1 / 160100%
1
CHAPTER ONE
INTRODUCTION
Zebrafish as a Model System
Zebrafish (Danio rerio), are a species of small minnow native to the
freshwater streams of Northern and Central India. Zebrafish belong to the
cyprinid family of teleost fish, which includes several other popular model
organisms such as medaka, pufferfish and the three-spined stickleback. These
organisms are often used in genetic and behavioral studies. Over the last
several decades, the zebrafish has gained popularity as a model organism in a
variety of backgrounds including genetics and developmental biology (Eisen
1996; Dooley and Zon 2000; Grunwald and Eisen 2002).
More recently, zebrafish have become a widely used model system for
studying human diseases, drug-targeting studies, toxicity screening, sleep and
anxiety studies, neurodegenerative and aggression disorders (Eisen 1996; Gerlai
et al. 2000; Hendricks et al. 2000; Grunwald and Eisen 2002; Gerlai 2003; Bilotta
et al. 2004; Kari et al. 2007; Feitsma and Cuppen 2008; Guo 2008; Ingham 2009;
Norton and Bally-Cuif 2010). Researchers have been using zebrafish to study
behavioral, anxiety, sleep and learning disorders because the regulatory
processes that underlie behavior in zebrafish and mammals is highly conserved.
The zebrafish has also become extremely common in cancer research, drug
2
discovery and aging disease studies because of the similarity of tissue histology
between fish and humans (Amatruda et al. 2002; Gerhard 2003; Rubinstein
2003; Zon and Peterson 2005). Using zebrafish gives researchers the
advantage of directly testing a mutation in a whole animal background rather
than a single cell. Additionally, using zebrafish in chemical screens allows
researchers to understand the toxicity and targets of potential therapeutics before
clinical trials are performed. The techniques developed over the last 30 years for
zebrafish researchers have made all this possible.
The basic genetics and molecular biology methods can easily be applied
in zebrafish research including PCR, cloning, gene-mapping, in situ hybridization
and mutagenesis. Histological methods have also been important in zebrafish
research since it is relatively easy to prepare paraffin sections of adult and
embryonic fish, resin mounts and sections, and even cell-specific staining in the
sections. Initial RNAi approaches in zebrafish were not very promising; however,
the development of microinjection techniques have allowed reverse genetics or
gene knockdown studies to be carried out using morpholino oligonucleotides
(MOs) (Nasevicius and Ekker 2000; Ekker and Larson 2001; Grunwald and Eisen
2002; Ingham 2009). MOs are synthetic molecules, usually 25 bases in length,
which bind complementary sequences of RNA by standard base pairing.
Structurally MOs are very similar to DNA since MOs have standard bases; the
difference is that in MOs, the bases are bound to a morpholine ring instead of
deoxyribose rings and are linked through phosphorodiamidate groups instead of
phosphates (Robu et al. 2007; Moulton 2007).
3
The importance of the MO chemistry is that unlike typical RNAi methods,
MOs do not degrade their target RNA molecules but rather act by steric blocking,
reducing the interaction of the target RNA with other molecules. The reduction in
gene expression using this technique is only effective for the first 4-5 days of
development, but allows for direct targeting of developmental genes (as
reviewed by Gerhard 2003). Microinjections have also aided in transplantation
and cell-labeling studies and development of transgenic zebrafish systems.
Although other methods of introducing foreign DNA into zebrafish have been
used including electroporation of fertilized eggs, particle gun bombardment,
liposome-mediated gene transfer and sperm-mediated gene transfer, the highest
survival rate and method of choice continues to be microinjection (Lele and
Krone 1996).
Teleost Evolution: Despite having more than 300 million years separating
the last common ancestor of fish and humans, the overall biology between the
two are strikingly similar (Postlethwait et al. 1999; Gerhard 2003). As a
vertebrate, zebrafish possess many anatomical and functional features that are
similar to humans (as reviewed by Gerhard 2003). Analysis of the zebrafish
genome, particularly focusing on Hox gene clusters, suggests that during the
course of vertebrate evolution, the zebrafish and human lineages have shared
two rounds of whole genome duplication prior to a third teleost-specific
duplication event (Postlethwait et al. 1994; Postlethwait et al. 1999; Postlethwait
et al. 1998). As a result of the genome duplication events, zebrafish often have
4
two functional homologs of the mammalian gene equivalent in which the function
of the ancestral gene is now divided between two genes. For this reason, each
zebrafish homolog has a more restricted function, often appearing as a
divergence of spatial and temporal gene expression (Carroll, Grenier and
Weatherbee 2000). Unfortunately, gene isolation and analysis in zebrafish tends
to be more difficult because of the genome duplication, but in many cases the
presence of two orthologs of a mammalian gene provides an advantage for
developmental genetic analysis by providing the opportunity to investigate gene
functions that may otherwise be obscured by other functions of those same
genes in mammalian models (Postlethwait et al. 1998; Postlethwait et al. 1999,
Carroll, Grenier and Weatherbee 2000).
Aside from the duplication event in teleosts, when compared to the human
genome sequence, the zebrafish genome demonstrates conservation of
functional domains, developmental pathways, syntenic genes, cell cycle and
tumor suppressor genes, allowing the zebrafish to be an ideal model organism
for the identification of genes and pathways involved in human diseases (Shin
and Fishman 2002; Rubinstein 2003; Lieschke and Currie 2007). Additionally the
general features of zebrafish during development through adulthood and its basic
anatomy enable it to be a useful model in other areas of research as well.
Zebrafish Development, Life Cycle, and Physical Characteristics:
Fertilization and development of zebrafish occurs externally and the optical clarity
allows for easy manipulation of individual cells or embryos for cell-fate
5
determination or cell-labeling studies (Gerhard 2003; Eisen and Smith 2008).
This also enables researchers to identify mutants based on phenotypes, specific
behaviors or lethality simply under a microscope. This has led to the genetic
identification of several developmental disorders and increased the usage of cell
signaling assays originally developed for use with Xenopus larvae. Other useful
advantages at the early stages of zebrafish development are that the
developmental process occurs relatively synchronously among large clutches of
eggs.
Zebrafish embryogenesis is a relatively rapid process. During the first 24
hours of development, zebrafish embryos are completely transparent making
them easy to visualize and identify the development of organs and limbs (Figure
1.1A) (Eisen 1996; Grunwald and Eisen 2002). Pigmentation can be seen by 48
hours post fertilization (hpf), which helps with genetic screens exploiting pigment
mutants such as golden and albino. By this time, zebrafish embryos display the
vertebrate-specific body plan and most organs are fully developed (Figure 1.1B).
At 72-hpf, most larvae will hatch from their chorions and swim freely (Figure
1.1C). At approximately six months of age the fish are sexually mature and
ready to breed. The adult fish reach a size of 3-4 centimeters in length; females
are often slightly larger than the males (Kimmel et al. 1995; Grunwald and Eisen
2002; Volff 2005). Adult zebrafish have a silver body with seven to nine bluish-
black horizontal stripes that are present from dorsal to caudal fins. Male
zebrafish also have a gold hue between the stripes.
6
Figure 1.1: Images of wildtype zebrafish embryos (A) prim-6 or approximately 25-hpf (B) long-
pec or 48-hpf (C) protruding mouth or 72-hpf (Adapted from Kimmel et al. 2005).
The breeding and aquaculture of zebrafish is relatively easy. Breeding
pairs are set up in the afternoon before the fish are fed. Depending on the
purpose of the breeding, stocks, collection or injections, the breeding tank set up
has various options. When breeding for stocks, several males and females
(group breeding) may be placed in the breeding tank and left overnight until the
following day. This allows for a heartier stock by having multiple males fertilize
eggs from various females. Another option that is particularly useful for
identifying carriers of certain genes and other mutant studies is having a single
male and a single female in a breeding tank. In other cases when embryos need
to be of specific ages for and experiment, a divider is used to separate the male
7
and female fish. The dividers are then pulled at specific times the following
morning and eggs are collected within a few minutes of deposition.
Streisinger and the Age of Zebrafish Genetics
George Streisinger was a molecular biologist who worked on transcription
and protein synthesis in the T4 phage (Tsugita et al. 1968). Although he was
quite established in this field, he wanted to find a vertebrate model that could be
used to continue his studies. According to several published articles, Streisinger
had a fondness for tropical fish and attempted to use several different species
from pet stores in his lab prior to settling on zebrafish (Eisen 1996; Grunwald and
Eisen 2002). In the early 1980s, breakthrough research was done when
Streisinger and associates applied mutational analysis to study embryonic
development, establishing a method to activate the development of zebrafish
without genomic contribution from sperm, giving rise to haploid embryos.
Streisinger reasoned that the zebrafish could be used in carcinogenicity and
toxicology testing of chemical and environmental agents, and could serve as a
model to establish quantitative dose-response relationships of carcinogenic
exposures in vivo (Streisinger 1984; Walker and Streisinger 1983). In order to
test for carcinogenicity, Streisinger developed a rapid genotoxicity test based on
the current experiments using mice that exploited the zebrafish pigment
mutation, golden. The golden heterozygous zebrafish were exposed to various
mutagens, including gamma rays, ethyl methanesulfonate (EMS) and ethyl-
nitrosourea (ENU) during the early stages of embryogenesis. These exposures
8
resulted in the appearance of mosaic patches of golden and wildtype
pigmentation in the retinal-pigmented epithelium (RPE) at 48- to 72-hpf; this
result suggested that the mutagens effectively targeted the early blastula cells
and caused genotoxic effects (Streisinger 1984). Additionally, it was concluded
that the golden cell patches arose from mutation, somatic crossing over, or loss
of the chromosome containing the golden locus (Streisinger 1984). Later, it was
found that exposure to EMS causes a large portion of chromosome breaks and
induces a higher percentage of mosaics than ENU, which causes point
mutations. These findings allowed for direct comparison of mutation frequency
and tumor development, thereby increasing the significance of using zebrafish in
these types of studies (Streisinger 1984; Currie 1996; Grunwald and Streisinger
1992). Streisinger’s lab also laid the foundation for such techniques as the ability
to breed zebrafish by in vitro fertilization and generate fully homozygous diploid
embryos using UV-inactivated sperm. Before his death in 1984, George
Streisinger showed that zebrafish could be used in classical forward genetic
screens, mutation-based genetic analysis (golden) and gynogenetic assays.
