Life in Its Biological Environment Laboratory Lab 10: Paternity Testing with DNA Fingerprinting
I need the worksheet completed
2 years ago
25
Activity7.docx
Activity7.docx
Life in Its Biological Environment Laboratory
Lab 10: Paternity Testing with DNA Fingerprinting
Name: Faith Watson
Introduction
DNA “fingerprinting” is a powerful tool for comparing two DNA samples. The process is relatively simple. This exercise should help you see how this tool can be applied to forensic and paternity testing.
The Case: A married couple, Joe and Sally (Sally is infertile), arranges with a close friend, Mary, to have a baby. Mary is artificially inseminated with Joe’s sperm. When Mary gives birth to the child, she decides that she wants to keep it. She claims that the child's biological father is not Joe, but her own husband Dan. You are the DNA technician who has been asked to perform genetic testing to determine the true biological father.
1. Review information about the process of genetic fingerprinting. You can perform an Internet search on the subject if you do not have other reference materials.
2. You have been given the following DNA samples:
Mary
CCTAGACGGCCAGGCACAAGCCAGGCCATGGCCACATCAGTTAGACCGAGGCCGAATCGGCCTTATTGCAGG
Joe
CCGAGGCCAGGGTATACCGGTATAGGCCAATTTGGCCGGCATGGGCCGATACAGCCGATGGCCATATAGGGGG
Dan
CCGGTACATTACCAGGCCAAGGATACGGCAAGCAGGCCTTCATGGCCAAGGCCTTAGCACGGGCCAATGACGG
Baby Jacob
CCACATCAGTTAGACCGAGGCCAAGGCCAACCGACGGCAAGGCCCGACAGGCCAAAGACGGCCATATAGGGGG
3. You have decided to use restriction enzyme Hae III to cut between the GG and CC of each GGCC sequence. (It does NOT remove the GGCC.) Show where the Hae III will cut the DNA. Use your mouse to move the lines to the right into the sequences above.
One cut has been done for you in Mary’s DNA as an example.
4. Since we know that the process of DNA fingerprinting will cause the restriction fragments in each sample to separate according to size, count the number of bases in each fragment. Then fill in the chart on page 2 by copy/pasting each fragment into the correct cell. This chart represents the “gel” that separates DNA by size.
|
Bases |
Mary |
Joe |
Dan |
Baby Jacob |
|
5 |
|
|
|
|
|
6 |
|
|
|
|
|
7 |
|
|
|
|
|
8 |
|
|
|
|
|
9 |
CCTAGACGG |
|
|
|
|
10 |
|
|
|
|
|
11 |
|
|
|
|
|
12 |
|
|
|
|
|
13 |
|
|
|
|
|
14 |
|
|
|
|
|
15 |
|
|
|
|
|
16 |
|
|
|
|
|
17 |
|
|
|
|
|
18 |
|
|
|
|
|
19 |
|
|
|
|
|
20 |
|
|
|
|
The first restriction fragment produced in Mary’s DNA has been done for you as an example. It was placed in Mary’s column because it comes from Mary’s DNA. It was placed in Base row 9 because this restriction fragment contains 9 bases.
5. You have decided to use a probe that is a small piece of DNA with a sequence of “GTA” that has been labeled with radioactivity. This probe will attach to a section of DNA with the complementary code. What DNA sequence will your GTA probe attach to?
|
|
Mary |
Joe |
Dan |
Jacob |
|
5 |
|
|
|
|
|
6 |
|
|
|
|
|
7 |
|
|
|
|
|
8 |
|
|
|
|
|
9 |
|
|
|
|
|
10 |
|
|
|
|
|
11 |
|
|
|
|
|
12 |
|
|
|
|
|
13 |
|
|
|
|
|
14 |
|
|
|
|
|
15 |
|
|
|
|
|
16 |
|
|
|
|
|
17 |
|
|
|
|
|
18 |
|
|
|
|
|
19 |
|
|
|
|
|
20 |
|
|
|
|
6. Using the Highlighter feature of your word processing program, highlight all of the sequences in the “gel” above that contain the complementary sequence determined in #5. These sequences will have the radioactive probe attached to them.
7.
8. After exposing an x-ray film to the gel, only the areas containing the radioactive probe will leave a cloudy area on the film. These are the same areas you just highlighted and they are known as “genetic markers.” We will now fill in the “film” to the right with gray blocks that represent our markers. They will be located in the same positions as the highlighted fragments above.
9. Remembering that all the markers found in Baby Jacob must be found in either Mary or the father, who will you say is the father of Mary’s baby?
10. If you were serving on the jury in this case, who would you choose to raise the baby? Why?
- Economics 3 2 help
- m7a2sc
- Importance of Research and Research Methods
- Legal research and writing_A6
- Questions need to be answered fully and professionally with credible references and no plagiarism. Who can handle this?
- Assignment 1
- RES-850 Module 2 DQ 1
- prof maurice
- LDR/300 LEADERSHIP NEWSLETTER
- Lean Enterprise Organization Application