site that is away from the active site, and the ribosome shifts along the mRNA to bring a new codon into the active site. This creates an open space for a third tRNA to "try on" the third codon of the message. If codon and anticodon match, another peptide bond is formed, another tRNA exits, and the ribosome shifts again. As new codons are matched to anticodons, new amino acids are transferred to the ribosome and incorporated into the growing peptide chain. This entire process is driven by phosphate bond energy (GTP instead of ATP) at each peptide bond formation step, and it is guided by required soluble protein factors too complicated to represent here. It is a truly elegant process.
Eventually, the ribosome reaches a specialized codon called a stop codon. There is no tRNA with an anticodon recognizing this codon (see Figure 7.27). Instead, a protein called release factor
enters the tRNA binding site, recognizes the stop codon, and causes the now completed protein chain to separate from the ribosome. Other release factors are then activated, which, in turn, cause the ribosomal subunits to disassociate from the mRNA and from each other in a process called termination.
In higher cells like your own, the completed peptide chain signals its own destination. Immediately following translation, some proteins are complete and are simply released in the cytoplasm, where they will function. Others, based on their amino acid sequence, are destined for further processing and possibly export from the cell. These end up in the lumen of the endoplasmic reticulum (see Figure 7.28).
elongation (translation)—the movement of the ribosome along the mRNA generating a single polypeptide chain composed of amino acids.
GTP—guanosine triphosphate; a nucleoside triphosphate whose covalent bond between the second and third phosphates contains as much potential energy as the same bond in the ATP molecule.
stop codon—one of three mRNA base sequences, —UAA—, —UAG—, or —UGA—, for which there is no corresponding amino acid; recognized by release factors that cause translation termination.
release factor—a protein that enters a tRNA binding site on the ribosome; sensing the presence of a stop codon, it causes translation to terminate.
termination (translation)—the process by which translation is ended, including the disassociation of ribosomal subunits, mRNA, and a completed polypeptide chain.
Releasing Factor will cause: release of peptide chain
release of mRNA
Dissociation ribosomal subunits
The Human Intracellular Protein Factory
DNA
Transcription
Initiation
Elongation
Termination
4
Pre-mRNA Processing
4
Capping
Polyadenylation
Splicing activity
Figure 7.28 The Human Intracellular Protein Factory. The steps in the production of a mature protein as discussed in this chapter are listed in this flow chart
along with some possible variations in processing. Cellular structures are able to determine from the"front end"sequence of amino acids in the protein whether or not it will enter the endoplasmic reticulum for processing or not.
Further Processing in Golgi Complex
or
Export
As you may recall, the journey through the endoplasmic reticulum and later the Golgi complex may involve the loss or modification of amino acids, cross-bonding between amino acids at other places in the peptide chain, or the addition of sugars or lipid groups. When all of these additional processing steps are complete, the result is a mature protein, processed and ready for use. Think of the ribosome, the endoplasmic reticulum, and the
Golgi complex as somewhat like a bicycle factory. The newly synthesized peptide chain is something like a basic bicycle: wheels, frame, handlebars, and pedals. It goes. But it would be nice to have a seat, fenders, and a horn. These extras make the working bicycle fully functional and safer. The processing steps add the nonprotein parts to the peptide chain making it ready to fulfill its function completely.
IN OTHER WORDS
1. Translation is the mRNA-guided process of synthesizing proteins; it occurs on ribosomes in the cytoplasm of the cell.
2. Information for amino acid sequence is stored in the base sequence of mRNA in a sequence of base triplets called codons.
3. Sixty-four different codons in mRNA control amino sequence and the start and termination of the translation process.
4. The five component parts of translation are a message,tRNAs, tRNA synthetases, amino acids, and ribosomes.
5. Each variety of transfer RNA in the cell contains a specific anticodon that is complementary in sequence to some codon in mRNA.
6. tRNA synthetase enzymes load each individual tRNA with the amino acid it is designed to carry.
7. Ribosomes are composed of two subunits, one large and one small.Together, these subunits contain three different molecules of rRNA and some 50 ribosomal proteins.
8. Translation begins with the formation of an initiation complex consisting of a mature mRNA, an initiator tRNA carrying the amino acid methionine, and the large and small ribosomal subunits.
9. Elongation of the polypeptide chain results from movement of a ribosome along an nnRNA.The ribosome reads codons, matches them with anticodons in tRNA and peptide bonds amino acids from those tRNAs in the correct sequence.
10. Translation terminates when the ribosome brings a "stop" codon into its active site. Release factors read that codon, cleave the completed peptide chain, and release the mRNA and ribosomal subunits from the translation process.
11. Following translation the amino acid sequence of the peptide itself determines whether the peptide is complete or whether additional processing in the endoplasmic reticulum and/or Golgi complex will be required.
The Genetic Code
The genetic code is a marvelous piece of craftsmanship. In its simplest expression it relates codons in mRNA to amino acids in protein sequence. But as we've seen, there are 64 possible codons using four bases three at a time, and this excess of codons over amino acids has left us with enigmas that appear somewhat accidental to materialists. To those who embrace design however, we expect that these enigmas will someday clarify only to reveal precise reasons for code redundancies that today appear fanciful.
So we say that the code is degenerate. This simply means that most of the amino acids are specified by more than one codon (see Figure 7.22). With our limited understanding of the occasional instabilities of DNA, we can see some value to code degeneracy. Rarely, in the DNA "archives" do bases get altered or mutated (see Figure 7.29). This happens when, for example, mistakes are made during the copying of DNA for distribution to daughter cells. Mutations can be highly damaging or even let'. al to cells. Examining the code closely shows how serious damage to proteins by mutational changes in DNA is minimized by the structure of our genetic code. (Think about this while you are out trying to get a suntan!) For example, suppose a mutational change in DNA alters the third base of the codons UUU or CUU or GUU or GGU (as examples).
degeneracy—absence of a one-to-one correspondence between codon sequence and the amino acid coded for; rather, several codons code for the same amino acid.
mutated, mutation—referring to changes in the base sequence of DNA; change of identity of one base for another, loss or addition of a base, loss or addition of multiple bases; some mutations result in serious functional loss or organismal death.
0 part of DNA template:
mRNA transcribed from DNA: resulting amino acid sequence:
base-pair substitution in DNA:
altered mRNA:
altered amino acid sequence:
InTrInftriWWWWWWITMI
iitattAlltAIKAAAISIglalala
THREONINE PROLINE GLUTAMATE GLUTAMATE LYSINE
WITVITTUIVITTIVITTM
AILIAX11111111ALILI
THREONINE: PROLINE VAL I NE 'GLUTAMATE LYSINE
Figure 7.29 Effect of DNA Mutation on Protein Structure. (a) In this diagram we are lodged somewhere in the middle of a huge (gene) DNA sequence. (b) Notice the effect on the protein of substituting the base adenine for the base thymine. That one amino acid difference may have a profound effect on the three-dimensional shape of the protein because the amino acids glutamate and valine have very different structures. This alteration, as diagramed, actually occurs in sickle-cell anemia sufferers.
It wouldn't matter what base that final U mutated to; the code would still call for the same amino acid! Also, looking vertically through the chart, the structures of the amino acids in each column of the chart tend to be somewhat similar to each other. In this way, a mutational change in the first base of a codon will result in substituting an amino acid from the same column, again, minimizing the effect of the mutation. So the strategy inherent in the code clearly rises above the level of simply getting each amino acid represented by a few different codons in mRNA.
Finally, our genetic code is not universal. Figure 7.22 does not hold true for all organisms! Now, evolutionarily, it really should, you know. One would assume that coding relationships would be laid down very, very early in the history of life, after cells began to divide but before they began to diversify. Yet in certain groups of bacteria (prokaryotes), protozoa (single-celled eukaryotes), and yeasts (fungal forms), there are very slight differences in the code. For example, in the yeast Candida, the codon CUG codes for the amino acid serine rather than for leucine as it does in the normal code. Why in the world is this? If life-forms are designed, there will be an important reason for these (rare!) coding differences. But as of this writing, the reasons for these differences are not known.
IN OTHER WORDS
1. The degeneracy of the genetic code helps to protect cells and organisms from the harmful effects of mutations.
2. The genetic code is not universal. Scientists have just begun to uncover a variety of microorganisms whose codes show slight but significant variations from the normal code.
ATION OF INFORMATION EXPRESSION
Our Deep Desire to Control Information Expression
One of humanity's most valuable stories tells of an ideal man and woman who were placed in a garden and told to "subdue and have dominion" over it and its component life-forms. The story goes on to describe how that man and woman made a choice and, as a result, lost their idyllic existence. Both their motives for action and their environment fell into a degeneracy that survives to this day. The story keeps alive the notion that a Designer had not desired life to take this foul turn and might yet have a remedy for it. His earlier directive to subdue and have dominion over the biosphere survived this loss of original dignity. Only now, the command must be carried out with tainted motivations. And the arena for its fulfillment would now both contain and develop many new trials and challenges to have dominion over!
With time, genes in human populations would take on harmful variations. Faulty versions of hemoglobin genes would give rise to sickle cell anemia. Faulty cell surface receptor genes would predispose their bearers to type 2 diabetes. In this fallen world, parasitic forms like viruses would now infect man and his domesticated animals (see Figure 7.30). Tobacco mosaic virus would eventually threaten his tomato crops. The ultimate challenge humans would face was their own demise. Death would now be programmed into them and all other life-forms. Civilization, in seeking to subdue and have dominion over this tragedy, has wrestled with these challenges for years. But in the twentieth century an understanding of DNA structure and its mutation led to a hope of correcting mutations. The power of gene expression began to yield fruit in the biotechnological suppression of parasitism. And the discovery of genes associated with aging has left some wondering if we might significantly postpone or even preclude organismal death.
0 Helical virus Polyhedral virus
(tobacco mosaic virus) (adenovirus)
Protein spikes
Figure 7.30 Viruses. A fallen world has viruses that cause disease and sometimes death. They take many forms. Here are some examples: (a) tobacco mosaic virus that infects plants (b) an adenovirus which causes some of your colds (c) the AIDS virus (d) even bacterial cells have their own viruses.
IN OTHER WORDS
1. Scientists have developed means to control or alter gene expression in an attempt to cure genetic diseases, control crop pests, and provide cheap protein sources to society.
Information Expression as Problem Solving
Such formidable disease states and challenges have prompted scientists to turn to life's most powerful resource: segments of pre-designed genetic information—genes! Consider some examples of using specific genes to solve difficult problems:
1. Researchers have inserted the gene for normal hemoglobin into stem cells from mice that have sickle cell disease. Mice that received this treatment were cured of the disease.
2. The gene for human insulin has been inserted into bacterial cells and more recently into the cells of the safflower plant, where it supports the production of human insulin. This insulin can be harvested and used as a drug for therapy in diabetes patients.
3. A human gene whose protein product inhibits blood clot formation has been injected into the nuclei of embryonic cells of goats (see Figure 7.31). Adult female goats grown from these embryos secrete the human anticoagulant protein in their milk from which it is easily isolated.
4. A bacterial gene that promotes ice formation on the surface of plants has been rendered nonfunctional and inserted into plant-associated strains of the bacterium. When these strains colonize plant surfaces, ice formation requires a lower temperature, decreasing crop losses in cold weather.
5. A bacterial gene that codes for a protein toxic to insect pests has been inserted into tissues of economically important crop plants (see
Figure 7.31 Genome Alteration. The glass tube on the right is introducing foreign DNA into the nucleus of a fertilized egg—a zygote. If the DNA successfully incorporates into the genome, it will be replicated into all the cells of the adult developing from this embryo.
Figure 7.32 European Corn Borer. This pest of corn plants is now encountering a damaging neurotoxin in corn fields across North America. The toxin is engineered into corn tissues. It was taken from the genome of a soil bacterium.
Figure 7.32). The plants now have increased resistance to these pests.
Recombinant DNA research began in 1970. Research since that time has provided a host of examples comparable to those cited above (see Table 7.3). Each technological triumph results from making a series of component decisions:
1. The optimal gene sequence for the task must be selected or created.
2. The cell type in which the gene will be expressed must be selected.
3. The gene sequence and its flanking sequences must be appropriately modified to optimize expression in the cell it will function within (see Figure 7.33).
4. A method for inserting the gene into the target cells must be selected and sometimes modified to optimize gene delivery (see Table 7.4).
5. The cells must be assayed to determine that the gene is functioning as was hoped.
stem cells—undifferentiated cells found in most organisms; cells that are able to divide continuously by mitosis and eventually differentiate into any of the types of cells found in the mature organism.
insulin—a hormone in mammals that controls the absorption of glucose into the tissues from the bloodstream.
recombinant DNA—the use of nuclease and ligase enzymes to cut and join segments of DNA from the cells of two different species of organisms.
Modification
1973 I Salmonella bacterial gene expressed in E. Coli
|
1976 |
yeast genes expressed in bacteria |
|
1977 |
bacteria produce human growth hormone |
|
1978 |
human insulin gene expressed in bacteria |
|
1979 |
multiple oil degradation genes inserted into a single bacterial strain |
|
1980 |
ice-minus gene inserted into bacterial strain for crop protection |
|
1983 |
bacterial toxin gene expressed in tomato plants |
|
1985 |
mouse enzyme (reverse transcriptase) expressed in bacterium |
|
1990 |
normal adenosine deaminase gene inserted into immunodeficient human cells |
|
1994 |
genes added to tomatoes to help retain ripeness |
|
2000 |
daffodil and bacterial genes inserted into"golden"rice |
|
2009 |
human anti-thrombin genes expressed in goat mammary glands. |
1. Begin with many copies of a purified gene of interest
2. Paste appropriate promoter sequence upstream
3. Paste additional gene (and promoter) coding for resistance to antibiotic. Cells grown in presence of antibiotic will now die unless they have incorporated this sequence (and probably our gene next to it!) into their genome
4. Paste on each end DNA sequences that are known (from DNA sequence studies) to be on either side of the gene that we wish to replace within the genome
Defective gene in fragment
Normal gene in chromosome
Enzymes within the cell nucleus "find" regions of identical base sequence to either side of the gene and move the normal gene into the chromosome discarding defective gene in the fragment.
Figure 7.33 Typical Gene Modification. There are many (!) variations on this general sequence. The ultimate purpose is to prepare a gene to precisely replace a defective one in the genome. All this design is useless unless there is already a well designed set of recombination enzymes present in the nucleus to insert the modified gene while discarding the old one.
For example, workers (in item 1 above) who wanted to replace the sickle cell gene in anemic mice with a normal gene, had to (1) select the normal hemoglobin gene source and isolate and purify the gene. Then (2) they had to determine in what cell population the normal gene would function. For this they used mouse tail cells, which they genetically converted into undifferentiated stem cells. Next, (3) the gene required an active promoter next to it so that it would be efficiently transcribed. They also arranged the DNA sequences adjacent to either side of the gene so that it would get inserted at the right place in the genome (see Figure 7.33). Enzymes in the cell nucleus would do
|
Method Chemical Transfection |
Description use of calcium salts and organic buffers to precipitate DNA; precipitate is taken up by cells in culture use of positively-charged lipid-like molecules to complex with DNA and carry it through the cell's membranes |
|
Viral Vectors |
use of disabled viruses specific for the organism to receive the DNA; DNA is incorporated into their genome in place of genes that render the normal virus pathogenic to the cell being invaded |
|
Liposomes |
incorporate DNA within small lipid-lined spheres that fuse easily with cell membranes dumping their DNA content into the cell |
|
Electroporation |
mixed cells and DNA are subjected to electric current that generates transient pores in the membrane through which the DNA then passes. |
|
Gene Gun |
DNA is coupled to a microscopic particle of an inert solid (like gold) which is then "shot"directly into the target cell's nucleus |
this for them. They then (4) selected a way to get the genes into the stem cell population (a process called transfection). Lipid-like chemicals are often complexed with genes to carry them through membrane barriers and into the nucleus. Finally, (5) they examined the resulting mature red cells for any evidence of sickling (which would mean failure of the procedure).
Suppose, however, we desire (2) bacterial cells to generate a useful human protein for us such as human growth hormone. The human gene (1) for the hormone will require (3) replacement of an upstream human promoter sequence with a bacterial one so that bacterial RNA polymerase will transcribe it effectively. We may even need to alter codons in the gene in favor of ones typically used in the bacterial cell (recall the degeneracy of the genetic code mentioned above). For trickier problems like this we have "gene machines" that can manufacture gene sequences from solutions of nucleotides. The genes are moved into bacterial cells (4) in a procedure called transformation. Using calcium salts and a bit of temperature abuse, bacterial cells will take up DNA directly from solution. The bacterial culture soon produces large amounts of human growth hormone (5), which vastly exceeds the nanogram amounts available from the pituitary glands of human cadavers.
When therapeutic genes are being inserted into a human being, a fundamental choice must be made. This choice was defined for us back in the late 1800s by the German zoologist August Weismann. He argued that, at some early point during development, the fertilized egg—like the one you once were—gives rise to two separate populations of cells. One population, the somatic cells, differentiate into
all the functional tissues of your own body (see Chapter 9 for more discussion of this). The other population becomes your sex cells—egg or sperm cells—which are committed not to supporting your own function but to provide "germinal cells" for the next generation. Weismann called this latter group germ line cells (see Figure 7.34).
Should we insert therapeutic genes into just the specific somatic cells of an individual where the defective gene is currently being expressed? This would have its cost, but it would solve an immediate problem in a single individual. We could also, however, insert therapeutic genes into the germ line cells—egg or sperm cells—of the individual. This is similar to what was done in goats that now secrete human anticoagulation protein in their milk (example 3 above). Then, the defect is corrected in all the cells of the next generation of individuals. This is a difficult question to address. With germ line therapy, the possible beneficial effects could quickly move into the population at large and
|
transfection—the process of incorporating DNA from an external source into the nucleus of a eukaryotic cell. transformation—the process of incorporating DNA from an external source into the genome of a bacterial cell. nanogram-1/1000 of a microgram. somatic cell—a cell from the body of an organism that carries out some contributory function there other than becoming a sex cell. germ line cell—any cells within the developing embryo whose descendant cells will become sperm or egg cells in the mature adult |
Figure 7.34 Germ Line Cells. Somewhere, early in development a cell arises in the embryo from which all precursor germ cells and eventually all sex cells in the mature adult will arise. This separate cell lineage does not contribute to the function of the organism. Rather it produces the new generation of individuals.
might eventually eradicate the genetic defect from the population. Many individuals would be spared the disability as a result of one investment of effort. But possible serious side effects could also occur. Once human-engineered genes enter the germ line of the population, they would affect countless cells in an ever-expanding group of individuals. These genes could hardly be withdrawn from the population. A horrible, unstoppable error could be perpetuated in this way. By contrast, changes merely to somatic cells are lost when the individual harboring them dies. Current efforts at human gene therapy, despite growing sophistication, still lack critical controls. For these reasons, governmental
authorities have required that human gene therapies respect the Weismannian boundary described here. Only alterations of human somatic cells are allowed and then only with careful review by peers. By contrast, gene engineering experiments in plants have no such boundaries. Those involving animals need respect only the boundary of cruelty to obviously sentient (self-conscious) forms.
Weismannian border—the conceptual divide between somatic cells and germ line cells; gene therapy in humans employs only somatic cells.
IN OTHER WORDS
1. Genes for hemoglobin, insulin, anticoagulation of blood, ice nucleation protein, bacterial toxins (and many other proteins) have been recombined with DNA from other sources and engineered into novel sites in new genomes.
2. Genetic engineering requires selecting a gene, selecting a cell type in which it will be expressed, creating useful flanking sequences for the gene, inserting the gene into the target cells, and assaying to determine that the gene is functioning as was hoped.
3. Scientists have used the normal gene for mouse hemoglobin to cure mice of sickle cell anemia.
4. Scientists have used bacteria and plants to generate large quantities of human insulin.
5. Insertion of genes into human cells has been restricted to somatic tissues only; placing novel gene combinations into human germ line tissue is currently not acceptable.
Essentials of Recombinant DNA Technology
The examples of genetic engineering just cited may leave you wondering if scientists are also magicians. Many elegant DNA technologies have been developed. Detailed descriptions are beyond the scope of our text. Instead, in question and answer format, lets observe some of the basic means by which DNA is manipulated and genes get engineered into new cellular environments.
How is DNA isolated away from the other parts of the cell?
Cells containing desired DNA are physically torn open in homogenizers or sonic wave generators (see Figure 7.35), or chemicals that disrupt cell membranes are used. We then employ salts and enzymes to get rid of polysaccharides and RNA. An organic compound, phenol, is often used to denature membranes and proteins. The goal is to remove other polymers leaving one polymer—DNA—in solution. DNA can then be brought out of solution using ethyl alcohol. This alcohol precipitation leaves many small monomeric molecules behind.
How are long polymers of DNA reduced to gene-sized segments?
A collection of enzymes called restriction nucleases have been isolated from a variety of bacterial and fungal cells. These enzymes were brilliantly designed to efficiently deactivate foreign (viral) genes entering a cell like invaders hiding in a Trojan horse. If viral DNA is expressed, the products take over the workings of the cell. How can viral DNA be quickly deactivated without some enzyme having to slowly chew off nucleotides from each end of a long viral genome? A given restriction nuclease recognizes a specific sequence of bases in the DNA that is usually six to eight base pairs in length. The
phenol—an organic compound that denatures membranes and proteins, bringing them out of solution so that they can be removed from the system, leaving highly polymerized DNA behind.
restriction nuclease an enzyme that recognizes a specific
sequence of six to eight base pairs along a double-stranded DNA molecule; it creates within the base sequence a staggered break in the DNA characterized by single-stranded DNA ends.
DNA Isolation
1. Disrupt Cells Internal contents released
2. Remove/ precipitate polysaccharides if necessary
Polysaccharide polymers gone
3. Precipitate proteins, membranes IProtein, lipid polymers gone
4. Enzymes degrade RNA to monomers
1
DNA polymer, all other cell monomers remain
I
All cell monomers remain in solution 6. Discard monomers
Figure 7.35 DNA Isolation. The procedure at each step of the isolation varies considerably depending on the nature of the cell type from which the DNA is isolated. Newer, proprietary approaches abound.
Figure 7.36 Restriction Nucleases. (a) Amazing enzymes that are prepared to make a staggered cut through the DNA double helix, but only at sites where a precise DNA base sequence is present. Imagine the precision of design inherent in the active site of this enzyme! (b) Such breaks will occur randomly but fairly frequently within the genome of the cell.
nuclease makes a staggered cut at that sequence (see Figure 7.36a). Since the recognition sequence shows up (by chance?) only every 1000 base pairs or so, the nuclease, when incubated with a DNA sample will degrade long polymeric segments in the sample to gene-sized segments of various lengths (see Figure 7.36b). In nature, this means that critical viral genes cannot be transcribed. In the lab, a chosen sample of DNA from some cell of interest can be degraded such that one segment may well contain our gene of interest. If not, there are hundreds of different restriction nucleases with differing recognition sites that can be tried. One of them will leave our gene of interest in a gene-sized segment. Now it must be found!
How do these gene segments get chemically linked with genes from other organisms?
Suppose we place DNA from two separate sources into one tube. We then add a restriction nuclease isolated from the bacterium E. coli that lives in our bowel. That enzyme, EcoRl, recognizes the base sequence GAATTC/CTTAAG in double-stranded DNA and makes a staggered cut across the double helix exactly as shown in Figure 7.36a. The product of the cut is two segments of DNA with what we call "sticky ends." The two cut ends could easily base pair with each other: Their sequences are complementary. There just isn't enough available energy for them to covalently rejoin. However, if the complementary sticky ends do "find each other" briefly in solution, another DNA handling enzyme called
nick
5 G AATT C 3'
11111 1111 11111
C TTAA G 5'
nick
DNA ligase action
5' GAATTC 3'
3' 5'
Figure 7.37 Ligation. Ligase enzyme was created in order to repair single-stranded nicks or breaks in the sugar-phosphate backbone of the DNA molecule. How very useful it become to genetic engineers. How fortunate that they did not have to design it before being able to use it!
ligase (Lt., liga- = to bind or tie) could quickly glide over that base-paired region and reform the originally broken covalent bonds. Now remember, we're using DNA from two different sources. So sticky ends of two DNA molecules from the two different organisms can get together, and the ligase can join them. The result (see Figure 7.37) is recombinant DNA—a possibly quite novel gene combination.
How can you find the particular DNA segment you want?
We begin by controlling the DNA sources in the mixing experiment described previously. One source is the genome of the cells that contain the gene we wish to fish out—like a needle from a haystack. The other source of DNA is millions of copies of a single, small, circular, double-stranded DNA molecule called a plasmid. Plasmids were discovered in bacterial cells where their DNA codes for functions less "basic," more optional, than the genes on the bacterial chromosome. Small plasmids containing about 3 to 15 genes are a nice size for this work (see Figure 7.38). Because they are short, we have already learned the DNA base sequence of many of them. Before bacterial cells divide, they replicate their chromosomes and in some cases duplicate their plasmids
EcoR1—a restriction nuclease that recognizes the base sequence GAATTC/CTTAAG in double-stranded DNA; it creates single-stranded ends with the sequences—AATTC and CTTAA‑
ligase—an enzyme that recognizes breaks in DNA molecules between sugars and phosphates along the DNA backbone; it repairs these breaks.
plasmid—a small, circular piece of double-stranded DNA found within a cell; it contains a far smaller number of (functionally less critical) genes than are found in a cell's chromosomal DNA.
|
0 |
0 |
Figure 7.38 Plasmids. (a) a color-enhanced electron microscope image of a circular plasmid DNA isolated from a bacterium. A bacterial chromosome would be hundreds of times larger. (b) This plasmid has about 5 different genes carefully engineered onto it. The purple and blue ones enable the engineer to be certain a bacterial cell contains this plasmid. The red gene has cut sites for about 22 different restriction nucleases, any of which can be used to open up the plasmid for
insertion of foreign DNA. Such insertion disrupts the lacZ gene, destroying it's function. Within a bacterial cells such loss indicates that foreign DNA is in the plasmid at that point.
up to a hundred or more copies per cell. Thus it is not difficult to get many copies of a single plasmid.
We carefully mix equal amounts of DNA from our two sources and add our selected restriction nuclease. Based on our knowledge of the plasmid's DNA base sequence, we already know that the nuclease will cut it open in exactly one place (see Figure 7.39). This will make our plasmid a linear, double-stranded piece of DNA. If we cut both our DNA and our plasmid with the same restriction nuclease, we'll have two sets of linear molecules all having the same sticky ends. Controlling the dilution of our DNA segment mixture, we then allow the sticky ends to bond with each other and we use a ligase enzyme to paste DNA segments together. The result is a whole library of different gene sequences, each one nested within a small plasmid whose DNA sequence we know (see Figure 7.39).
But how can a plasmid help you find your gene of interest?
We have extensively cut and pasted DNA sequences on these plasmids; they are highly engineered. Look again at Figure 7.38. This plasmid has a site where it can be cut open with a wide variety of restriction nucleases for insertion of our gene of interest. We well know the DNA sequence to either side of that cut site. We haven't isolated our specific gene yet. But that gene is now isolated into a plasmid away from all the other genes of its genome. Once we find it, our restriction nuclease that enabled it to combine with the plasmid will pop it back out and give it to us in pure form. What we have is like a school library's information neatly separated into discrete "books." But there's no catalog. So now we must find the one book we are looking for.
How might you find the gene that codes for insulin from a huge collection of plasmids?
Insulin is a small protein. It is fairly similar in cows and humans and biochemists can purify it from pancreas tissue. It is now possible to begin lopping off amino acids from the front end of the protein and identifying them. Because insulin is a small protein, its amino acid sequence has been known for years. But suppose we knew only the first seven amino acids in the protein. Using the genetic code we could write down a small variety
library—a collection of gene-sized pieces of DNA each inserted into a plasmid or other vector. The collection, taken from a single cell type, is large enough to include all the genes present in a cell's genome.
Figure 7.39 Library Construction. Building a library of the genome of an organism involves cutting and pasting millions of randomly generated genomic fragments into millions of copies of the same, well studied plasmid. The plasmid is the"book cover' The"content"is the foreign DNA sequence.
of nucleotide sequences 21 base pairs long that would code for those seven amino acids (see Figure 7.40). Why could we not write down a single sequence? Suppose we designed several nucleotide sequences of single-stranded DNA. These could all be produced using current gene machine technology. We then use a population of millions of these 21-nucleotide-long sequences as probes. When they
|
polymerase chain reaction a technique that replicates a single or few copies of a segment of DNA by several orders of mag‑ nitude, generating millions of copies of a particular DNA sequence. primer—a short sequence of single-stranded DNA that, by base pairing with a much longer template strand of DNA provides a substrate for DNA polymerase to lengthen using the template sequence as a guide. |
· PCR can operate on double stranded DNA within a plasmid library.
· When double-stranded DNA is held at 92° C it melts apart into single strands. Each strand is now a template to copy against.
· Single-stranded DNA Primers with
sequence complementary to the front end of the gene or plasmid sequence are now added along with a thermo-stable DNA polymerase.
· The system is cooled to about 60° C so
base pairing between primers and regions of complementary base sequence can begin.
· The substrate for DNA polymerase is a suitable template to read and a primer
sequence to add to. These conditions met, the polymerase "takes off” copying DNA strands.
· Reheating to 92°C will melt apart all the newly generated double-stranded DNA.
· The system is returned to 60° C again.
Primer now provides four strands of complementary sequence against which the
polymerase can work. The gene of interest is doubled in frequency again in the population of sequences.
· The cycling continues as more and more polymerase product gets copied and recopied. Soon the gene of interest becomes the major component in the DNA of the library.
|
0 |
|
Figure 7.41 Polymerase Chain Reaction. (a) Small primer sequences of single-stranded DNA (shown in red) drift through melted, single-strand plasmid libraries binding to genomic DNA sequences that their base sequence is complementary to. A special DNA polymerase recognizes the ends of these primers and builds gene sequence onto them, making more copies of the gene being searched for. (b) Shelves of machines busily running PCR amplication of genes.
left-hand side of the insulin gene. Corresponding primers for the right-hand side of the gene can be made to be complementary to the first 21 base pairs in the plasmid DNA sequence after the insertion point where the insulin gene is located. This plasmid sequence is well known. In the PCR process, the entire population of plasmids we created earlier would be placed at 92°C. At this temperature, the hydrogen bonds between bases in the double helix of DNA melt apart and DNA becomes single stranded. The temperature is then lowered slightly and our primers are added along with DNA polymerase, an enzyme that makes new copies of DNA strands. The DNA polymerase used here is one that functions well at very high temperatures. The primers we added wander around within our sample of all the genes in the genome until they find a sequence they are complementary to—the front end of the insulin gene and the tail end of the plasmid just after the insulin gene. As soon as the primers base pair with these sequences, they become a reactant for the enzyme DNA polymerase. Because a DNA strand's chemistry has an orientation to it (see Figure 7.9), the polymerase will only copy forward on one strand of DNA into the front end of the insulin gene and backward on the other strand into the tail end of the insulin gene (see Figure 7.41).
How does replication of the insulin gene help us to find it?
After enough time has elapsed to copy through the insulin gene, the temperature of the system is suddenly raised to 92°C again. All DNAs melt apart again and become single strands. More primer is added. When the temperature is brought down again and strands can rebond to each other, there are now four single strands of insulin DNA that can be read during a second cycle of the process. If the process of raising and lowering temperature and adding primer is allowed to go on for about 30 cycles, there will soon be a billion copies of the insulin gene while all other genes in the genome remain essentially uncopied. At this point, a simple biochemical separation technique can be used to isolate the desired plasmid containing the insulin gene.