Thus, this body of work revolutionized the use of the zebrafish model system for
studying development (embryology) and genetics.
Genomic Instability Mutants in Zebrafish
Genomic instability refers to a wide range of genetic alterations from point
mutations to chromosomal anomalies leading to the disruption of the integrity of
an organism’s genetic material. The causes of genomic instability also vary from
9
replication errors, loss of repair mechanisms, improper chromosome segregation
and cell cycle checkpoint errors. It is now known that genomic instability is a
major contributor of diseases including cancer (Amatruda et al. 2002; Beckman
and Loeb 2005).
The ability to perform genetic screens in zebrafish using the mosaic eye
assay developed by Streisinger allows for the detection of mutant genes that lead
to increased frequencies of somatic mutations and a cancer predisposition.
Zebrafish genomic instability (gin) mutations can be induced by exposure to the
point mutagen ethyl-nitro-urea (ENU) and quickly detected by the mosaic eye
assay, which uses the golden locus on chromosome 18 to measure the somatic
loss of gene function (Moore et al. 2006). Normally at 48-hpf, wildtype and
golden heterozygous zebrafish embryos exhibit black pigmentation in the retinal-
pigmented epithelium (RPE) of the eye and the melanophores (Figure 1.2).
Embryos that are homozygous for the golden gene have a much lighter golden-
brown pigmentation; these variations can be easily distinguished under a
dissecting microscope. In order to detect the somatic mutation or gin phenotype,
golden heterozygous embryos are screened for patches of lightly pigmented RPE
cells; these patches indicate the loss-of-function of the wildtype allele in the cells
and therefore verify the mosaic.
10
Figure 1.2: Eye pigmentation in the zebrafish embryo. Three different 72-hpf zebrafish embryos
are shown above. (A) The embryo at the top of the photo with the gin/gin; gol/+ genotype
displays the classic multiple patch mosaic eye phenotype, due to the loss of function of the
wildtype golden allele in the lighter patches of cells. (B) The gol/gol (golden homozygous)
embryo (lower left) has the characteristic light golden-brown eye color known to this pigment
mutant. (C) A dark black color is visible in the +/+ (wildtype) or gol/+ (golden heterozygous)
embryo in the lower right portion of the photo. Photo adapted from Moore et al. 2006.
Twelve gin mutant lines were generated by ENU mutagenesis followed by
half-tetrad mapping that involved producing gynogenetic embryos from a cross
by activating eggs with irradiated sperm and applying pressure to inhibit the
second meiotic division (Moore et al. 2006). The goal of this mutant screen was
to identify new genes that may be important in maintaining genomic stability.
The mutants show a strong linkage to a centromeric marker on the same
chromosome independent of its map position. Genetic experiments with the gin
mutants indicated that they exhibited both maternal and zygotic gene expression
in the developing zebrafish embryo (Moore et al. 2006). These zebrafish
experiments proved to be the first direct genetic screen in a vertebrate for
11
somatic mutations based on a locus-specific assay (Moore, Gestl and Cheng
2004; Moore et al. 2006).
Consistent with the role of these genes in genomic instability, tumors
spontaneously arose in adult carriers of the 12 gin mutations. However, carriers
of the gin-10 mutation showed a strong phenotype and became the focus of a
survey to determine the frequency and variety of cancer in these fish. Although
all of the gin carriers displayed a predisposition to malignant peripheral nerve
sheath tumors, gin-10 carriers also had approximately a 10-fold increase in the
incidence in tumor formation when compared to wild type fish, and often had an
earlier appearance of tumors as well. PCR-based LOH analysis was performed
for several tumor samples, many were from gin-10 fish, and the loss of a parental
allele for a marker within the gin-10 region had been lost from the tumor tissue
itself, while it was still apparent in the normal tissue samples from the same fish.
Additional analysis on the gin-10 region in zebrafish tumors suggested that
recombination or a regional deletion was the cause of LOH (Moore et al. 2006).
Potential Candidate Genes for gin-10 Mutations
As a first step in identifying the gin-mutant genes, chromosome
assignments were made for the 12 gin mutants based on preliminary mapping
experiments. Most of the gin-mutants were confirmed using adjacent markers.
Three of the mutants, gin-5, -9, and -10 were all mapped to chromosome 18
where the golden locus is also found.
12
The gin-10 mutant on chromosome 18 was mapped between bases
14,738,066 and 15,810,769 (Figure 1.3). Using this mapping data and the recent
Sanger database information, a list of potential gin-10 candidate genes was
made. An overview of this region is shown in Figure 1.3. Several of these gin-10
candidates were explored as part of this dissertation project and are the focus of
Chapter Two. Although the focus for the gin-10 candidates was specifically on
mapk12, rfx4, sir2, and synbl, several other genes within the region were also
cloned and analyzed by RT-PCR. The rationale for the role of these genes in
genomic instability is discussed below.
Figure 1.3: Overview of the zebrafish chromosome 18 region were gin-10 was initially mapped in
previous studies. Although there are several additional genes within this region (based on the
Ensemble zv8 database), this diagram shows the key genes (bold) identified with potential for
genomic instability activity.
Mapk12: The evolutionary conserved mitogen activated protein kinase
(MapK) family is involved in diverse cellular processes including growth,
proliferation, differentiation, survival, inflammatory response and development.
Using sequential phosphorylation events, MapKs can transmit signals from the
cells’ environment to the nucleus and elicit an appropriate cellular response.
These phosphorylation events occur on conserved domain (Thr-XXX-Tyr), which
13
leads to the activation and localization of the protein. There are three major
subclasses of the MapK family: the extracellular signal related kinases (ERK), c-
jun amino-terminal kinases (JNK), and the p38 MapKs. The middle amino acid
residue of the dual-phosphorylation domain determines these subclasses;
generally ERKs have a TEY motif, JNKs have a TPY motif and the p38 MapKs
have a TGY motif (Krens et al. 2006).
Figure 1.4: Schematic of the MapK family pathways showing initiating factors and the cascade
of downstream targets (Adapted from Krens et al. 2006).
Several members of the MAPK family have been studied intensely
because of their association with a number of diseases such as cancers,
autoimmune diseases, and developmental abnormalities. For example, the Ras-
MAPK (Erk1/2) pathway has been observed as one of the most oncogenic
pathways in a variety of cancers, leading to uncontrollable cell proliferation by
activating c-myc, c-jun, elk-1, and other transcription factors that promote DNA
synthesis and cell growth. For this reason, ERK pathways are often targets for
anti-cancer therapeutics and research (Tang et al. 2005).
14
This family has also been shown to be important during vertebrate
development by regulating mesoderm induction and neuronal differentiation.
Examples of this have been documented in the human prostatic PC12 cell line
where a transient activation of the ERK pathway by EGF leads to proliferation
whereas a sustained activation of this pathway in response to nerve growth
factor causes differentiation (Krens et al. 2006). Activation by T- or B-cell
receptors can also cause cell differentiation into platelet precursors.
p38γ (Mapk12) protein has been shown to be highly expressed in several
human malignant cell lines, which may indicate a potential role in tumorigenesis
(Tang et al. 2005). Several studies have revealed that the ERK/MAPK pathway
activation is sufficient in transforming NIH 3T3 cells; furthermore Ras
transformation is also dependant on the JNK pathway (Tang et al. 2005).
Activation of p38 MAPKs is thought to inhibit Ras-induced cell proliferation in NIH
3T3 cells, suppress Ras transformation and induce K-Ras-dependent cell death
in human colon cancers (Tang et al. 2005). Recent studies based on the p38
family of MAPKs have shown that K-Ras is an activator of p38γ; it has the ability
to increase the expression of p38γ without phosphorylation. Consequently, this
study also provided evidence that increased expression of p38γ was a
requirement for K-Ras transformation by a new mechanism involving a complex
with other ERK proteins (Tang et al. 2005).
15
Figure 1.5: The proposed model showing the requirement of p38γ for K-Ras transformation and
the inhibitory response from p38α (Adapted from Tang et al 2005).
Additionally, JNK and p38 MAPKs have been shown to modulate cellular
responses to a variety of extracellular signals such as mitogens, inflammatory
cytokines and UV irradiation; often these MAPKs are involved in promoting
programmed cell death when activated (Krens et al. 2006). Interestingly, UV
irradiation specifically activates the p38 MAPK pathway in many organisms,
although it appears that each isoform is independent or has distinct biological
roles (Wang et al. 2000; Krens et al. 2006). Studies have shown that all p38
isoforms can activate the transcription factor-activating factor 2 (ATF2) in vitro,
and are involved in cell cycle arrest at particular cell cycle checkpoints. Wang et
al. (2000) demonstrated that MKK6 and all p38 isoforms are activated by γ
irradiation. Activation of this pathway is ATM-dependent and sufficient to arrest
cells in G2 following irradiation; additionally, the inhibition of MKK6 and or
specifically p38γ disrupts this checkpoint (Wang et al. 2000).
16
Figure 1.6: The MKK6-p38γ pathway is involved in the G2-M DNA damage checkpoint (Adapted
from Wang et al. 2000).
The mapk12 gene was initially found by screening human cDNA using a
rat erk-3 gene. Interestingly, mapk12 was isolated from a human skeletal muscle
cDNA library and was later confirmed to be identical to sapk3. From that finding
it appeared that mapk12 functioned in the differentiation of myoblasts. In
Xenopus, MAPK12 or p38γ has been shown to phosphorylate Cdc25C and is
important for G2/M progression of oocytes (Perdiguero et al. 2003). Additionally,
data from Wang et al. (2000) supports the model of an important interplay
between p38γ and the G2 cell cycle checkpoint control.
