Biology
RajkandhareHow many amino acids would be there in the polypeptide chain if the
mRNA has following sequence of nucletides ?
5
/GACCGAUGCCCGGGAAAAUGGUCCCGGUAAAUAUAGUAGUC
UAGAAUAAAA3/
5 years ago
2
Answer(0)
other Questions(10)
- n your assignments, journal activity, and discussion, you have researched and analyzed case law related to school desegregation; church-state interaction; education of students with disabilities and English Language Learners (ELL) students; teacher rights
- Research Paper topic and preliminary references
- Sterotypes
- Prof Dan
- cas 6
- 06/11/2016 Science
- See attachment
- ACC-250 Week 2 DQ 1- Respond to the following question, exercise, problem, or case in your textbook: “Chapter 2 Assess Your Progress:……….
- nutrition class 2
- Find P[X + Y = 1], P[X + Y = 2].