Once you have your gene, how do you get it into human cells?
Various techniques have been studied for this purpose. One is transduction—using viruses to carry genetic information into cells. Historically, the preferred technique has been to cut human genes from plasmids and ligate them into retrovirus genomes (see Figure 7.42). Retroviruses are very
Figure 7.42 Retroviruses. Among these viruses are those that cause AIDS, and various cancers, particularly leukemias. Thousands of retroviruses could fit within a single host cell.
efficient at entering certain human cell types and integrating their genomes into our chromosomal DNA. Their genome is composed of RNA, not DNA. But the virus has a specialized enzyme that constructs a double-stranded DNA sequence from the RNA genome (see Figure 7.43). This process is called reverse transcription. The double-stranded DNA is then picked up by another viral enzyme called integrase and incorporated directly into the human host cell's DNA. Thus this difficult part of
DNA polymerase—an enzyme that reads a sequence of bases along a single strand of DNA and constructs a complementary strand of DNA using nucleoside-triphosphates as substrates.
transduction—a process by which a virus carries foreign DNA into a host cell; the DNA is then expressed within the host.
retrovirus—a subcellular infectious particle whose genome is composed of RNA. In the infection process, the RNA is reverse-transcribed into double-stranded DNA, which integrates into the host cell genome.
reverse transcription—the process of using RNA base sequence to construct, first a single strand of DNA, and from that, a second complementary strand of DNA thereby replacing RNA-based information with DNA-based information.
integrase—an enzyme that recognizes similarity of base sequence between two double-stranded DNA molecules and then breaks covalent bonds in each molecule such that the two strands exchange ends with each other; integrates viral genes into host cell DNA.
Figure 7.43 Retroviral Infection. (a) Viral Entry. The viruse's envelope protein binds to a host cell surface receptor protein (that has some other"normal"function.)
This releases its RNA genome into the host cell cytoplasm where it is reverse transcribed into DNA and integrated into the host cell's DNA. This latent (quiet) proviral "presence" in the cell can last for days or years. (b) Stimulation of the cell to a high activity level can also promote return of the provirus to more activity. It's genome gets transcribed and translated to generate mature virus particles that then leave the host cell taking a bit of host cell membrane with them as they go.
gene therapy—getting the therapeutic gene incor‑ porated into the cell's genome—has been designed for us! Retroviruses can be produced in cultured
|
0 |
|
|
p t gene |
|
|
Therapeutic gene with promoter |
|
|
0 |
|
|
C R I Nr gag pol env |
R 1 poly-A |
|
Retroviral genome |
|
|
0 |
|
|
C Rh, |
RI poly-A |
|
Retroviral genome with structural genes removed |
|
|
0 |
|
|
p t gene poly-A |
|
|
Therapeutic retroviral genome |
|
Figure 7.44 Recombining Genomes. (a) the therapeutic gene that has been found using PCR amplification. (b) the normal retroviral genome shown as an RNA ready for translation into viral proteins (note the cap and tail). (c) the parts of the viral genome that must be retained for proper packaging and integration later (d) the newly engineered retroviral genome with its therapeutic gene embedded.
cells from which the virus is harvested, disrupted, and the genome isolated.
How does the retrovirus genome serve the genetic engineer?
The retroviral genome (see Figure 7.44b) contains highly useful repeated sequences at each end, which are read by a viral integrase enzyme. These same sequences occur in the human genome! The enzyme matches the human sequences up to the viral ones and then recombines the viral genome right into the host cell's DNA at that site. Also, within the viral genome, between the terminal repeat sequences, are four additional useful gene regions. One of these, called psi NI, is a tag that is read during production of new virus particles. The psi sequence causes the virus' RNA genome to be properly packed into the outer protein coat that will protect it while the virus is outside the cell. The other gene regions, gag, pol, and env code for critical viral proteins: Gag codes for viral coat proteins, env codes for viral surface proteins that bind the virus to its host cell, and pol codes for the polymerase and integrase enzymes that process the viral genome and move it into the host cell DNA (see Figure 7.42).
How is a nasty retrovirus rendered "therapeutic" ? The trick is to produce a complete retrovirus with its surface proteins, coat, and enzymes all functioning properly. But in its genome, we will re‑ place genes critical for further viral reproduction with a therapeutic human gene! We use a restriction
t gene I A H
Transcription
•
|
p t gene R |
Figure 7.45 Virus Packaging Cell. Retroviral structural genes have been engineered into the cell genome permanently. The therapeutic viral genome is transfected into the packaging cell within which it is then transcribed into multipe copies. The psi function allows them to be packaged into newly assembled virus capsids.
As they leave the cell, the viruses get enveloped with surface proteins that will gain them entry into patient's cells complete with enzymes that will repicate and integrate the therapeutic gene into the patients cells genomes. Humans are"second generation"designers!
nuclease to cut out the gag, pol, and env genes and discard them (see Figure 7.44c). Then we use a ligase enzyme to paste a therapeutic human gene into the space between the two ends of the viral genome (see Figure 7.44d). The resulting virus will then neatly take that gene into our host cell, insert it into the genome, and then, lacking its structural gag, pol, and env genes, be unable to proceed any further with its infection process! The main problem with this is that we need the products of these structural genes to make functional therapeutic viruses in the first place.
How do we then make these therapeutic viruses? Gene engineers have created what's called a packag‑ ing cell line. They keep these cells in culture (see Figure 7.45). The packaging cell has viral envelope, poly‑ merase, and group antigen (gag) genes incorporated
right within the cell's genome. But the packaging cell has no viral psi gene region—there is no way it can destroy itself ahead of time by accidentally producing viruses. Scientists then use a lipid-like carrier molecule to transfect the packaging cells with engineered therapeutic viral DNA. The lipid carrier takes the DNA through the cell membrane and the nuclear membrane where host RNA polymerase is found.
cell culture—the process of growing cells from a multicellular organism in dishes or bottles or on slides using a growth medium complex enough to support the growth and division of those cells apart from the host organism.
carrier molecule—a lipid-like polymer that attaches to DNA molecules and transports them into eukaryotic cells.
The packaging cell can do all the rest for us (see Figure 7.45). It transcribes the therapeutic virus genome into RNA copies appropriate for insertion into mature virus particles: The psi region was left intact in the therapeutic virus genome so it is present on these RNAs. A chemical signal added to the medium caused the packaging cell to transcribe and translate the in-house gag, pol, and env genes so that mature virus particles are generated. Each particle will have stuffed within it the therapeutic human gene plus the enzymes necessary to reverse transcribe the gene from RNA to DNA and the integrase needed to get the therapeutic gene incorporated into the human cell's DNA. What a triumph of human design technology!
What do we do with these therapeutic viruses?
We harvest them from the packaging cell culture (see Figure 7.46). They are used to infect a sample of the human somatic cells whose behavior we wish to correct. Again, this work is done by culturing the patient's cells apart from the patient. The cultured cell sample is then infected with the therapeutic virus. Finally, the genetic engineer must devise a simple way to select the cells that now have corrected function from among the remaining non-transduced defective cells. This may require getting individual patient cells into separate culture wells, growing them up as clones, and, for example, assaying individual clones for enzyme function.
Gene Therapy, Clinical Stages
Patient somatic cells in culture
••••: : •
•••
Shed
Packaging therapeutic cells viruses
_0. Returned
Virally infected to patient
patient cells in Assay for
culture function
Figure 7.46 Gene Therapy, Clinical Stages. The therapeutic viruses generated by packaging cells are incubated with cells in culture taken from the patient. After infection occurs, the cells are assayed for correct functioning of the therapeutic gene and after several rounds of division are returned to the patient.
The cells with corrected gene function are then returned to the patient, where it is hoped that they compete favorably with the defective cell population remaining in the patient's body. In the cases where human gene therapy has been successful in the past (see below), patients required continuing occasional infusions of corrected cells to grow alongside of defective cells that continued to survive in the patient's body.
IN OTHER WORDS
1. DNA can be isolated from a variety of tissues using physical or chemical disruption of cells followed by various chemical purification steps.
2. Long polymeric DNA molecules can be reduced to gene-sized pieces with complementary base-pairing sticky ends. Restriction nucleases are used for this purpose.
3. Two separate populations of DNA molecules with such sticky ends can be mixed in one tube and ligated together such that recombinant molecules are produced having DNA from two distinct species.
4. Stable libraries of genomic DNA from a given cell type can be built by inserting DNA from that genome into the DNA of well-studied plasmids.
5. Information about the amino acid sequence of a protein can be used to construct primer sequences for the polymerase chain reaction process.
6. PCR is a process that uses primers and DNA polymerase to generate enormous numbers of DNA sequences built off of the same primer molecule.
7. A large uniform population of therapeutic genes can be ligated between the left and right ends of retroviral genomes to generate a therapeutic viral genome.
8. Packaging cells can incorporate the therapeutic genome into infectious virus particles in cell culture.
9. Therapeutic viruses can be incubated with cells from a patient needing gene therapy. The patient's cells can be assayed for successful virus integration and therapeutic gene function.
10. Cured patient cells can be reintroduced to the patient, where they must compete with noncured cells in order for the patient to experience relief from the genetic disease state.
Figure 7.47 Approaches to Gene Therapy. (a) Specific replacement therapy involves precise intra locus replacement of a defective gene by a normal one.
(b) Augmentation therapy seeks to stably add a normal gene to a cell without concern for the defective gene or the effects of its products. In both cases, some integrase enzyme is probably seeing base sequence similarities between sequences to either side of the therapeutic gene being inserted and sequences in genomic DNA. This is what results in the recombination events (the X's in the diagram) that brings the therapeutic gene into the genome.
The Sobering Early History of Human Gene Therapy
The first documented attempt at controlled human gene therapy was carried out in 1990 at the National Institutes of Health on a four-year-old girl named Ashanti DeSilva. At that time, two conceptual approaches to gene therapy were known. The one approach, called specific replacement therapy, would send a therapeutic gene into her cells in such a way that the defective gene would be removed from the nuclear DNA (see Figure 7.47a). The therapeutic gene would be recombined into the precise site from which the defective gene had been removed. In 1990, specific replacement therapy was not technically possible. So the only other approach—augmentation therapy—was followed (see Figure 7.47b). In this process, the more humble hope is to get a therapeutic gene incorporated and functioning somewhere within the genome. The mRNA from the therapeutic gene must outcompete or somehow compensate for mRNA coming from the defective gene that is still present. Was
this a simplistic assumption or was it a reasonable hope? Surely that would depend on the nature of defect in the nonfunctional gene.
Ashanti suffered from a genetic disease called severe combined immunodeficiency (SCID). She had very few functioning lymphocytes and, as a result, would be subject to a short life filled with endless infections, one of which would ultimately be her demise. Her particular version of the disease resulted from a defect in a single gene, Ada, coding for the enzyme adenosine deaminase. Since her Ada gene product was not working properly,
|
specific replacement gene therapy a process by which a normal, functional gene is directly (spatially) substituted for a defective gene within a cell. The defective gene is removed and the normal one precisely takes its place within the genome. augmentation gene therapy—a process by which a normal functional gene is permanently inserted and expressed within the genome of a defective cell. The defective gene in the cell remains; the location of the normal gene within the genome is not specified. |
augmentation therapy seemed like a reasonable approach. After all, wouldn't a therapeutic version of the Ada gene simply enter the nucleus, get integrated, and begin functioning? If her defective gene produced either no mRNAs or mRNA coding for a nonfunctional enzyme, wouldn't a therapeutic gene product rescue her lymphocytes and get them functioning normally?
Modified retroviruses were used similar to those described in Section 7.4c. A helper cell population was transfected with a therapeutic viral-Ada' genome and therapeutic viruses were made. A few surviving lymphocytes were isolated from Ashanti and transduced with therapeutic virus particles in culture. Joy abounded when her cell populations began to produce functional adenosine deaminase! These new healthy lymphocytes were given back to her by injection, and soon her disease symptoms began to wane. The day was a triumph for molecular medicine.
Subsequent results with SCID patients have seen guarded success. But most patients require subsequent infusions of corrected cells. They don't seem to be able to convert stably to the Ada' condition. In some cases, their immune systems slowly destroy the corrected cells possibly because of residual viral (foreign) components (see Figure 7.48).
But a more insidious problem has surfaced. Back in the 1980s, when gene augmentation therapy was being considered, evolutionary assumptions about the organization of the human genome were naive. It was hoped that the therapeutic Ada gene would integrate harmlessly somewhere in the large amounts of randomly distributed junk DNA that appeared to constitute much of the human genome. But such harmless, nonspecific integration events
Possible SCID Patient Lymphocyte
|
|
|
|
|
|
|
|
|
|
Transcription |
|
|
|
|
|
|
|
|
Residual defective RNAs |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
-I- I Ada-- I |
|
|
|
|
|
|
|
|
|
|
|
Lost RNAs |
|
|
|
Cell nucleus |
|
|
|
|
|
|
111111 Viral (foreign) proteins on cell surface. |
|
|
|
|
||
|
|
Lost control of cell division |
"Visible" to immune system
Figure 7.48 SCID Patient Lymphocytes. The theraupeutic Ada gene is transcribed and translated successfully. But the original defective gene is still present. The site
of integration of the therapeutic gene is not controlled. This cell shows the gene inserted into a"proto-oncogene"—a gene whose malfunction results in the loss of control of cell division.
appear not to be the rule. Soon, patients who'd conquered SCID began developing leukemia—a form of lymphocytic cancer. Of 20 trials in Europe, five patients developed the disease. As a result, clinical trials in the United States were halted. It appears that the therapeutic viral genome is being integrated a bit more systematically than was hoped—integrating into the middle of genes whose consequent dysfunction is causing leukemia (see Figure 7.48). The relationship between the retrovirus and the human genome is more sophisticated than we'd supposed.
Specific gene replacement therapy is now being carried out successfully in mice. It will not be long before human studies succeed as well. Such therapies should avoid the errant integration events that predispose to leukemia. In retrospect, viewing the virus—human genome interaction from a design perspective rather than an evolutionary one may have enabled us to approach gene therapy in humans with a more appropriate caution. At the very least, secondary effects of the therapy might have been more prudently anticipated. Everywhere we look within the human cell and within the retrovirus, we see design. Specific gene replacement will completely succeed only when we take all of this design into account.
IN OTHER WORDS
1. Gene therapy has been successfully employed to temporarily cure severe combined immunodeficiencies (SCID) in cases where they are due to a dysfunctional adenosine deaminase gene.
2. Success in these efforts has been limited by the short-lived expansion of treated cell populations within the patient and the occasional insertion of the therapeutic gene into a functionally critical gene regulating cell division rates.
3. Viewing the virus-host cell relationship from the perspective of design will be a superior approach to future research in the field of gene therapy.
|
|
DRAMA: INFORMATION EXPRESSION AT ITS VERY BEST |
The prospects for biotechnology are bright! There are many exciting changes we will soon be making by expressing newly acquired information in novel ways. To save our dwindling modesty from morphing into undue presumption, let's finish this chapter on information expression by imagining a miracle. Imagine journeying to Ely, England and discovering two Ely cathedrals right next to each other, both just slightly smaller than the original one, both possessing all the intricacies and glory of the original one. What would the news media do with
that one? (Who in the world could be responsible for such a spectacle?) Now, think again of the green alga Micrasterias or any other microbial life-form. That wonderful miracle of self-replicating is happening constantly in mud puddles, in the backs of refrigerator drawers, and even within the microbial community in your own bowel. Complexity generating more complexity—this drama can only happen because living things have been provided with a vast and glorious store of information to express.
QUESTIONS FOR REVIEW
1. In what ways is information expression in a cell superior to that in the construction of an ornate part of a building?
2. Explain why the scientific community has at 8. various times referred to the same molecule as nuclein, gene, and DNA.
3. Griffiths injected material from heat-killed virulent bacteria along with nonvirulent liv‑ ing bacteria into a mouse and discovered that 9. the mouse soon dies. List two different control studies he must do, and the result he must get before his conclusions about transformation become justifiable.
4. What characteristic of enzymes makes their use 10. in Avery's experiments so powerful in helping him reach his conclusions?
5. Consider some molecular details of Figure 7.9. What would be the effect on the double helix of 11. allowing adenine to occasionally pair with guanine? cytosine with thymine? What feature of 12. DNA's final structure was being constrained by Chargaff's findings about the relative amounts of adenine and thymine in his DNA samples?
6. Whose contribution to the discovery of the 13. double helix was more important, Rosalind Franklin's or Watson and Crick's? Explain your 14. response.
7. You have isolated a short piece of DNA. The base sequence of one of its strands is
TGAGGAATCCTTCTT. Starting from the left-hand end, what would be the sequence of bases on the complementary strand?
In order for Theodor Boveri to assert that all of a sea urchin's chromosomes must be present and normal in order for development to proceed normally, what must he have been observing in his studies?
Look up the terms transcription and translation in a dictionary to see how they are used in relation to words. Why is the term transcription applied to mRNA production? Why is the term translation applied to the production of protein? If the middle of an exon in a sense strand of DNA read as –GGTACCTAATT– what base sequence would be found in a pre-mRNA at that point? in a mature mRNA at that point?
List two possible structural differences between a ribonucleotide and a deoxyribonucleotide. Predict what would happen to transcription in a bacterial gene if the termination sequence was altered (mutated) such that RNA polymerase would not recognize it.
List three differences between pre-mRNA and mature message.
After having read the section of the text on transcription, list two questions that are in your mind in regard to how gene expression is controlled.
15. In bacteria, transcription and translation can be happening to the same mRNA at the same time. How is this possible?
16. What are the four essential molecular components of the translation process?
17. Before tRNA's existence was demonstrated or its structure known, it was presumed to exist and was called the adapter molecule. Why was it given that name?
18. What is the functional role of a tRNA synthetase enzyme?
19. Which translation functions are served by the small ribosomal subunit? by the large subunit?
20. What is the role of tRNA in translational initiation? in elongation? in termination of translation?
21. Translate the following mRNA into a peptide chain:
—AU GACACACACACACACACACUAAU GA‑
22. A very important kind of cell surface protein is the glycoprotein, a protein that has sugar groups attached to it in its final form. List all the organelles involved in its production.
23. What is the value of having a genetic code that is degenerate?
24. Of the five examples of gene engineering in Section 7.4b, which ones represent genes now flowing in the germ line of engineered organisms?
List the steps involved in a typical gene therapy study.
What is transfection? How does it differ from transformation?
List the steps involved in making a plasmid library of the mouse genome.
What is the function of ligase? Use the phrase covalent bond in your answer.
When mixing cut plasmid DNA with cut genomic DNA, why is it critical to control the concentration of each DNA going into the mixture? If you we asked to isolate from a genomic library the structural gene that codes for a protein that you've studied quite a bit, what would be your strategy for finding the gene?
For what purpose does a researcher use PCR? Why were cancer-causing retroviruses chosen for development of a way of getting DNA into human cells?
Why is a packaging cell a necessary step in getting therapeutic viruses into human cells? Why not simply add a therapeutic gene to a virus genome and directly infect a patient's cells with it?
List two problems researchers have encountered in using the augmentation therapy approach to cure SCID patients.
QUESTIONS FOR THOUGHT
1. Consider the humble laborer standing beside a half-finished cathedral perfecting a stone to go into its wall. To which cellular organelle would he be most analogous?
2. You spent some time learning about atoms. Was that time wasted? Consider the atoms sulfur and phosphorus. How has our knowledge of these atoms helped us define and describe what DNA is and what its function is?
3. Assume for a moment that your body has 60 trillion human cells in it. (It has more bacterial cells than that within its structure.) Using the figure given in this chapter for DNA length per cell, what is the total length of the DNA in your body? (There are 1609 meters/mile.)
4. What function of a DNA molecule is principally served by coiling it up tightly through several levels of compaction? What function then is
served by unwinding it to the relatively loose orientation seen in chromatin?
5. Since DNA has sufficient information for guiding protein structure and ribosomes are able to read base sequences directly, what would be the principle problem with using DNA directly to translate proteins?
6. Suppose a serious defect occurred in the promoter sequence of a gene. (We call these defects mutations). Which is more likely, that the mutation would result in a defective, nonfunctioning gene product or no gene product at all? Explain your choice.
7. The existence of transfer RNA was predicted a couple of years before it was discovered. How is that possible? What assumptions was the theoretician making?
8. What assumption is a scientist making when he refers to a sequence of DNA as junk?
9. Why are codons not two base pairs in length? Why are they not four base pairs in length?
10. How many different kinds of structures and molecules must a tRNA molecule fit or conform to structurally? What are the sources of constraint on its structure?
11. In order for translation to evolve so that proteins can be made, which must evolve first, synthetase enzymes or transfer RNAs? Explain your reasoning.
12. Is peptide bond formation an exergonic reaction or an endergonic reaction? Explain.
13. Think about the meaning of the genetic code. Think about the minority of organisms whose code varies from the normal one. Why might their codes vary in slight ways?
14. Which of the following diseases would probably be the most difficult to eradicate: sickle cell anemia, typhoid fever, or clinical depression? Explain your reasoning.
15. Which of the following examples are descended from germ line cells: liver tissue, ovarian follicle cells, sperm cells, pharyngeal epithelial cells, seminal vesicles, egg cells?
16. In bacterial cells where restriction nucleases are present for destroying the occasional intrusion of viral DNA, there is always another enzyme present called a methylase. This enzyme add methyl groups (–CH3) to DNA at the same sites where restriction nucleases normally make their cuts. What might be the purpose of such methylases?
17. Figure 7.38 diagrams a plasmid that has two antibiotic resistance genes on it. Where would you expect to find a bacterium that contains this plasmid?
18. The developer of PCR won a Nobel Prize for his efforts. Why is this procedure considered so valuable?
19. What is the value of infecting patient cells in culture? Why not simply introduce the therapeutic virus directly into a patient's bloodstream?
20. Suppose you had a young daughter with SCID. Would you be willing to submit her to currently available therapy and sign a document stating that you would not litigate against a clinic or a physician if the therapy does not yield the results you anticipate? Explain your position.
GLOSSARY
algal—of or referring to algae, a diverse, relatively simple, autotroph form of life typically found in fresh water or marine habitat; they lack distinct organs.
anticodon—a sequence of three adjacent nucleotide bases in tRNA that are complementary in sequence to an mRNA codon; the tRNA carrying it also carries the correct amino acid corresponding to the mRNA codon.
augmentation gene therapy—a process by which a normal functional gene is permanently inserted and expressed within the genome of a defective cell. The defective gene in the cell remains; the location of the normal gene within the genome is not specified.
cap—a guanine ribonucleotide with three phosphate groups and an additional methyl group that is attached to a pre-mRNA during processing; this structure assists in ribosomal attachment to a mature mRNA.
carrier molecule—a lipid-like polymer that attaches to DNA molecules and transports them into eukaryotic cells.
cell culture—the process of growing cells from a multicellular organism in dishes or bottles or on slides using a growth medium complex enough to support the growth and division of those cells apart from the host organism.
chromatin—fibers within the cell nucleus consisting of DNA periodically stabilized by being wrapped around protein spheres called nucleosomes.
chromosome—a highly coiled and organized arrangement of a single DNA molecule within the nucleus of a cell; used to transport DNA to a daughter nucleus.
codon—a sequence of three adjacent nucleotide bases in mRNA that code for a single amino acid in a sequence within a polypeptide chain or protein.
complementary—in nucleic acids, describes the appropriately sized nucleotide bases from opposite strands of a double-stranded DNA (adenine with thymine, guanine with cytosine) that pair via hydrogen bonds, thereby holding the double-stranded nucleic acid together.
degeneracy—absence of a one-to-one correspondence between codon sequence and the amino acid coded for; rather, several codons code for the same amino acid.
DNA polymerase—an enzyme that reads a sequence of bases along a single strand of DNA and constructs a complementary strand of DNA using nucleosidetriphosphates as substrates.
DNase—an enzyme that catalyzes the breakdown of DNA either into smaller segments of DNA or completely down to its nucleotide subunits.
domain—a structural region of contiguous amino acids within a protein that performs a specific component function within the overall function the protein performs.
EcoR1 —a restriction nuclease that recognizes the base sequence GAATTC/CTTAAG in double-stranded DNA; it creates single-stranded ends with the sequences—AATTC and CTTAA‑
elongation (transcription)—the movement of RNA polymerase along the DNA template strand generating a single complementary strand of RNA.
elongation (translation)—the movement of the ribosome along the mRNA generating a single polypeptide chain composed of amino acids.
exon—a sequence of nucleotides in DNA that are transcribed into pre-mRNA and that represent protein-coding portions of a gene; retained and joined together during processing to form a mature mRNA.
fraction—a single portion of a biological sample that is being separated into many such portions as part of a purification process.
gene—a segment of (usually) DNA that controls a single characteristic or trait of an organism.
genotype—the genetic makeup of—the informational specifications for—an organism.
germ line cell—any cells within the developing embryo whose descendant cells will become sperm or egg cells in the mature adult
GTP—guanosine triphosphate; a nucleoside triphosphate whose covalent bond between the second and third phosphates contains as much potential energy as the same bond in the ATP molecule.
hemoglobin—a protein with a quaternary level of structure consisting of four polypeptide chains, 2 a chains, and 213 chains. It transports oxygen from the lungs to the tissues.
initiation (translation)—the productive binding of mRNA, an initiator tRNA, and a small and large ribosomal subunit into a complex that enables translation to begin.
initiation (transcription)—the productive binding of RNA polymerase to DNA and the initial alignment of ribonucleotides such that transcription has begun.
insulin—a hormone in mammals that controls the absorption of glucose into the tissues from the bloodstream.
integrase—an enzyme that recognizes similarity of base sequence between two double-stranded DNA molecules and then breaks covalent bonds in each molecule such that the two strands exchange ends with each other; integrates viral genes into host cell DNA.
intron—a sequence of nucleotides in DNA that are transcribed into pre-mRNA and that separate protein-coding portions of a gene from each other; removed during processing to form mature mRNA.
junk DNA—a sequence of DNA believed to have no useful function; some see usefulness for it in the past, other see usefulness for it in the future.
library—a collection of gene-sized pieces of DNA each inserted into a plasmid or other vector. The collection, taken from a single cell type, is large enough to include all the genes present in a cell's genome.
Life Is Information Expressed—one of 12 principles of life on which this book is based.
ligase—an enzyme that recognizes breaks in DNA molecules between sugars and phosphates along the DNA backbone; it repairs these breaks.
micron (or micrometer)—is 1/1000 of a millimeter; the millimeter is the smallest division visible on a metric ruler.
mRNA—a class of RNA molecules that code for proteins and serve to direct the process of translation on ribosomes in the cell cytoplasm.
mutated, mutation—referring to changes in the base sequence of DNA; change of identity of one base for another, loss or addition of a base, loss or addition of multiple bases; some mutations result in serious functional loss or organismal death.
nanogram-1/1000 of a microgram.
nanometer—a distance of 1/1000 of a micrometer. Cells are measured in micrometers. Molecules are measured in nanometers.
nucleosome—a structural repeat unit within chromatin in which 147 base pairs of DNA are wrapped around a spherical protein core for purposes of stability and protection.
phenol—an organic compound that denatures membranes and proteins, bringing them out of solution so that they can be removed from the system, leaving highly polymerized DNA behind.
phenotype—the physical appearance of an organism resulting from the expression of the organism's genotype.
phosphorus—an element in nature widely distributed in nucleic acids but seldom found in newly synthesized proteins.
plasmid—a small, circular piece of double-stranded DNA found within a cell; it contains a far smaller number of (functionally less critical) genes than are found in a cell's chromosomal DNA.
poly(A) tail—a sequence of adenine ribonucleotides attached to a pre-mRNA following transcription; controls the length of time a mature mRNA will survive degradation in the cell's cytoplasm.
polymerase chain reaction—a technique that replicates a single or few copies of a segment of DNA by several orders of magnitude, generating millions of copies of a particular DNA sequence.
pre-mRNA—an RNA molecule that is an immediate product of transcription; it contains introns that must be removed before it can be translated into protein.
primer—a short sequence of single-stranded DNA that, by base pairing with a much longer template strand of DNA provides a substrate for DNA polymerase to lengthen using the template sequence as a guide.
promoter—a sequence of bases in DNA that guides an RNA polymerase to the precise position where initiation of transcription is to occur.
proteinase—an enzyme that catalyzes the breakdown of protein either into smaller segments of peptides or completely down to its amino acid subunits.
recombinant DNA—the use of nuclease and ligase enzymes to cut and join segments of DNA from the cells of two different species of organisms.
release factor—a protein that enters a tRNA binding site on the ribosome; sensing the presence of a stop codon, it causes translation to terminate.
restriction nuclease—an enzyme that recognizes a specific sequence of six to eight base pairs along a double-stranded DNA molecule; it creates within the base sequence a staggered break in the DNA characterized by single-stranded DNA ends.
retrovirus—a subcellular infectious particle whose genome is composed of RNA. In the infection process, the RNA is reverse-transcribed into double-stranded DNA, which integrates into the host cell genome.
reverse transcription—the process of using RNA base sequence to construct, first a single strand of DNA, and from that, a second complementary strand of DNA thereby replacing RNA-based information with DNA-based information.
ribonucleotide—a subunit of the nucleic acid polymer RNA; within RNA it is composed of a single phosphate attached to a ribose sugar that is attached to one of the nitrogenous bases adenine, cytosine, guanine, or uracil.
RNA polymerase—a protein; an enzyme that builds RNA molecules using free ribonucleotides and using a strand of DNA as a sequence template (guide) against which to build.
RNase—an enzyme that catalyzes the breakdown of RNA either into smaller segments of RNA or completely down to its nucleotide subunits.
rRNA (ribosomal RNA)—single-stranded nucleic
acids composed using ribose sugars and containing the nitrogenous base uracil instead of thymine. They form structural parts of ribosomes assisting with alignment of other RNA classes.
somatic cell—a cell from the body of an organism that carries out some contributory function there other than becoming a sex cell.
specific replacement gene therapy—a process by which a normal, functional gene is directly (spatially) substituted for a defective gene within a cell. The defective gene is removed and the normal one precisely takes its place within the genome.
splicing enzyme—small particles composed of protein and RNA that attach to pre-mRNA at junction points between introns and exons; they cut RNA at these sites, remove intron sequences, leaving exon sequences contiguous to each other.
start codon—the base sequence –AUG- in mRNA that codes for the amino acid methionine. This sequence is the first translated codon in most mRNA molecules.
stem cells—undifferentiated cells found in most organisms; cells that are able to divide continuously by mitosis and eventually differentiate into any of the types of cells found in the mature organism.
stop codon—one of three mRNA base sequences, –UAA–, –UAG–, or –UGA–, for which there is no corresponding amino acid; recognized by release factors that cause translation termination.
sulfur—an element in nature widely distributed in proteins (because of its presence in the amino acids cystine and cysteine) but never found in nucleic acids like DNA or RNA.
termination (transcription)—the process by which transcription ends, including the disassociation of RNA polymerase from its DNA substrate and the release of the mRNA or pre-mRNA product.
termination (translation)—the process by which translation is ended, including the disassociation of ribosomal subunits, mRNA, and a completed poly-peptide chain.
transcription—the process of reading a sequence of bases in DNA and generating from it a complementary sequence of bases in RNA.
transduction—a process by which a virus carries foreign DNA into a host cell; the DNA is then expressed within the host.
transfection—the process of incorporating DNA from an external source into the nucleus of a eukaryotic cell.
transform—to change a hereditary characteristic of an organism by introducing new DNA into its genome.
transformation—the process of incorporating DNA from an external source into the genome of a bacterial cell.
translation—the process of reading a sequence of bases in RNA and generating from it an encoded sequence of amino acids that comprise a polypeptide chain or protein.
tRNA synthetase—an enzyme that recognizes the structure of from one to four tRNAs that specify a particular amino acid; the enzyme links them covalently to that correct amino acid.
tRNA (transfer RNA)—single-stranded nucleic acids composed using ribose sugars and containing the nitrogenous base uracil instead of thymine. They attach to and transport amino acids to ribosomes for incorporation into growing protein chains.
virulent—possessing a highly increased ability to cause disease.