Rfx4: Regulatory factor X (RFX) proteins are evolutionarily conserved
transcription factors among S. cerevisiae, S. pombe, C. elegans, zebrafish,
mouse and humans, that possess a winged helix DNA binding motif (Morotomi-
17
Yano et al. 2002). These proteins appear to function in a variety of unrelated
systems including regulation of mitotic cell cycle in yeast, mammalian immune
response, brain development and brain-specific diseases and testes
development in mammals (Emery et al. 1996; Mach et al. 1996; Morotomi-Yano
et al. 2002; Zhang, Zeldin and Blackshear 2007).
RFX1, RFX2, and RFX3 were first identified in human and mouse and
classified as a family based on the 76-amino acid DNA-binding domain; RFX4
was found later fused to the estrogen receptor in two aberrant cDNA clones from
human breast tumor tissue while other RFX proteins have just been recently
identified (Emery et al. 1996; Matsushita et al. 2005). Several alternative splice
variants of RFX4 have been reported in the testis and brain and may function
during both morphogenesis and disease formation (Blackshear et al. 2003;
Matsushita et al. 2005). More recently, Matsushita et al. (2005) have shown that
there are several human isoforms of RFX4 and they are often overexpressed in
gliomas but are not detectable in other cancers including liver, colon and
stomach. The function of rfx4 in zebrafish development and disease has yet to
be explored.
Rpc2/Polr3b: RNA polymerase III (Pol III) is a 17-subunit complex that is
responsible for the transcription of various small non-coding and nuclear RNAs in
eukaryotes (Yee et al. 2007). One of the largest subunits, Rpc2, is highly
homologous to its Pol I and Pol II counterparts, and the gene happens to lie
within the gin-10 region in zebrafish. Previous studies analyzing the structure of
18
Pol III as well as yeast two-hybrid and biochemical investigations have identified
its unique functions including high processivity, efficient transcription termination
and recycling, RNA 3’ cleavage activity, and interaction with diverse promoters to
specific individual subunits (Yee et al. 2007). Additionally, mutational analysis in
yeast have shown that intact Pol III is essential for cell growth; reduced Pol III
function are broad including disruption of protein synthesis, incomplete ribosome
biogenesis, mRNA splicing defects and defects in membrane targeting for newly
translated proteins. Studies in human cell lines have also implicated the roles of
known oncogenes and tumor suppressors, including c-myc and Rb, in controlling
the interactions of transcription factors that bring the Pol III complex to the
promoters of its target genes (White 2005; Yee et al. 2007). Deregulated Pol III
activity has been shown to be a common feature of tumorigenic cells in culture;
however, there is little evidence that it is elevated Pol III activity. Determining the
role of rpc2 in zebrafish tumors will increase the understanding of human cancer.
Sir2: Sirtuins (sir2) are NAD-dependent deacetylases that are found in a
variety of organisms from bacteria to humans. They were originally found in
yeast and have been shown to act in transcriptional repression, recombination,
cellular division, microtubule organization, cellular responses to DNA damage
and aging (Buck, Gallo and Smith 2004; North and Verdin 2004). The sirtuin
family has a unique catalytic domain characterized by its requirement for NAD as
a cofactor (Blander and Guarente 2004; North and Verdin 2004). One of the
main functions of this protein family is the regulation of transcriptional repression
19
through binding a multiprotein complex. Sequence-specific DNA binding proteins
mediate the initial recruitment of sirtuin protein complexes to telomeres and other
loci for transcriptional repression (North and Verdin 2004).
There are several types of sirtuins found in yeast, mammals, and
zebrafish. Sirt1 has been implicated in the repair of DNA damage by negatively
regulating the p53 pathway; it has been shown to deacetylate p53, which is
initially acetylated at two lysine residues in response to DNA damage in order to
activate it (Sakaguchi et al. 1998; North and Verdin 2004). The human Sirt2
protein has been shown to localize in the cytoplasm and is involved in the
regulation of the microtubule network by deacetylating lysines of α-tubulin.
Recent studies have also shown that Sirt2 is upregulated prior to mitosis and is
potentially involved in cell-cycle regulation (Blander and Guarente 2004; North
and Verdin 2004). Additionally, recent proteomics research has provided a role
for Sirt2 in cancer pathogenesis since the gene is located in a region of frequent
chromosomal deletions in human gliomas, indicating that Sirt2 may act as a
tumor suppressor (North and Verdin 2004). Mammalian Sirt3 has been shown to
localize in the mitochondrial matrix mediated by an amphipathic α-helix at its
amino terminus (Buck, Gallo and Smith 2004; North and Verdin 2004). Several
studies have shown that in vitro, Sirt3 has robust histone deacetylation activity;
since it appears to be localized in the mitochondria, the relevance of its HDAC
activity is still not understood (North and Verdin 2004). Recent research has also
shown that sirtuins may play a considerable role in the genetic control of aging
and related diseases. Additionally, the mammalian Sirt4, Sirt5, Sirt6 and Sirt7
20
also display some histone deacetylation properties; however, that research is still
underway.
Synbl & Ric8a: Asymmetric cell division plays an important role during
embryogenesis by producing daughter cells with distinct differentiation pathways
(Cowenbergs, Spilker and Gotta 2004). Members of the RIC-8 or synembryn
family proteins are known to be key regulators of asymmetric cell division in
invertebrate and vertebrate embryogenesis. Appropriate centrosome positioning
and movement determines the alignment of the mitotic spindle and is an
essential feature of development since it determines the cleavage plane during
cytokinesis (Miller and Rand 2000; Miller et al. 2000). Many studies have been
modeled in C. elegans showing the importance of accurate spindle orientations
for an asymmetric first cell division. The movement and positioning of
centrosomes also mediates nuclear migration in a variety of cells and organisms
(Miller et al. 2000). The machinery that regulates these movements during
development are still not fully understood; however recent studies in C. elegans
and Drosophila are beginning to identify the mechanisms involved.
The ric-8 gene was first identified in a screen of C. elegans mutants that
were resistant to inhibitors of cholinesterase and defective in vesicle priming
(Miller et al. 2000; Miller and Rand 2000; Cowenbergs, Spilker and Gotta 2004).
Subsequently ric-8 has been identified as a required cytoplasmic protein for G-
protein signaling in the C. elegans nervous system and more recently as an
important part of the machinery that regulates the mitotic spindle, nuclear
21
migration and other centrosome-mediated events during early embryogenesis
(Miller et al. 2000; Miller 2000). RIC-8 proteins are G-protein positive regulators,
which exhibit G-protein coupled receptor-independent guanine nucleotide
exchange activity for Gα subunits. These proteins act downstream of
partitioning-defective (PAR) proteins, which contributes to spindle and
centrosome anchoring events (Wilkie and Kinch 2005).
Figure 1.7: Schematic of the Ric8 mediated asymmetric cell division in C. elegans zygotes
(Adapted from Wilkie & Kinch 2005).
Other studies in C. elegans, Drosophila and in mammals have also shown
that Ric-8 proteins are required for signaling during synaptic transmission and
thus seem to also be involved in receptor-dependent signaling (Hampoelz et al.
2005). Ric-8 mutants have been created in C. elegans, Drosophila, and in
zebrafish; all homozygous ric-8 mutants are lethal but studies have shown in all
three models that they can be rescued by injection of a transgene that covers the
ric-8 genomic locus (Hampoelz et al. 2005). In addition to the role in
22
development, dysregulation of asymmetric cell division has recently been shown
to play an important role in cancer.
In Xenopus, mouse and other mammals, there are two ric-8 homologs: ric-
8A (synembryn-a) and ric-8B (synembryn-b), while there is only one ric8 gene in
C. elegans that gives rise to two proteins by alternative splicing. The zebrafish
synembryn-like gene (synbl) is a ric-8b homolog and is located on chromosome
18 within the interval thought to contain the gene responsible for the ENU-
induced gin-10 genomic instability mutation. The zebrafish ric-8a gene is located
on chromosome 25 and appears to have at least three protein-coding transcripts.
The role of these different ric-8 transcripts during zebrafish development is not
clear.
Mdm1 as a gin-12 Candidate Gene
Similar to gin-10, the ENU-induced genomic instability mutation, gin-12,
has been shown to cause embryonic somatic mutations in golden heterozygous
zebrafish; this mutant was mapped to an interval on chromosome 4 in zebrafish
in previous studies (Cheng and Moore 1997; Moore, Gestle and Cheng 2004;
Moore et al. 2006). Several genes within the gin-12 region may potentially
display genomic instability activity including mdm1, which was originally cloned
from 3T3DM cells along with mdm2 and mdm3.
The well-studied Mdm2 protein has been shown to cause acentric
chromatin bodies or double minutes (DMs) and mediate the immortalization and
transformation of rat embryo fibroblasts when overexpressed in cooperation with
23
Ras (Freedman, Wu and Levine 1999). Additionally, Mdm2 has been shown to
negatively regulate the p53 tumor suppressor and is classified as an oncogene.
Since mdm1 was originally identified on DMs with mdm2, it is possible that it also
functions as an oncogene in the p53 pathway, giving rise to genomic instability
(Snyder et al. 1988).
Figure 1.8: Diagram of the autoregulation of p53, Mdm2 and Mdm4 following DNA damage
and/or mitogenic signals in the cell.
Unlike Mdm2, the structure and functional domains of the Mdm1 protein
have yet to be studied. Using the ExPasy Proteomics server (www.expasy.org),
phosphorylation, glycosylation, and myristoylation sites were predicted the known
zebrafish Mdm1 peptides (Figure 1.9, Appendix C). Interestingly, two potential
sumoylation (SUMO) sites were also predicted, which may play and important
role in the cellular localization and stability of the Mdm1 protein. While it does
not appear that Mdm1 shares the same functional domains as the Mdm2 protein
24
based on the bioinformatics predictions, it remains an interesting candidate for
the gin studies.
Figure 1.9: Predicted functional sites of the zebrafish Mdm1-001 (long) peptide. The ExPasy
Bioinformatics resource portal predicted several Protein Kinase C (PKC) phosphorylation sites,
Casein Kinase II (CK2) phosphorylation sites, five N-myristoylation (MYR) sites, two cAMP/cGMP
dependent protein kinase (cAMP) phosphorylation sites, one Tyrosine Kinase (TYR)
phosphorylation site, and one N-glycosylation site. Additionally, two SUMO sites were predicted
in the Mdm1 peptide sequence, along with a potential Nuclear Localization Signal (NLS) and a
52- amino acid serine-rich region. A larger version of this image can be found in Appendix C.
