SweetStudy (HomeworkMarket.com)
  • homework question
    chat0
Home.Literature.
Help.
  • Contact Us
  • FAQ
Log in / Sign up
  • Log in / Sign up
  • Post a question
  • Home.
  • Literature.
  • Help.
  • Contact Us
  • FAQ
  • Biology

    profileRajkandhare
    • Main
    Home>Homework Answsers>Biology homework help
    biology
    How many amino acids would be there in the polypeptide chain if the
    mRNA has following sequence of nucletides ?
    5
    /GACCGAUGCCCGGGAAAAUGGUCCCGGUAAAUAUAGUAGUC
    UAGAAUAAAA3/
      • 5 years ago
      • 15.04.2021
      • 2
      Report issue
      Answer(0)
      Bids(44)
      • Brainy Brian
      • PROF_ALISTER
      • All Works solver
      • Jahky B
      • Callie Thorne
      • Amanda Smith
      • Ultimate GEEK
      • Guardiantutor
      • Ashley Ellie
      • PROF_TOMMY
      • brilliant answers
      • Prof.MacQueen
      • Brilliant Geek
      • perfecto
      • Karim Asad
      • Catherine Owens
      • Rey writer
      • michael smith
      • Rosie September
      • kim woods
      other Questions(10)
      • 1.5 pages essay
      • Assignment 5 – Integrating Elements of Engagement
      • High school math questions only need 10 mintues
      • History paper
      • ECO Discussion
      • operations management 200 three pages assignment
      • week 9
      • Can you complete
      • See below
      • Brave the new world 300 words MAL format
        1. Applied Sciences
        2. Architecture and Design
        3. Biology
        4. Business & Finance
        5. Chemistry
        6. Computer Science
        7. Geography
        8. Geology
        9. Education
        10. Engineering
        11. English
        12. Environmental science
        13. Spanish
        14. Government
        15. History
        16. Human Resource Management
        17. Information Systems
        18. Law
        19. Literature
        20. Mathematics
        21. Nursing
        22. Physics
        23. Political Science
        24. Psychology
        25. Reading
        26. Science
        27. Social Science
        28. Liberty University
        29. New Hampshire University
        30. Strayer University
        31. University Of Phoenix
        32. Walden University
        • Home
        • Homework Answers
        • Archive
        • Tags
        • Reviews
        • Contact
          • twitter
          • facebook
        Copyright © 2026 SweetStudy.com (Step To Horizon LTD)