Weismannian border—the conceptual divide between somatic cells and germ line cells; gene therapy in humans employs only somatic cells.
X-ray crystallography—a physical technique in which a purified sample of protein or nucleic acid is exposed to high-powered electromagnetic radiation to determine its molecular structure.
Informational
Continuity ]in Cells
|
|
N OF LOPE CHASING DEATH immomm( |
He had never seen such a moon, so white, so blinding, and so large . . . 'Weston,' he gasped, 'what is it? It's not the moon, not that size. It can't be, can it?' `No,' replied Weston, 'it's the earth.' .. .
—C. S. LEWIS, OUT OF THE SILENT PLANET
It suddenly struck me that that tiny pea, pretty and blue, was the Earth. I put up my thumb and shut one eye, and my thumb blotted out the planet Earth. I didn't feel like a giant. I felt very, very small.
—NEIL ARMSTRONG, FROM THE APOLLO 11 SPACECRAFT, 1%9
Somewhere, tucked far away in the cold dark emptiness of universal space is an incredibly tiny planet bearing life. You happen to be on it. Within its mere 8000-mile diameter, life's domain is only a few miles thick—a precariously thin skin on a cinder in the near infinity of cosmos. That's our biosphere.
Close examination of life-forms within this thin skin reveals that they all have death as a prospect. Life spans limit the large forms; predation and competition, the small ones. Since life spans of organisms are vanishingly brief compared with life's history on Earth, life
|
Survey Questions 8.1 A Thin Skin of Life Chasing Death · What is the"thin skin of life"? · How are the processes of life and death related in the living world? 8.2 Cell Division: A Requirement of Life What is the importance of cell division in the living world? What is the result of many cell divisions in a yeast cell or in a fertilized human egg cell? · How does a cell prepare to divide? · What does each daughter cell need to receive from the parent cell? · How is the cell's DNA information copied prior to cell division? How are the copies managed during cell division? 8.3 Cell Division Is Part of a Cycle: the Cell Cycle · What is a cell cycle? · What aspects of cell life other than division are part of the cell cycle? · What are the stages within the cell cycle? · What occurs in each stage? · Is cycling time constant or subject to control? How is the cycle controlled? 8.4 Mitosis · What is the role of mitosis in the cell cycle? · What happens to chromosomes before, during, and after mitosis? · How is the process of mitosis organized? How do chromosomes actually get moved into daughter cells? |
Life's Essential Resources in Cell Division
|
|
-4— Energy From nature -4— Monomers |
Limited
Chemical
Energy and Monomers
From nature
Figure 8.1 Life's Essential Resources. Newly divided cells bring all three essential resources along
from the parent cell. But soon raw materials and energy are obtained from the cell's own environment. Information is not.
must have a rugged continuity to it. It has persisted through millennia! If, in its chase after death, life did not persist and prevail over it, Earth would become Mars. How does life manage to keep up?
The chase of life requires three essential resources for its success: a good supply of life's monomers (recyclables like sugars and amino acids), a persistent supply of energy (the sun will do . . . ), and a continuous source of information to direct growth (see Figure 8.1). Now, some monomers, parts of other monomers, and the energy to use them are coming into life-forms from nature around them. But the information is not. It is internal. This most amazing, self-directing character of living things forms the basis for our sixth principle: Life Is Informational Continuity. To have life is to have inherited information from the past. To have robust life is to pass information into the future. Like some precious Biblical text, life's information creeps forward through time, carefully copied within cells, relentlessly protected from sources of change.
The chase of life in the skin of Earth is essentially cellular in nature. So is death. Just before a viewing, the funeral director clips the nails and trims a few hairs on the corpse. Not every cell finishes life at exactly the same moment! So this whole business of acquiring monomers and energy takes place at the microscopic level. In the chapter on cell structure we saw why this was necessary. Diffusion brings monomers and energy sources to the cell. Diffusion rates are quite adequate over microscopic distances. But for large organisms like ourselves, diffusional processes are hopelessly slow. Our cellularity delivers us from smearing peanut butter on our arms and waiting for it to diffuse to our bones. But if Earth's thin skin is cellular, then in order to win life's race, it is cells that do the absorbing, the processing, the growing, and the dividing. They must do this at a rate that at least matches the death rate. So to understand life's informational continuity, we must understand cell growth and division. We will find it to be a wonderfully timed, cyclical, integrated, and carefully controlled process.
IN OTHER WORDS
1. The biosphere is a place where living things both die and yet persist.
2. Living things require monomers of life, an energy source, and information.
3. These resources are processed and used at the cellular level.
4. Understanding the balance of life requires an understanding of cell growth and division.
CELL DIVISION: A REQUIREMENT OF LIFE
The division of a parental cell into two daughter cells is a basic life process. Yet its significance depends heavily on its context. In single-celled organisms, cell division amounts to reproduction. The daughter cells are two new individuals in a population of largely independent cells. By contrast, in multicellular organisms, cell division is how the organism grows to its adult size and replaces its worn-out tissues (see Figure 8.2).
Consider the humble yeast cell. Some of its varieties have lived on us and within us. Others have matured our breads and wines for centuries. A common form of cell division in yeast is budding (see Figure 8.2) A daughter cell begins as a small bud on the end of the maternal cell. The bud acquires monomers, energy, and eventually a nucleus generated from the maternal cell nucleus. When the bud approaches the size of the maternal cell it normally breaks free, leaving behind a bud scar on the surface of the maternal cell. The mature bud is a complete version of the entire organism. Nothing is missing from the daughter cell. The maternal yeast cell has reproduced itself.
A single fertilized human egg cell is a quite different story. On its voyage through a masterful
developmental program, it will divide its way to over 100 trillion cells in a period of 18 to 20 years (see Figure 8.2, Chapter 9). Along the way, daughter cells will grow, differentiate, and eventually cooperate to read this sentence! Only you—the resulting individual—have all of your properties. No one cell of your body could be called the "essential organism." In you, cell division is not reproduction of the individual; it is rather a means of growth—and replacement. Even before your adult form is reached, replacement processes begin. Your body's cells are entirely replaced with new ones in an average of seven years' time. For example, though your life expectancy may be 78 years, that of each of your 30 trillion red blood cells is only about
budding—in yeast, the process by which a new daughter cell emerges from the surface of the larger maternal cell using materials and information from the maternal cell.
differentiation—a process by which, through time and successive generations of cells, stem cells commit to utilizing a specific part of their genomes; this process transforms them into specific types of cells like neurons or epithelial cells.
Multicellular forms: growth, differentiation
Developing individual
Figure 8.2 Cell Division in Context. When unicellular yeast divides the result is reproduction of more yeast cells.When human egg cells divide, a new completely differentiated organism is the product. Various strains of the yeast Saccharomyces cerevisiae are used in baking bread and fermenting fruit juices. A different genus of yeast, Candida, contains species that grow on and in humans where they occasionally cause oral and vaginal infections.
Figure 8.3 DNA Replication. The maternal DNA molecule is shown in gray. New daughter strands are shown in red. As maternal strands unwind they become the templates against which new daughter polynucleotide strands are built using the base pairing rules. Each daughter double helix will be half-maternal, half newly-synthesized polymer.
0.30 years. So for life to successfully chase death here, we require about 1 million cell divisions or 2 million new red blood cells every second—every second!—within your bone marrow tissue. Cell division both produces you and keeps you alive!
For an animal cell to grow and mature to the point of division, it continuously absorbs monomers, parts of monomers, and chemical energy sources. It selectively transports these across its cytoplasmic membrane. Monomer and polymer construction inside the cell support its growth. But while this is happening, the cell is also enzymatically copying its entire genome within the nucleus.
Recall that structurally, the cell's genome is DNA. How DNA can be replicated is immediately apparent
from its structure (see Figure 8.3). The two strands need only separate from each other through the breaking of the interior hydrogen bonds between the bases. Then, using the base-pairing rules (the base A pairs with T, T pairs with A, G with C, and C with G), each single DNA strand can serve as a template against which to build a new strand with a sequence complementary to that of the template. All that is needed is a supply of monomeric nucleosides (in their triphosphate forms) and enzymes to read along the parental template strands, building a new daughter strand against each of them.
The molecular components of the DNA replication system are highly sophisticated. A set of 10 or more different protein "machines," working in synchrony, opens up the double helix, reads both template (parental) strands (each in the opposite direction of the other), builds new daughter strands, and checks for errors! The result is two new identical daughter double helices with an error rate of less than 1 in a billion base pairs misincorporated (see Figure 8.4). And the process runs at about 300 nucleotides per minute! The enzymes that actually orient and bond the individual nucleotides into the new DNA strands are called DNA polymerases. These proteins, some with molecular weights more than 100,000 times that of a hydrogen atom, are complicated multisubunit machines that can both produce and repair the structure of DNA.
Now, the polymerase enzymes themselves are protein products of polymerase genes within the genome. Yes, we are peering in on machinery that builds itself! Imagine the glory of an elegant polymerase molecule—like a brand new high performance sports car—rolling through the genome, copying hundreds of genes, and among them the very genes that code for its own amino acid sequence. What a powerful picture of external design
template—a sequence of nucleic acid that is read by a polymerase enzyme such that it generates a new sequence of bases complementary to the one read.
nucleoside triphosphate—a subunit monomer for nucleic acids DNA or RNA that includes three adjacent phosphate groups in its structure. ATP is an example.
DNA polymerase—an enzyme that replicates an organism's DNA by adding free nucleotides to the ends of single DNA strands.
molecular weight—the total mass number of the atoms comprising a molecule. Each carbon would contribute a mass number of 12 to the molecule; each oxygen, 16.
Primase
|
3' |
|
|
|
|
|
|
DNA polymerase
Figure 8.4 Enzymes of DNA Replication. Enzyme function is best understood in bacteria. After an opening is created in the maternal double-stranded DNA, a helicase enzyme inserts itself and begins to unwind the double strands. Binding proteins hop onto the DNA to keep it single-stranded transiently. Meanwhile, down ahead of the helicase a gyrase enzyme is twisting, breaking and resealing the DNA double helix so that helicase is able to continue unwinding the DNA strands. Primase enzyme creates a starting substrate for the DNA polymerase that has to work backwards along one strand of DNA while a second polymerase enzyme copies forward on the other strand. The reverse replication of the one strand is required by the fact that the one maternal DNA strand is upside down in orientation and chemistry relative to the other one.
imposing order on the randomness of nucleotide monomers in solution: a machine that copies code, copying its own code to generate more of itself!
One pair of polymerase enzymes starting DNA replication at one spot in the genome would be inefficient. The human genome at 3 billion base pairs would take over 10 years to replicate. Multiple polymerase systems start replicating the DNA at multiple origins of replication within the genome (see Figure 8.5). Replication proceeds in both directions from these points generating bubbles of replication, which grow larger and larger until they fuse to form one complete replicated genome. And what a pleasing result! Where we once had a
Origin DNA double helix
1
Figure 8.5 Chromosomal Replication. DNA replication begins at multiple sites within eukaryotic chromosomes.
single complete maternal genome of billions of base pairs, we now have two double-stranded daughter genomes that are genetically identical to the original maternal genome and to each other. In fact, one strand of each daughter genome is a strand from the maternal genome. Life is informational continuity, and the fidelity of DNA replication is its essence.
But now we propose to separate all these daughter genes from each other into two daughter cells! The human genome has about 25,000 genes. Suppose you owned 25,000 books—the best books ever written! You decide each of your two daughters must have these books. So you spend a year or so accumulating a complete duplicate set of these same 25,000 books. You have to keep the duplicates next to each other while you are accumulating them so you know what to buy next. Now your daughters are leaving home. What process will you use to separate 50,000 books into two identical collections? Eat your breakfast that morning! Buy lots of small sturdy boxes! How in the world do cells sort their replicated genomes every time they prepare to divide?
|
origin of replication a sequence of bases in DNA that is rec‑ ognized by a helicase enzyme; the enzyme twists open the double helix at this point to allow a polymerase enzyme to begin replicating single DNA strands. bubble—in DNA replication, the already-replicated region within the DNA molecule which begins at the origin of replication and expands as DNA is replicated in both directions from the replication origin. |
Recall from Chapter 7, Section 2b, that multibillion base-pair genomes are organized into structures called chromosomes. You've seen their super-coiled structures (see Figure 7.12). Now, let's add a temporal context to this structuring. When is the genome loose, unraveled chromatin and when is it tightly packaged chromosomes (see Figure 8.6)? For the DNA replication process we've just discussed, the unraveled chromatin nicely allows the polymerase enzyme machinery access to all of the origins of replication in order to accomplish their roles. For a cell's growth and biosynthesis activities, the RNA polymerase machinery requires access to the genes' promoter regions as well. But a point is eventually reached in the cell's life where two genomes need to be taken in two separate directions—kind of like "packing the whole circus into the truck before moving to the next town." Prior to cell division, a period of condensation and packaging ensues that converts the DNA of chromatin into proteinscaffolded, tightly super-coiled chromosomes. The super-coiled DNA is so dense that stained chromosomes are easily visible with an ordinary light-illuminated microscope. However, when a genome as long as ours is tightly condensed to 46 more manageable chromosomes, it still requires a very elaborate system of microtubules to equally split and distribute them into daughter cells. We will
Distribution in
mitosis
Decondensation
|
Replication |
|
Figure 8.6 Genome Cycling. Chromosome behavior coordinates immaculately with the roles required of it. When it is needed as an immediate information source, it assumes a decondensed form making the maximum amount of information accessible. When it is needed for alocating information to daughter nuclei it assumes a condensed form making distribution simpler.
examine this distribution architecture in Section 8.4. Once their distribution is complete and cells have divided, chromosomes de-condense again making their DNA more accessible to the next round of transcriptional and replication activity.
IN OTHER WORDS
1. Cell division can represent reproduction or a component part of growth depending on the cellular complexity of the organism it occurs in.
2. One common method of reproduction in yeast cells is a form of cell division called budding.
3. Cells increasing in size, then dividing, and then differentiating transform a fertilized human egg into a human being.
4. In preparation for generating two daughter cells, a maternal cell must accumulate monomers and molecular forms of energy and must replicate its DNA.
5. DNA is replicated by polymerizing nucleotides into single strands of DNA; the single strands of the maternal DNA are used as templates against which to sequence daughter strands.
6. DNA replication is carried out by a collection of elegant proteins that unwind and stabilize maternal strands. DNA polymerase then builds the new strands.
7. Replication of DNA begins at multiple origins of replication distributed along each chromosome.
8. In the human genome, 25,000 genes' worth of DNA is replicated, then meticulously condensed into 46 chromosomes to be split, and their halves distributed into daughter cells.
9. DNA cycles from a highly condensed form suitable for distribution during mitosis to a de-condensed chromatin state suitable for its transcription and later replication.
|
|
ION IS PART OF A CYCLE: THE CELL CYCLE |
|
CELL DI |
|
Cell growth is the counterpart to cell division. Were there no growth, division would eventually reduce cell size to oblivion. Were there no division, cell growth would quickly render transport processes into and out of the cell ineffective. These two processes taken together are called the cell cycle (see Figure 8.7). The cycle begins when daughter cells emerge from a division event, and it ends when each daughter cell completes its own division process forming granddaughter cells.
Cell division is relatively brief and quite dramatic. Biologists in the 1800s observed it and meticulously characterized its structural changes (see Sections 8.4 and 8.5). They then rather dismissively gave the name interphase to the much longer, less spectacular growth interval that followed each division. In cultured mammalian cells, division may last the greater part of an hour, while interphase accounts for about 20 hours. In recent years, that 20 hours has been finely dissected.
Growth during interphase is a well-designed and carefully controlled process.
Right after division, the daughter cell enters a period of biosynthetic activity that usually continues throughout interphase. The result is growth of the cell from its size as a new daughter cell to an optimal size for its function. The first portion of this cell growth period is termed the G, phase
cell cycle—a sequence of stages that prepares a cell for and that carries it through cell division. It begins immediately within daughter cells following the division of a maternal cell.
interphase—that portion of the cell cycle when the cell is not in the process of dividing. It is characterized by biosynthesis and growth of the cell.
phase—an initial period of growth immediately following cell division that precedes DNA synthesis; highly variable in length in diverse cell types or under varying conditions of growth.
Figure 8.7 The Cell Cycle. A cell is either growing, dividing or arrested in its growth. These processes comprise the cycle. Growth takes the longer amount of time and is referred to as interphase. Interphase has it functional subphases; see the text for details.
(see Figure 8.7). It is the part of interphase that varies most in length and where the most critical control over the cell cycle is exercised. The letter G stands for gap because, although many kinds of biomolecules are being synthesized apace, the DNA synthesis critical to future daughter cells has not yet begun. When will DNA synthesis begin? This is where control becomes important. Is this growing cell going to divide again? For many nerve cells in the human body, the answer may be "no." In this case, DNA synthesis never does begin and the cell seems to drop out of G, entering a holding pattern that is termed the Go phase (see Figure 8.7). The cell will continue to maintain itself biochemically for an indefinite period of time. It sits behind what is termed a checkpoint—a biochemical control point that will never allow it into the next phase of the cycle.
Logically, G, is the phase that most varies in length. If materials for growth are scarce, if some required hormonal signal does not arrive at the cell surface, or if some other genetically controlled roadblock is in place, the G, phase grows longer in response—the cell simply waits. But once the G, checkpoint is passed, the cell proceeds forward toward division at a constant rate limited only by availability of monomers and energy.
Your intestinal epithelial cells are an absorptive surface that replaces itself every five days. In such a cell population, continuous division is needed. These cells routinely pass the G, checkpoint and move into S phase, where S stands for DNA synthesis (see Figure 8.7). During this period of time, all of the cell's chromatin—the DNA and supportive proteins—is replicated to generate two complete copies of the genome. Also, in S phase, biosynthesis of other important cell structures and polymers continues simultaneously. In cultured mammalian cells, S phase lasts about 10 hours. Why is DNA synthesis accorded a phase of its own? Well, a single cell needs only its own genome. And once a cell begins this expensive genome duplication process, it has passed a critical checkpoint: It is now committed to making two daughter cells.
From the time DNA synthesis is complete until chromatin condenses just prior to cell division, there is another growth period called the G2 phase (see Figure 8.7). In this phase, much of the cellular architecture needed to organize and distribute chromosomes into daughter cells is constructed.
Again, biosynthesis of other cellular organelles and structures continues. When entering both the S phase and the G2 phase, checkpoints are being passed. The cell wastes nothing. It will not head into a division event unless and until the S and G2 phases have been passed successfully. When they have, all is ready for the cell's final drama to begin. The first act will include the division of the nucleus and its component chromosomes—a process called mitosis. Along with or following mitosis, act two: the division of the cell's cytoplasm or cytokinesis occurs.
We've noted the three overlapping periods of growth and synthesis that characterize interphase. But before observing cell division, let's return to that critical checkpoint between G, and S phases and see what occurs there. What would stop a cell from mechanically moving ahead with division? How would you arrange the division machinery of the cell such that it would divide only if new daughter cells are needed and if it is materially possible to make them? This is a tall order; serious design is needed. First, the protein machinery that actually moves the cell cycle forward must be controllable. This is exactly what we find! Proteins controlling cycling will not signal DNA synthesis (the entering of S phase) to move forward
|
Go phase—an indefinite, usually long time period (formally within G, phase) during which a cell simply maintains its vitality because it is unable to pass a checkpoint leading to DNA synthesis. checkpoint—a collection of interacting proteins that monitors conditions within a cell, inhibiting the cell from proceeding further into its cycle until conditions are favorable. S phase—that portion of the cell cycle during which DNA and its scaffolding proteins are synthesized. G2 phase—that portion of the cell cycle following DNA synthesis during which cellular biosynthesis focuses on structures needed for division of the cell. mitosis—the process of dividing a single maternal nucleus into two daughter nuclei distributing to each nucleus equal halves of replicated chromosomes. Cell division is usually concurrent or follows immediately. cytokinesis—the division of the cytoplasm of a maternal cell resulting in two daughter cells. Mitosis precedes this process. |
Figure 8.8 Regulating Cell Division. A hormonal signal arrives at the surface of the cell where it binds precisely to the receptor designed for it. A resulting structural alteration of the interior part of the receptor starts a cascading series of reactions between intracellular proteins or"intermediates"which results in increased cyclin concentrations. These in turn signal the phosphorylation of proteins that will cause the cell to cycle on into S phase toward division.
unless they are phosphorylated—that is, unless they have phosphate groups attached at critical points on their structure (see Figure 8.8). Then they function. Second, a group of kinase enzymes that add phosphates to these controlling proteins are always present, but they are themselves in an inactive form. Third, a group of proteins called cyclins are produced that can activate these kinase enzymes. But cyclins are produced only in response to the favorable conditions outlined previously. If a hormone signal arrives outside the cell, it will bind to a membrane receptor protein (see Figure 8.8). This binding will, in turn, cause the concentration of cyclins within the cell to rise. If nutrients levels are acceptable for DNA synthesis, a cyclin is generated. Cyclins are the activator function of an elegant "situation reporting network" whose details are still not entirely understood. This network involves various receptor proteins in the cell membrane and a huge collection of intracellular proteins that, by binding to each other, transmit molecular signals. But a go-ahead signal always involves activating
kinase enzymes, which then phosphorylate cycle-mediating proteins. The molecular signals cause the cell to do the sensible thing from the organism's perspective, not because the cell understands its own behavior or that of the organism as a whole. Rather a brilliant Designer crafted a protein network that mindlessly weighs alternatives at both the cellular and organismal levels and either holds the cell at the checkpoint or lets it by. When these systems work well, life is fun. When they're defective, the result is often cancerous (see Section 8.6).
|
phosphorylation—the attachment of a phosphate group (—P03) to a molecule; often protein modification from inactive to active states is accomplished in this way. kinase enzyme—a protein that catalyzes the addition of a phos‑ phate group to some other protein or molecule. Addition or removal of the phosphate often results in altered regulation of some cell function. cyclin—intracellular protein that activates kinase enzymes involved in moving the cell cycle forward. |
IN OTHER WORDS
1. In the cell cycle, a relatively long period of growth precedes a shorter period of cell division.
2. The period of growth, termed interphase, is itself divided into three phases—G1, S, and G2—which are named for their temporal relationship to DNA synthesis.
3. Depending on circumstances, some cells move rather quickly through the G, phase; other cells enter it and never leave.
4. There are biochemically controlled checkpoints around the cell cycle that control how a cell proceeds through the cycle.
5. G1 phase is most variable in length. Phases S, G2, and M (Mitosis) proceed according to a more constant time frame from cell to cell.
6. While biosynthesis of most cell constituents occurs all through interphase, DNA synthesis is limited to the S phase.
7. Checkpoints are really collections of interacting proteins that sense when cell division is desirable and raise cyclin levels to signal a transition toward division.
8. Defects in checkpoint function are usually the basis for the cell's progression toward the cancerous state.
The Reason for Mitosis: Chromosomes
In a bacterial cell like E. coli, where mitosis is unnecessary, virtually all of the cell's genetic information resides on one circular chromosome, which is neatly replicated and distributed to two daughter cells. Eukaryotic life is more complex. There are larger genomes and longer chromosomes, which may number as high as 78 in the cells of your cocker spaniel or even 208 in king crab cells! Also, most eukaryotes, like yourself, have two copies of each kind of chromosome—and therefore of every gene they possess. You have two different versions of genes influencing eye color, skin color, height, intelligence, and so on. You got one set of these genes from your father and one from your mother (see Chapter 12). So the 46 chromosomes in each of your cells are really 23 matching pairs of chromosomes, one chromosome in each pair from your mother, the other from your father (see Figure 8.9). Only 23 chromosomes' worth of information is needed to generate a human being. We call this the haploid (or n) number of chromosomes. But your somatic cells contain 46 chromosomes—what we call the diploid number (or 2n). It's sort of like having the luxury of buying two different biology texts in order to pass the course—one will do, but two give the richer perspective and correct each other's errors.
As you examine the process of mitosis, please realize that a maternal cell cannot simply duplicate its 46 chromosomes to 92 and then throw any 46 of them into each daughter cell! In this way, a daughter cell might miss both chromosomes of one or more given pairs while receiving unneeded duplicates for other pairs. Important information would be lacking—the daughter cells would never
haploid—refers to a cell (often a sex cell) that contains a single set of chromosomes or one copy of the cell's genome.
diploid—refers to a cell that contains two complete sets of chromosomes, usually inherited from two separate parent genomes.
Figure 8.9 A Human Chromosomal Karyotype. The forty-six chromosomes of a human cell arranged by shape and size into 23 pairs. Similar chromosomes contain similar genes. One pair, at the bottom of the photo, is the sex chromosomes. They determine the sex of the individual. This cell has two X's and is therefore from a female. Were one of the X's replaced with a smaller Y chromosome, the cell would be from a male.
survive. Rather, each of the 46 chromosomes, once duplicated in a pre-mitotic S phase, must be systematically split during mitosis such that one copy goes to each daughter cell. The result is two daughter cells each with a genome that looks exactly like the genome of the maternal cell before its S phase. Hence, there is a necessary and severe elegance to the division process we are about to observe.
The Process of Mitosis: A Sequence of Stages
Once interphase checkpoints have been passed, the cell has signaled to itself that (1) it is large enough to divide, (2) its chromatin is entirely replicated, and (3) the machinery is in place for distributing
halves of replicated chromosomes. The process of mitosis will now distribute these copies of genetic information into daughter nuclei in preparation for division of the rest of the cell (cytokinesis). Mitosis occurs in several stages based on the appearance and behavior of the now-condensed chromosomes. These stages are: prophase, metaphase, anaphase, and telophase (see Figure 8.7). For each stage in this sequence, let's examine the obvious structural changes that have been observed for years and, here and there, a few of the molecular changes that have been discovered more recently.
Prophase begins when the chromatin-tochromosome transition reaches a point where chromosomes are now visible with a simple light microscope (see Figure 8.10). This high level of condensation is somewhat like taking cooked spaghetti in a bowl and reversing the cooking process to return each strand of pasta to its straight, precooked configuration. Just as it would be easy to separate the contents of a box of spaghetti into two pots of boiling water, it is easier to move halves of tightly coiled chromosomes into daughter cells. Each chromosome now has two duplicated daughter halves to its structure; these are called sister chromatids. They remain attached to each other through a small, complexed region of highly repeated DNA sequences called the centromere (see Figure 8.11). Bound to this region is a pair of protein complexes called kinetochores, which serve the same function for a chromosome as does a door handle for a door. (Door handles are usually paired as well.) Microtubules will soon attach to the kinetochore on each side of the centromere, preparing to pull each half of the replicated chromosome in opposite directions. Where do these microtubules come from? To answer this question, we must wander back in time a bit.
Next to the cell nucleus during the G1 phase was a complex cytoplasmic structure called the centrosome. It functions as an organizing center for microtubule construction. During S phase, the centrosome is replicated into two centers. Now, in prophase, these two centers begin to move around the surface of the nuclear membrane to opposite ends or poles (see Figure 8.10). As they move, microtubules grow in length between them. During prophase, the nuclear membrane deteriorates and the microtubules extending between the centrosomes become a beautiful, symmetric, and dominant architectural frame called a mitotic spindle because of its overall shape. Microtubules also extend back away from the centrosomes toward the cytoskeleton just beneath the cell membrane in two more stunning, star-like,
astral arrays. These microtubules will anchor the spindle structurally for the work it is about to do.
When a tow truck pulls a car from a ditch, it's not enough to have an ultra-strong winch. Without ultra-strong brakes, the winch may take the tow truck into the ditch with the car. When a mitotic spindle pulls halves of chromosomes toward two different poles, the same pulling and restraining forces are used but in a much more elegantly orchestrated arrangement of winching and braking (see Figure 8.12). Three different groups of micro-tubules (cellular "cables"), and their associated motor proteins (cellular "winches and brakes" ), are involved in chromosome distribution:
1. A set of kinetochore microtubules extend from opposite centrosomes to the kinetochores of
prophase—the first stage of mitosis during which chromosomes become visible, the nuclear membrane deteriorates, and the mitotic spindle apparatus takes shape
metaphase—the second stage of mitosis during which chromosomes reach the center of the maternal cell being arranged across an imaginary equatorial plate.
anaphase—the third stage of mitosis during which replicated chromosomes split and a daughter chromatid goes to each daughter cell; a period of chromosome movement.
telophase—the fourth stage of mitosis during which parted sister chromatids (now chromosomes) decondense, nuclear membranes form, and daughter nuclei take on an interphase appearance.
sister chromatid—half of a replicated chromosome; joined to a replica of itself by a centromere; splitting of the centromere converts each chromosomal half into a separate (now unreplicated) chromosome.
centromere—a region of a chromosome containing highly repeated, short DNA sequences that is structural, not informational. Kinetochores attach to this region.
kinetochore—a protein complex that binds centromeric regions of chromosomes; microtubules attach to it and pull the chromosome to a spindle pole during mitosis.
centrosome—a cellular microtubule organizing center. Microtubules radiate from this structure during mitosis.
mitotic spindle—arrangement of microtubules used to separate halves of replicated chromosomes into daughter nuclei.
motor proteins—an enzyme that uses ATP energy to do mechanical work within the cell; interacts with cytoskeletal elements to move cell parts.
|
|
|
G2 of interphase |
|
Prophase |
|
Gt of interphase |
|
|
|
|
|
Chromatin is unreplicated at this stage and more diffuse than is indicated here. |
Condensation of chromatin is in preliminary stage, notice that all chromosomes are now replicated and exist as pairs of sister chromatids. The centrosome has also been replicated. |
|
Chromosome are now further condensed, centrosomes are moving to opposite poles as nuclear membrane degenerates. The mitotic spindle darkens as kinetochore and spindle microtubules take their place. Kinetochore microtubules are attached to chromosomes. |
Figure8.10 Mitosis in Stages. The photographs are of cells in the embryo of the whitefish caught in various stages of mitosis. They were taken through a light microscope. The accompanying diagram uses just two pairs of chromosomes to illustrate what the larger number of (darkly stained) chromosomes in the photographs are doing.
Prometaphase chromosome
Figure8.11 A Duplicated Chromosome at Metaphase. The two kinetochores are attached to the centromeric region of the chromosome. (Kinetochore) microtubules of the spindle attach to the kinetochores in preparation for the splitting/unravelling of the centromeric region that starts anaphase.
each chromosome. They extend by being built out, monomer by monomer, toward the kinet‑ ochores, where they attach by protein "hooks."
2. Another set of polar microtubules, form the outline of the spindle extending from each centrosome toward the other. They meet each other out in the center of the spindle and make productive contact with each other by means of shared motor proteins.