Not much is known about mdm1 in human, mouse, or zebrafish; however
there have been studies suggesting that it is involved in retinal degenerative
diseases including arrd2 in mouse (Chang et al. 2008). A nonsense mutation in
the mdm1 gene appears to cause a late-onset RPE atrophy and
hypopigmentation, similar to human AMD, in the affected mice; the complete
absence of mdm1 in mice leads to severe retinal degeneration. Further
25
investigation of the mdm1 gene in zebrafish as a model to knockdown and
overexpress this gene will allow for a better understanding of its function during
development and whether it has any genomic instability activity.
Summary and Specific Aims
Several zebrafish mutations have been found that display increased
frequencies of somatic mutations during embryonic development and cause an
increase in tumor formation during adulthood. These genomic instability mutants
(gin) are heritable, ENU-induced mutations that have been shown previously to
act both maternally and zygotically in the zebrafish embryo (Moore et al. 2006).
The focus of this dissertation project was to study candidate genes for the gin-10
and gin-12 genomic instability mutations.
There are three Specific Aims for this project.
1. Explore and study potential gin-10 candidate genes and determine
whether these candidates have the potential for genomic instability
activity by knocking each down in golden heterozygous embryos.
2. Distinguish the differences in gene expression and developmental
function of the paralogs synbl and ric8a, both of which have been
shown to regulate asymmetric cell division in the development of C.
elegans.
3. Characterize the gin-12 candidate gene mdm1 in early zebrafish
development using transcript expression analysis and morpholino
26
knockdown technology, as well as analyzing potential protein-protein
interactions.
Chapter Two focuses on gin-10 candidate genes and Specific Aims 1 & 2.
The goal of Specific Aim 1 is to explore the potential candidate genes within the
gin-10 region on chromosome 18 in zebrafish embryos and determine which of
the candidate genes may contribute to genomic instability during development.
The initial prediction was that only 1-2 genes within the gin-10 region would
model genomic instability activity and lead to future research in the
characterization of its function during development and cancer. Specific Aim 2 is
based on a candidate gene found within the gin-10 region, synembryn-like
(synbl), which has been shown to regulate asymmetric cell division in C. elegans.
A homolog was found on chromosome 25, ric8a, which recent studies have
shown that it is often abnormally regulated in certain cancer types. The purpose
of this aim is to characterize the functions of these two homologs in zebrafish by
exploring developmental expression patterns and through the use of transgenic
zebrafish models.
Chapters Three and Four explore Specific Aim 3, which is a study of the
gin-12 candidate gene mdm1. It was initially thought that the mdm1 gene might
play a role in the p53 tumor suppressor pathway by either regulating p53 directly
or as part of an overall regulatory component. Based on the amino acid
sequence of Mdm1 and it’s homology to Mdm2 and Mdm4 (known p53
regulators), it appeared that Mdm1 did not contain the p53 binding sequences
and most likely did not directly bind to the p53 protein. Thus, studies were
27
designed to determine whether mdm1 functioned in the p53 pathway or
displayed genomic instability activity in the zebrafish embryo.
28
CHAPTER TWO
AN INVESTIGATION OF THE ZEBRAFISH GIN-10 CANDIDATE GENES
Rationale and Experimental Design
An ethyl-nitrosurea (ENU) mutagenesis experiment led to the discovery of
twelve genomic instability (gin) mutants with the phenotype of increased
frequencies of embryonic somatic mutations (Moore et al. 2006). The gin-10
mutant line showed noticeably increased frequencies of tumor development and
somatic loss of heterozygosity (LOH) based on PCR assays; thus the goal of
these studies was to identify the gene or genes involved in the gin-10 line. In
previous studies, half-tetrad analysis and SSR markers were used to
approximate the gin-10 region on the zebrafish chromosome 18 (Moore et al.
2006).
Table 2.1: Potential gin-10 Candidate Genes on chromosome 18
Sanger Gene
Gene Information
si:dkey103i16.1
PTPRF interacting protein (liprin beta 1)
cry1b
cryptochrome 1b
rpc2/polr3b
RNA pol III subunit B
rfx4
regulatory factor X, 4
synbl
synembryn-like; resistance to inhibitors of cholinesterase B
si:dkey103i16.6
sir2 homolog
btbd11b
btb (POZ) domain containing 11b
mapk12 (ERK6 or p38γ)
mitogen-activated protein kinase 12a
cirh1a
cirrhosis, autosomal recessive 1a (cirhin)
rpb5
RNA pol II subunit 5
29
Since ENU causes point mutations that can be difficult to map, a
candidate gene approach was used to identify the potential gin-10 mutant genes.
Initially, a list of genes within the gin-10 region was created based on the SSR
mapping data, most current Sanger Ensemble database (www.ensemble.org)
and evaluated based on potential for genomic instability activity using the known
orthology information from NCBI and Sanger databases. The 10 candidate
genes identified are presented in Table 2.1
Since previous genetic studies suggested that the gin carrying mutants
must be expressed both maternally and zygotically during development, the first
step was to determine the candidate gene expression profiles during various
stages of development by RT-PCR. The synbl, mapk12, cry1b, rfx4, and sir2
candidate genes were fully cloned as cDNA from the wildtype (WT(AB)) strain of
zebrafish for future sequence comparison to gin-10 fish. Additionally, expression
profiles of the synbl, rfx4, and sir2 were explored using semi-quantitative RT-
PCR and whole mount in situ hybridization in zebrafish embryos of various ages.
To formally investigate the contribution to genomic instability of synbl, ric8a, rfx4,
and sir2, the genes were knocked down in zebrafish embryos using morpholino
oligonucleotides (MOs) in both WT(AB) and golden heterozygous fish. The use
of MOs in the zebrafish embryo provides information about the biological function
of synbl, ric8a, rfx4, and sir2. Lastly, synbl heterozygous transgenic zebrafish
were obtained from the Zebrafish International Resource Center (ZIRC), in order
to further explore the function of this candidate and the paralog, ric8a, in a
background other than WT(AB).
30
Cloning and Sequencing Candidate Gene Fragments from WT(AB)
Embryos
The initial phase in these studies was to determine whether the candidate
genes were expressed both maternally and zygotically in WT(AB) embryos. To
do this, zebrafish embryos were collected at various stages of development and
euthanized in order to isolate total RNA. Several pairs of primers were made to
amplify cDNA from each candidate gene (Table 2.1). The primers were designed
specifically to amplify a region of the transcript that spans more than one exon in
the genomic DNA; this allowed for the successful amplification from the RNA
without any trace of genomic DNA contamination.
Candidate gene fragments were amplified using 4-hpf and 24-hpf embryo
RNA and ligated into the pCR4 vector (Invitrogen) for sequencing. The pCR4
vector was used primarily because it allowed for a greater percentage of positive
clones since it contains the TA cloning feature and has a fast ligation time.
Additionally the sequencing promoters are much closer to the PCR insert,
allowing for better sequencing results (Figure 2.1).
Creating a Bank of cDNA Clones from WT(AB) Stocks: It had been
suggested that cDNA libraries of wild type zebrafish genes be created for this
project to provide a stable and consistent source of cDNA. Therefore, this
project began by preparing cDNA stocks from 24-, 48-, 72-hpf, and 7-dpf WT(AB)
embryos using two different commercial kits: Invitrogen’s Superscript III First
Strand Synthesis kit and New England BioLab’s Protoscript II kit. Unfortunately,
31
several of the candidate genes showed poor amplification from the cDNA stocks
or had numerous, non-specific amplification on the gel photos (Figure 2.2).
These results were seen using both cDNA kits with multiple primer sets for
several candidate genes; however a preliminary direct RT-PCR experiment gave
robust clean amplification of specific candidate gene fragments of interest (Figure
2.3 and Appendix 1). Thus, RT-PCR became the method of choice for cloning
the gin-10 candidate genes.
Figure 2.1: pCR4-TOPO cloning vector (Invitrogen) used to clone fragments of candidate gin-10
genes for sequencing and later probe making for other experiments.
RT-PCR and Cloning: WT(AB) embryos were collected from breeding
tanks and brought over to the lab in system water, transferred to a glass dish and
sorted into petri dishes in groups of 100 embryos or less. Embryos were allowed
to develop under normal conditions in a 27oC incubator until the desired
developmental age was reached, when they were collected into microfuge tubes
in groups of 50 and total RNA was isolated using the Trizol method (Invitrogen).
RT-PCR reactions for each candidate gene were performed several times for
each primer pair initially to determine whether the gene was expressed both
32
maternally (4-hpf RNA) and zygotically (after 8-hpf). All reactions were run on
the appropriate concentration agarose gel and photographed.
Figure 2.2: PCR performed using the Invitrogen Superscript III First Strand Synthesis kit and
several sets of synbl and rfx4 primer sets. (A) Most of the primer sets shown here amplified
multiple fragments when using the cDNA stocks, except for synbl F2R1. These same primer sets
amplified single, robust bands with direct RT-PCR. Additionally, synbl F4R2 did not amplify with
this method. (B) Primers for the rfx4 gene were also used to amplify fragments from cDNA, and
gave rise to multiple fragments appearing on the gel. Actin is shown as a positive control in both
gel photos.
Figure 2.3: RT-PCR results of several gin-10 candidate genes at 48- and 72-hpf.
33
Candidate gene fragments were amplified from WT(AB) RNA at various
ages to determine if the genes were expressed both maternally and zygotically in
the embryos. Figure 2.3 demonstrates the zygotic expression of several
candidate genes, cry1b, ps20, btbd11, rfx4, rpb5, and mapk12; this is a
representative experiment with complete RT-PCR data for all of the gin-10
candidates shown in Table 2.2. The initial objective was to narrow down the gin-
10 candidate list by removing genes that were not expressed both maternally and
zygotically. However, it appears that all of the candidates screened had both
maternal and zygotic expression. Before pursuing these candidate genes
further, it was important to search Sanger and NCBI databases for information
regarding the function and orthology of the current list of zebrafish gin-10
candidate genes. By doing so, several of the genes were immediately removed
from the list based on orthologous information in human and mouse studies. For
example, although cry1b is close to one of the gin-10 markers on chromosome
18 in zebrafish, database, and publication searches revealed that it is involved in
circadian rhythms with CLOCK genes and has been regularly studied without
inference to genomic instability activity. Other genes that were removed from the
candidate list included cirh1a, rpb5, and ps20. Full developmental expression
profiles were obtained for the rest of the candidate genes, including rpc2/polr3b,
which was also eventually removed from the candidate list since recent
publications determined that it functioned mainly in the development of the
digestive system and also did not appear to have genomic instability activity (Yee
34
et al 2007). Table 2.2 shows complete results for RT-PCR data, based upon
individual experiments that can be found in Appendix A.
Table 2.2: Summary of RT-PCR Maternal and Zygotic Expression Results from the gin-10
Candidate Genes on Chromosome 18 in Zebrafish.
Gene/Fragment
4-hpf
8-
hpf
12-
hpf
18-
hpf
24-
hpf
36-
hpf
48-
hpf
72-
hpf
btbd11
F1R1
+
+
+
F2R2
+
+
+
+
cirh1a
F1R1
+
+
+
+
F2R2
+
+
+
+
cry1b
F1R1
+
+
+
+
F2R2
+
+
F3R3
+
+
mapk12
F1R1
+
+
+
+
F2R2
+
+
ps20
F1R1
(long)
+
+
+
+
F3R3
(short)
+
+
+
rfx4
F1R10
+
+
+
+
F5R9
+
+
+
F5R13
+
+
+
F6R9
+
+
+
F5R5
+
F7R6
+
F1R1
F4R4
rpb5
F1R1
+
+
+
+
F2R2
+
+
rpc2
F1R5
+
+
+
+
+
+
+
+
F3R1
+
F4R6
+
F5R7
+
F3R2
+
+
F2R3
+
+
+
+
+
+
sir2
F1R1
+
+
+
+
F2R2
+
+
+
+
F3R3
+
+
+
+
synbl
F1R1
+
+
+
+
F6R3
+
+
F3R2
+
+
+
+
F1R5
(genomic
5'UTR)
+
F2R1
+
+
+
+
+
+
+
+
F3R4
+
+
F4R2
+
F4R4
+
+
F1R3
+
35
Due to the apparent involvement in asymmetric cell division during
development of C. elegans, the focus of the gin-10 candidates shifted towards
the synbl gene and its homolog ric8a on chromosome 25. The goal was to
continue investigating the candidates that remained on the list including sir2 and
rfx4, but to concentrate particularly on the function of synbl and ric8a since
asymmetric cell division is a known characteristic of many cancer types (Aguilera
and Gomez-Gonzalez 2008).
Figure 2.4: Developmental profile of embryonic gene expression of synbl, ric8a and actin in
WT(AB) zebrafish.
A developmental RT-PCR profile was performed using WT(AB) RNA and
primers for synbl and ric8a; actin is shown as a positive control. As seen in
Figure 2.4, both synbl and ric8a appear to be expressed throughout zebrafish
embryonic development through larval stage day 7. From this data, it appears
that maternal expression of synbl is slightly more robust than its homolog, ric8a.
36
Noticeably, synbl expression decreases from Mid-Blastula Transition (MBT)
through 12-hpf, then remains robust and constant through 7-dpf. Expression of
ric8a appears relatively low in comparison through approximately 18-hpf, then
increases slightly at 24-hpf and remains constant through 7-dpf. It is important to
note that although actin was used as a positive control, its expression does vary
slightly during development.
Normal Expression of Candidates in Developing Zebrafish Embryos
Semi-Quantitative RT-PCR: In order to further explore the developmental
profiles of the gin-10 candidate genes, a more quantitative approach was
pursued. All of the candidates initially tested by RT-PCR showed consistent
levels of both maternal and zygotic gene expression (Table 2.2, Figure 2.4).
Rather than using qPCR, which is very expensive and unavailable in the
laboratory, it was suggested that the expression of candidate gene transcripts
was assessed by the semi-quantitative RT-PCR technique (Marone et al. 2001;
Livingston personal communication). This method uses a low-cycle RT-PCR in
combination with a partial Southern blotting procedure, allowing for better
visualization of the quantity of a transcript than standard PCR (Marone et al.
2001). For these experiments, DIG-labeled DNA probes for the candidate genes
were used on developmental blots and detected with CSPD substrate (Roche).
37
Figure 2.5: Semi-quantitative RT-PCR Developmental Profile of several gin-10 candidate genes,
synbl, rfx4 and sir2. ric8a is not a gin-10 candidate; however it is a paralog of synbl making it an
important gene to study and determine what expression and functional differences occur between
the two.
Previous examination of the gene expression of these particular gin-10
candidates resulted in all of the candidates displaying both maternal and zygotic
gene expression (Figure 2.4). In contrast, Figure 2.5 shows a very distinct
difference in the gene expression patterns of synbl, ric8a, rfx4, and sir2.
Particularly, there appears to be an apparent differential expression pattern
between paralogs synbl and ric8a. As demonstrated earlier, synbl has a strong
maternal expression that decreases around MBT, then steadily increases
through 24-hpf. This data suggests that synbl expression is slightly decreased at
48-hpf, peaks at 72-hpf then continues to decrease through larval stage (day 7).
Interestingly, ric8a displays very low expression through 18-hpf, where it begins
to increase until its expression peaks at 72-hpf, then decreases by 7-dpf. Since
these results initially appeared very different from the original RT-PCR
experiments, the semi-quantitative experiments were repeated several times for
38
verification. By using a more sensitive application of RT-PCR, a variation in gene
expression between these homologs was finally identified.
Similarly, rfx4 and sir2 exhibited robust bands when amplified by the
standard 35-cycle RT-PCR experiments at various ages. The semi-quantitative
data suggests that rfx4 has very little maternal expression while the zygotic
expression peaks by 12-hpf and remains at a constant level through 48-hpf. By
7-dpf, expression of rfx4 in WT(AB) is completely absent. Maternal expression of
sir2 appears to be very robust in comparison with original RT-PCR and some of
the other candidate genes, and then gradually decreases at MBT. From 12- to
24-hpf, there is a gradual increase in the expression level of the sir2 transcript;
by 48-hpf the transcript level appears to decrease again until it is hardly
detectable from 72-hpf through 7-dpf.
Whole-mount in situ Hybridization: This technique was used to investigate
the temporal and spatial expression of specific candidate gene transcripts at
various ages during development. WT(AB) embryos treated with 1-phenyl-2-
thiourea (PTU) to stop pigment formation and golden embryos were utilized for
these experiments. Several DIG-labeled RNA probes were made from the
candidate clone library using the Ambion MaxiScriptT3/T7 kit.
It is important to note that many ages of zebrafish embryos were used for
the in situ hybridization experiments. Due to the complexity of this procedure,
many of the embryos disintegrated during the various washing steps (See
39
Chapter Six for detailed methods). The results shown here are representative
examples of the data gathered.
Figure 2.6: Whole-mount in situ hybridization of a 48-hpf WT(AB) zebrafish embryo using an
DIG-labeled actin RNA probe. Both sense and antisense probes were made for each gene
tested; actin was used as a positive control since it results in the staining of the entire embryo
when using the antisense RNA probe. Other controls (not shown here) were (1) batches of
embryos that were not subject to an RNA probe but were blocked and stained, and (2) embryos
that were not subject to an RNA probe or Anti-DIG antibody but were stained. Controls were
used to verify that non-specific staining by BM Purple (Roche) would not occur in the
experimental embryos.
Figure 2.7: Whole-mount in situ hybridization of WT(AB) embryos using a DIG-labeled synbl
RNA probe (A) 8-hpf (B) 12-hpf (C) 24-hpf (D) 48-hpf (E) 72-hpf. It is important to note that
embryos were treated with PTU to prevent the development of pigment after 24-hpf.
40
Figure 2.8: Whole-mount in situ hybridization of WT(AB) embryos using a DIG-labeled ric8a RNA
probe (A) 8-hpf (B) 12-hpf (C) 24-hpf (D) 48-hpf (E) 72-hpf. It is important to note that embryos
were treated with PTU to prevent the development of pigment after 24-hpf.
The expression pattern of synbl in developing zebrafish embryos is shown
in Figure 2.7. These results suggest that the synbl gene is ubiquitously
expressed in the early embryo through approximately 24-hpf, then expression
becomes restricted to the brain as seen in the 48- and 72-hpf embryos. Figure
2.8 shows the in situ results for ric8a in WT(AB) embryos. Although there
appears to be some staining in 8- and 12-hpf embryos, the staining is muted and
not robust, and may be contributed to background staining. The deep purple
stain is apparent in the 24-hpf embryo, and like the synbl homolog, appears to be
ubiquitous at this time point, with some more concentrated staining in the
hindbrain and cerebellum. Likewise, between 48- and 72-hpf, staining for ric8a
appears to become restricted to the brain.
41
Based on teleost evolution, it was anticipated that the ric8 homologs, synbl
and ric8a, would diverge in their expression and function as a result of gene
duplication events. Thus, the differential expression patterns during zebrafish
development were expected. The data suggests that the temporal expression of
synbl and ric8a are significantly different, as it appears that ric8a is transcribed
well after MBT. Interestingly, both genes appear to be initially expressed
ubiquitously throughout the embryo, and then becoming restricted to the brain
based on in situ data. It is possible that both genes function cooperatively during
development within the central nervous system (CNS). In order to further the
understanding of these two homologs, it became necessary to identify specific
gene function during early development by knocking down each gene with
Morpholino Oligonucleotides (MOs).
Consequently, rfx4 and sir2 were still priority candidates on the gin-10 list.
The functions of these two genes in zebrafish development were still unknown.
Therefore it was important to investigate these genes further using MOs into a
WT(AB) background for functional analysis and golden heterozygotes for
genomic instability analysis.
Testing Candidate Genes for Genomic Instability
In the mosaic eye assay used to identify gin mutations, mosaicism at the
golden locus was seen in gin/gin homozygotes (Streisinger 1984; Moore et al.