3. A third set of astral microtubules flare out from the centrosomes toward the cell's cytoskeleton, where motor proteins anchor them to the cell's periphery.
The subsequent movements of these microtubules are carefully coordinated.
Soon, the kinetochore microtubules begin to shorten by being disassembled at the centrosome poles. This places tension on the chromosomes since they are all attached to both centrosomes by
Metaphase
Kinetochore microtubules shorten toward both poles pulling all chromosomes to the midline of the spindle.
Anaphase
Sister chromatids unravel at the centromeric regions allowing microtubules to pull sister chromatids of each chromosome to opposite poles.
Telophase
Chromosomes decondense to interphase state, nuclear membranes form around chromatin as cytokinesis begins.
G1 of the following interphase
The resulting daughter cells are genetically identical to each other and to the paternal cell from which they were derived.
Figure 8.10 (Continued)
their two kinetochore linkages. This pulling from both ends has the effect of bringing all the chromosomes to the midline of the spindle, a region called the metaphase plate. Once the chromosomes are neatly aligned there, the cell is said to be in metaphase. The system is neatly designed so that chromosome condensation reaches its maximum during this critical phase.
The shortest phase of mitosis is anaphase; it lasts only a few minutes in the hour consumed by division. It is a period of dramatic movement. At a critically timed moment (have we used this phrase before?) a collection of enzymes concentrated in the centromeric region of each chromosome alter the DNA conformation there so that the sister chromatids of each chromosome are able to separate from each other. (The mechanism is still being studied.) Now, kinetochore microtubules begin to be disassembled
|
|
|
|
|
|
|
|
|
|
|
Chromatids (now "chromosomes") are dragged toward opposite poles by shortening of kinetochore microtubules. |
0 Shortening results from motor proteins that pull the microtubule through the kinetochore structure, disassemblingthe microtubule. |
|
Sliding of polar microtubule ends past each other at the spindle midpoint lengthens the spindle carrying divided chromatids even further from each other. Astral microtubules at each end of the spindle anchor the spindle to the cell membrane. |
|||
|
Figure 8.12 Mitotic Spindle Structure and Activity. |
|
|
|
|
by abruptly ending 46 individual tug-of-war events for each of your 46 now-replicated chromosomes. Those events end with each future daughter cell getting precisely 46 halves of 46 replicated chromosomes. Each daughter cell is genetically complete, genetically identical to the other daughter cell—and your hair grows just a bit longer. . . .
Telophase could be called the clean-up or restoration phase (see Figure 8.10). Conditions revert to those of the non-dividing cell. Telophase begins once the chromosomes have arrived at the poles of the now larger mitotic spindle. As it progresses, the spindle microtubules are all disassembled and the nuclear membranes of two new nuclei begin to form around the daughter genomes. The chromosomes rapidly begin the de-condensation that will allow the genes to be transcribed again so that informed life can continue. It is while this nuclear drama winds down that the cytoplasmic division—cytokinesisreaches full expression.
IN OTHER WORDS
1. Because of their relative complexity, eukaryotic cells require a highly elaborate and controlled system for distributing genetic information into daughter cells prior to cell division.
2. In the cell nuclei of most animals, the number of chromosomes is diploid; there are two complete sets of genetic information, one set derived from each parent.
3. Mitosis must divide human chromosomes such that each of the 46 chromosomes provides one of its sister chromatids to each of the two daughter nuclei.
4. Mitosis occurs only after the last checkpoint between G2 and mitosis has been successfully passed.
5. In prophase of mitosis, duplicated chromosomes become visible as they become attached to kinetochore microtubules; the nuclear membrane deteriorates and a mitotic spindle takes shape.
6. Spindle architecture for dividing chromosomes includes three types of microtubules: kinetochore micro-tubules that pull chromosomes, polar microtubules that control the size of the spindle, and astral microtubules that support the spindle structurally.
7. In mitotic metaphase, microtubules are preliminarily shortened, generating a structural tension that pulls all chromosomes to the midline of the maternal cell.
8. In anaphase, sister chromatids physically separate and microtubules pull them to opposite poles of the mitotic spindle.
9. In telophase of mitosis, chromosomes de-condense to their chromatin state, nuclear membranes form around daughter genomes, and cytokinesis, if occurring, continues toward completion.
OK SIS
Cytokinesis accomplishes for the cell boundary and cytoplasm what mitosis does for the cell nucleus. Thus mitosis followed by cytokinesis results in complete division of a cell. Organellar structures, monomers for growth and intracellular energy sources, are distributed by cytokinesis into separate daughter cytoplasms, which become separated from each other by new cell boundaries. While cytokinesis typically begins during late anaphase or telophase of mitosis, the two processes are not strictly connected mechanically. Cytokinesis can, in some situations, follow along well after mitosis. In early insect development, for example, repeated mitotic events generate a multi-nucleate embryo with a common cytoplasm (see Figure 8.13). Following some cytoplasmic differentiation activities, cytokinesis then carves up all the nuclei into
separate cytoplasms for subsequent development. Temporal separation of mitosis and cytokinesis is atypical however; close association of cytokinesis with mitotic telophase is the more common rule.
In animal cells, cytokinesis involves cleavage of the maternal cytoplasm into two daughter domains. What starts as a minor depression in the cell membrane above and below the former metaphase plate deepens into a cleavage furrow that surrounds the cell (see Figure 8.14). The furrow draws interiorly like purse strings, and eventually cleaves the cell
cleavage furrow—a constricting region of cytoplasm in a maternal cell that encircles the cell and progressively deepens finally resulting in two separate daughter cells.
Figure8.13 Mitosis Apart from Cytokinesis. Insect development begins with a fertilized egg containing
a single diploid nucleus. This nucleus undergoes many rounds of mitosis, and daughter nuclei migrate to the periphery of the cytoplasm before the blastodermal stage of development when cytokinesis provides a separate cytoplasm for each nucleus. By this time, considerable regional differences exist in the cytoplasm so that different kinds of larval segments can subsequently form. The insect egg has been grossely enlarged compared
to the adult form so that nuclear behavior can be represented.
Segmented embryo at 10 hours
Cellular blastoderm (nuclei now in separate cells)
KEY
A = Anterior P = Posterior D = Dorsal
V = Ventral
Contractile ring of microfilaments
o During mitotic telophase an indentation deepens into a furrow surrounding the maternal cell where the metaphase plate had been located.
el Furrowing finally completes cell separation forming two daughter cells.
Figure 8.14 Cytokinesis in Animal Cells. The photograph is of a fertilized egg cell beginning to undergo its first cell division
cytoplasm in two. Electron microscopy reveals that just beneath the cleavage furrow is a contractile ring composed of bundles of actin microfilaments whose orientation is parallel to the cleavage furrow. A dynamic process that involves both pulling on and rapid shortening of actin filaments (depolymerizing) leads to the observed constriction of the contractile ring. The ring eventually separates the cell into two daughter cells with one nucleus in each.
The challenge of separating a plant cell into two daughter cells is heightened by the existence of a tough, protective, supportive cell wall just outside the cell membrane. A constricting contractile ring would be inadequate in this situation for much the same reason that human hands are not effective in breaking tree branches in half. So an entirely different strategy is employed—one that works from the interior to the exterior of the maternal cell rather than the other way round as in animal cells (see Figure 8.15). During telophase of mitosis, vesicles containing molecular components for a new membrane and wall begin arriving at the center of what was the metaphase plate within the maternal cell. As these vesicles fuse with each other, they generate a growing internal structure called a cell plate. The plate slowly expands toward the exterior edges of the maternal cell boundary and eventually fuses with existing cell
wall components. The last step involves construction of cellulose fibers and insertion of them into the new partition being constructed. The final partition has two new membrane surfaces separated medially from each other by two distinct layers of wall material. This new wall structure becomes continuous with the preexisting wall material of what is now two daughter cells.
Many preliminary structural changes within a maternal cell support the subsequent process of cytokinesis. Large organellar structures and networks tend to fragment prior to cytokinesis so they can be
contractile ring—a visible structure within a cleavage furrow composed of actin microfilaments; responsible for the deepening of the cleavage furrow.
actin—a protein subunit of which microfilaments are composed. Together with myosin filaments, it is responsible for contractile events either in dividing cells or in muscle tissue.
cell plate—a medial, incipient, combined membrane and wall component preparatory to complete division of a maternal plant cell into two daughter cells.
medial—occurring or situated in the middle or between other structures or processes.
|
|
|
|
|
Cell Plate |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
R. Ca lentine/Visuals Unlimited |
|
|
|
111=1. MOO ON •=1 •(•(• |
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
Vesicles from Golgi complex Q More vesicles arrive U Eventually a cell plate O Cell plate fuses with
carry membrane and wall and fuse together. forms within which wall existing membranes and
materials to cell midline. formation continues. walls to complete cytokinesis.
Figure 8.15 Cytokinesis in Plant Cells. The photograph shows formation of a cell plate.
uniformly distributed to daughter cells. Mitochondria and chloroplasts have grown and divided in sufficient numbers for appropriate distribution to each daughter cell. The final result of cytokinesis is two separate
cell cytoplasms, each containing a complete diploid genome within a nucleus and enough energy sources, biomolecular monomers, and organellar structures for continued cell grow or maintenance.
IN OTHER WORDS
1. Once the cell nucleus has divided in mitosis, cytokinesis completes the cell division event by partitioning organelles and other cytoplasmic components into two separate daughter cells.
2. In animal cells, orchestrated microfilament contraction draws a cleavage furrow down through the maternal cell cytoplasm creating two daughter cells.
3. In plant cells, new membrane and wall components develop within the maternal cell partitioning it into two daughter cells.
4. The living cell is superior to any human contrivance in its ability to marshal resources, construct its own components and completely reproduce itself repeatedly using energy and information with unmatched efficiency.
CANCER: MU ATKIN HREA ENfiNG JESDGN
=MM.
The Unifying Basis of Cancer
Cancer is an unqualified enemy of the living world. In the United States alone it drains close to $50 billion from the economy per year and costs our species dearly both in emotional turmoil and in thousands of careers invested in diagnosis, treatment, and research. Cancer is a broad collection of molecular disease states characterized by cells that divide in an uncontrolled fashion and that no longer respect their role or confinement within their tissue of origin (see Figure 8.16). Despite the many environmental, hereditary, viral, dietary, and chemical causes of cancer, they all have one common root cause: mutational changes in genes that control cell division.
We know of about 150 genes whose mutation predisposes the cell to cancer. One hundred or so of these are called proto-oncogenes. Their products are entirely normal proteins that activate regulatory pathways that move a cell toward division. When these genes mutate, they become oncogenes (Gk. oncos = tumor), which move the affected cell toward the cancerous state (see Figure 8.16). Another 50 or so genes are called tumor suppressor genes. Their products are also normal proteins that tend to inhibit regulatory pathways, keeping a cell from moving toward division. As you might guess, proto-oncogenes that are over-expressed, or protooncogene proteins that mutate to hyperactivity are likely to cause the cell to divide uncontrollably.
On the other hand, tumor suppressor genes that (1) become underexpressed, (2) that are not expressed, or (3) whose protein products are non-functional are likely to allow cells to divide uncontrollably. In either case, again, cancer is a likely outcome.
Cancer rarely results from a single gene mutation. Recall that our genomes are diploid. We have, in our genome, two copies of every proto-oncogene and tumor suppressor gene. This is a wonderfully protective situation. Sometimes, when a gene mutates to the cancerous state, a normal copy of the gene is there to limit the effect of the cancerous one. It has also been shown that mutation is generally necessary in at least two different genes regulating cell division to initiate the cancerous state. So the frequency of cancer in the human population is happily limited by the need for multiple mutations in order for it to begin and progress.
proto-oncogene—a normal cellular gene whose product helps control progress within the cell cycle toward cell division.
oncogene (Gk. oncos = tumor), a mutant proto-oncogene
that predisposes the cell toward uncontrolled division.
tumor suppressor gene—a normal cellular gene whose product inhibits progress toward cell division; its mutation or loss leads to cancer.
Figure8.16 Cancer — A Result of Mutation. Shown here is a malignant melanoma, a fast-growing and invasive variety of skin cancer. Possible processes that contribute to cancer formation are outlined to each side of the photo. Characteristics of cancer cells are listed above the photo.
041,41T
Proto-oncogene
Mutation Oncogeneqb41":1>
Expression
Hyper expression or hyperactivity of gene producet
Stimulates division
Cancer — a result of mutation
Features:
· Uncontrolled cell division
· Loss of original function
· Loss of adherence to tissue of origin
043.04:13>
Tumor suppressor gene
Mutation
Defective suppressor gene
Expression
Gene product less functional or absent
)1(
Figure 8.17 Control of Cell Division. Cells sense signals that control their rate of growth and division. In embryonic life, childhood, and later life cell division rates in each organ and tissue conform to the changing needs of the individual. Tissue specificity of cell division rate is one of many factors that contribute to control pathway complexity.
The protein products of proto-oncogenes and tumor suppressor genes participate in complex intracellular regulatory pathways. These pathways often link signaling functions that begin outside the cell membrane to transcriptional changes deep within the genome (see Figure 8.8). So the protooncogene that mutates might code for (1) external growth signal molecules, (2) receptors for those molecules, (3) numerous kinase enzymes that are intermediate controls along the pathway, or (4) transcriptional control factors that function within the nucleus to determine what constellation of genes will be read. We might complain here about why pathways that regulate cell division must possess so very many stages of activation or inhibition. If only regulation of cell division involved a mere two or three steps, there would be far fewer ways of getting cancer! The problem is that the cell needs to be ready to divide or not divide in response to many different environmental variables both within and outside of its boundaries (see Figure 8.17). So the regulatory pathways must be long enough to interact with all of the somewhat unrelated signals they are receiving. Life Is Complex!
KRAS—a proto-oncogene whose product, the Ras protein, functions in the control of cell division.
Ras—a regulatory protein whose activation stimulates a cascade of regulatory alterations that results in the movement of a cell from 61 into S phase of the cell cycle.
A Tale of Two Cancer Genes
Let's consider two examples of genes that control cell division. Mutation in either of them will predispose a cell to becoming cancerous. One is a proto-oncogene; the other is a tumor suppressor gene.
The proto-oncogene KRAS (gene names are italicized) codes for a protein called Ras. Ras is an intermediate in the control pathway that moves a cell from G1 phase in the cell cycle past a checkpoint and on into S phase. Suppose you've gone to the beach and gotten too much sun. As a result, many of your epidermal cells have been fried to death and you need to make new ones. How is this accomplished? Inside of millions of healthy dermal cells, the following stages in a regulatory process unfold (see Figure 8.18.):
1. Increased amounts of growth factor arrive at the surface of mature dermal cells that now need to divide. Growth factor complexes with a cell-surface receptor protein, part of whose shape is designed to specifically bind to the growth factor.
2. The binding of growth factor and receptor protein causes the internal part of the receptor protein to accept phosphate groups: It becomes phosphorylated.
3. Through an adapter protein, the phosphorylated receptor protein is now able to activate the Ras protein.
4. Ras then activates a cascade of intracellular protein kinase enzymes.
5. Their activation results in increased cyclin production.
6. Each cyclin binds to its own kinase protein called Cdk.
Protein receptor for hormone
Figure 8.18 Ras Protein Control of Cell Division. At least eight steps are involved in this control pathway: 1. growth factor arrives from endocrine gland and binds to cell receptor protein. 2. Cell receptor protein binding alters internal protein structure resulting in receptor's susceptibility to being phosphorylated. 3. Phosphorylated receptor activates adapter protein which in turn activates the Ras protein. 4. Ras protein activates a series of pathway intermediate kinase proteins, the last of which, when phosphorylated causes an increased production of cyclin molecules. 5. Increased cyclin binds to cyclin-specific kinase enzymes in the nucleus activating
them. 6. Activated Cdk-cyclins phosphorylate the Rb protein converting it to its inactive state. 7. Inactivate Rb protein no longer holds cell at checkpoint. 8. Cell moves into S phase, division is now one checkpoint closer.
7. The cyclin-bound Cdk kinases now add phosphate groups to an important regulatory protein called Rb. Rb has been keeping the cell at the GrS transition checkpoint.
8. The Rb protein, once phosphorylated, becomes inactive. This releases the cell into S phase so DNA synthesis can begin!
Since you are constantly replacing skin cells at a slower rate even in the absence of a good sunburn, this multistep process happens all the time in your skin cells (with no thought at all on your part)!
But suppose, during your day at the beach, ultraviolet rays from the sun hit the DNA in one of your cells causing some critical covalent bonds to break and reform. During replication of that DNA in an S phase, this might cause a base pair in the DNA of the KRAS proto-oncogene
to be mutationally altered (see Figure 8.16). For example, an A=T pair in double-stranded DNA might be substituted with a GC pair at some point along the DNA sequence. If this results in a dangerous amino acid substitution in the structure of the Ras protein, then KRAS is now an oncogene. Its mutant protein product Ras becomes hyperactive. It is no longer responsive to activation by the adapter protein. It is now active all the time! It continually activates the protein kinase cascade, so cyclin levels remain abnormally high. The result is a cell that will not stop dividing. That is the hallmark of cancer.
Rb—a regulatory protein that, when phosphorylated, moves a cell from G1 into S phase of the cell cycle.
Can you see how difficult it would be for some oncologist to find that tiny cell or to stop it from dividing? Once it has produced enough daughter cells to be detectable, our strategy becomes to kill that cell and all of its daughter cells. We must get every last one! That is why our crude therapeutic approaches of radiation and chemotherapy are so drastic in their effects and side effects.
Let's now take another look at the control of cell division to see how a normal tumor suppressor gene functions. We are at the beach again, and today solar radiation—without killing a particular skin cell—happens to do considerable damage to that cell's DNA. Depending on the degree of damage, it might be dangerous for that cell to continue to live. It could become cancerous or it could simply function improperly. Your cells are crafted in such a
way that DNA damage can halt normal cell division until the DNA is repaired. If the repair needed is too extensive, your cell can actually cause its own death!
The cell uses a widely studied tumor suppressor gene to hold up cellular division when DNA is damaged. Human gene TP53 codes for a control protein named p53 (see Figure 8.19). This protein
TP53—a tumor suppressor gene whose product, the p53 protein, is used to suppress division of the cell.
p53—a regulatory protein whose phosphorylation causes it to bind the DNA sequences, resulting in expression of genes that will halt the cell cycle temporarily or result in apoptosis (cell suicide).
DNA damage
'N1
Figure 8.19 Protein Control of Cell Division. This pathway senses when cellular DNA has been damaged. 1. DNA damage activates a kinase protein called ATM. 2. Active ATM adds phosphate groups to p53 which cause p53 to bind to a particular site on DNA. 3. This binding causing transcription and translation of
protein p21. 4. Protein p21 inhibits the activity of cyclin-dependent Cdk kinase. 5. With Cdk inactive, the control protein Rb remains active. 6. The result is that the cell cannot pass the checkpoint moving it from the GI phase to the S phase.
receives signals from other proteins such as ATM, a protein kinase that is activated when DNA is damaged. ATM, a kinase, activates p53 by adding phosphate groups to it. In its activated state, p53 now binds to DNA at a specific site coding for still another protein called p21. (Such romantic names for proteins!) DNA binding by p53 causes the gene for p21 to be expressed and soon the p21 protein is floating about in the cell's nucleus. The p21 inhibits the activity of the combined Cdk-cyclin proteins. Now, they can no longer inactivate the Rb protein whose continued activity keeps the cell behind the G1-S phase checkpoint. So the cell gets stuck there. If it is a dermal cell meant to divide to produce new skin cells for you, then it will not do so. Amazing! All by itself, the cell is recognizing that it is damaged and should not go on to generate other damaged cells with its own genetic defects. Tumor suppressor genes code for wonderful products that may protect us from another new cancer that starts every other week or so!
But what if this protection is lost? Cancer researchers have estimated that more than half of the world's 10 million people diagnosed with cancer each year have mutations in the TP53 gene. It is the most widely mutated gene associated with cancer in humans. In these people, damage to DNA is not clearly sensed. Protein p53 is defective: It either fails to be properly phosphorylated, or it fails to bind DNA properly—or it is simply absent (see Figure 8.16). In either case, the p21 protein is never produced. So cells that are damaged and should be stopped until repairs are done, go right on dividing. If a proto-oncogene in the DNA of such a cell has also been damaged—and is now oncogenic—p53 will not be there to stop it. Cancer will probably result.
Life at the cellular level is highly competitive and just generally a dangerous form of existence. Protozoa engulf other species of protozoa for lunch (see Figure 8.20). Bacterial cells attack and destroy human cells, then absorb their remains. Fungal cells enzymatically degrade the brain cells of the ants they invade. Yet poised in the midst of all this vital, even rabid cellular greed is this wonderful example of selflessness based on carefully crafted cellular control genes. TP53 has been designed to guide a cellular process that is not in the best interest of the cell but rather of the organism that owns it. The active p53 protein can call for the death of its own cell so that the rest of the cells in the organismal population can continue to live! It does so even though new mutations in its own cell might enable that cell to reproduce vigorously by comparison with its sisters! What an insight into the mind of the Designer! It is entirely appropriate at this point for the reader to feel a deep sense of thankfulness. The control of cell division, though focused on cellular perpetuity, clearly has the greater welfare of the organism in mind. You are that organism. The cell is dispassionately, mechanistically selfless in this example. As an organism, your selflessness is a choice. Might a caring Designer be showing you a better use of your life?
ATM—a protein kinase that is expressed and activated as a result of numerous breaks occurring in the double-stranded DNA of the cell's genome. It phosphorylates key regulatory molecules affecting cell division.
p21—a protein that inhibits the activity of Cdk-cyclins; their inhibition halts progress toward cell division.
Figure 8.20 Cellular Predation. Protozoa don't have an easy life. Here a ciliate protozoan Didinium fires paralyzing "darts" into another type of ciliate, a Paramecium, turns it about and ingests it as you might a foot-long sub. It does so slowly and without teeth.
IN OTHER WORDS
1. Cancer cells differ from normal cells by dividing uncontrollably, dedifferentiating, and spreading into other tissues of the body.
2. Cancer is caused by mutations in genes of two different types: proto-oncogenes and tumor suppressor genes.
3. Usually two or more mutations in at least two different genes are required to cause the cell to become cancerous.
4. Cancer-causing mutant genes typically code for proteins that are parts of highly elaborate control pathways that determine when or whether a cell will divide to form two daughter cells.
5. Control pathways usually possess a receptor protein within the cell's plasma membrane, a series of kinase enzymes that phosphorylate pathway intermediates, and DNA binding proteins that influence transcription of specific genes in the DNA.
6. The proto-oncogene KRAS codes for the protein Ras, an intermediate in the control pathway that allows a cell to move past a checkpoint from G, phase into S phase.
7. A common type of base substitution (point) mutation in KRAS DNA causes a change in the Ras protein so that it becomes hyperactive and no longer subject to control; the cell is now instructed to divide continuously.
8. Tumor suppressor genes normally code for protein products that work to inhibit cell division when there are good reasons for a cell not to divide.
9. The tumor suppressor gene TP53 codes for the protein p53 that inhibits cell division when the cell's DNA is badly damaged.
10. The gene TP53 is the most commonly mutated gene in human cancers.
11. Both positive and negative control pathways affecting the G1-S transition checkpoint work by controlling the form of the Rb protein. When Rb is inactive, the checkpoint is passed; when it's active, the checkpoint is respected.
12. If a proto-oncogene mutates to oncogene status on a genetic background where TP53 is already mutant, the host cell is likely to become cancerous.
13. The selfless character of the p53 regulatory pathway causes it to inhibit division or even kill the cell it functions in.
QUESTIONS FOR REVIEW
|
1. List three essential resources that any living thing must have to maintain its living state. 2. What is the source of energy-containing molecules for the bud forming on a maternal yeast cell? Be as comprehensive as possible. 3. Name three component processes that contribute to the program that starts with a fertilized egg and ends with a mature adult. 4. How many new red blood cells do you produce every second? 5. A DNA polymerase molecule encounters the following base sequence on a maternal template strand of DNA: —AATATC GATCCCTTATGAGA—. Write down the sequence of nucleotides |
6. |
it will build into the new daughter strand opposite this template strand. When a DNA polymerase copies the base sequence that codes for its own structure, of what significance is this to the maternal cell it is working within? to the daughter cell in the next generation? What is a replication bubble? What functions of DNA are best served by its de-condensed chromatin state? its condensed chromosomal state? Which process takes more time: cell growth or cell division? Why might this be so? Explain the difference between the G, phase and a Go phase. |
11. What do you know about the future of a cell that 18. has started synthesizing daughter-strand DNA?
12. What is the function of a kinase enzyme, gener- 19. ally speaking?
13. What effect does the binding of a cyclin have on an intracellular kinase enzyme? What is the result of this binding? 20.
14. Why is it accurate to say that your physical appearance is a blend of your mother's and 21. your father's characteristics? Use boldface terms from this chapter is fashioning your response. 22.
15. Fill in the blanks with summary terms of your choice: Mitosis is principally about the partitioning of . As such, prophase 23.
is a time of metaphase, a
time of , anaphase, a time
of and telophase, a time of 24.
16. List three types of microtubules in a mitotic 25. spindle and describe the function of each.
17. Distinguish between the terms mitosis, cytokinesis, and cell division. 26.
Why is the cleavage furrow mechanism not useful for cell division in plants?
What part of a vesicle coming from the Golgi complex is the most likely source of membrane material for the new partition that will divide two daughter plant cells?
List the three basic characteristics that differentiate a cancer cell from a non-cancerous, normal cell. What is the functional difference between protooncogenes and tumor suppressor genes?
What is one important limit on cancer cell formation that keeps cancer relatively rare in the human population?
List the kinds of proteins that contribute to pathways that regulate cell division in normal body cells.
What is the precise function of the Ras protein? What does it immediately interact with? (Review question) Explain how changing a base pair in the KRAS DNA from A=T to G=C can alter the structure of the Ras protein.
How is a p53 protein activated?
QUESTIONS FOR THOUGHT
1. A pointy-headed friend announces vociferously 7. that life's race with death occurs essentially at the level of the organism, not the cell. Which two words in the previous sentence would immediately become the focus of subsequent debate?
2. The fertilized egg cell that gave rise to you went through many rounds of cell division with 8. daughter cells eventually differentiating into a variety of cell types. Which cells in your body 9. would have to retain the function of all of your genes in order to properly differentiate and serve their very important function?
3. Estimate the proportion of cells in your body that are red blood cells. 10.
4. At what rate does DNA polymerase check its work for errors? How many base pairs per second does it check? 11.
5. "Cells multiply by dividing." What biological process removes the paradox from this statement? 12.
6. Some acellular slime molds are simply large masses of cytoplasm multiple centimeters in diameter that 13. contain thousands of separate nuclei. How does this add meaning to the term cytokinesis?
In a nucleus containing 78 replicated chromosomes, how many centromeres are present? After the cell goes through a round of division, how many centromeres are present in each daughter cell? Explain again the phrase "cells multiple by dividing."
Why is it necessary for a centrosome to divide before anything else in the cell can divide? Consider what you learned about microtubules in Chapter 5. What must happen to the micro-tubules of the mitotic spindle once cell division is completed? Work from your conclusion to evidence that the cell is a designed thing.
Why might cytokinesis be delayed during the repeated mitotic events of early insect embryo development?
Why do cell division control pathways involve 8 to 10 separate control proteins instead of only one or two such proteins?
What determines whether or not the gene for protein p21 will be expressed?
In the living world, is it advantageous for a cell to mutate such that it now grows faster than other cells around it?
GLOSSARY
actin—a protein subunit of which microfilaments are composed. Together with myosin filaments, it is responsible for contractile events either in dividing cells or in muscle tissue.
anaphase—the third stage of mitosis during which replicated chromosomes split and a daughter chromatid goes to each daughter cell; a period of chromosome movement.
ATM—a protein kinase that is expressed and activated as a result of numerous breaks occurring in the double-stranded DNA of the cell's genome. It phosphorylates key regulatory molecules affecting cell division.
bubble—in DNA replication, the already-replicated region within the DNA molecule which begins at the origin of replication and expands as DNA is replicated in both directions from the replication origin.
budding—in yeast, the process by which a new daughter cell emerges from the surface of the larger maternal cell using materials and information from the maternal cell.
cell cycle—a sequence of stages that prepares a cell for and that carries it through cell division. It begins immediately within daughter cells following the division of a maternal cell.
cell plate—a medial, incipient, combined membrane and wall component preparatory to complete divi‑ sion of a maternal plant cell into two daughter cells.
centromere—a region of a chromosome containing highly repeated, short DNA sequences that is structural, not informational. Kinetochores attach to this region.
centrosome—a cellular microtubule organizing center. Microtubules radiate from this structure during mitosis.
checkpoint—a collection of interacting proteins that monitors conditions within a cell, inhibiting the cell from proceeding further into its cycle until conditions are favorable.
cleavage furrow—a constricting region of cytoplasm in a maternal cell that encircles the cell and progressively deepens finally resulting in two separate daughter cells.
contractile ring—a visible structure within a cleavage furrow composed of actin microfilaments; responsible for the deepening of the cleavage furrow.
cyclin—intracellular protein that activates kinase enzymes involved in moving the cell cycle forward.
cytokinesis—the division of the cytoplasm of a maternal cell resulting in two daughter cells. Mitosis precedes this process.
differentiation—a process by which, through time and successive generations of cells, stem cells commit to utilizing a specific part of their genomes; this process transforms them into specific types of cells like neurons or epithelial cells.
diploid—refers to a cell that contains two complete sets of chromosomes, usually inherited from two separate parent genomes.
DNA polymerase—an enzyme that replicates an organism's DNA by adding free nucleotides to the ends of single DNA strands.
G0 phase—an indefinite, usually long time period (formally within G1 phase) during which a cell simply maintains its vitality because it is unable to pass a checkpoint leading to DNA synthesis.
G, phase—an initial period of growth immediately following cell division that precedes DNA synthesis; highly variable in length in diverse cell types or under varying conditions of growth.
G2 phase—that portion of the cell cycle following DNA synthesis during which cellular biosynthesis focuses on structures needed for division of the cell.
haploid—refers to a cell (often a sex cell) that contains a single set of chromosomes or one copy of the cell's genome.
interphase—that portion of the cell cycle when the cell is not in the process of dividing. It is characterized by biosynthesis and growth of the cell.
kinase enzyme—a protein that catalyzes the addition of a phosphate group to some other protein or molecule. Addition or removal of the phosphate often results in altered regulation of some cell function.
kinetochore—a protein complex that binds centromeric regions of chromosomes; microtubules attach to it and pull the chromosome to a spindle pole during mitosis.
KRAS—a proto-oncogene whose product, the Ras protein, functions in the control of cell division.