2006). Candidate genes were therefore knocked down in golden heterozygous
embryos to determine if they would also cause mosaic eye pigmentation. The
42
preferred method of gene knockdown in zebrafish embryos is to inject the
antisense oligonucleotides known as morpholinos (MOs). MOs have become the
standard gene knockdown tool in embryonic animal systems. MOs are not
degraded by nucleases in animals, serum, or cells since cellular proteins do not
recognize the structure (backbone). Furthermore, injections of MOs do not
activate Toll-like receptors or activate innate immune responses, or modify the
methylation of DNA. Therefore, the effects of MOs during embryogenesis can be
seen up to several days following the injection.
Morpholino Design: Morpholinos have a higher binding affinity than
equivalent DNA-based antisense oligos, which allows them to target a specific
gene more effectively. Part of the reason for the success of MOs is because
they act by steric blocking as opposed to an RNase H-mediated mRNA
degradation mechanism. In eukaryotes, pre-mRNA is transcribed from the DNA
in the nucleus, introns are spliced out, and then mature mRNA is exported into
the cytoplasm where translation of the peptide product occurs (Figure 2.10A).
MOs can be made to modify or block the splicing process, or block translation
depending on the sequence of the oligo.
The most common MOs used are those that block translation by binding to
the 5’UTR of mRNA (just upstream of the AUG), which allows the MO to interfere
with the progression of the ribosomal initiation complex from the 5’ cap to the
start codon (Figure 2.10B). By preventing translation initiation, the MO effectively
43
knocks down gene expression; this allows for the function of the gene during
development to be identified.
Figure 2.9: Structure of a Morpholino Oligonucleotide shown in heteroduplex with RNA.
Morpholinos are synthetic molecules, approximately 25 bases in length that bind to
complementary RNA sequences by standard base pairing. Although morpholinos contain the
standard nucleic acid bases (adenine, cytosine, guanine and thymine), they are structurally
different from DNA or RNA since the bases are bound to morpholine rings rather than
deoxyribose or ribose rings. Additionally, phosphorodiamidate groups rather than phosphates
link the morpholine rings, which eliminates ionization; when injected into cells or whole embryos,
morpholinos are uncharged molecules (Adapted from Moulton 2007).
44
Figure 2.10: Schematic showing normal gene expression in eukaryotes and types of morpholino
targeting. (A) Normal gene expression where mRNA is transcribed and processed in the nucleus
and exported into the cytosol to be translated by ribosomes into protein precursors. (B)
Translation-blocking morpholinos work in the cytosol and target the 5’cap and start codon of the
processed mRNA, which blocks the binding of the translation initiation complex. (C) Splice-
blocking morpholinos target the pre-mRNA in the nucleus and prevent the formation of the splice
lariat or blocks the binding of splice complexes to splice sites. In some cases, these mRNAs are
translated into mis-spliced proteins (shown above) or occasionally be degraded (Adapted from
Moulton 2007).
45
Additionally, MOs can be used to hinder the pre-mRNA processing steps
by preventing snRNP complexes from binding to target sequences, by blocking
the nucleophilic adenine and preventing the formation of the splice lariat, or by
interfering with the binding of splice regulatory proteins (Figure 2.10C)
(Summerton and Weller 1997; Moulton 2007). While splice-blocking MOs can be
efficient in knocking down gene expression, several other effects can occur
including modified splicing, intron inclusions, and activation of cryptic splice sites.
However, assaying for splice blocking MOs can be conveniently done by RT-
PCR and visualized by agarose gel electrophoresis.
Use of the p53 ATG Morpholino: The downside to using MOs in
developing embryos is that the MO can produce non-specific or off-target effects.
It has been shown that up to 18% of MOs appear to have non-targeted
phenotypes in the central nervous system (CNS) and somite tissues of zebrafish
embryos; this is due to the activation of p53-mediated apoptosis (Robu et al.
2007). These non-target effects can be suppressed by co-injection of the
standard p53 MO along with the experimental MO (Robu et al. 2007).
Optimization of Injection Experiments using the golden Morpholino:
Knockdown experiments began by injecting golden heterozygous embryos
(between 1-8 cell stage) with various concentrations of the golden morpholino
reconstituted in Danieau buffer with 0.1% phenol red dye. The lethality of the
injections and the concentration needed to knockdown the single wildtype
46
pigment allele was determined, then used as a baseline in the following injections
into WT(AB) embryos to produce the golden phenotype. Additionally, golden
heterozygous and WT(AB) embryos were also injected with Danieau buffer and
0.1% phenol red dye in order to determine if any effects occurred. These
embryos were raised in the nursery and bred, showing that there were no
negative effects of the buffer solution on lethality or fertility of the fish. The data
obtained from these initial experiments was used to standardize the
concentrations used in future morpholino injection experiments and also served
as a positive control since it clearly demonstrated that the morpholino was
effectively getting into the cytosol of the zebrafish embryonic cells.
Experimental Morpholino Injections: Zebrafish embryos were injected with
MOs specific to the target candidate genes and screened for mosaic eyes at 48-
72 hpi. Based on the genetic evidence that gin-10 has maternal activity,
translation-blocking MOs were initially used for knockdown experiments in an
effort to knockout and/or significantly reduce maternal transcripts within the
embryo prior to MBT. The goal of the morpholino injections was to further
evaluate the gin-10 candidate genes and potentially narrow down the list to one
or two genes, Effects of the morpholinos on the golden heterozygous embryos
were verified by injections into WT(AB) embryos.
47
Table 2.3: Morpholino oligonucleotide sequences against specific gin-10 candidate genes.
Target
Gene
Morpholino
Type
Sequence
Purpose
golden
Translation
Blocker
5’-GCTGGAGAAACACGTCTGTCCTCAT-3’
Positive
Control
p53
Translation
Blocker
5’-GCGCCATTGCTTTGCAAGAATTTG-3’
Standard
rfx4
Translation
Blocker
5’-GCTCTTCCAGCAGCCCACAATGCAT-3’
Experimental
sir2
Translation
Blocker
5’-CTCTGCTCAACCTCGCCTTGCTCAT-3’
Experimental
synbl
Translation
Blocker
5’-CACTCAAACTCATCTCTGAATGATG-3’
Experimental
Splice
Blocker
5’-ACTGTCACTCTCACCTTAT-3’
Experimental
ric8a
Translation
Blocker
5’-TTAAGTCCATTTTCATCGCTGTTCC-3’
Experimental
Morpholinos were designed and ordered from Gene Tools, LLC.
Both WT(AB) and golden heterozygous embryos were injected with
various concentrations of morpholinos that were custom designed to target
specific gin-10 candidate genes (Table 2.2). Initially, embryo survival following
morpholino injections was very low (at 24-hpi) due to neural death and necrosis.
After completing the optimization of golden morpholino injections and co-injecting
embryos with the p53 morpholino, embryo survival increased while neural death
and necrosis was visibly less noticeable, which allowed for the mutant phenotype
to be screened. Controls for each injection session included setting aside
approximately 50-100 not-injected embryos to verify normal development within
the clutch, and injections of the p53 morpholino into embryos as well as dye-only
injections to verify that the phenol red solution that the morpholino was diluted
did not cause any change to normal embryonic development.
48
Figure 2.11: Representative results of Morpholino Injections into WT(AB) and golden
heterozygous zebrafish embryos. (A) 48-hpf WT(AB) not injected control embryo (B) 48-hpf
golden heterozygous embryo injected with sir2/p53 morpholino (C) 48-hpf WT(AB) embryo
injected with the sir2/p53 morpholino (D) 48-hpf golden heterozygous embryo injected with
rfx4/p53 morpholino (E) 48-hpf WT(AB) embryo injected with rfx4/p53 morpholino (F) 24-hpf
golden heterozygous embryo injected with rfx4/p53 morpholino (G) 48-hpf WT(AB) embryo
injected with ric8a/p53 morpholino (H) 48-hpf WT(AB) embryo injected with synbl(splice)/p53
morpholino (I) 48-hpf WT(AB) embryo injected with ric8a/synbl(splice)/p53 morpholino.
Wildtype embryos injected with sir2/p53 morpholinos displayed a
decrease in metabolic processes, delayed growth, severe pericardial edema and
a 90-100% lethality rate by 48-hpi (Figure 2.11B-C). The same phenotypes were
49
seen when injected into golden heterozygous embryos. Since lethality was an
issue at 48-hpi, it was not possible to use the mosaic eye assay to test for
genomic instability by observing the RPE. Therefore, a lower dosage was used
in golden heterozygous embryos, which enabled the use of the mosaic eye
assay, as well as having embryos with less severe metabolic defects, although
the defects were still observable. By doing so, the survival of the injected
embryos was increased to approximately 4-dpi. Unfortunately, no mosaics were
found in the zebrafish embryos injected with the sir2 morpholino.
Based on the cloning and morpholino experiments, it appears that the
sirtuin gene within the gin-10 region of zebrafish may be most closely related to
the human sirt3 gene. In humans, SIRT3 is a soluble protein located within the
mitochondrial matrix, and has been implicated in regulating metabolic processes
including adaptive thermogenesis based on overexpression and fasting studies in
mammalian cells (Blander and Guarente 2004; North and Verdin 2004).
Although there are a few studies that suggest SIRT3 is also found within the
nucleus and has some histone deacetylase properties, it is much more likely,
based on the well-known published data and morpholino knockdown results in
zebrafish, that the zebrafish gin-10 candidate, sir2, is involved specifically in
metabolic regulation and not genomic instability activity (Buck, Gallo and Smith
2004).
Embryos injected with the rfx4/p53 morpholinos exhibited delayed growth
through 24-hpi and some CNS abnormalities. Interestingly, these embryos either
had very long, curly tails or short, stubby tails (Figure 2.11D-F). No mosaics
50
were observed in any of the rfx4 morpholino injected embryos, suggesting that
this gene is not involved in the genomic instability activity seen in the gin-10
mutants.