Life Is Informational Continuity—one of 12 principles of life on which this text is based; DNA base sequence that is used to craft any cell came to that cell from a parental cell by DNA replication.
medial—occurring or situated in the middle or between other structures or processes.
metaphase—the second stage of mitosis during which chromosomes reach the center of the maternal cell being arranged across an imaginary equatorial plate.
metaphase plate—an imaginary region, disc-shaped, often in the cell's geometric center, where all of the cell's chromosomes come to lie during the second stage of mitosis.
mitosis—the process of dividing a single maternal nucleus into two daughter nuclei distributing to each nucleus equal halves of replicated chromosomes. Cell division is usually concurrent or follows immediately.
mitotic spindle—arrangement of microtubules used to separate halves of replicated chromosomes into daughter nuclei.
molecular weight—the total mass number of the atoms comprising a molecule. Each carbon would contribute a mass number of 12 to the molecule; each oxygen, 16.
motor proteins—an enzyme that uses ATP energy to do mechanical work within the cell; interacts with cytoskeletal elements to move cell parts.
nucleoside triphosphate—a subunit monomer for nucleic acids DNA or RNA that includes three adjacent phosphate groups in its structure. ATP is an example.
oncogene—(Gk. oncos = tumor), a mutant protooncogene that predisposes the cell toward uncontrolled division.
origin of replication—a sequence of bases in DNA that is recognized by a helicase enzyme; the enzyme twists open the double helix at this point to allow a polymerase enzyme to begin replicating single DNA strands.
p21—a protein that inhibits the activity of Cdkcyclins; their inhibition halts progress toward cell division.
p53—a regulatory protein whose phosphorylation causes it to bind the DNA sequences, resulting in expression of genes that will halt the cell cycle temporarily or result in apoptosis (cell suicide).
phosphorylation—the attachment of a phosphate group (–P03) to a molecule; often protein modification from inactive to active states is accomplished in this way.
prophase—the first stage of mitosis during which chromosomes become visible, the nuclear membrane deteriorates, and the mitotic spindle apparatus takes shape
proto-oncogene—a normal cellular gene whose product helps control progress within the cell cycle toward cell division.
Ras—a regulatory protein whose activation stimulates a cascade of regulatory alterations that results in the movement of a cell from G, into S phase of the cell cycle.
Rb—a regulatory protein that, when phosphorylated, moves a cell from G, into S phase of the cell cycle.
phase—that portion of the cell cycle during which DNA and its scaffolding proteins are synthesized.
sister chromatid—half of a replicated chromosome; joined to a replica of itself by a centromere; splitting of the centromere converts each chromosomal half into a separate (now unreplicated) chromosome.
telophase—the fourth stage of mitosis during which parted sister chromatids (now chromosomes) decondense, nuclear membranes form, and daughter nuclei take on an interphase appearance.
template—a sequence of nucleic acid that is read by a polymerase enzyme such that it generates a new sequence of bases complementary to the one read.
TP53—a tumor suppressor gene whose product, the p53 protein, is used to suppress division of the cell.
tumor suppressor gene—a normal cellular gene whose product inhibits progress toward cell division; its mutation or loss leads to cancer.
Complexity IV:
From Cell to
Organism
ELOPMENT: DECODING PLAN
What Can Be Done with a Fertilized Egg?
Thus far, your impression of biology is one of a vast assortment of carefully crafted biomolecules functioning within the membranes and "bowels" of even more intricate cells. Yet most of what our eyes observe in the living world is organismal. (Isn't biology about dissecting frogs and making leaf collections?) We have now explored cells and their workings just barely long enough to enable us to move on. On to where? To the subject of development—the use of cells to develop an organism.
The process of development is difficult to define. We might describe it as a trek of informational expression from a single cell—a fertilized egg—to a mature organism (see Figure 9.1). But this trek expresses itself in unfolding levels of internested complexity! (Life Is Complex.) Sporting a wonderful program that we still fail to comprehend, a single cell begins to grow, and divide, with the products developing first into tissues, then into organs, and finally into organ systems, presenting to us the mature organism.
Perhaps you've visited or worked at an assembly line in a factory. Computers and automobiles "develop" in this way (see illustration
below). It is exciting (at first) to watch as the parts of a new automobile get spot welded into place. A high-performance engine and drive train, sophisticated electronic panels, and carpeting are added. Eventually, a key is turned, and the automobile takes on a life of its own—a triumph of human knowledge, mental creativity, and strength.
Far more amazing than that assembly line, is the ultrasound suite in a prenatal clinic. Like the automobile, the parts of the child are taking shape. But how highly superficial is our analogy! For all the time that the embryo develops it is also entirely alive! It respires without lungs. Without a brain it sends out neurons to appropriate places in the body. And as stated previously, the design is not found in file drawers in some model shop. And it is not implemented by some external skilled craftsmen. The design is within the embryo itself, and the construction, driven with placental support, is also directed from within! The embryo is the "auto-mobile" that makes itself. While it is becoming it is also being.
So development is the study of initiation and construction. Once the mature adult exists, we can then study a variety of maintenance functions. This will be the subject of Chapter 10. But far more amazing than the efficient function of the 11 organ systems that are you is the process that "pulled them out of the hat"—the single-celled zygote that you once were. The daunting complexity of organismal development is an integrating field in biology (see Table 9.1). Molecular; cellular, tissue, and organismal studies are all part of its province. Scientists trained in a variety of subdisciplines are drawn to the fascinating mysteries inherent in the process of development.
Getting from One Cell to You or to a Tree
In our relative ignorance of its nuances, we have attempted to categorize aspects of development that isolate and clarify the mysteries to be explained. Currently, we see four component parts to the process that commences with a zygote (a fertilized egg) and results in you. Some of them are obvious, some, more subtle.
1. The first is growth. Your first cell was the size of the point of a pin. What is your size now? (150 lbs? 220 lbs?). And some of us, with the help of ice cream and cookies, continue to grow. One fruitful question you might ask is why are there limits to growth in height? Why does the average human male in the United States reach a height of 5' 9" and then stop growing?
|
embryo—an organism in its early stages of developing toward maturity; immediately following fertilization, the cell has commenced this development. zygote—a single diploid cell resulting from the fertilization of a haploid egg cell by a haploid sperm cell. growth—accumulation of biomass in either a cell, a tissue, an organ or an individual. |
Figure 9.1 A cell becomes a frog.
One thing we know for certain. If growth were the only component to development, you'd be no larger than a single cell. Why is that? (Return to Section 5.1 for ideas.)
2. This huge mass we've become must have undergone cell division. This was critical so we could molecularly service all the parts of our bodies with oxygen, nutrients, and waste removal (see Figure 9.2). This is why the coffee you spill onto your hand isn't going to get the caffeine working in your fingertips! The developing organism is something like what happens to a grocery business when it graduates from a farm stand to a supermarket. In a farm stand everyone gathers around the goods, reaches in, and selects what they want. But in a supermarket, there're too
Table 9.1 Biological disciplines contributing to developmental biology
|
Sub-discipline of Biology anatomy |
Interest in Development form of new structures |
|
physiology |
embryonic processes |
|
genetics |
informational control of development |
|
histology |
how tissue layers form and move |
|
cell biology |
how cells differentiate |
|
microbiology |
development of simpler multicellular organisms |
|
molecular biology |
the chemical basis of differentiation |
Figure 9.2 Servicing a Multicellular Hand. Blood vessels carry nutrients,
oxygen, and hormones to billions of cells all throughout the hand.
many goods to use that approach. So we have aisles separating various goods so everything is available to everybody. In a huge tree or a human body, growth must be followed by subdivision (cell division) with spaces in between so that bulk flow of materials can service all the parts.
3. But we can't get by with just one type of cell. In a macroorganism with many cells, there has to be differentiation of those cells into separate types, with each type serving the organism in its own way (see Table 9.2). We humans must have neurons to inform us, lymphocytes to fight our microbial battles, myocytes to lift things, erythrocytes to transport oxygen, and osteocytes to support us. Somehow, for each of the more than 200 different types of cells in your body, a select set of genes is activated, and all the other genes that would support the functions of all the other cell types are shut off. Someone has written an amazing developmental program! It was not any scientist I know.
4. But finally, we aren't just a grab bag of 200 cell types just strewn through the organism randomly. Cells are organized into tissues. Neurons are found in nerves. Osteocytes work together in bones (see Figure 9.3a). Tracheids form long water-conducting tubes of xylem in the stem of an alfalfa plant (see Figure 9.3b). When many cells of one type divide, grow, and move together in a process called morphogenesis, they become spatially organized into large ordered groupings like a stomach lining or a toenail. In this way, they can better serve an organism as large as a tree or a human being.
But the variety of tissue structures and functions is small compared to the diversity of activities required within an organism like a human or a tree.
Table 9.2 Differentiation in plant cells.
|
|
|
|
|
|
Cell Type Parenchyma cell |
Function Secreation, storage, photosynthesis |
|
|
|
mans |
|
Collenchyma cell |
Support |
|
|
|
|
mama |
|
|
|
|
|
|
|
ammo |
|
|
|
|
|
|
|
steseson• |
|
|
|
|
|
|
096,!0. |
Sclerenchyma cell (fiber) |
Support |
|||
|
|
|
--.-s-ar•(••( |
Tracheid |
Conduction of water and minerals; support |
||
|
|
9(--orr7Tywim. |
Vessel element |
Conduction of water and minerals; support |
|||
|
|
Sieve-tube element Companion cell (not shown) |
Conduction of dissolved food materials (carbohydrates) Aids sieve-tube element |
||||
|
i |
, . • 1 |
Epidermal cells |
Protective covering over surface |
|
differentiation a process by which a generalized cell or tissue matures into a specialized cell or tissue. morphogenesis the development of the form of the organ‑ ism; involves getting and keeping differentiated cells and tissues organized into productive groupings. |
Bone tissue
Fine canals
Central canal containing
1 blood vessel
Osteocytes
0
Figure 9.3 Morphogenesis leads to Organization. (a) Within a human bone is a dense array of concentric rings of bone cells arranged around central canals whose blood vessels and nerves service the surrounding cells. "Osteocytes" (bone cells) secrete the dense layers around them that give strength to the bone. (b) Within the stem of an alfalfa plant is a glorious
arrangement of diverse tissue structures that together support the plant physically, conducts water and nutrients, and protect interior structures from dessication and parasites.
So tissues are arranged into higher-order structures called organs, whose diversity suits this myriad of activities. Epithelial tissue, connective tissue, glandular tissue, muscle tissue, and neural tissue work together to make an organ we call the stomach (see Figure 9.4a). Epidermal tissue, mesophyll tissue, and conducting tissues work together to form a leaf (see Figure 9.4b).
But how do miracles like leaves and stomachs ever get structured from their component tissues? Questions like this invade the realm of high mystery where developmental biology operates! Our current answers are crude but maturing year by year. The miracle of development is really a highly sophisticated program. As the program unfolds, movements of separate tissue layers cause them to change their relationships to each other spatially within the embryo (see Figure 9.5). Signal molecules from cells in a newly adjacent tissue can cause gene expression changes in cells of another tissue. We call this process induction. This sort of signal reception and response informs the process of patterning and structuring as tissues interact and mature into organs (see Figure 9.5).
In humans, as many as 78 organs serve 78 discrete functions. But these functions fall into natural groupings that suggest a still higher level of organization in the Mind of the Designer. In Chapter 1, we called this higher level the organ system. For example, the stomach, pancreas, liver, small intestine, and large intestine are all organs that cooperate to support nutritional intake of the organism. They are
an organ system: the digestive system. The human organism is composed of 11 such organ systems, which, although separately defined, are highly interrelated (see Figure 9.6)!
This, then, is a superficial description of how development uses a single cell to create a macroorganism. In summary, cells grow till they're large enough to divide. Once there are enough of them, they differentiate into different types of cells, but the various cell types organize into tissues and organs as the body grows, so that the whole organism is served. While a two-sentence summary of development many have a basic intellectual appeal to it, it does practically nothing to detract from the pleasant mystery the gardener anticipates as he drops a seed in a hole.
|
epithelial tissue—layers or groups of animal cells that cover body surfaces, line body cavities, and give rise to certain glands. connective tissue—a collection of cells in an extracellular matrix of supportive material that adds structural strength to other nearby collections of cells. mesophyll tissue—interior photosynthetic cells in a leaf. induction—that chemical process by which one cell or tissue produces a change in behavior or structure in a second cell or tissue. digestive system—that organ system in the animal body that takes in, breaks down, and absorbs the components of food. |
Figure 9.4 Tissue Structure of an Organ. (a)The stomach is an organ used for the mechanical and enzymatic degradation of food. Four of its supporting tissues
are shown. Epithelial tissue: absorption, secretory glands. Connective tissue: blood vessels for transport, supportive structures. Muscle tissue: mixing and movement of food. Nervous tissue: intra-organ, inter-organ control and communication.
(b)The leaf is the principal site of photosynthesis. Note the protective epidermal layers, the stomatal openings with surrounding guard cells that permit gas exchange to the leaf interior, the mesophyll layers and the vascular tissues within the mesophyll layers.
Guard cells
Embryonic induction
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
· |
|
|
|
· |
· |
Main organs: Brain, spinal cord, peripheral nerves, sensory organs
Main functions: Senses internal and external stimuli;
coordinates responses to stimuli;
controls other organ systems.
Main organs: Pituitary, thyroid, adrenal, pancreas, and other hormone secreting glands
Main functions: Cooperates with nervous system to control body function using hormonal signals.
Main functions: Main functions: Support and Protection from protection of body; dehydration,
leverage for pathogens, injury; muscle contraction; temperature
blood cell control;
production. waste excretion.
Main organs: Heart, blood vessels, blood
Main functions: Services body cells with nutrients, oxygen, and waste removal; temperature and pH stabilization.
Main organs: Lymph nodes, lymph ducts, spleen, thymus
Main functions: Filters tissue fluids, monitors and protects
against disease.
Figure 9.6 Organ Systems in the Human Body.
IN OTHER WORDS
1. The process of development uses information in the nucleus of a single cell and the positional relationship of molecules in the cytoplasm of that cell to generate a complex multicellular organism.
2. The developing organism is entirely alive and functions all the time that it is in the process of maturing to adulthood.
3. The first cell of the developing organism is a fertilized egg, also called the zygote.
4. Organismal development can be dissected into four component processes: growth, cell division, differentiation, and morphogenesis (or organization).
5. Cell division permits growth of the organism beyond the limits of cell size imposed by exchange capabilities across the cell membrane.
6. Differentiation of cells into diverse types involves turning on separate, specific sets of genes in each cell type. Most genes are not expressed in most cells.
7. As cells differentiate, those of a given type tend to stay together to form tissues. Tissue movement and signalling in the embryo—the process of morphogenesis—yield body organs that can be classified into organ systems.
8. One tissue signaling another to alter its behavior is called induction.
|
|
|
|
|
|
|
Digestive System |
|
Reproductive System |
|
Main organs: Lungs, diaphragm, trachea, and other airways Main functions: Oxygen delivery to tissues, waste CO2 removal; pH regulation. |
Main organs: Pharynx, esophagus, stomach, intestines, liver, pancreas, rectum, anus Main functions: Ingestion of food; mechanical and chemical breakdown of food, nutrient absorption, waste elimination. |
Main organs: Kidneys, bladder, ureter, urethra Main functions: Controls volume and composition of internal fluids, removes excess water and metabolic wastes. |
Main organs: Female: ovaries, oviducts, uterus, vagina, mammary glands Male: testes, sperm ducts, accessory glands, penis Main functions: Production and union of sex cells; supports embryonic development; hormonal control of some body systems. |
Figure 9.6 (Continued)
LOBA: HOW TO MAKE A TREE
We've just made some very broad generalizations about development. Let's apply them to two specific examples: the development of a tree and the development of you. What sort of tree might we select for our study? The maidenhair tree, scientific name Ginkgo biloba, is a fascinating tree for study (see Figure 9.7). A quick look at the structure of its graceful leaf supports what we know from other studies as well: No other trees alive today are quite like it. In fact, we're not really certain that it grows anywhere in the wild—perhaps in Eastern China, but even this particular location is debated. It's been cultivated by Chinese monks in this region for over 1000 years, perhaps out of interest in its culinary and medicinal properties. The glorious yellow color of the leaves in fall commends their rare beauty to us. Ginkgo trees exist that are claimed to be more than 2500 years in age! They're hardy too! Several individual trees survived the intense, high-energy radiation of the atomic bombing of Hiroshima in 1945. Little else did. And the medical community is highly interested in the chemistry of the leaves for a variety of pathological conditions. There is a certain satisfaction in studying the development of an organism so
attractive, long-lived, durable, and medically useful. Let's have a look at how it begins life.
Early Development
Childhood experience suggests to us that a new plant results from the germination of a seed. But a closer look reveals that the life of a new plant formally begins deep within the female reproductive structures of the parent plant. Ginkgo trees are "good" plants, but they have some surprises for us. First, they are dioecious—they exist as separate male and female trees. Second, their female reproductive structure is unique. We hesitate to call it a flower or a cone (see
germination—the beginning or resumption of growth in a seed, spore, or bud structure.
seed—an embryonic plant together with its nutrient source enclosed within a protective coat of external tissue.
dioecious (Gk. di- = two, oikos- = house)—a species of plant in which the reproductive organs of the two sexes are found on separate individuals.
0 0 O
Figure 9.7 Ginkgo biloba. (a) a beautiful specimen in a formal garden in England (b) the fall color of the leaves is glorious. On a single tree, they all drop (abscise) within a few days'time. (c) a Ginkgo leaf resting on a fossil of a Gingko leaf taken from Cretaceous sediments.
Figure 9.8 Ginkgo Reproduction. (a) In the upper right-hand corner of this diagram is a portion of a stem from a female tree. Note the ovules protruding from the stalks. In the lower lefthand corner is a portion of a stem from a male tree. Note the loosely arranged"cone"that forms pollen grains. In the lower right hand portion of the diagram a seed is shown both entire and sectioned through with a knife. (b) a diagramatic slice through an ovule at a time just prior to fertilization of an archegonium (or egg cell). (c) a diagramatic slice through an archegonium (egg cell) showing fertilization by a haploid sperm nucleus. (d) the same archegonium following multiple nuclear divisions and cytokinesis events that generate a 256 cell embryo.
Section 9.2b). It's a 1.5-cm-long stalk with a colorful swollen end that contains just one to two ovules in the end of it (see Figure 9.8a, b). Within each ovule is a haploid egg cell. When a pollen grain from a cone on a male tree (see Figure 9.8a) wanders by and lands there, male tissue arises from it, begins to invade the ovule and grows there. Soon, haploid sperm cells are produced and one of them migrates to and fertilizes the haploid egg cell (see Figure 9.8b—c). This fertilization event can occur while the ovule is still on the tree or after it has matured a bit and fallen to
|
ovule—a female reproductive structure in plants in which the haploid egg cell has matured. The mature ovule contains the new individual and is called a seed. pollen grain—a spore-like structure in plants containing the haploid nucleus that will fertilize the female ovum to produce a zygote. It is carried from the male reproductive structure to the female one by wind, water, or other organisms. fertilization process by which a male sex cell and a female sex cell fuse to form a diploid first cell (zygote) of a new individual. |
Figure 9.9 Ginkgo biloba seed. (a) The seed and surrounding fruit have a shape similar to that of the ovule in Figure 9.8 because the seed develops within the ovule. The cotyledon is a primary embryonic leaf whose nutritive content is utilized once the seedling begins to grow. The actively dividing apical part of the embryo (toward the
cotyledons) grows forward (downward) digesting maternal nutrient tissues as it grows. (b) photo of the seeds/fruit.
O
the ground. The product of fertilization—the fusion of egg and sperm—is a diploid cell (two complete sets of chromosomes)—the zygote. Development of a huge ginkgo tree begins with a zygote measuring less than one-tenth millimeter in length.
The zygote begins development with a sequence of eight nuclear divisions in a common cytoplasm (see Figure 9.8d). The resulting nuclei get distributed into separate cytoplasms generating an oblong embryo containing about 28 or 256 cells in it. Growth accompanies these early divisions. Both processes are completely supported materially and energetically by specialized maternal nutritive tissues within the ovule of the parent plant, sometimes called the endosperm. The ovule also synthesizes a tough outer seed coat that will protect the embryo from possibly harsh desiccating conditions to follow (see Figure 9.9). Next, it synthesizes a foul-smelling organic acid in the fruit that will surround the seed-coated embryo. It is suspected that this "rotting flesh" odor may attract some reptilian predators that then ingest the fruit, distributing the seeds unharmed in their feces. Other potential predators may be repelled by the odor. Without all this biologically "expensive" support from the parent plant, the embryo wouldn't have a chance in a cold, dry, external world filled with predatory fungi, insect, and avian forms.
Meanwhile, within the seed, the cells of the embryo are differentiating into distinct tissues. How does this happen? Signal molecules called hormones move cell populations in new directions structurally and functionally by causing them to stop transcribing some genes within their genomes and to start transcribing others. Early on, within the maternal tissues surrounding the new zygote, a gradient of a plant hormone called an auxin is set up—the concentration of the auxin being higher toward the basal end of the zygote than the apical end (see Figure 9.10a). Auxins
0
are readily transported from cell to cell and they diffuse readily within cells. So a gradient is quickly established extending away from the cell in which the auxin is being generated. When the cell divisions occur that give rise to the 256-cell embryo, cells at the basal end will have a higher auxin concentration than at the other end. The higher concentration of auxin in basal cells will call different genes to expression and result in distinct cell types emerging in the new embryo. So it is maternally supplied information—an auxin gradient—that controls information expression in the new organism. Toward one end of the embryo (the apical end), tissues that form the shoot (future stem, leaves, flowers) will emerge; toward the basal end, the root (that will absorb water and mineral nutrients from the soil) will form. The cells at each end of the embryo have the same genetic information! But differential auxin signaling yields expression of different subsets of the genome in different cells. In Figure 9.10b you can see embryonic cells that will become the tip of the first shoot—the first stem of the seedling.
endosperm—a plant tissue within a seed that contains stored nutrients for a developing embryo. It forms from fertilization of nuclei in the ovule by a nucleus in the pollen grain.
hormone—within an organism, a (usually small) molecule generated in one kind of tissue that becomes a signal or message causing cells elsewhere in the organism to alter their behavior in response.
auxin—a class of plant hormones that tends to promote cell elongation leading to stem elongation and root initiation.
shoot—the portion of embryonic tissue that will give rise to aerial parts of the plant: the stems, leaves, and flowers.
root—the portion of embryonic tissue that will give rise to underground parts of the plant designed for absorption and anchoring of the plant.
Hormonal gradient in embryo
Figure 9.10 Differentiation in an Early Embryo. (a) Maternal tissues set up a gradient of auxin concentration within embryonic cells which defines an axis of polarity along which the embryo develops the root to one end, the shoot tip to the other end. (b) After several weeks, the embryo within the seed has a clear polarity with structures as labelled. The cotyledons are loaded with starch granules which will provide nutrients once the seed germinates.
0
Development of the embryo within a seed reaches a point less commonly reached in animal development—a stopping point. In many plants, especially in temperate climates, by the time the seed coat has become fully protective of the embryo, environmental (seasonal) conditions no longer favor continued development. So the embryo simply stops developing, the seed remains dormant until optimal growth conditions resume. The seed then germinates, and development of the embryo into a seedling resumes.
Cell Specialization: Tissue Types Emerge
Within the maturing root and shoot, three basic types of cells differentiate from each other and organize as separate tissues. Later on, these three tissue types will be found in all organs of the plant: The ground tissue serves basic life-support functions such as photosynthesis and storage of food and water, vascular tissue distributes water and solutes throughout the plant, and dermal tissue covers and protects plant surfaces (see Figure 9.11).
But there is one other sort of tissue, especially within stems and roots, that fascinates plant biologists: It is a
Figure 9.11 Ginkgo biloba root in cross section (cut through with a sharp
blade and seen on end). The tissues are stained for better visibility.
|
ground tissue—the fundamental tissue system of a plant excluding its epidermal and vascular tissues. vascular tissue those structures both cellular and cellular products that conduct fluids from one place to another in the plant body. dermal tissue—those cellular layers that serve a protective function on the surface of the plant body; protection from desiccation and parasitic pests. |
Figure 9.12 Apical Meristem. This is a longitudinal slice through the tip of a stem in a plant of Genus Coleus showing a region of apical meristem. Other developing structures are noted as well
permanently undifferentiated, continuously dividing collection of cells called meristem (Gk. meristo- = divided). This tissue allows us to study the developmental processes of growth and cell division in the absence of any differentiation or morphogenesis. It is somewhat like stem cell tissue in humans, but unlike in humans, it enables the gingko tree to reach thousands of years in age instead of simply decades! This difference was appreciated by observers literally thousands of years ago. In the ancient Biblical story of Job we read:
For there is hope for a tree, if it is cut down, that it will sprout again, and that its shoots will not cease. . . . but a man dies and is laid low; man breathes his last and where is he? ... (Jos 14: 7, 10)
The mystery of the superior durability of meristem cells as compared with human stem cells is one that still challenges molecular biologists today. It is a quandary in the midst of which naturalistic biologists appeal to the accidental aspects of their theory. By accident, plant meristem has achieved this exceptional durability while, by accident, human stem cells only discover it in the cancerous state. Meristem durability means that for the entire life of an individual plant, growth is a more continuous process. In animals, by contrast, development leads to maturity and then maintenance. This results in entirely different lifestyles. In waging life's wars, animals go places whereas plants grow places.
Meristem exists within a plant in zones—small regions of cells that seasonally give rise to fresh stem, leaf, flower, and root tissues. Consider the apical meristem at the tip of a stem (see Figure 9.12). Cells in this region have high growth and division rates. As the rapidly dividing cell region moves up or forward, the cells left behind then begin to differentiate into the three tissue types discussed above. Apical meristems tend to lengthen stems and roots. By contrast, consider again Figure 9.11—a section through a root of Ginkgo biloba. Shown there is a thin layer (dark purple) of lateral meristem—undifferentiated cells that, by their division, thicken the root as the seedling grows. As cells divide horizontally away from these meristems, they differentiate into the various tissues that support function in the thickening
undifferentiated—referring to a cell or tissue that is committed to no specified role or function within the organism other than providing a source of new cells.
meristem—undifferentiated plant cells and tissue from which new cells are produced.
stem cell—a growing, dividing, undifferentiated cell within animal embryos or adults that eventually differentiates into a variety of types of cells found in the animal's body.
apical meristem—a zone of rapidly dividing, undifferentiated plant cells near the tip or apex of a shoot, stem, or root.
lateral meristem—within a stem or root, a layer of undifferentiated plant cells whose division adds to the diameter of the stem Or root.
stem. Once meristematic tissue generates new cells, it is the response of these cells to plant hormones that unfolds the differentiation and morphogenesis processes.
Morphogenesis: Organ Formation
Origin of Roots After a period of dormancy, a seed responds to temperature and moisture levels appropriate for growth. For example, the seed absorbs available moisture and its coat cracks open. Germination follows immediately. Differentiation within the young seedling continues as it emerges from the soil (see Figure 9.13a). The primary root is the first structure to emerge from the seed. It thickens as it grows downward. The meristem near the tip generates many cellular descendants behind it that divide, enlarge, and elongate. The meristem also produces cells in the forward direction (down) to form a dome-shaped mass of expendable cells called a root cap that protects the root as it pushes through the soil (see Figure 9.13b). From the cellular descendants trailing behind the meristem, auxin-driven differentiation gives rise to the ground tissue for nutrient storage and a vascular cylinder consisting of xylem and phloem tissues that will conduct water and nutrients respectively throughout the plant. The rate at which cell division occurs in the root meristem is under the control of a class of plant hormones called cytokinins. These hormones are synthesized near the tips of the roots.
root cap on the very tip of a root, a layer of cells that generates
a mucoid secretion easing the root further into the soil.
vascular cylinder—also called the stele; within a root, a central collection of xylem and phloem tissue including internal meristematic and surface dermal tissues.
xylem—a transport tissue in plants; in trees it comprises much of the wood of the trunk; transports water upward within a plant.
phloem—a transport tissue in plants; carries nutrients, sucrose in particular, to all parts of the plant.
cytokinins—plant hormones that promote cell division in roots and shoots; contribute to dominance of growth of the central stem of a plant.
Figure 9.13 Root Development. (a) The primary root is the first structure to emerge from the cracked seed coat. The cotyledons remain within the seed contributing their nutrients to the emerging seedling. (b) Zones of growth and differentiation found within a typical primary root.
Origin of Stems In the embryo's shoot tip is another small collection of apical meristem cells. As it divides its way upward, cells left behind divide at different rates and in disparate directions differentiating in size, shape, and function. Lateral (axillary) buds will arise from these differentiated tissues, each with its own apical zone of meristematic cells. From these will come lateral stems, leaves, and eventually, in half of all gingko trees, ovule-containing stalks (see Figure 9.14). Stem development is also influenced by plant hormones. The young tissues of shoots produce gibberellins, hormones that promote stem lengthening. Auxins, a group of hormones mentioned above, also stimulate lengthening growth. They tend to inhibit production of lateral buds, but this tendency is offset by cytokinins travelling up through the phloem from the root tips. Apical stem growth and lateral stem grow are skillfully orchestrated in length and pattern as a result of the interactions of cells with all of the various classes of hormones.
Origin of Leaves Shortly after germination, the leaves of the gingko seedling unfold. Within each leaf, cell populations have already begun to differentiate into the tissues that will compose the mature leaf. As the meristem in the apical bud moves forward, the immature leaf has a deeply bibbed, wing-like structure to either side on the stem. Below each wing is a bulge that will become the next tier of immature leaves. As the stem lengthens, tier after tier of new leaves is left behind (see Figure 9.15). The emerging leaves come under the control of the cytokinin class of hormones that promote the expansion of leaves to their full size and inhibit their aging. As the growing season progresses, the plant begins to generate other hormones that cause leaves to wilt and sever their connection to the stem, causing them to drop from the tree. This process is closely timed in Gingko biloba; some trees drop all of their leaves in a single day!
lateral bud—forming at the base (axil) of a leaf, embryonic tissue that will give rise to an axillary shoot from the surface of an existing stem.
gibberellins—plant hormones that regulate growth and differentiation particularly with respect to stem elongation, germination and flowering.
O
Ginkgo biloba stem development
O
Figure 9.14 Stem Development (a) On the top surface of the branch, a lateral bud has given rise to a long shoot (a new branch). On the lower surface, the lateral bud has generated one of the more numerous spur shoots that form leaves. (b) Whether a lateral bud becomes a long shoot or a spur shoot is dependent on the interactions between hormonal gradients within the branch.
Figure 9.15 Leaf Development. Hormonal signals in concert prompt the genetic programs within differentiated stem cells to give rise to new tiers of leaves.
As gingko leaves mature, their cells develop a surface, thickness, and shape that perfectly fit them to temperate climates. They are not designed for the sweeping winds of the tundra or the desiccating conditions of the desert. The ginkgo leaf develops a robust defensive chemistry that makes the trees resistant to a wide variety of insect pests. This chemistry may help explain their wide distribution within temperate regions of the planet.
Generally speaking, plant leaves vary widely across habitats in both their structure and chemical composition. These variations neatly adapt each type of plant to both the physical characteristics and the principle predators in their range of habitat (see Figure 9.16). Desert leaves are thick with heavy cuticles to prevent water loss. Aquatic plants have very thin leaves by comparison.
This habitat-constrained logic in the design of leaves has resulted in an almost limitless variety in leaf structure and chemistry that man has exploited for food (lettuce, cabbage, onion, rhubarb, spinach, etc.), spices (mint, bay, thyme, etc.), medicines (garlic, mint, belladonna, digitalis, teas), fumigants, construction materials (thatch, roofs, walls), waxes, abrasives, hair dyes, ropes, burlap, and for decorative purposes. Did we think that their only value was the oxygen they generated?