The synbl gene was the first gin-10 candidate on the priority list due to the
known involvement in asymmetric cell division in C. elegans development (Wilkie
and Kinch 2005). Since there is a paralog on chromosome 25, it was important
to determine whether the knockdown of either of these genes causes mosaic
eyes, and whether they appear to function similarly in the developing zebrafish
embryo. Morpholinos were designed to target both synbl and ric8a, and were
used separately and in combination in WT(AB) and golden heterozygous
embryos.
Embryos injected with ric8a/p53 morpholinos appeared to have defects in
tail development, which may have been caused by non-specific off target effects
of the morpholino. More importantly, there was noticeable defects in the brain,
which most likely led to the observed cerebral edema in injected embryos 24-hpi
and older (Figure 2.11G). Embryos injected with either the synbl/p53
(Translation-blocking) morpholino or synbl splice/p53 (splice-blocking)
morpholino had severe developmental delay through 24-hpi, but interestingly
also had similar defects in brain and CNS development that resulted in embryos
with abnormally developed heads as compared to WT(AB) not-injected embryos
(Figure 2.11H). None of these morpholinos, when injected into golden
heterozygous embryos, resulted in mosaic eyes. When injected in combination
(ric8a/synbl/p53), embryo survival past 48-hpi significantly decreased while the
51
brain and head development still appeared to be considerably underdeveloped
(Figure 2.11I). This data suggests that synbl and ric8a work cooperatively during
zebrafish embryonic development.
Several publications have suggested that synbl mutants and knockdowns
have tiny, round, smooth melanophores that migrate abnormally during
development, which was the expected phenotype of the synbl morpholino
injections into WT(AB) embryos (Nagayoshi et al. 2008, Amsterdam et al. 2004).
After many injection sessions using various concentrations of synbl and ric8a
morpholinos, this expected phenotype was never observed. Rather, the
morphants were typically small and underdeveloped, with abnormal brain
development while the melanophores appeared to migrate properly with the
wildtype rough-edge appearance. The synbl MOs used for these experiments
were custom designed based on the VEGA annotated sequence information and
appeared to be different than those used in the published methods from
Nagayoshi et al. 2008. Additionally, the 5’ UTR and portions of exon 1 were
difficult to clone and were eventually cloned using genomic DNA from WT(AB)
embryos (Appendix A); morpholinos were designed using both the sequencing
information that was gained as a result of the cloning and the published VEGA
sequence. The differences in the phenotype of the injected embryos may have
been due to the effectiveness of the synbl MOs to appropriately target the synbl
transcripts. In order to determine the role of synbl and its paralog ric8a,
transgenic zebrafish were utilized.
52
Table 2.4: Summary of Morpholino Results for the gin-10 Candidate Gene Knockdowns
Morpholino
# Injected
Embryos
%
Survival
at 48-hpi
% Embryos displaying
Abnormal Phenotype
Golden (Control)
407
33.2
45.9
Rfx4
350
66.9
61.5
Rfx4 + p53
1137
80.1
75.4
Sir2 + p53
406
73.6
82.9
Synbl (ATG)
2422
83.4
85.2
Synbl (Splice)
325
60.9
61.1
Synbl (Splice) +
p53
558
82.8
76.6
Ric8a
1649
66.8
89.7
Ric8a + p53
1080
80.9
90.6
Ric8a + Synbl
(Splice) + p53
1235
78.1
93.6
Transgenic synembryn-like (Tg-synbl) Zebrafish from ZIRC
The Zebrafish International Resource Center (ZIRC) in Oregon listed
transgenic zebrafish embryos that were heterozygous for synbl (Tg-synbl), which
were purchased in order to evaluate the effects of the ric8a and synbl morpholino
knockdowns in a background other than wildtype and golden heterozygous.
Since homozygous mutants are lethal within a few hours after fertilization,
morpholino injections into the heterozygotes should provide better insight to the
function of each gene during development. The purchased fish were placed in
the nursery area in 10L tanks until they reached breeding age. Only two males
survived, therefore they were outcrossed with WT(AB) females in order to
maintain the stock.
Morpholino Injections into Tg-synbl Fish: The two male Tg-synbl fish were
bred to various Tg-synbl females for the morpholino injection experiments; this
53
self-cross should have resulted in wildtype and Tg-synbl heterozygous embryos
since the homozygous mutants are lethal. Immediately, it was recognized that
the 25% lethality by 24-hpf from these crosses did not occur, which was
interesting and unexpected. Morpholino injections using the synbl splice-blocker,
the ric8a morpholino and a combination of both were used in the resultant Tg-
synbl self-cross embryos. The results obtained appeared to be consistent with
the data from prior injections into WT(AB) and golden heterozygous embryos
(Figure 2.12).
Figure 2.12: Morpholino injections into the embryo progeny of the transgenic fish self-cross
breeding purchased from ZIRC. (A) Control, not injected 48-hpf embryo (B) 48-hpf embryo
injected with synbl(splice)/p53 morpholino (C) 48-hpf embryo injected with ric8a/synbl(splice)/p53
morpholino (D) 48-hpf embryo injected with ric8a/p53 morpholino.
PCR Analysis of the Transgenic Insert: Based on the self-cross and
morpholino results in the Tg-synbl fish, ZIRC was contacted for the genotyping
protocol for this particular transgenic line. Primer sequences were obtained from
ZIRC and ordered from IDT (primers were called Tg-synbl F1 and Tg-synbl R1).
Genomic DNA was prepared from fin clippings of all the existing ZIRC fish and
several of the young fish from a self-cross mating (not-injected embryos that
were tanked in the nursery system). According to ZIRC, the primers were
created in such a way that one primer anneals to the viral sequence and the
54
other anneals to the flanking genomic region, resulting in a 238bp band on an
agarose gel (Figure 2.13A).
As seen in Figure 2.13B, the PCR results suggest that approximately 40%
of the fish from ZIRC had the transgenic insert, revealing that the initial cross was
Tg-synbl/+ x WT(AB); based on the original ZIRC information, it was thought that
all of the purchased fish contained the transgenic insertion (Figure 2.14).
Figure 2.13: Identifying the Transgenic ZIRC fish (A) Schematic showing the transgenic viral
insert (red dotted line) within the gene (black line) at an intron-exon boundary. Primers designed
to specifically genotype the Tg-synbl fish obtained from ZIRC (blue arrows) will result in a PCR
band of 238bp on an agarose gel. (B) PCR results from the genotyping assay of the 20
transgenic fish received from ZIRC. These results suggest that approximately 40% of the fish
carried the transgenic insert, while the rest are wildtype.
55
More importantly, neither of the males carried the transgenic insert and the initial
outcross to WT(AB) simply produced wildtype fish; the embryos resulting from
self-crosses that were also genotyped did not carry the transgenic insert either.
Preservation of the transgenic line was important, so those females carrying the
transgenic insert were out crossed to robust looking WT(AB) males.
Figure 2.14: In vitro fertilization was performed at ZIRC using frozen sperm from a Tg-synbl
heterozygous male to fertilize a WT(AB) female. This resulted in half of the F1 progeny to be
heterozygous for the transgenic insert while half of the progeny was fully WT(AB).
Verification of the Transgenic Insertion Point: Since the results from the
morpholino injections did not vary from prior injection experiments, the PCR
product from the transgenic analysis was cloned into the pCR4 vector
(Invitrogen) and sent out to Macrogen Inc (S. Korea) for sequencing. Using the
NIH BLAST program, the sequencing results revealed that the transgenic insert
was on chromosome 18 but not actually interfering with the synbl gene; the
56
results suggested that the insert was actually in the second intron of the cry1b
gene, a former gin-10 candidate gene on the adjacent contig to the synbl gene
(Figure 2.15).
Figure 2.15: Representative results from BLAST analysis of the cloned viral insert and flanking
genomic region of the PCR genotyped ZIRC fish. These results suggest that the insert is actually
within the cry1b gene on an adjacent contig to the synbl gene.
The full viral sequence was obtained from ZIRC and new primers were
designed to amplify the ends of the insert and synbl genomic sequence. Primers
were also designed for cry1b genomic sequence based on the cloning and
sequencing results. Genomic PCR of the viral primers in combination with the
synbl primers never yielded a band on the agarose gels; only one combination of
57
the viral primer with a cry1b primer yielded a band (Table 2.3). The resultant
PCR product was also cloned and sequenced for verification; the results still
implied that the viral insert was in the second intron of the cry1b gene.
Table 2.5: Results of the Genomic PCR using Primers to Identify the Location of the Transgenic
Insert in WT(AB) and Confirmed Transgenic Fish.
Primer Pair
Results
WT(AB)
Male #1
Confirmed
Transgenic Female
F1/R1
-
-
+
F1/R5
-
-
-
F1/F3
-
-
-
F1/R3
-
-
-
F1/R5
-
-
+
F1/R1
-
-
-
F11/R1
-
-
-
F3/R1
-
-
-
F5/R1
-
-
-
R3/R1
-
-
-
F1/R5
+
+
+
F3/R3
+
+
+
Viral Primers Synbl Primers Cry1b Primers
This was an unfortunate finding in that it did not allow for an expanded
insight into the functional differences between the synbl paralogs, other than they
do not appear to function within the cry1b gene network (based on the
morpholino injections into the transgenic embryos in comparison with the
injections into WT(AB) and golden heterozygous embryos).
Summary of Experimental Results:
• Candidate genes were analyzed for maternal and zygotic activity in WT(AB)
zebrafish embryos by RT-PCR. Since the entire set of candidate genes
initially listed within the gin-10 region showed both maternal and zygotic
58
expression, the candidate gene list was narrowed down based on the
known orthology information on the Sanger and NCBI databases. This left
synbl, rfx4, and sir2 as the main candidates on the gin-10 list.
• The ric8a gene is a paralog of synbl located on chromosome 25. This gene
was being studied simultaneously with the gin-10 work, in order to
determine if there were any differences in expression and function of the
homologs during early zebrafish development.
• Expression analysis of the four genes (synbl, ric8a, rfx4, and sir2) was
performed using the semi-quantitative RT-PCR protocol and whole-mount
in situ hybridization. It was interesting to find that synbl and ric8a did
appear to have some divergence in the temporal expression, whereas synbl
is expressed throughout early development and ric8a appears to show
activity after 12-hpf. Additionally, both genes appear to be expressed
specifically in the brain and CNS after 24-hpf.