Origin of Reproductive Structures The ginkgo tree's reproduction is unique in the plant world. Ginkgos develop according to a visually pleasing pattern in which long branches send out short branches via an attachment that is at almost a right angle with the parent branch. It is off of these short branches that the reproductive structures develop. While male trees have cone-like structures that generate pollen, female trees do not
0 0 O
Figure 9.16 LeafVariation. (a) In this dessert cactus Mammilaria, leaves are reduced to mere spines. These minimize water loss and deter predators. (b) Another approach to minimizing water loss when sunlight is ample: spherical leaves of the Senecio plant. (c) When water is plentiful and sunlight more limiting, leaves approach two dimensionality and can become 11 inches in diameter as in this water lily (Nymphae odorata)
have either a flower (like in flowering plants) or a cone (as in conifers). Rather, under hormonal control, the short branches of the female tree send out 1.5-cm-long stalks on the end of which are ovules preparing for pollination (see Figure 9.8). But ovules and cones do not appear for the first 20 to 35 seasons of growth! Wind carries pollen from the male trees to the female ovules. The fleshy ovule becomes a yellow fruit the size of a cherry. The odor of this fruit is distinctly unpleasant, but the nuts inside are quite edible (see Figure 9.9).
Gingko's unique mode of reproduction confounds conventional classification schemes. But
then, classification schemes are the products of mere men. The ginkgo is so adapted, yet graceful, in leaf morphology and so glorious in fall color that one looks for a gifted Artist behind such majesty.
flower—a plant reproductive structure in angiosperms (flowering plants) that serves to bring ova and sperm nuclei together to form embryos within seeds.
cone (or strobilus)—reproductive structure in conifers that generates pollen or ova, and following fertilization, seeds; often woody in structure.
IN OTHER WORDS
1. Ginkgo trees are unique in their leaf structure, reproductive processes, and natural history—a fascinating plant for study.
2. The life, the separate identity, of a ginkgo tree begins within the ovule of the maternal parent tree where fertilization takes place.
3. The maternal tissues, and specifically seed structures, protect and nutritionally support the developing embryo.
4. A multicellular gradient of auxin hormone within maternal tissues sets up a polar axis along which the embryo's root and shoot will develop.
5. Development in plants, especially in temperate climates, is often halted within the seed during winter months until acceptable growth temperatures resume in the spring.
6. Three basic types of plant tissue are the dermal tissues that protect plant surfaces, the ground tissues that support essential plant functions, and vascular tissues that transport substances from place to place in the plant.
7. Meristematic tissue in plants is a place of growth and division of undifferentiated cells. It supports development of the plant throughout the plant's entire life span, which may be thousands of years in length.
8. The plant root is the product of cell division in root tip meristem, cell elongation, and hormone-driven cell differentiation into the basic tissue types.
9. The shoot of the embryo becomes the trunk of the ginkgo tree; hormonal levels in cells all along the shoot control sites where lateral buds will form to become branches on the tree.
10. Leaf cells elongate and leaves expand in size under the influence of the cytokinin hormones.
11. Leaves have had a wide variety of uses by man, including food, shelter, and medicines.
12. The ginkgo tree's uniqueness among plants is shown by its lack of either flowers or cones in the production of female reproductive tissues; male cones have a very loose, open structure.
VELOPMENT OF A HUMAN BEING
Early Events
Just as a glorious ginkgo tree results from the expression of a carefully crafted program of growth, cell division, differentiation, and morphogenesis, so does an adult human. Both the tree and the person who studies it begin as a humble microscopic zygote. Both begin life ensconced within maternal tissues. Let's wander inside the uterine tube of your mother (some years back) and discover what was happening to you. Once a human egg is fertilized by a sperm cell, within four days' journey along the uterine tube, it undergoes a sequence of initial cell divisions that leads to a tiny ball of 16 superficially similar cells called a morula (Lt. morul = a little mulberry; see Figure 9.17). It is the size of the period at the end of this sentence. Can we just stop here and be amazed at that? Sixteen complete copies of instructions to make "you" hide in a sphere 1/8 of a millimeter in diameter. If a miracle is something that defies both senses and rational explanation, then the morula closely approaches that definition.
Initially, there is very little growth; only a carving up of the available cytoplasm and placement of separate sets of genetic information (nuclei) into each portion (see Figure 9.17). But along with these cell divisions a subtle change is occurring. The cytoplasm of the original egg cell was regionally differentiated (see Figure 9.18). This geometric (or spatial) differentiation was created within the egg cytoplasm as it matured within the ovary. (Mom may not successfully orient the life of her teenager right now, but there was a time . . . !) During cell division within what was the egg cytoplasm, this spatially nonrandom distribution of molecules results in a population of cells that are cytoplasmically differentiated from each other, even though their appearance is quite similar. So if we observe cells in different locations within the embryo beginning to behave in different ways and appear different in structure, these distinctions can be traced back to differentiation of concentrations of cytoplasmic molecules (perhaps stable mRNAs?) within the first cell.
Soon, growth rate in the morula does increase and it becomes a hollow, fluid-filled ball of cells called
a blastocyst (see Figure 9.17). Notice that the cells are now differentially arranged. Part of the hollow sphere of cells is a thicker inner cell mass. It's from this inner mass that the embryo will develop. The rest of the cells of the hollow sphere (the trophoblast) will contribute to the placenta: a baby organ perfectly adept at extracting nutrients from the mother's uterine lining. (The process of extracting maternal resources may continue in one form or another until the individual is 40 years old or older. . . .)
As development proceeds, the inner cell mass pulls away from the trophoblast resulting in a fluid-filled space on both sides of the embryo that will have a nice cushioning effect. The inner cell mass has now become organized into a flat disc, the blastodisc, which initially consists of two cell layers (see Figure 9.17). On the surface of the thicker of the two cell layers, a specific region near the center line of the disc begins to form a slight depression called the primitive streak. It's a zone where rapid cell division is coupled with an inward migration of daughter cells into a space that opens up between the two original cell layers. The name for this process is gastrulation. The result of all this rearrangement is three cell layers that are referred to
|
morula—a very early embryonic stage of development in mam‑ mals in which initial cleavage divisions have given rise to a ball of cells. blastocyst—an early developmental stage in the human embryo in which further cell divisions in the morula have generated a hollow ball of cells with a central, fluid-filled cavity; implantation in the uterus occurs in this stage. placenta—an organ that connects the developing embryo to the uterine wall of the mother for the exchange of nutrients and wastes. primitive streak—a line bisecting the middle of the embryonic disc; from this area cells divide and migrate into the interior of the embryonic disc forming a mesodermal layer of cells. gastrulation—a process occurring in a blastula or blastocyst in which cell movements on the surface of the embryo and into its interior result in the formation of the three primary tissue layers on which further differentiation will be based. |
0 Day 0. Sperm cells penetrate a clear area (zona pellucida) around the waiting egg as they "compete" to fertilize it.
Figure 9.17 Early Human Development. The process begins after fertilization, is first dominated by cell division, then, about day five, growth and differentiation become apparent. By days 10 —11 morphogenetic (organizational) processes begin shaping what will be the embryo itself.
o Days 1-2. The first cleavage furrow creates the two-cell stage. Tiny spheres within the zona are "polar bodies" that contain excess chromosomes.
Day 3. Cleavage division continue allowing the now smaller cells to form a sphere and to communicate more efficiently with
each other.
O Day 4. Sixteen to 0 thirty two cells are
present in this morula, a solid sphere of cells, most of which will give rise to cells involved in implantation and
nutrient absorption.
Day 5. The ball of
cells is now a hollow blastocyst. Growth and differentiation have become part of the process now. The inner cell mass will generate the actual embryo. The inner cavity is fluid-filled.
as the ectoderm, endoderm, and the newly created mesoderm (because it lies in between the two original cell layers).
These three cell layers are referred to as primary germ layers. They represent the first three cell
ectoderm—a primary tissue layer in the embryo whose further differentiation gives rise to nervous system and integumentary surface tissues.
endoderm—a primary tissue layer in the embryo whose further differentiation gives rise to the internal lining of the digestive, respiratory, and urinary systems.
mesoderm—a primary tissue layer in the embryo whose further differentiation gives rise to digestive, circulatory, muscular, and other internal systems of the embryo.
actual size
0
actual size
0 Days 10-11. The embryo begins to flatten into a disk. Amnion and the misnamed "yolk sac" cavities become fluid-filled to either side of it.
0 Day 15. The perspective changes. You are now looking in from the left hand side with surface cell layer removed and amniotic cavity
actual
size visible. The primitive streak is the
exposed. The embryonic disk is
line along which surface cells migrate into a space between the two cell layers of the disk. Gastrulation is thus occuring. The result is a disk that is three layers thick—the three primary tissue layers.
populations or tissues of the embryo. You, then, these three primary tissue layers (see Table 9.3).
were once organized into just three different tis- Thus by 14 to 15 days, you have a tissue level of
sues: ectoderm, endoderm, and mesoderm. The ori- organization.
gin of all the parts of your body can be traced from
Table 9.3 Primary tissue layers and structures derived from them.
IN OTHER WORDS
1. In four days' time, development converts a fertilized human egg cell into a ball of 16 cells called a morula. The morula is about the same size as the original egg cell.
2. Differentiation of molecular content of the egg cytoplasm thus becomes 16 differentiated cells that have identical genomes, which receive different signals from their respective cytoplasms.
3. Continued differentiation generates a hollow ball of cells, the blastocyst, within which the embryo develops as a flattened disc, two cell layers in thickness.
4. Gastrulation is a process that creates a third cell layer between the two original cell layers in the embryonic disc; the result is three primary tissue layers from which all adult structures finally form.
Embryonic Differentiation of Organ Systems
This two-week-old program of meticulously arranged and ordered differentiation events will now deepen in complexity. Numerous chemical signal gradients from precise points in the embryo will cause each of your three primary tissue layers to further grow and differentiate into the rudiments of the organ systems that will later form your adult structures.
But before we can describe this development efficiently, we require some unifying and simplifying terms for referring to the various aspects of a three-dimensional adult form (see Figure 9.19). Learning just four of them will greatly enhance our communication and your understanding. For a typical animal walking, crawling, or gliding forward, the front end is the anterior aspect and the hind end is the posterior aspect; the back or upper side is the dorsal surface, and the belly or underside is the ventral surface. We will use these terms freely in this and the next chapter as we refer to the various aspects of the form of an organism. Now, we are prepared to trace out just a few major patterns in the development of the form of the embryo.
neural fold—paired thickened regions of ectodermal cells moving forward toward either side of the primitive streak; becoming ridge-like in shape with time.
neural groove—a shallow medial depression between the neural folds of the developing embryo.
neural tube—the result of the coalescing of the ridges of the neural folds above the neural groove; the precursor of the brain and spinal cord.
The primitive streak region on the embryonic disc surface defines your anteroposterior (head to toe) axis and is the site where your central nervous system begins its development. Time wise then, your nervous system is the first one we can observe to begin differentiation. By day 18 the surface ectodermal layer ahead of the streak pushes forward and thickens to form a plate-like structure that then develops into neural folds to either side of a neural groove (see Figure 9.20a). Over the next five days the folds grow dorsally up and over the groove to form a neural tube, which will
Dorsal
Ventral
Figure 9.19 Terms for Direction. These six simple terms greatly facilitate discussion of the parts of an organism.
Days 18-19. Rudiments of the nervous system are first to be observed. The thickening ectoderm generates neural folds and
the resulting groove between them. These folds will further thicken, grow toward each other and fuse to become the neural tube.
Days 20-21. Further thickening at the head end of the embryo will become the brain. Mesodermal "blocks" of tissue called somites become visible beneath the ectodermal surface layer.
They will become skeletal and muscular parts of the embryo's torso as well as the
dermal layer of the skin.
Figure 9.20 Early Organogenesis. Following gastrulation, visible structural regions like the neural groove, somites and pharyngeal arches begin to appear. This
sequence of figures directly follows those in Figure 9.17. A remnant of the primitive streak is visible at the base of the first drawing. Drawings (a — c) shown the embryo from its back. Drawings (d) and (e) are side views of the embryo. Corresponding differentiation events are occuring inside the embryo as indicated in drawing (e).
differentiate further to become your spinal cord. The anterior end of the tube expands to become what will be your brain (see Figure 9.20b, Section 9.3c). What is driving all of this? We'll return to this question.
Meanwhile, the entire embryonic disc—once quite flat—continues to thicken and becomes more tube-like (see Figure 9.20b, c). Its edges begin to fold in and around the innermost endodermal layer of tissue. The folding edges coming in from each side soon fuse to form a long endoderm-lined sac that becomes your primitive gut (see Figure 9.20e). The gut lengthens as you grow and develops into three sequential regions: the foregut, midgut, and hindgut. As your endodermal and mesodermal layers expand and grow next to each other, they cooperate to both differentiate (many!) new cell types and organize them into new structures. The foregut will give rise to your pharynx, esophagus, stomach, upper portion of the duodenum, the respiratory tract and lungs, the liver, gallbladder, and the pancreas (see Figure 9.21; also Section 10.6). The midgut region will likewise differentiate into the lower portion of your duodenum, jejunum and ileum, the appendix, the ascending colon, and the first two-thirds of the transverse colon. The hindgut generates the last third of your transverse colon, your descending colon, rectum, and the upper part
|
pharynx—the part of the throat situated immediately below the mouth and nasal cavity and just above the esophagus, larynx, and trachea. esophagus—an internal tube that connects the mouth and pharynx with the stomach; a passage for food from the site of initial ingestion to the site of storage and initial digestion. duodenum—the first section of the small intestine in most higher vertebrates where most of chemical digestion occurs. gallbladder—a small organ near the duodenum that stores bile secreted by the liver; the bile aids in digestion of fats. pancreas—an organ located beneath the stomach that manufactures and secretes several important hormones such as insulin and digestive juices that follow a duct to the duodenum, where it degrades ingested food. jejunum—the middle region of the small intestine accounting for almost half its length; large profuse projections (villi) within the jejunum absorb nutrients from digested food. ileum—the final section of the small intestine, about one-third of its total length; absorbs vitamin Bit, bile salts, and residual nutrients not absorbed in the jejunum. appendix—a small, narrow blind sac feeding into the upper end of the large intestine; appears to have fetal immune function and serves as a reservoir for maintenance of bacterial populations associated with the large intestine. colon (large intestine) the last portion of the vertebrate digestive system; absorbs water, salts, and compacts and eliminates unabsorbed indigestible remains of food. rectum—final, straight portion of the colon that functions in the elimination of indigestible residue of food—the feces. |
Differentiation in the primitive gut of the embryo Figure 9.21 Early Gut Differentiation. The foregut,
midgut and hindgut of the 4 week embryo give rise by differentiation to the indicated structures.
4 week structures Foregut
Midgut
Hindgut 9
Adult structures
|
Pharynx Esophagus Lungs Stomach Duodenum (upper portion) Liver Gall bladder Pancreas |
|
Duodenum (lower portion) Jejunum !Ileum Appendix Ascending colon Transverse colon (partial) |
|
Transverse colon (partial) Descending colon Rectum Anal canal (partial) |
of the anal canal. These structures, while having mesodermally derived parts, are all lined with endodermally derived tissue.
What becomes of that new internal mesodermal layer generated during your gastrulation? Initially, along your length it thickens and divides into several zones. Near your midline it differentiates into the notochord, a solid rod of tissue just beneath the ectodermal layer on the dorsal surface of the embryo (see Figure 9.22a). A diffusible signal molecule from notochord cells is what causes your surface ectodermal tissue to differentiate to form the neural folds and later the neural tube. Eventually, the notochord, having served this critical developmental role, recedes in significance and becomes the bony core of the base of each vertebra in your vertebral column.
Just to either side of the notochord, a head-to-tail sequence of blocks of mesodermal tissue called the somites emerges (see Figure 9.22a). These will differentiate into all of the bones and skeletal muscles of your head and trunk as well as dermal cells that will form the basal layer of your skin. Finally, to either side of this central region beyond the somites, the lateral sheet of mesoderm divides into two separate layers known as splanchnic and somatic mesoderm (see Figure 9.22a). A space gradually forms between these layers, which will become the body cavity that houses your internal organs.
KEY
· Ectoderm
· Mesoderm
Notochord
Splanchnic Somatic Somites
Mesoderm Mesoderm
Figure 9.22 Mesoderm Differentiation.A slice through the 4 week old vertebrate embryo (about half way between the head and tail) reveals surface ectoderm, a complete neural tube derrived from ectoderm, and elaborate differentiation of the mesoderm into somites, notocord, and splanchnic and somatic sheets of lateral mesoderm.
Let's follow the splanchnic layer a bit. Toward its anterior edge the primordial structure of the heart begins to form in a plate-like region of cells located at your cranial (anterior) end. Within this plate, a long, horseshoe-shaped zone of cell clusters begins to differentiate from the surrounding cells (see Figure 9.23). During week three of development, these cell clusters begin to coalesce to form two endocardial tubes to either side of your midline. The anterior and lateral folding of embryonic tissues mentioned earlier forces these tubes (medially) toward each other into the center of the thoracic region, where they fuse together forming a single, central endocardial tube—the primordial heart. In subsequent days, this tube subdivides into primordial heart chambers. Growth of the tube outstrips your overall growth in length during week four of development, so the tube bends back on itself! This will ultimately result in a circulation wherein the blood returns from the posterior end of the embryo to chambers high on the dorsal surface of the heart and flows out of the heart from chambers that are lower
|
anal canal—terminal portion of the colon; its internal surface is ectodermal, not endodermal as in the rectum; lined with muscle tissue that controls defecation. notochord a flexible shaft of mesodermally derived cells found in the embryos of all vertebrate animals; influences formation of the nervous system. vertebra—a single bone with many extension-like processes; a somewhat linear series of these bones surrounds and protects the spinal cord in vertebrates. somite—one of numerous blocks of mesodermal tissue distributed along the side of the neural tube; gives rise to vertebrae, the dermal layer of skin, and skeletal muscle. lateral mesoderm—tissue composed of cells descending from cells that migrated internally during gastrulation; arranged to either side of the midline tissues in the embryo. splanchnic mesoderm—the inner layer of lateral mesodermal tissue that will contribute to development of the circulatory system and the digestive system of the fetus. somatic mesoderm—the outer layer of lateral mesodermal tissue that contributes to the structure of the body wall. endocardial tube—an embryonic structure differentiated from specialized cells in the splanchnic mesoderm; two such tubes coalesce to form the rudimentary heart. thoracic—refers in humans to the region between the neck and the diaphragm containing the heart and lungs. |
Figure 9.23 Heart Development. (a) Dorsal view of 18 day old embryo with dorsal surface ectoderm largely removed to make mesoderm visible. Near the front edge of the splanchnic mesodermal layer, cells that will become heart tissue begin to differentiate; (b) through (f) are ventral views of successive stages in heart formation. Notice the folding process that drives the atrium anteriorly to the ventricle.
and on the ventral face of the heart (see Figure 9.23). By the end of the eighth week your essentially "adult" heart chambers are intact. The original splanchnic layer of mesoderm that generates these heart structures will also surround the endodermal layer of the gut and generate the muscle and connective tissues that are part of your gastrointestinal tract.
Late in the third week of development, a series of prominent, largely mesodermal bulges begins to appear on the lateral surface of your head just posterior and to either side of the developing brain region. These pharyngeal arches, lined internally with endoderm and externally with ectoderm, will give rise to various portions of your mouth, inner ear, and laryngeal structures. Also during weeks three and four, mesoderm and ectodermal tissues are cooperating with each other to form apical ridges, which will further develop into limb buds that will eventually give rise to your arms and legs (see Figure 9.20).
This brief description of your early development is a wonderful mystery to which we have simply attached a collection of labels. But scientists love to search out mysteries like this. To explore a bit of the complexity they've unraveled, let's focus more specifically on one aspect of human development.
pharyngeal arch—mesodermal outpocket from the pharynx formed both to the right and left side of the four-week-old embryo; gives rise to structures within the mouth, ear, and larynx.
laryngeal—of or referring to the larynx, a cartilaginous structure in the throat that forms the voice box and protects the trachea.
apical ridge—region of thickened ectodermal cells that, with the underlying mesoderm, participate in formation of embryonic limbs: future arms and legs.
IN OTHER WORDS
1. Chemical signals emerging from precise points in the embryo cause each of the three primary tissue layers to continue differentiating into more and more diverse structures.
2. We use the terms dorsal, ventral, anterior, posterior, lateral, and medial to speak about aspects of the architecture of the three-dimensional biological organism.
3. The nervous system of humans begins development as a pair of thickened neural plates that fold into a neural tube destined to become the brain and spinal cord.
4. The primary endodermal tissue contributes the inner lining of the primitive gut and all structures derived from it, including lungs, liver, stomach, and large and small intestines.
5. The notochord, a mesodermal derivative, emits signal molecules to cause early differentiation of surface ectodermal tissue into elements of the neural tube.
6. The anterior portion of the inner layer of lateral mesoderm gives rise to the endocardial tubes that will become the adult heart.
7. Pharyngeal arches and apical ridges are sites where mesoderm, endoderm, and ectoderm interact with each other to differentiate structures of the mouth, nose, throat, forelimbs, and hind limbs.
Organogenesis of the Brain
Lacking space to focus in detail on all of your development, let's pick a modestly useful organ for further study: How about the brain? We start with the primary germ layer ectoderm and somehow we develop an organ—the brain. What an amazing project the Designer gives to every new conceptus that begins life! Charles Noback, a former professor of anatomy at Columbia University College of Physicians and Surgeons, has stated:
"To generate the estimated 100 billion neurons of the adult brain requires the production and differentiation of an average of 250,000 neurons per minute throughout the entire length of prenatal life."
How does that happen? We've described how the notochord, a mesodermal structure, induces the formation of the primitive neural tube. We then said that the anterior end of the tube/groove begins to thicken into what will become your brain with the spinal cord developing posteriorly (see Figure 9.20).
The anterior thickened end of the neural tube first expands, then differentiates and organizes into three separate regions: the forebrain, the midbrain (or mesencephalon), and the hindbrain (see Figure 9.24a). With time, your forebrain and hindbrain each further differentiate into two discernible regions yielding a total of five embryonic brain regions: the telencephalon and diencephalon from the forebrain, the mesencephalon, and from the hind-brain, the metencephalon, and myelencephalon. In Figure 9.24a and b, notice how the higher growth rate of cells on the dorsal surface of the neural tube causes the tube to curve following the curvature of the developing embryo. What causes cells at
various points along the tube to differentiate into discrete and separate structures? Again, the process of embryonic induction is involved (see Figure 9.28). For example, cells in the very most dorsal peak of the neural tube secrete a signal protein called Wnt (see Figure 9.25a). Cells in the notochord ventral to the neural tube secrete a different signal protein called SHH (which stands for sonic hedgehog; developmental biologists have fun too...). All the cells along the lateral aspect (sides) of the neural tube have surface receptors for both of these
telencephalon—that forward region of the forebrain that gives rise to the cerebrum, the site of thought and volitional action.
diencephalon—that region of the forebrain that gives rise to thalamic structures such as the thalamus, which relays signals to and from the cerebrum and the hypothalamus, which regulates pituitary gland function.
mesencephalon—the midbrain; controls visual and auditory functions as well as moderating certain involuntary reactions.
metencephalon—that region of the hindbrain that gives rise to the cerebellum and pons, which function in integrating signals for muscle movement and information flow between the cerebellum and the telencephalon.
myelencephalon—that region of the hindbrain that gives rise to the medulla oblongata; a brain region associated with a variety of basic involuntary functions such as breathing rate.
Wnt—a widely distributed class of signal proteins in animals that are generated in one cell type and induce differentiation in nearby cells that specifically bind them.
SHH (sonic hedgehog)—one of three signaling proteins in the mammalian "hedgehog" signalling pathway; involved in brain organization, digit formation.
Figure 9.24 Brain Development. Shown are three separate stages of human brain development. (a) at about 3 weeks (b) at about 7 weeks, (c) at about 3 months in utero. Terms defining the differentiating regions of the brain are described in the text.
0
signal proteins (see Figure 9.25b); they therefore experience a crisscrossing gradient of these two signals (see Figure 9.25a). The amount of SHH experienced by a cell influences how it will respond to the Wnt signal it receives. Cells in the ventral portion of the neural tube, for example, sense almost
no Wnt protein at all. Varying relative concentrations of these two signal substances result in differences in the genes activated within individual cells along the gradients. Activation of different genes is the essential source of differentiation patterns in cells.
[SHH] gradient SHH—producing cells
0 0
Figure 9.25 Induction in the Neural Tube. (a) Cells in the most dorsal part of the neural tube make and secrete the signal protein Wnt. (b) Cells throughout the
neural tube have surface receptors for this protein. Cells closest to the dorsal surface of the neural tube will"sense" more of it than cells in the ventral parts of the tube. The notochord generates the signal protein SHH. Ventral neural tube cells sense more SHH than Wnt. These signal concentration differences result in different patterns of intracellular signalling via 13- catenin or Ci protein pathways. These proteins interact to control which genes are expressed in the cell. Different gene expression patterns drive dorsal and ventral tube cells into separate differentiation pathways.
Obeying induction signals and gradients such as these, each of your five brain regions mentioned above goes on to differentiate the adult structures
cerebrum—a large, bi-hemispheric region of the vertebrate brain that in humans functions in learning, voluntary movement, and sensory interpretation.
thalamus—a coordinating center of the brain that routes sensory inputs to areas of the cerebrum devoted to generating motor responses.
hypothalamus—control center in forebrain that regulates body temperature and responses to hunger and thirst; generates pituitary hormones.
pituitary gland—an endocrine gland at the base of the brain that produces, stores, and secretes hormones controlling growth and sexual processes as well as secretions of other glands.
pineal gland—an endocrine gland in the thalamic region of the brain; secretes the hormone melatonin, which controls sleep/wake cycles in mammals.
cerebellum—a derivative of the metencephalic region of the embryonic brain; functions in muscle coordination, tone, and balance.
pons—a derivative structure of the metencephalon; appears as a swelling of the brainstem; relays signals from the cerebrum to the cerebellum relating to sleep, respiration, swallowing, hearing, equilibrium, posture, and other functions.
of the brain. The telencephalon, for example, expands to create the cerebrum, which controls all of your sensory and motor functions and is the locus of your thought and memory. The diencephalon differentiates into the brain regions known as the thalamus, the hypothalamus (with its pituitary gland), and the pineal gland (see Figure 9.26). The thalamus will coordinate sensory inputs to your cerebrum. The more ventral hypothalamus and pituitary gland will exert a dominant control over your endocrine system. The pineal gland will influence your sexual maturation and daily patterns of sleeping and wakefulness (more on that in Chapter 11).
The mesencephalon further differentiates into a series of structures called colliculi and peduncles (fancy Latin terms for protuberances or mounds; see Figure 9.24c). These brain regions are involved in such processes as the integration and relay of visual and auditory inputs coming from your sensory organs, the control of muscle tone, and the processing of incoming and outgoing information to and from the forebrain regions.
The metencephalon differentiates into two major brain regions. Dorsally, the cerebellum is involved in maintaining spatial balance and coordination (see Figure 9.26). Ventrally, the pons mediates information flow between your cerebellum and cerebrum (among other things).
Adult brain regions
Figure 9.26 Adult Brain Regions. By induction of differentiation and
subsequent morphogenetic changes, the structurally simpler embryonic brain attains the complexity of the adult brain. It is a miracle of organizational wisdom we wish we could fully understand.
The myelencephalon differentiates into the medulla oblongata, which helps regulate your heart rate, blood flow, the pacing of your respiratory inhalation. It also relays information from your spinal column to the rest of your brain.
And so an amazing organ results from the careful design of a program—an elegant sequence of signal synthesis and signal response that causes legions of cells to grow and divide, to differentiate, and then to organize into progressively more specifically defined regions of function—all at a rate of 250,000 per minute . . . until you are born.
medulla oblongata—portion of the brain closest to the spinal cord; functions in control of involuntary processes such as heart rate and breathing intensity.
IN OTHER WORDS
1. The anterior end of the neural tube becomes the five regions of the embryonic brain while the posterior end becomes the spinal cord.
2. The signal protein molecules Wnt and SHH interact across the dorsoventral axis of the neural tube to facilitate differentiation of specific structures in the developing brain.
3. Each of the five primary brain regions of the embryo contributes critical structures to the adult organ even though the cerebrum, derived from the telencephalon, appears to dominate the structure of the mammalian brain.
Cooperation of Organs in Organ Systems
But the brain, as an organ, is part of an organ system (see Figures 9.6, 9.27; see also Section 1.2). Therefore human development involves organizing into communicative, cooperative arrangements, sets of organs that together serve a more general function. (Life Is Complex.) The brain, spinal cord, and the peripheral nerves are an organ system—the nervous system. The system's function is tightly integrated. The organism is far better served by systems than by individual organs serving separately on their own. For example, many individual parts of the brain are committed to monitoring,
routing, and organizing the afferent signals com‑ ing in from the sensory system via the peripheral
|
organ system—an integrated selection of multi-tissue structures within the organism that cooperate in serving a common function. spinal cord—an organ within the central nervous system that moderates the interaction of the peripheral nervous system with the brain that controls it. peripheral nerves—all nerves throughout the body that lie outside the central nervous system—both those emanating from and returning to the central nervous system. afferent—of or referring to signals generated from within the sen‑ sory systems of the body that then travel to the central nervous system. |
KEY
Central nervous system Peripheral nervous system Afferent and somatic systems Autonomic system
Figure 9.27 The Nervous System. Information comes to the brain via the afferent or sensory nerves from sense organs. The output of the central nervous system is of two sorts: one, somatic, carries signals that prompt the conscious use of muscles. The other autonomic signals—take care of responses you do not consciously make. It uses two branches, the sympathetic and parasympathetic to control and coordinate opposite effects on each organ serviced. Generally the sympathetic system activates functions and the parasympathetic system relaxes them.
nerves. Efferent peripheral nerves, by contrast, connect the volitional parts of the brain with the muscles that carry out the brain's demands. The central nervous system also uses efferent nerves to drive glandular processes that are autonomic—you aren't even conscious of them. This degree of organization requires an even higher level of integration, control, and design. In terms of the level of integration of parts within the whole, we are here far beyond the functional versatility of any computing device ever invented by man. To quote the Psalmist of ancient Israel, "We are fearfully and wonderfully made . . ."
A great human seagoing invention was the fast‑
sailing clipper ship that plied the oceans of the nineteenth century. There are two ways to imagine
building a detailed model of such a wonderful ship. It could be built with a few basic kinds of Lego-like blocks that are used repetitively but fashioned very, very artfully into the final product. Or the ship could
efferent—of or referring to signals generated from within the central nervous system of the body that then travel to the effector organs of the body such as muscles or glands.
autonomic—that part of the nervous system that exerts control over involuntary bodily functions such as blood circulation and digestion.
be built from a model kit with hundreds of distinct parts, each part used only a few times or even once. The human body is like the ship built from Lego pieces. In modeling us, the Designer used the essential pattern of the cell, the Wnt signal protein, and the same basic molecular monomers over and over again in a wide array of distinctly different combinations and settings. In a blind evolutionary system,
such repetitive use of a few basic parts would become confusing—parts would interact that should not. Organization would have to remain painfully simple. Rather, the human body reveals a Designer's genius, multiply expressed in His ability to do diverse things with simple bits. The self-driven development of the human body is an entire triumph of an amazing Mind. What else could it be?
IN OTHER WORDS
1. The brain, spinal cord and peripheral nerves are organs that comprise the nervous system.
2. The nervous system includes nerves that carry signals to and from the central nervous system; those coming from the central nervous system carry two categories of signals: voluntary responses and involuntary responses.
3. From a small variety of simpler parts, the human organism develops into a vast variety of structures and their functions by following an already amazing plan that is still only partly understood.
In the discipline of developmental biology, singular elegant experiments have often been the basis for major generalizations that gave insight into the way forward. The following two figures can both help
us review how scientific methodology works and exemplify two great generalizations that moved the discipline forward.
[Elegant Experiment #1 — Induction
A Existng Knowledge
Allikeks
The Genus Triturus, poorly understood taxonomically, contains several species of newts: amphibians whose early development had been carefully observed.
The bottom of the egg, called the vegetal pole was more yolky than the top or "animal" pole. After fertilization of the egg, the pigmented animal pole shifts somewhat leaving behind a region called the "gray crescent".
Vegetal pole
Cell migration
Later in development, a hollow ball of cells, the blastula develops with an internal fluid-filled space called the blastocoel. The grey crescent of the egg becomes the "blastopore" of the blastula, the spot where gastrulation begins with the inward migration of cells that become mesoderm.
Subsequent interactions between ectoderm, mesoderm and endoderm in the top half of the "gastrula" eventually gives rise to the embryo proper.
Archenteron Endoderm Ectoderm
|
G Interpretation H New Questions! |
It would be impossible for the few cells of the transplanted blastopore to themselves give rise to an entirely new embryo. Rather, the second blastopore at a novel site on a newt gastrula altered the course of development of cells in that area of the embryo. Instead of contributing to the development of the primary recipient, they were induced to contribute to the development of a new embryo. 1. Do most of the cells in the second embryo come from the graft recipient embryo, or do they result from very rapid divisions within the graft itself? Is induction really happening? 2. Is induction the result of one set of cells "touching" another set of cells or is there a diffusible chemical that flows from one cell to cells around it? 3. Your question! : |
Elegant Experiment #2 — Genomic Potency
|
Irradiation with UV light inactivates DNA |
|
It was further known that ultraviolet (UV) light is highly destructive of DNA molecules. UV irradiated Xenopus eggs contain nuclei that will not support development. |
Unfertilized egg
QUESTIONS FOR REVIEW
1. Compose a sentence that describes the process of development. Be certain to use the phrase information expression in your sentence. 15.
2. List four component processes that comprise development of the organism.
3. Consider the size of an unfertilized hen's egg and the size of a baby chick. When does most 16. of growth occur during the embryonic development of a chicken? 17.
4. Compare the diagrams of the stomach and the leaf. What kinds of tissues do they have in common? Which are unique?
5. What is induction? How does it work (in a general sense)? 18.
6. Make a list of 11 human organ systems and for each list as many component organs as come to mind.
7. What biological event signals the origin of the life of an individual ginkgo tree? Where does it take place? 19.
8. In the development of a ginkgo tree, are mitosis and cytokinesis always coordinated so that one occurs just before the other? Explain. 20.
9. How is the root end and the shoot end of a ginkgo embryo determined? 21.
10. List and describe the three basic types of tissue found in all parts of all plants.
11. What are the respective functions of xylem 22. and phloem tissue within the root of a ginkgo seedling? 23.
12. What common effect do both gibberellins and auxins have on the stem of a ginkgo seedling?
13. Explain why the range of growth of ginkgo trees is so much broader than for many other trees. 24.
14. Higher plants are generally found in one of two large groups: either the angiosperms (flowering plants) or the gymnosperms (conifers,
cone-bearers). The group, Gingkophyta, is outside of both these groups. Why is that? Consider the fertilized human egg cell. Of the four component processes of development, which one dominates initial development? Which one dominates gastrulation?
What will be the function of the cells that develop from most of the 16 cells of the morula? Construct your own chart of the three primary tissue layers and list under each layer the adult structures that will develop from that layer. Put initials after each structure indicating the organ system it is part of.
Draw a likeness of a dog. Label its aspects using
the terms dorsal, ventral, anterior, posterior, lateral, and medial. Do the same thing for a human being; be careful here; biologists assign those words to humans while "standing" on all fours as a dog would.
Name two systems of the body that are closely related based on their embryonic pattern of formation.
Is the notochord found in adult humans? Explain your answer.
What two tissue layers give rise to your body cavity? Your body cavity is entirely the product of which primary tissue layer?
Select some terms from this chapter to briefly trace the development of your right arm.
List five embryonic brain regions; after each one list the major functions that structural derivatives of that region will carry out in the adult human.
List two intercellular signal molecules that influence cell differentiation in human development. List two intracellular signal molecules that function in a similar way.
QUESTIONS FOR THOUGHT
1. In a quiet, friendly discussion with a pro-choice individual, you hear the rejoinder, "It's my body. Don't I have a constitutional right to decide what happens to my body?" How could you use the terms zygote and fertilization to respond to that statement?
2. In the differentiation of a zygotic cell into a red blood cell, turning on specific genes is involved. Would certain genes also be turned off? Explain your thoughts here.
3. Auxin gradients extend over very large numbers of cells. Auxins do not simply diffuse through
plant cell membranes. How then are these gradients set up?
4. Is seed formation more critically important in a tropical climate or a temperate climate? Explain your choice.
5. Predict what would happen to a small piece of meristematic tissue that is grown apart from a plant on a nutrient medium in a culture dish in the absence of any hormones.
6. In order to understand how differentiation and morphogenesis contribute to human development, with what population of cells should our study begin?
7. Which of the organ systems begins its development first? Speculate as to why that might be.
8. Why might the heart form from two separate lateral tubes instead of one medial one? Think "differentiative" thoughts!
9. Brain development gives rise to the pituitary gland, which enables the nervous system to interact in a variety of ways with which other body system(s)?
10. Differentiation of the cerebellum is most critical to what particular Olympic event?
11. Explain how all three primary germ layers are involved in the final development of your stomach.
GLOSSARY
afferent—of or referring to signals generated from within the sensory systems of the body that then travel to the central nervous system.
anal canal—terminal portion of the colon; its internal surface is ectodermal, not endodermal as in the rec‑ tum; lined with muscle tissue that controls defecation.
apical meristem—a zone of rapidly dividing, undifferentiated plant cells near the tip or apex of a shoot, stem, or root.
apical ridge—region of thickened ectodermal cells that, with the underlying mesoderm, participate in formation of embryonic limbs: future arms and legs.
appendix—a small, narrow blind sac feeding into the upper end of the large intestine; appears to have fetal immune function and serves as a reservoir for maintenance of bacterial populations associated with the large intestine.
autonomic—that part of the nervous system that exerts control over involuntary bodily functions such as blood circulation and digestion.
auxin—a class of plant hormones that tends to promote cell elongation leading to stem elongation and root initiation.
blastocyst—an early developmental stage in the human embryo in which further cell divisions in the morula have generated a hollow ball of cells with a central, fluid-filled cavity; implantation in the uterus occurs in this stage.
cerebellum—a derivative of the metencephalic region of the embryonic brain; functions in muscle coordination, tone, and balance.
cerebrum—a large, bi-hemispheric region of the vertebrate brain that in humans functions in learning, voluntary movement, and sensory interpretation.
colon (large intestine)—the last portion of the vertebrate digestive system; absorbs water, salts, and compacts and eliminates unabsorbed indigestible remains of food.
cone (or strobilus)—reproductive structure in conifers that generates pollen or ova, and following fertilization, seeds; often woody in structure.
connective tissue—a collection of cells in an extracellular matrix of supportive material that adds structural strength to other nearby collections of cells.
cytokinins—plant hormones that promote cell division in roots and shoots; contribute to dominance of growth of the central stem of a plant.
dermal tissue—those cellular layers that serve a protective function on the surface of the plant body; protection from desiccation and parasitic pests.
diencephalon—that region of the forebrain that gives rise to thalamic structures such as the thalamus, which relays signals to and from the cerebrum and the hypothalamus, which regulates pituitary gland function.
differentiation—a process by which a generalized cell or tissue matures into a specialized cell or tissue.
digestive system—that organ system in the animal body that takes in, breaks down, and absorbs the components of food.
dioecious (Gk. di- = two, oikos- = house)—a species of plant in which the reproductive organs of the two sexes are found on separate individuals.
duodenum—the first section of the small intestine in most higher vertebrates where most of chemical digestion occurs.
ectoderm—a primary tissue layer in the embryo whose further differentiation gives rise to nervous system and integumentary surface tissues.
efferent—of or referring to signals generated from within the central nervous system of the body that then travel to the effector organs of the body such as muscles or glands.
embryo—an organism in its early stages of developing toward maturity; immediately following fertilization, the cell has commenced this development.
endocardial tube—an embryonic structure differentiated from specialized cells in the splanchnic mesoderm; two such tubes coalesce to form the rudimentary heart.
endoderm—a primary tissue layer in the embryo whose further differentiation gives rise to the internal lining of the digestive, respiratory, and urinary systems.
endosperm—a plant tissue within a seed that contains stored nutrients for a developing embryo. It forms from fertilization of nuclei in the ovule by a nucleus in the pollen grain.
epithelial tissue—layers or groups of animal cells that cover body surfaces, line body cavities, and give rise to certain glands.
esophagus—an internal tube that connects the mouth and pharynx with the stomach; a passage for food from the site of initial ingestion to the site of storage and initial digestion.
fertilization—process by which a male sex cell and a female sex cell fuse to form a diploid first cell (zygote) of a new individual.
flower—a plant reproductive structure in angiosperms (flowering plants) that serves to bring ova and sperm nuclei together to form embryos within seeds.
gallbladder—a small organ near the duodenum that stores bile secreted by the liver; the bile aids in digestion of fats.
gastrulation—a process occurring in a blastula or blastocyst in which cell movements on the surface of the embryo and into its interior result in the formation of the three primary tissue layers on which further differentiation will be based.
germination—the beginning or resumption of growth in a seed, spore, or bud structure.
gibberellins—plant hormones that regulate growth and differentiation particularly with respect to stem elongation, germination and flowering.
ground tissue—the fundamental tissue system of a plant excluding its epidermal and vascular tissues.
growth—accumulation of biomass in either a cell, a tissue, an organ or an individual.
hormone—within an organism, a (usually small) molecule generated in one kind of tissue that becomes a signal or message causing cells elsewhere in the organism to alter their behavior in response.
hypothalamus—control center in forebrain that regulates body temperature and responses to hunger and thirst; generates pituitary hormones.
ileum—the final section of the small intestine, about one-third of its total length; absorbs vitamin B12, bile salts, and residual nutrients not absorbed in the jejunum.
induction—that chemical process by which one cell or tissue produces a change in behavior or structure in a second cell or tissue.
jejunum—the middle region of the small intestine accounting for almost half its length; large profuse projections (villi) within the jejunum absorb nutrients from digested food.
laryngeal—of or referring to the larynx, a cartilaginous structure in the throat that forms the voice box and protects the trachea.
lateral bud—forming at the base (axil) of a leaf, embryonic tissue that will give rise to an axillary shoot from the surface of an existing stem.
lateral meristem—within a stem or root, a layer of undifferentiated plant cells whose division adds to the diameter of the stem or root.
lateral mesoderm—tissue composed of cells descending from cells that migrated internally during gastrulation; arranged to either side of the midline tissues in the embryo.
medulla oblongata—portion of the brain closest to the spinal cord; functions in control of involuntary processes such as heart rate and breathing intensity.
meristem—undifferentiated plant cells and tissue from which new cells are produced.
mesencephalon—the midbrain; controls visual and auditory functions as well as moderating certain involuntary reactions.
mesoderm—a primary tissue layer in the embryo whose further differentiation gives rise to digestive, circulatory, muscular, and other internal systems of the embryo.
mesophyll tissue—interior photosynthetic cells in a leaf.
metencephalon—that region of the hindbrain that gives rise to the cerebellum and pons, which function in integrating signals for muscle movement and information flow between the cerebellum and the telencephalon.
morphogenesis—the development of the form of the organism; involves getting and keeping differentiated cells and tissues organized into productive groupings.
morula—a very early embryonic stage of development in mammals in which initial cleavage divisions have given rise to a ball of cells.
myelencephalon—that region of the hindbrain that gives rise to the medulla oblongata; a brain region associated with a variety of basic involuntary functions such as breathing rate.
neural fold—paired thickened regions of ectodermal cells moving forward toward either side of the primitive streak; becoming ridge-like in shape with time.
neural groove—a shallow medial depression between the neural folds of the developing embryo.
neural tube—the result of the coalescing of the ridges of the neural folds above the neural groove; the precursor of the brain and spinal cord.
notochord—a flexible shaft of mesodermally derived cells found in the embryos of all vertebrate animals; influences formation of the nervous system.
organ system—an integrated selection of multi-tissue structures within the organism that cooperate in serving a common function.
ovule—a female reproductive structure in plants in which the haploid egg cell has matured. The mature ovule contains the new individual and is called a seed.
pancreas—an organ located beneath the stomach that manufactures and secretes several important hormones such as insulin and digestive juices that follow a duct to the duodenum, where it degrades ingested food.
peripheral nerves—all nerves throughout the body that lie outside the central nervous system—both those emanating from and returning to the central nervous system.
pharyngeal arch—mesodermal outpocket from the pharynx formed both to the right and left side of the four-week-old embryo; gives rise to structures within the mouth, ear, and larynx.
pharynx—the part of the throat situated immediately below the mouth and nasal cavity and just above the esophagus, larynx, and trachea.
phloem—a transport tissue in plants; carries nutrients, sucrose in particular, to all parts of the plant.
pineal gland—an endocrine gland in the thalamic region of the brain; secretes the hormone melatonin, which controls sleep/wake cycles in mammals.
pituitary gland—an endocrine gland at the base of the brain that produces, stores, and secretes hormones controlling growth and sexual processes as well as secretions of other glands.
placenta—an organ that connects the developing embryo to the uterine wall of the mother for the exchange of nutrients and wastes.
pollen grain—a spore-like structure in plants containing the haploid nucleus that will fertilize the female ovum to produce a zygote. It is carried from the male reproductive structure to the female one by wind, water, or other organisms.
pons—a derivative structure of the metencephalon; appears as a swelling of the brainstem; relays signals from the cerebrum to the cerebellum relating to sleep, respiration, swallowing, hearing, equilibrium, posture, and other functions.
primitive streak—a line bisecting the middle of the embryonic disc; from this area cells divide and migrate into the interior of the embryonic disc forming a mesodermal layer of cells.
rectum—final, straight portion of the colon that functions in the elimination of indigestible residue of food—the feces.
root—the portion of embryonic tissue that will give rise to underground parts of the plant designed for absorption and anchoring of the plant.
root cap—on the very tip of a root, a layer of cells that generates a mucoid secretion easing the root further into the soil.
seed—an embryonic plant together with its nutrient source enclosed within a protective coat of external tissue.
SHH (sonic hedgehog)—one of three signaling pro‑ teins in the mammalian "hedgehog" signalling path‑ way; involved in brain organization, digit formation.
shoot—the portion of embryonic tissue that will give rise to aerial parts of the plant: the stems, leaves, and flowers.
somatic mesoderm—the outer layer of lateral mesodermal tissue that contributes to the structure of the body wall.
somite—one of numerous blocks of mesodermal tissue distributed along the side of the neural tube; gives rise to vertebrae, the dermal layer of skin, and skeletal muscle.
spinal cord—an organ within the central nervous system that moderates the interaction of the peripheral nervous system with the brain that controls it.
splanchnic mesoderm—the inner layer of lateral mesodermal tissue that will contribute to development of the circulatory system and the digestive system of the fetus.
stem cell—a growing, dividing, undifferentiated cell within animal embryos or adults that eventually
differentiates into a variety of types of cells found in the animal's body.
telencephalon—that forward region of the forebrain that gives rise to the cerebrum, the site of thought and volitional action.
thalamus—a coordinating center of the brain that routes sensory inputs to areas of the cerebrum devoted to generating motor responses.
thoracic—refers in humans to the region between the neck and the diaphragm containing the heart and lungs.
undifferentiated—referring to a cell or tissue that is committed to no specified role or function within the organism other than providing a source of new cells.
vascular cylinder—also called the stele; within a root, a central collection of xylem and phloem tissue including internal meristematic and surface dermal tissues.
vascular tissue—those structures both cellular and cellular products that conduct fluids from one place to another in the plant body.
vertebra—a single bone with many extension-like processes; a somewhat linear series of these bones surrounds and protects the spinal cord in vertebrates.
Wnt—a widely distributed class of signal proteins in animals that are generated in one cell type and induce differentiation in nearby cells that specifically bind them.
xylem—a transport tissue in plants; in trees it comprises much of the wood of the trunk; transports water upward within a plant.
zygote—a single diploid cell resulting from the fertilization of a haploid egg cell by a haploid sperm cell.
The Internally
Integrated Human
Animal
T GR ED HUMAN
Imagine you are visiting Washington, DC, the capital of the United States of America. You've ridden a subway into a huge underground station and have come up onto the Mall — a vast grassy area, America's "front yard" surrounded by many monuments and museums. The most prominent structure on the Mall is the towering Washington Monument (See Figure 10.1). As you walk toward it, it just gets larger and larger! Rather than taking the elevator to the top, you decide to climb its 896 steps. By the 150th step, a tiny hint of boredom begins to set in. You begin to wonder—just a fleeting thought—if this whole climb is just a matter of your muscles driving mindlessly forward. This thought is born of a secret inner inclination of yours that life should be simple, but the biology text you've been reading argues that it is complex. Hmm. It is really? How complex could this "just climbing stairs" be? Let's dissect that question a bit.
Actually, several systems in your body ramp up to get you from the bottom to the top of the Monument (see Figure 10.2). Yes, your muscular system does the work, but muscles need something on
muscular system—a collection of organs (muscles) that facilitate movement of the body and movement within the body.
|
· How is the system that brings blood to the muscles structured? · If more oxygen is needed in one area of the body than another, can this system respond differentially to that need? What happens to the waste products of muscle contraction? Is the blood involved in removing them? · How does the human heart relate structurally to the system of vessels that carry the blood? · How does the heart connect the system to the lungs—the source of oxygen? How do the fluids throughout the body relate to the blood in the blood vessels? The heart is quite dynamic. Is its muscle structured specifically for the process of repeated, coordinated contraction? How is the rate of a person's heartbeat controlled? 10.4 Basic Concepts of Immunity · To what substances or foreign agents do humans become immune? · How are these agents encountered? · What is the nature of the immune response? · What organs of the body are involved in responding to foreign agents? · Are there specialized cells within these organs that are committed to the immune response? If so, what are they? · Is there more than one way in which we respond to foreign pathogens? · Are our responses learned? Can we improve our response to the same pathogen? · How specific are our responses? Do we respond to all foreign pathogens in essentially the same way? · What is the first step in our response to a particular pathogen? Where does it occur? · How does our immune response finally destroy the pathogen invading our tissues? |
Figure 10.1 The Washington Monument.
which to pull. That something is provided by the skeletal system. As your muscles start using up the oxygen and nutrients they had when you started, your heart rate (within your cardiovascular system) and breathing rate (in your respiratory system) both increase. You start to sweat (from your integumentary system) to remove the heat your muscles are generating. In addition, part of your nervous system (the sympathetic part) responds to the physical stress you are putting on your body by calling for hormones from the endocrine system. The wastes being produced
|
skeletal system—a collection of organs (bones) that gives support and form to the body and that assists the muscular system during movement. cardiovascular system—a collection of organs that facilitate the movement of cells and soluble materials to and from all parts of the body. respiratory system—a collection of organs that enables critical gaseous reactants and products to be added to and removed from blood. integumentary system —a collection of organs (largely skin) that insulates the organism while protecting it from desiccation and invasion by foreign pathogens. nervous system—a collection of organs composed of neurons that coordinates the activities of the organism while transmitting signals from one location to another. endocrine system—a collection of organs (glands) that secrete hormones into the bloodstream; the hormones in turn control many aspects of the body's form and function. |
Chapter 10 The Internally Integrated Human Animal 283
"Life is Internally Integrated"
Figure 10.2 Life is Internally Integrated. Every system in the body serves and is served by every other system. The level of integration is staggering.
by the muscles' metabolism will be removed by the urinary system. On the way up, you grab the rail for support and then rub your eye to remove the sweat forming on your face. Now, your immune response, produced by the lymphatic system, will be stimulated to prevent you from getting sick due to viruses that were on the rail. Once you get to the top, you pull out a snack and activate your digestive system. All the systems in your body have worked together to get you to this point. Haven't we seen this sort of cooperation somewhere before?
In Chapter 5 we peered into a cell and saw that its organelles worked together, sometimes through each other to perform tasks that supported the common welfare—the good of the entire cell. Then our study of development in Chapter 9 showed us that cells divide, differentiate, and begin to communicate and cooperate
urinary system—a collection of organs that filters the blood, creating, collecting, and storing the resulting urine for excretion.
lymphatic system—a collection of organs that facilitates the surveillance of tissue fluids and their movement back to the bloodstream.
digestive system—a collection of organs that facilitates the intake and mechanical and enzymatic degradation of foods, followed by absorption of nutrients and elimination of wastes.
Animal
Figure 6.1 The cathedral and the cell—two glorious works of art potentially pleasing to the same set of eyes and mind. Light illuminates the interior of a cathedral but sadly, it obscures much of the fine structure of the cell interior.
Lee Frost/Robert Harding World Imagery/Corbis; Nik Wheeler/CORBIS; Visuals Unlimited/Corbis
0 Biosynthesis
0 Movement
•
••((
•
.11M(
•411/BIA 4.•
•�
•
• •• •
. •�
�
Energy�input
•
•
Elodea cell membrane in stem of plant Cell exterior Cell interior
•
•
•
• • • • •
• •
•�
�
•
Sucrose molecule
Lower concentration
• •
•
Transport • • • •
• • ••
• • •
• •
•• • •
•
•
Higher concentration
•
•
Tyrone Turner/National Geographic Society/Corbis
PRODUCERS�plants and other�self-feeding organisms
CONSUMERS
animals, most fungi,
many protists, bacteria
ENERGY OUT
With each conversion, there is a one-way flow of a bit of energy back to the environment, mainly in the form of heat.
2 H2 + 02
(hydrogen) (oxygen)
2 H2O�(water)
co co Oa
0.4) 01°G
(lec 0.4)
4 hydrogen atoms�+ 2 oxygen atoms
�
A + B
A + B
Reactants:
2 H2 + 02
00
Activation energy
Difference in�energy between�reactants and products
Products: 2 H2O
AO AO
(r)
LLJ
activation energy�without enzyme
starting reactant
with enzyme
energy released by the reaction
forward reaction
products
enzyme—
glucose
active site
el Reactant binds normally to enzyme in absence of allosteric inhibitor.
Allosteric inhibitor
1111?
Allosteric
Ksite
Active�Enzymesite Reactant
Linear pathway Cyclical pathway
Polymerization
H —H —H —H —H 401.°
1
�
�
El When inhibitor Is
bound "active" site is�deformed and inactive.�
�
�
�
�
�
Low-affinity state�
�
�
�
OH
1 /NH3+
CH3—C—C—\ H
H 1
COO�
Threonine
Enzyme 1 (threonine deaminase)
Intermediate A
Enzyme 2
Intermediate B
Enzyme 3
Intermediate C
Enzyme 4
Intermediate D
Enzyme 5
0
1 /NH3'
CH3 —CH2—C—C—H
\COO�
H
CH3
Isoleucine
Feedback inhibition
Active
Reactant
Product Reactant
Product Reactant
Product Reactant
Product
ATP energy
Movement nutrient transport
Environment
0
Figure 6.13 Energy Flow within the Cell. (a) Energy-rich molecules enter the cell and are degraded in exergonic reactions which release their chemical bond energy which is trapped into the chemical bond energy of ATP. ATP then, becomes the energy"currency" paid out to make all of the changes the cell needs to make to stay alive and grow. (b) When ATP is used for energy, the last phosphate is removed forming ADP (adenosine diphosphate) which has less chemical bond energy in its structure. The exergonic reactions work to"rephosphorylate"ADP back to its more energetic triphosphate state.
IN OTHER WORDS
Cell components
Biosynthesis�(endergonic)
Nutrients
Exergonic�pathway
Simpler chemicals
Waste products
Glycolysis�
��
2 ATP IVIOP�
�
�
�
�
�
2 NADH 2 pyruvate
I
Mitochondrion
B Within the mitochondrion, pyruvates are
degraded to 2-carbon acetyl fragments which then enter the Krebs Cycle. All carbons that entered respiration within the glucose molecule leave the pathway as carbon dioxide molecules. The useful products of the Krebs cycle are ATPs, and the energetic electron carried on the molecules NADH and FADH2.
C The fina stage of the respiration pathway involves the transfer of the many electrons derived from glycolysis and the Kreb's Cycle. As electrons pass through a sequence of electron transfer compounds, protons are pumped across the mitochondrial membrane and 32 ATPs form as a result. The electrons are finally passed along to oxygen which accepts them, combining with hydrogen ions to form water.
�
8 NADH, 2 FADH2
Electron Transfer Phosphorylation
H2O
32 ATP
oxygen I
C6H1206
Glucose�(energy rich)
Acetyl-CoA
Formation ON
pyruvate
coenzyme A
(002) GNO:e�
NAD+ NADH
0.—CoA acetyl-CoA�
�
Krebs Cycle
CoA
NAD+
At9(96
oxal acetate
t
NAD+
"•--- FAD
NADH
FADH
ADP + phosphate group
N glucose
4,0000.141.1111111(11114,,,
- -
..,„\•111111e.'--41,41%.2.444#+064,04,
Glycolysis
2 acetyl-CoA
oxygen accepts "spent" electrons
Electron Transfer Phosphorylation
Living organism
4
Dies
I
In a field I In pond mud
Decomposition
1
Oxygen present Oxygen absent
Energy-rich molecules Energy-rich molecules
respired for many ATP fermented for a few ATP
Electrons accepted Electrons accepted
by oxygen by organic
compound
Figure 6.18 Fate of Energy-rich Molecules in Organisms that have Died.
fermentation—a short metabolic pathway in which electrons transferred to NADH carrier molecules are finally accepted, not by oxygen but by some organic molecule.
NAD+ NADH�Glycolysis
(
J
1 .1 .0
Pyruvate (2)
Ready energy for�making changes
Fermentation Summarized
NADH NAD+
�
J•)
Carbon Acetaldehyde (2) dioxide (2)
4( 4)
Ethanol (2)
Final electron�acceptor
441
602
C6H1206
Solar�energy
Sunlight is a mixture of�many wavelengths
0
TV and radio waves
Micro��waves
Infrared
Visible
UV�X-rays
Gamma�rays
Electromagnetic spectrum
Color spectrum of visible light
One wavelength�I I
Longer wavelength
760 nm
700 nm
600 nm
500 nm
400 nm
380 nm
Shorter wavelength
Craig Tuttle/Corbis
Porphyrin ring�(absorbs light)
Hydrocarbon side chain
0
Don Johnston/ Corbis
Light energy is absorbed by an electron moving it to a higher energy level
Photon
Low energy level High energy level
Electron
Either
Electron'', accepting ' quinone
What's inside this lettuce leaf?
leaf's upper epidermis
photosynthetic
cell in leaf
leaf vein
leaf's lower epidermis
two outer membranes
A single photosynthetic cell within the leaf.
thylakoid membrane system
o a single chloroplast within a photosynthetic cell.
stroma
thylakoid compartment
Solar�energy
Water�(energy poor)
Changes needed in Animal cells
upper
epidermis
palisade
mesophyll
spongy
mesophyll
lower
epidermis
these reactions
proceed in the chloroplast's stroma
49EA9199
6 RuBP
ATP
11.
Light-Independent Pathway Summarized
0
6CO2
Carbon dioxide (energy poor)
From�water split�in light��dependent�pathway
From light��dependent�pathway
ATP�18 ATP
From light�
dependent Chloroplast�pathway (enzymes in�the stroma)
C6H1206
Glucose�(energy�rich)
6H20
Water�(energy�poor)
12H+ 12 NADPH
Same chlorophyll with excited electron
Slectron energy level
Electron
4-- transfer
\1/4 compounds
e�
L
Solar energy
Chlorophyll
Autotrophs
Glucose, oxygen
Energy in (mainly�from sunlight)
Photosynthesis
Heterotrophs and autotrophs
Aerobic respiration
)Water, carbon dioxide
Atmospheric CO2�Dissolved CO2�Organic carbon
Energy out (ATP, heat)
Energy out (ATP, heat)
Origin of Photosynthesis and Respiration — No Designer
— Conjectural
Time
— Demonstrable
Microfossils and oxygen accumulation
Dual
photosystem photosynthesis
Cyclic electron transfer
Primitive electron transfer
Organic soup
Monalyn Gracia/ Corbis
Survey Questions
7.1 The Need for Biological Information
How much structure is there to a cell?
What is information needed for within a cell?
7.2 The Nature of Biological Information
What is biological information made of physically?
How was the physical substance of information discovered?
What is the physical structure of biological information?
How is biological information stored within a cell?
7.3 The Expression of Biological Information
What physical form does the expression of biological information take?
Where does information expression start, and where does it end?
What component processes are involved in information expression?
What structures and molecules�participate in transcription?
What are the products of transcription and their roles in the cell?
nanometer—a distance of 1/1000 of a microm�eter. Cells are measured in micrometers. Molecules are measured in nanometers.
algal—of or referring to algae, a diverse, rela�tively simple, autotroph form of life typically found in fresh water or marine habitat; they lack distinct organs.
How does the arrangement of the information support its efficient expression?
What structures and molecules participate in translation?
What are the products of translation, and does translation complete the process of information expression?
How is biological information encoded in archival molecules?
7.4 The Application of Information Expression
Why has society desired to control information expression in biological systems?
What are some problems society has solved by engineering and expressing genes?
What steps are involved in
engineering and artificially
expressing genes?
How do scientists get genes from one organism into another?
What risks are involved in these activities?
What technologies had to be developed in order to do gene therapy?
What has the recent history of gene therapy taught us about its prospects?
7.5 A Hidden Drama: Information�Expression at Its Very Best
What is the most dramatic display of information expression around us in nature?
Life Is Information Expressed—one of 12 principles of life on which this book is based.
Rob Reichenfeld/Getty Images. Biophoto Associates/Photo Researchers
Dr. Peter SiverNisuals Unlimited/Corbis
Expression Product
Construction Cathedral
Transcription,
2 algal cells
translation
Processing Report, image
Research Book, report
Friederick Miescher�1844 — 1895�Physician-biochemist�discoverer of DNA
Science Photo Library
Avery's Experiment
+ DNase + Protease
4
+ RNase
L
Transforming "factor" from heat-killed virulent "S" cells
+ R •lk
Non-virulent cells
35 S-labeled�protein
Progeny phages from�E. coli growing in 35 S
Phage coat lacking DNA
progeny phages
Phage coat lacking DNA
32P-labeled DNA
4
Progeny phages from E. coli growing in 32 P
Ratios of Base Composition in DNA
Values
[Adenine] / [Guanine] [Adenine] / [Thymine] [Cytosine] / [Adenine] [Cytosine] / [Guanine] [Thymine] / [Guanine] [Cytosine] / [Thymine]
Varies from species to species 1.0
Varies from species to species 1.0
Varies from species to species�Varies from species to species
Brackets around the name of the base indicate the concentration or amount of base per weight of DNA
X-ray source
Beam of X-rays
Photographic plate
SPL/Photo Res
5' end 3'end
Distance between�each pair of bases =�0.34 nm
Each full twist of the�DNA double helix =�3.4 nm
5-carbon sugar (deoxyribose)
Nitrogenous
base (guanine)
Phosphate
group
OH
3' 3' end
... ..
Hydrogen bond
2' 3
H2C 5
O
-0—P=0 5'
O�5' end
G
/ c
3'
5'
Direction of replication
3'
multiple levels of coiling of DNA and proteins
beads on�a string
DNA double helix
core of protein
nucleosome
DNA-binding protein
Informational
domain
DNA
Polypeptide Ribosome
Translation
mRNA
Prokaryote
DNA
scription
Pre-mRNA
Transcription start point�
�
Transcription stop point
RNA polymerase molecule DNA double helix�
�
Growing RNA transcript
3'
5'
3'�
�
5'�
Transcription continues to end of gene�
�
RNA copy
Hybrid RNA-DNA�double helix
DNA template chain
Direction of transcription --
Site of RNA assembly
DNA rewinds
RNA polymerase
DNA unwinds
Proofreading function
fie*ArAi
0 poly-A tail
�
Thus coding must involve using short sequences of bases to code for individual amino acids. These sequences of bases are called codons. Suppose a codon were two bases in length. The number of kinds of codons we could form taking four bases, two at a time, would be 42 or 16 codons. This would still be inadequate for amino acid coding. Keeping sequence efficiency in mind, it was thus predicted and later demonstrated that a codon in mRNA consists of a sequence of three bases that together code for a specific amino acid. The num�ber of combinations of four bases taken three at a time is 43 or 64 combinations. This repre�sents more than enough codons for all 20 amino acids. In the 1960s, the genetic code was eluci�dated by Drs. Marshall Nirenberg of the National Institutes of Health in Washington, DC, and Har Gobind Khorana at the University of Wisconsin (see Figure 7.22). They used ribosomes to trans�late simple, artificially constructed mRNAs as a means to crack the code. Details of the code's structure will be discussed below.
Given a coding relationship between bases and amino acids, what "biological hardware" is needed to actually "do" translation? Naturalistic think�ers beware! A formidable challenge faces us. We require (1) a properly processed mature mRNA containing a biologically meaningful sequence of codons; (2) a set of adapter molecules, each of which must recognize a codon in mRNA and pro�vide the amino acid it codes for; (3) a set of cor�responding enzyme molecules, each of which can attach the correct amino acid to its correspond�ing adapter molecule; and (4) a machine that can use an mRNA codon sequence to properly order adapter molecules in the correct sequence to gener�ate a polypeptide chain containing amino acids in the correct sequence. Let's reflect on some specific aspects of these requirements:
1. As we've seen, the mature mRNA molecule is a succinct code that not only contains a meaningful sequence of codons but has a cap that attracts the translation machinery to the beginning of the message (see Figure 7.20). Its poly-adenine tail controls how many times it will get translated before cytoplasmic enzymes degrade it.
UUU
UUC
UUA 1 UUG�
Iphe
leu�
UCU UCC UCA UCG�
ser�
UAU UAC 1
UAA�UAG�
tyr
0�
UGU UGC 1
UGAO UGG�
cys
trp�
�
CUU CUC CUA CUG�
leu�
CCU CCC CCA CCG�
pro�
CAU CAC CAA CAG�
his
1
gin �
CGU
CGC
arg
CGA
CGG�
�
AUU ' AUC AUA AUG�
Ile
met�
ACU ACC ACA ACG�
�
AAU AAC AAA AAG�
asn
1
lys�
AGU
AGC
AGA
AGG�
ser�arg
1�
�
GUU GUC GUA GUG�
val�
GCU GCC GCA GCG�
a�
GAU�GAC
GAA GAG�
I asp
1glu �
GGU GGC GGA GGG�
gly�
�
leu leucine (L)
lys lysine (K)
met methionine (M) phe phenylalanine (F)
pro proline (P)
ser serine (S)
thr threonine (T)
trp tryptophan (W)
tyr tyrosine (Y)
val valine (V)
Figure 7.22 The Genetic Code. Mentally construct an mRNA codon using any three bases you wish in sequence. Find the first base down the left-hand side of the chart to select a row. Now go across the top in search of the second base in your codon and select the large box from your selected row. Select the third base in your codon from the list down the right-hand side of the chart. Within the large box, you can now determine what amino acid your codon codes for. Abbreviations of amino acid names are given with their full names in the list below. Some codons like AUG or UAA start and stop translation. See the text for details.
first second base
base
third�base
F
F
If
rr
ala alanine (A)
arg arginine (R)
asn asparagine (N) asp aspartic acid (D)
cys cysteine (C)
glu glutamic acid (E)
gln glutamine (Q)
gly glycine (G)
his histidine (H)
Ile isoleucine (I)
anticodon
amino acid�attachment site
DNA sequence
vv
cl A 11
IAA
Information flow from DNA base sequence to amino acid sequence
codon codon
mRNA M CI A tEl bi A A, ,
codon
Correct amino acid attached to correct tRNA by synthetase
Transcription
RNA processing I;
I
Translation
o Complete ribosome
tRNAs Growing
polypeptide
t.\t7
mRNA
14111Ii.
Ank
Large ribosomal
subunit
Small
ribosomal�sbunit
start codon (AUG)
initiator tRNA
�
Figure 7.27 Termination of Translation. A class of proteins called "release factors" respond to the mRNA codons UAA, UAG and UGA. When any of these codons come into the ribosome's active site, release factors recognizes them and release first the peptide chain, then the mRNA and the ribosomal subunits.�
�
Translation
Initiation
Elongation
4
�
Termination�
�
�
�
�
�
�
�
�
Release into Cytoplasm�
�
�
�
�
or�
1�
�
�
Processing in�Endoplasmic Reticulum�
�
�
�
�
Mature mRNA Transport
0 Enveloped virus Complex polyhedral virus
(HIV) (T-even bacteriophage)
Protein spikes
V.
Coat proteins
Head
Tail
Baseplate
recognition fibers
Viral DNA (cutaway view)
Protein coat
Sheath
Viral
enzymes
Protein subunits of coat
Coat proteins
EURELIOUS/Phototake
Table 7.3 Genetically engineered cells.
Typical Gene Modification
1
2
3
4 el(mi(im
The Cell's Response:
Defective gene in chromosome
Table 7.4 Methods of Inserting DNA into Eukaryotic Cells.
Germ Line Cells
Somewhere, early in development a cell arises in the embryo from which all precursor germ cells and eventually all sex cells in the mature adult will arise. This separate cell lineage does not contribute to the function of the organism. Rather it produces the new generation of individuals.
Cell division, migration, differentiation
Sex cells are within the abdominal cavity in this fetus; later testicles will descend into the scrotum.
Early embryonic stage
5. Alcohol precipitate DNA
6. Further purify DNA as
needed
enzyme recognition site cut fragments
A A T T=
IIICTTA$
5 3'
3' A /45
one DNA fragment
5 AATT
3=5 ' '
another DNA fragment
5 GA AT
1 1 1 1
3 I I 1 'C T T A
0 A restriction enzyme cuts a specific base sequence everywhere it occurs in DNA.
T7 promoter
Acc65I
Kpnl Sphl Pstl
Mlul SnaBl
BamHl
EcoRl
EcoRl Sall
Accl Hincll Hindll Xhol AvrII/Styl
Nhel Xbal Eco721
BstXl Eco01091
Apal�Sacl�Notl
Sp6 promoter
Plasmid Cloning Vector�3.85 kb
0 The chromosomal DNA fragments have sticky ends.
.4,114
O The plasmid DNA also has sticky ends.
O A selected restriction enzyme cuts a specific base sequence everywhere it occurs in a chromosome.
0 The same enzyme cuts the�same sequence in plasmid DNA.
encounter a gene whose first 21 nucleotides are complementary in base sequence to the probe, base paring will occur and this becomes the reactant in a gene-searching process known as the polymerase chain reaction (PCR).
What is PCR?
PCR is a process designed to search within a huge population of diverse gene sequences. The compo�nents of the process work together to find a specific sequence of interest and make so many copies of that single sequence that they become the dominant species of DNA in the sample (see Figure 7.41). The 21-nucleotide-long sequences of single-stranded DNA we have constructed (red, in the diagram) will be used as primers of DNA synthesis for the
Finding the Gene for Insulin�
�
�
�
�
�
�
Insulin protein showing se�condary
structure�
�
�
�
�
PHE - VAL - ASN - GLN - HIS - LEU -CYS -�
First seven amino acids in primary sequence�
�
UUUGUUAAUGGUCAUCUUUGU
UUCGUCAACGGCCACCUCUGC
UUUGUAAAUGGACAUCUAUGU
UUCGUGAACGGGCACCUGUGC�
Four possible nucleotide sequences coding for these
amino acids�
�
Figure 7.40 Finding the Insulin Gene. Working backwards from the amino acids sequence, we infer nucleotide sequences and use these early sequences to"fish"the gene from our library using the polymerase chain reaction.
0 The
plasmid DNA and the foreign DNA are mixed in a solution with DNA ligase, an enzyme
that can
41.11P seal them
together.
0 The result? A library of recombinant plasmids that incorporate foreign DNA fragments.
111111111111111111111111111
111111111111111111111111111
PITT MITI PITT TT!�61.61 1.1 1.6611
11111.1
111111111111111111111111111
i1j111111111111111111111.LLI�1171711111111111TE' I-17711
111111111111111111111111111 111111111111111111111111111 111111111111111111111111111 111111111111111111111111111
111111111111111111111„
rrrril„„„„„„„„„„,
771111111111111111111111
IIIIIIIIII111I1Iijjlij
0
reverse transcriptase�(pol)
RNA genome
capsid protein (gag)
envelope�protein�(env)
membrane�(from host cell)
Chromosome
DNA in nucleus of host cell
DNA provirus
RNA/DNA hybrid )0000000000000(
Viral RNA
\AAA/WV\
RNA virus
Provirus inserted
into chromosome DNA
DNA replication
Digestion of�RNA strand
Reverse transcription
0
N./‘/VVVVV
Viral mRNA
Viral RNA
is:• • • Viral proteins
RNA virus
Provirus DNA transcribed
0
�
•�
�
�
�
H =�
�
�
•�
�
Therapeutic viruses�
�
�
�
�
�
�
�
IPatient
Ada�
X
Patient genome during integration
Ideal Specific Gene Replacement
Ada�
, Patient genome prior
to therapy
Ada�
Patient genome following transduction
Ada'
Ada+
Ada+
mom I
Ada�
Defective Ada gene is now on a DNA fragment, normal Ada gene is integrated into genome.
0
I
Gene x�Gene x
II
Gene w
Gene w
junk DNA
I
Ada+
Elsewhere in patient genome following transduction
Ada+
Gene x
I
Gene w
Elsewhere in patient genome during integration
Ada
I I
Ada
- 111111111•111ft-,
II Gene w
Gene x
0
Defective Ada gene remains in genome, normal Ada gene is integrated elsewhere in genome.
Ideal Gene Augmentation
Ada�
Patient genome prior to therapy
Therapeutic gene insert with viral ends
Therapeutic RNAs
Ada'
Transcription
Disrupted gene controlling cell division
p�
�
Ada+�
�
�
�
�
�
Functional adenosine deaminase enzyme
8.5 Cytokinesis
How does cytokinesis differ from mitosis? from cell division?
What changes occur during this process?
How does a cell with a rigid wall get divided in half?
8.6 Cancer: Mutation Threatening Design
What is a mutation?
How many genes, when mutated, cause cancer?
What do these genes normally do when not mutated?
How can a mutation in DNA cause a cell to become cancerous?
Life Is Informational Continuity—one of 12 principles of life on which this text is based; DNA base sequence that is used to craft any cell came to that cell from a parental cell by DNA replication.
Energy-0-- Monomers�
Information�
Information�
-4- Energy
4- Monomers�
From nature�
�
Unicellular forms: reproduction bud
Saccharomyces cerevisiae
Maternal cell Maternal cell
Many individuals
Dr. John D. CunninghamNisuals Unlimited
Homo sapiens�
�
�
�
�
�
�
�
�
�
�
Fertilized�ovum�
�
�
�
�
�
�
�
Direction of replication
A
C
C
A�
3'
G C�TA
T
A
A T
3'
G
5
5'
3'
DNA polymerase
5'
0 Binding proteins
0
Helicase
Daughter double-stranded DNA molecules
Gyrase
Maternal double-stranded DNA
/ Replication direction
I ....-....-----.... ..
\ ..=........(
Replication forks
Alignment in mitosis�
Chromosome�
�
�
�
�
Condensation�
Genome�Cycling
Chromatin�
�
S
Period when DNA replicates and chromosomal proteins are duplicated
Gi
Period of cell growth before
the DNA replicates
Go
Cell cycle arrest
G2
Period after DNA replicates; cell prepares for division
Protein
Inactive regulatory protein
ism(110.
Binding
.1111(111.. Cyclin increase
Cyclin
receptor for
hormone
Regulatory intermediates
•
Inactive kinase protein
((41( Cell division
Cyclin
Active kinase protein
Active regulatory protein
Hormone
arrives at cell surface
B
�
�
�
�
1 IVy�
�
�
MM�
�
16 16
�
21�
�
X x
Leona rd Lessin/Peter Arnold, Inc.
Mitosis
Interphase
Microtubules
of centrosome
Microtubules of Centrosome at
developing spindle a spindle pole
Kinetochore _
Kinetochore microtubule
Centrosome
Plasma —/ membrane
Pair of chromosomes
Nuclear envelope
Non�
kinetochore microtubule
Centrosome at opposite spindle pole
Chromosome
Sister
chromatids
41#
Sister chromatid I
Sister chromatid II
Kinetochore I
1//
Spindle
microtubules
Spindle pole
Spindle pole
Kinetochore II
(shortened) at both the centrosome and the kineto�chore ends (see Figure 8.12b), pulling sister chro�matids away from each other. Simultaneously, polar microtubules begin to lengthen, pushing the poles of the spindle further apart. Protein motors pull micro-tubules from opposite poles past each other. Both groups of microtubules contribute positively to a rapidly growing distance between the two daughter genomes. What is the result of all this movement? Consider, for example, a dividing cortical cell at the base of one of your body's hairs. It does anaphase
metaphase plate—an imaginary region, disc-shaped, often in the cell's geometric center, where all of the cell's chromosomes come to lie during the second stage of mitosis.
Microtubule disassembles as kinetochore passes over it
Kinetochore
Microtubule motor protein "walking" along microtubule
Kinetochore�microtubule
Direction of kinetochore movement
•
( •
I
111
Nine nuclear
Fertilized egg divisions
D
. • . •
A • • • • •
• : • • ' • • •
Nuclei _
V
Multinucleate blastoderm�(nuclei in common cytoplasm)
Zygote
nucleus
(2n)
Embryo hatches from egg, develops through three larval stages and a pupal stage, and then undergoes metamorphosis to produce an adult
Nuclei migrate
Ito periphery and continue dividing
fp
Head
Thoracic Abdominal segments segments Adult
�
Segments�
�
..... •
: Pole
cells
•••••.........
Fg As actin microfilaments contract, the furrow deepens.
D.M. Phillips/ Visuals Unlimited
us*
sem Fails to halt cell�division
James Stevenson/ SPL/ Photo Researc
n�8
• it.
illW4Lik
-dam
;1
Cell division no longer inhibited
by Rb
Inactive regulatory protein Rb
Nucleus
Active regulatory protein Rb
Nucleus
Activates
ATM kinase protein
Adds phosphates to P53 protein
Transcription, translation
Inactive
Cdk
P53 protein
p21 Protein 21 inhibits cyclin-Cdk complex
Cyclin
Active Cdk
P53 Negative Regulation of Cell Division
Active regulatory protein Rb
Cyclin
Cyclin increase
Binding
1110
Inactive regulatory protein Rb
Cell
division
prey disappearing into predator's oral opening
Survey Questions
9.1 Development: Decoding a Master Plan
How does a single cell develop into a huge macroorganism? How does the acorn become the oak?
Is development a process that can be subdivided into more intelligible subprocesses?
What are these processes and how do they work together to produce an organism?
How comprehensive is
development? How is the final product, the organism, organized?
9.2 Gingko biloba: How to Make a Tree
What is a Ginkgo tree?
Where does development of the
tree actually begin?
How do plant and animal development differ?
What controls the differentiation of
the tree's cells into tissues and organs?
How are leaves, stems, roots, and
flowers differentiated?
9.3 Development of a Human Being
In what structure does human development begin, and how does it begin?
Do growth, cell division,
differentiation, and morphogenesis all begin at once and continue at a constant rate?
Through what sort of stages does�human development progress?
How does the process of
differentiation begin and get
maintained in human development? How does development progress from cells to tissues to organs?
How do tissues and organs with the same genetic information get to be different from each other?
How do whole systems like the digestive or nervous system develop?
How does the human heart form?
How can development start with a single-celled zygote and end up with a cerebrum that contemplates that process?
What sort of chemical
communication is involved in the process of development?
How do the parts of an organ system work together?
Imagine an automobile that, given sufficient energy and parts, makes itself. That would be close to imagining the hidden talent of the human embryo.
Lennart Nilsson, Dell Publishing
Kevin Fleming/CORBIS
Neural tube
11411000
Tadpole
Organization
Tissue layers differentiate Out cavity further generating organs
and organ systems.
Neural plate
Differentiation ; Dividing cells move and form into layers--the first '(
three tissues of the
organism.
Zygote
Blastula lastula
Cell Division
to form a ball of cells, the blastula.
Mesoderm
Growth
prior to fertilization
the egg grows from 10 pm in diameter to 2000 pm.
First Cell Sperm and egg
generate a�zygote: the first diploid cell of a frog.
Ectoderm
/1/1111/1)11/
Adult
3 years old
GJLP/CNRI/SPUPhoto Researchers, Inc.
vessel in�xylem
meristem�cell
epidermis —
cortex
vascular bundle
pith
sieve tube companion cell in phloem in phloem
0
Epithelial tissue
Connective tissue
Muscle tissue
Nervous tissue
Stoma
Figure 9.5 Embryonic Induction.
Biomolecular signals elaborated from one embryonic tissue layer
initiate structural changes and altered behaviors in another layer.
Morphogenetic movement brings two embryonic tissue layers into close proximity with each other.
The first tissue layer secretes a gene product (black dots) that has a signaling effect on the second tissue layer.
The second tissue layer responds to the signal
substance by altering its own gene expression resulting in new morphological and functional patterns.
�
•
Main organs: Main organs: Main organs:
Skeletal, cardiac, Bones, tendons, Skin, sweat
and smooth muscle ligaments, cartilage glands, hair, nails
Main functions: Movement of limbs and parts of internal organs; heat generation.
Micropyle (pollen entry) Pollen chamber
Sperm nuclei migrating a
doc-stock/Corbis
Multiple cytokinesis events
Multicellular embryo
III•: le
Multiple Is J 1
mitotic
(nuclear) I 11.4
N
divisions NN�(2N)
Maternal nutritive tissue
fused nuclei (2N)
Fertilized archegonium (zygote)
Male stalk tissue
Sperm cell (1 N)
Female nucleus (1 N)
Archegonium (egg cell)
Ginkgo biloba seed
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
�
aborted ovule —�
�
�
�
�
�
�
�
�
0.1 mm�
�
�
root
hormonal gradient
Ginkgo biloba embryo within the seed
�
�
�
Future root tip Future shoot tip
Seed leaf (cotyledon)
Maternal tissue (nutritive)�
�
shoot
cotyledon
maternal tissue�
�
�
�
�
�
�
�
�
�
ground tissue vascular tissue
' lateral
0
Older leaf
Leaf primordia
Apical meristem
Older leaf
Trichome
Bud
14 primordium
0k,
James Mauseth, University of Texas.
VASCULAR CYLINDER
xylem
phloem
cortex
epidermis
root�hair
Xylem cells are mature; root hairs are about to form.
New root cells lengthen, phloem —cells mature,
xylem cells
start forming.
Most cells have stopped dividing.
Meristem cells
are dividing rapidly.
No cell division is
occurring here.
root cap
— root�tip
0
Ginkgo biloba seed germination
Seed coat Primary leaves
Primary root
0
Michael P. Gadomski / Photo Researchers, Inc.
Section of branch
Lateral�branch
Shoot
Lateral bud
Root
Gibberellin gradient
111 Auxin
gradient
111 Cytokinin
gradient
Lena Clara/ fstop/Corbis
Lennart Nilsson, from A Child is Born 1966, 1977 Dell Publishing Company, Inc.�
Sperm attached to zona pellucida�
�
�
��
�
�
Sperm Zona EgIg cell
cells pellucida�
�
�
trophoblast (surface layer of cells of
the blastocyst)
inner cell mass
inner cell mass
uterine cavity
Uterine tissues
�
Days 6-7. The inner cell mass is differentiating into
two separate cell layers actual
at about the time the size
blastocyst begins to implant in the uterine wall.
unfertilized egg
�
cytoplasm regionally differentiated
morula
.41101011t*
�
multiple cleavage divisions
cells become�differentiated
Figure 9.18 Regional Differentiation. Color gradients in this diagram represent the concentration of some differentiating signal molecule. As cell division progresses, the cytoplasm of individual cells become differentiated. Signal molecules in the cells at the top of the morula will call for gene activity not called for in the cells further down.
start of start of
cana*Aredrnskbiyonic •
•�
��
�
start o
1•11111110116 yolk sap
yolk sac
embryonic disk amniotic cavity chorionic cavity
primitive�streak
Endoderm Derivatives�Mesoderm Derivatives
Ectoderm Derivatives
Epithelium of GI tract and its associated glands as well as glandular cells of the liver and pancreas Epithelium of the urinary bladder
Epithelium of respiratory passages; the pharynx, trachea, bronchi, and alveoli.
Epithelial parts of the tonsils, thyroid, parathyroids, tympanic cavity, thymus
Epithelial parts of anterior pituitary
Cardiovascular system
Cells of lymphatic system, spleen, adrenal cortex Skeleton, Striated muscles and smooth muscle coats Dermis of skin
Connective tissue and vessels associated with organs Urogenital system (gonads, ducts and accessory glands)
Epidermis of skin, nails, hair, sweat, mammary and, sebaceous glands
Central Nervous System, Peripheral Nervous System
Retina and lens of eye
Pupillary muscle of the iris (this is the only muscle of ectodermal origin)
Pineal body, anterior and posterior pituitary, adrenal medulla, melanocytes, Schwann cells.
�
Anterior
t.
Right Left
•
r
r
Posterior
�
future brain
paired neural folds
somites
neural groove
neural tube
Days 22-23. The neural tube will
become the spinal cord of the fetus; note the increased level of differentiation at the head end of the embryo.
�
Days 26-36. Ectodermal and mesodermal thickening reveals early eye and lens
formation; endocardial tubes have flexed and bent into the chambers of a heart, apical ridges are beginning to form limb buds; the yellow tube passing between the pharyngeal arches is the primordial digestive system.
Days 24-25. Pharyngeal arches have begun to appear. Their differentiation will contribute to structures in the mouth, nasal cavity, middle ear and larynx.
forebrain future lens
pharyngeal arches
developing heart upper limb bud somites
neural tube forming
lower limb bud
actual length
�
pharyngeal
arches
�
Ectoderm
Neural
tube
Coelom
Heart development in humans
To�aortas,
�
Ventricle�
Atrium
Cardiogenic�plate
Cell
cluster ri
Neura folds
0
0
Aorta
Pulmonary artery
Left atrium Right atrium
Right ventricle
Left ventricle
0
0
O Mesencephalon
Prosencephalon (midbrain)�(forebrain)
Optic vesicle�
/ Rhombencephalon
/-72- Nhindbrain)�
�
Heart
Telencephalon Diencephalon Mesencephalon Metencephalon Myelencephalon
-Tr-Spinal cord
�
Myelencephalon
Diencephalon
Telencephalon
Cervical
Iflexure
Spinal cord
Mesencephalic roof
Superior colliculus
Inferior colliculus
Diencephalic outline
Cerebral hemisphere
Olfactory
bulb
Cerebellum
\ Pons
Medulla
/ oblongata
Spinal \ cord
Mesencephalon Metencephalon
Mesencephalic (
flexure
O
�
Wnt and SHH Cell Signaling Wnt and SHH Cell Signaling
Wnt
Wnt
Wnt
Cells A and B will express separate sets of genes and differentiate in
different directions because of the variation in signal protein concentr�ations they experience.
�
SHH
ITCH
SUFU Cos
Notochord
Hemisphere Hypothalamus of cerebrum Thalamus
Pineal gland
Pituitary gland
Midbrain
Pons
Cerebellum
Medulla
oblongata
Central canal
Spinal cord
Central nervous system (CNS)
Brain and�spinal cord
Input Output
to CNS from CNS
Afferent�system�
Efferent�system�
�
Sensory�organs�
�
Somatic�system�
�
Autonomic�system�
�
�
�
�
�
�
�
4�
��
�
' Sympathetic�division�
�
�
�
�
�
Skeletal�muscles
Smooth muscles�Glands
Peripheral nervous
system (PNS) Effectors
ASK.N' • JD ANSWERING Q
Nimmimmini�
ES�
DONS�
�
�
�
�
�
-1(11111111111111M111�
�
Mark Bowler / Photo Researchers, Inc.
�
Pigment layer
KEY
Ectoderm Mesoderm Endoderm
Dorsal lip Invagination
of blastopore
�
�
Blastocoel displaced
��
E�
Hans Spemann (1869-1941) was born in Stuttgart, Germany and in the 1890's began his study of embryology at the Universities of Heidelberg and Wurtzburg under the guidance of Gustav Wolff and Theodore Boveri. He worked with a variety of organisms but when contemplating his induction experiments he began working with the common newt, Genus Triturus.�
�
F Results
�
Secondary notochord
Primary notochord
Primary
neural tube
Cjirn
Secondary
neural tube
�
At the graft site on the recipient embryo, a second gastrula�tion event occurred. As a result, a second embryo began to develop on the side of the recipient embryo. Pigmentation differences confirmed the separate identities of the two embryos.
Materials and Methods
Spemann and his student, Hilde Mangold worked with two spe�cies of newt that had distinctly different surface pigmentation patterns. They performed a series of transplantation experi�ments involving the critical gray crescent area of the embryo surface. They waited until the gray crescent gave rise to the blastopore and gastrulation was about to begin. Since surgical work is traumatic to an embryo, the experiment was designed so that the blastopore lip was cut from one embryo and trans�planted to a site on the opposite side of a second embryo. The recipient embryo thus has two blastopores spaced well apart from each other with one in its normal location. The donor em�bryo is discarded. Differences in donor and recipient tissue pig�ments facilitated the interpretation of the results.
Ectoderm
�
Donor embryo Recipient embryo
C Question�
Can one group of cells tell another group of cells what to do? That is, can the differentiation of a cell be induced to occur by a signal from another cell?�
�
Hypothesis�
Dramatic changes in cell behavior occur at the blastopore. If the blastopore is surgically placed elsewhere on an embryo, gastrulation will occur at that novel site.�
�
��
The Genus Xenopus, containing the African clawed toad, has been widely used in developmental biology studies.
The toad, like the newt Triturus, is an amphibian. Both produce eggs which hatch into larvae. The larval forms then undergo metamorphosis to the adult form.
The toad egg, has similar features to the newt egg and under�goes gastrulation in essential the same way. (See the diagrams in "Existing Knowledge" box of previous experiment.)�
�
�
New Questions!
We said that a morula contains 16 complete copies of instructions to make you. How do we know that? How do we know that total genomic information is retained through life?
Could nuclei from an albino (no pigmentation) strain of toad be placed into irradiated eggs from a normal strain of toad? Would albino toads develop?
Your question!
Interpretation
The genes necessary to direct the earliest stages of development and all succeeding stages of development up to the tadpole stage were present in the tadpole intestinal cell nuclei. Further the egg cytoplasm was capable of activating those genes and causing them to be expressed.
JOHN OVERTON/epa/ Corbis
John Gurdon (1933 —) was born in England and began working with Xenopus during his graduate studies at Oxford University. His initial studies with nuclear transplantation were carried out there. Much of his career has been spent at the Medical Research Council labs and in the Department of Zoology at Cambridge University. He has received the Lasker award for his seminal studies in the totipotency of the amphibian nucleus.
C Question
Could the nucleus of a fully differentiated cell still run the entire process of development? (Is a differentiated nucleus still "totipotent"?)
Hypothesis
The nucleus in a highly differentiated cell still contains all of the DNA that was present in the zygote nucleus from which it ultimately derives. It can therefore still direct the process of development.
The Inquirer
Materials and Methods
Inject nucleus into egg
Irradiate
with UV light to kill nucleus
Unfertilized egg
•
Gurdon began by irradiating unfertilized Xenopus eggs, irreversibly mutating the DNA in their nuclei to the point that none would develop if fertilized. He then used a very fine needle to withdraw a single nucleus from a differentiated tadpole intestinal cell. The nucleus was then injected immediately into one of his irradiated egg cells. This procedure was carried hundreds of times.
F Results
Injecting a differentiated nucleus into an unfertilized egg cell caused the egg to develop all the way to the tadpole stage in 1.5% of the transplantations performed.
Inject nucleus into egg
Success rate: 1.5%
Blastula
Survey Questions
10.1 The Integrated Human
At what structural level(s) does the human organism exhibit integration?
What is the level or degree of this integration? How many systems are involved?
When or at what times does the integration of parts become important?
10.2 The Muscular System
How widespread is the muscular�system in the human body?
How is a muscle structured? How many levels of organization are there in the structure of a muscle?
What enables a muscle to shorten�its own length—to contract?
How is a contraction event
initiated? From where does the stimulus to contract come?
What is the nature of the signal�that causes muscle contraction?
Does the signal occur at the level of the entire muscle (organ) or at the cellular level?
Are all muscles internally
structured in the same basic way, or are there different classes or kinds of muscles?
10.3 The Cardiovascular System
How do nutrients and oxygen arrive at the muscle to enable it to contract repeatedly?
What is the role of blood in this process?
Rudy Sulgan/Corbis
All Systems Support Each System
Muscular system
(•IT -
II
Nervous system 111
System Integumentary system
C
11Z11111.13
- Urinary system
Respiratory system"
Digestive system 311
rinphatic system
�
Skeletal system
rEndocrine system
What are some strategies that pathogens use to invade our bodies? Do they ever successfully evade our immune response?
What can we do to enhance our response to pathogens?
10.5 The Human Digestive System
What function does this system serve?
What are the major organs of this system?
What substances are digested and what are the products?
What happens to the products of digestion?
How is the process of digestion controlled?
Are other systems of the body involved in this control?
10.6 The Human Urinary System
Why does the human body need a urinary system?
What organs participate in the urinary system? What is the role of each?
How do these excretory organs process waste at the cellular level?
How is the urinary system related to the other systems of the body?
10.7 Neurons at Work
How does the nervous system relate to all the other systems of the body?
What is a neuron, and how does it relate to the rest of the nervous system?
How is a neuron structured?
What is the difference between a neuron and a nerve?
How does a neuron transmit a�signal to another neuron?
Does a signal in one neuron always become a signal in any neuron it synapses with?
Does a neuron receive signals from only one other neuron or from multiple neurons?
How does a signal move along the length of a neuron?
Are there different types of neurons or only one essential type?
What is a reflex?
How many neurons are involved in a simple reflex arc?
284 Chanter 70 The Internally IntprirAtpri Hilmar