• Morpholino oligonucleotides were used to knockdown individual candidate
gene expression in both WT(AB) embryos and golden heterozygous
embryos in order to determine whether genomic instability activity occurs by
using the mosaic eye assay. Unfortunately, none of the morpholino
knockdowns led to mosaic eyes in the golden heterozygous embryos,
although some general information on the function of the candidate genes
was determined.
• Transgenic fish were obtained to further study the synbl homologs. Since
the injection phenotypes did not vary from the previous experiments and the
59
self-crosses did not lead to a 25% dead-loss of homozygous mutants, the
integrity of the transgenic insert was questioned. By PCR and cloning
analysis, it was concluded that the insert was only in approximately 40% of
the fish purchased, and the insert was actually affecting the cry1b gene
rather than the synbl gene.
• The conclusions and implications of these results are discussed in Chapter
Five.
60
CHAPTER THREE
METHODS FOR ANALYZING MDM1 PROTEIN EXPRESSION IN ZEBRAFISH
EMBRYOS
Rationale and Experimental Design
The most interesting gene within the gin-12 candidate region on the
zebrafish chromosome 4 was mdm1. This gene was originally cloned from a
transformed murine cell line, and found to be overexpressed in these cells along
with the known oncogene mdm2 (Snyder et al. 1988). The aim was to determine
whether the Mdm1 protein is involved in the regulation of the tumor suppressor
p53 following DNA damage, or interact with other proteins in that pathway. In
order to explore this hypothesis, it was necessary to first establish protein
expression analysis of Mdm1 and other p53 regulators in zebrafish embryos.
Protein expression analysis and general proteomics experiments are not
common in the current realm of zebrafish research. Therefore, the availability of
antibodies reactive in zebrafish is limited. In order to perform western blots and
possible protein-protein interaction studies, custom anti-Mdm1 antibodies were
produced for these experiments. The custom anti-Mdm1 antibodies were
assayed for specificity and quality before more detailed analysis was carried out.
This chapter describes the experiments designed to optimize protein detection in
61
zebrafish. These experiments utilize custom and commercially available
antibodies to assess the expression of Mdm1, Mdm2, Mdm4 and p53 protein in
zebrafish as well as in vitro transcription and translation (TNT) expression of
Mdm1, Mdm2, Mdm4 and p53 protein that are used as controls in these and
future experiments.
Optimization of Western Blotting Techniques in Zebrafish Embryos
Preparing Embryo Lysate for Western Blot Analysis: As a first step
towards analyzing protein expression in zebrafish, it was necessary to optimize
the preparation of good quality embryo protein lysates There are very few
published protocols for lysate preparation from zebrafish, since protein work is
relatively rare in this model organism. An issue with generating protein lysates
from embryos is that the chorion must be removed before the lysate can be
produced. Zebrafish embryonic chorions can be removed either manually or
dissolved with a brief pronase treatment. For these experiments, manual
dechorionation was used to prevent exposure of the embryo lysate to
proteinases. It was important that after dechorionation that the yolk also be
removed from the embryos because it contains an abundance of protein that
could impact the sensitivity of antibody detection of the target proteins. Initial
experiments utilized two syringes with 25-G needles for the removal of the yolk
from the embryo. While observing the embryo under a dissecting microscope, it
was held with one syringe while the other was used to peel the yolk away from
the body. Although this technique worked well for removing the yolk, it was time-
62
consuming and often led to embryo damage and poor lysate quality. Therefore
the process was changed to a technique utilizing a two-buffer system (Link,
Shevchenko and Heisenberg 2006) that proved to be optimal in removing the
yolk without causing damage to the embryo itself. This technique involved
washing embryos in a high salt deyolking buffer, which dissolved the yolks while
shaking the embryos in a microfuge tube (See Chapter Six for full protocol).
After optimizing the deyolking step, it was essential to develop a
successful protocol for preparing embryo lysates. Three different protocols were
obtained and tested for quality and standardization of lysate preparation – Myers
lab protocol, the Look lab protocol and the Zebrafish book protocol (Karlovich et
al. 1993; Maslow personal communication; O’Shea and Westerfield 1993). The
first two protocols exploited the use of RIPA buffer with various protease
inhibitors (Roche). The resulting Ponceau staining of the lysate on a western blot
showed clear protein bands, but was frequently light and inconsistent in clarity
from one sample to the next (Appendix C). The Zebrafish book protocol, which
utilized a Sample buffer containing SDS and β-ME along with sonication,
appeared to result in the most consistent lysate samples from different embryo
samples based on clarity upon transfer and intensity of the bands, when loading
5µl on an SDS-PAGE gel and staining the blot with Ponceau-S (See Chapter
Six).
Standardizing the Western Blotting Technique: Before using any custom
antibodies, commercially available antibodies for zebrafish Actin and p53 were
63
purchased and used to optimize the western blotting procedure. Actin was used
because of its abundance and ubiquitous expression and p53 was used since
this was potential interacting protein with Mdm1. During these studies, embryo
lysates were resolved on 10% SDS-PAGE gels and blotted as detailed in
Chapter Six. Blots were incubated in either anti-Actin or anti-p53 antibodies at
4oC from one hour to overnight using concentrations recommended by the
suppliers. Primary antibody detection was carried out with the CSPD
chemiluminescent reagent. These experiments were repeated several times for
consistency with each antibody. Representative results for the standardization
experiments can be seen in Figure 3.1.
Figure 3.1: Western blots detecting β-Actin and p53 protein in WT(AB) zebrafish embryo lysate.
(A) Two sets of lysate samples for 48-hpf embryos and 72-hpf embryos were run on a 10% SDS-
PAGE gel. A polyclonal rabbit anti-Actin antibody was purchased from Cell Signaling Technology
and used at a dilution of 1:1000, and detected with CSPD Chemiluminescence substrate on X-
Ray film. The β-Actin protein appeared at a molecular weight of 45kDa. (B) 24-hpf and 48-hpf
zebrafish embryo lysates were run on a 10% SDS-PAGE gel. A polyclonal rabbit anti-Zebrafish
Anti-p53 antibody that exclusively reacts to the zebrafish C-terminal protein sequence was
purchased from Anaspec and used at a dilution of 1:1000 for these experiments. An
immunoreactive band at approximately 53kDa that corresponds to the p53 protein is visible in the
embryo lysate.
Western Blots using Custom Mdm1 Antibodies: Custom Mdm1 antibodies
were purchased from 21st Century Biochemicals to be used for these and future
protein experiments. Two epitope sites were chosen in the Mdm1 peptide
64
Figure 3.2: Epitope sites for the custom zebrafish anti-Mdm1 antibodies ordered from 21st
Century Biochemicals. Both monoclonal antibodies, Mdm1-44 and Mdm1-2, were designed to be
specific to the zebrafish Mdm1 protein with the ability to detect both known protein sequences
based on the Sanger and VEGA database information. BLAST analysis and HPLC Mass
Spectometry by the supplier verified sequences of the peptides. The finished products were
supplied as affinity purified antibodies, which are extremely fragile and specific care was taken to
ensure the stability of each sample.
sequence that would detect both known peptide sequences (Figure 3.2). After
achieving consistent results with the western blots using the zebrafish anti-Actin
and anti-p53 antibodies, the new custom zebrafish anti-Mdm1 antibodies were
used at several dilutions on embryo lysate in order to obtain a consistent protocol
when using these antibodies. Based on the peptide information for Mdm1 in the
Sanger and VEGA databases, it was expected that the Mdm1 protein from
zebrafish lysate would appear at approximately 74kDa on a western blot.
65
Interestingly, there was consistent detection of bands from various zebrafish
lysates at approximately 55kDa. In order to determine if the custom antibodies
were correctly detecting the Mdm1 protein, the zfMdm1 was produced using TNT
so that it could be used as a control on the western blots.
In vitro Transcription and Translation of Mdm1, Mdm2, Mdm4 and p53
The full-coding sequences of mdm1, mdm2, mdm4 and p53 were
amplified by RT-PCR from WT(AB) zebrafish embryos using several sets of
primers for each gene. Upon successful amplification, the PCR products were
gel purified and inserted into the pCR4 vector (Invitrogen), and sequenced to
assess the integrity of the gene and determine the orientation (Figure 3.4A). This
vector had been used previously to transcribe mRNA for in situ hybridization
probes (Chapter Two), and therefore is a suitable vector for the in vitro
transcription of inserted genes. The first TNT experiment utilized the Promega
Coupled in vitro Transcription and Translation (TnT) kit to express the full-length
p53 clones in the pCR4. However, these experiments did not yield any protein
product on Western blots stained with commercially available anti-p53
antibodies. These results were puzzling since the p53 clones had been
sequenced to verify that they contained the full-length cDNA insert. To assess
these results, full-length zebrafish mdm2 clones in the pCR4 vector were also
expressed using the Promega TNT system. These clones also failed to produce
protein from the TnT reaction.
66
To troubleshoot these results, the sequencing data was revisited and it
was noted that there was no Kozak sequence prior to the ATG transcription start
sites in any of the clones (Figure 3.3). Therefore, the forward primers used to
originally amplify the full-length sequence were resynthesized to incorporate the
Kozak sequence prior to the ATG start site the four genes (Figure 3.4). The
sequences were again amplified by RT-PCR from zebrafish embryo, cloned into
the pCR4 vector and sequenced. This process produced several clones that
contained the correct full-length insert with the Kozak sequence and were
inserted in the T7 direction. These clones were used for TNT reactions.
Unfortunately, the final products of these TnT reactions did not yield any protein
on an SDS-PAGE gel.
67
Figure 3.3: Sequence of the mdm1 gene with the Kozak sequence cloned prior to the
transcription start site and mdm1 sequence cloned without the Kozak sequence. Shown here is
the first 831 bases of the modified mdm1 gene sequence in the pCR4 vector with the Primer,
Kozak sequence, and Transcription start site annotated (Sequence 1) and the first 628 bases of
the original cloned mdm1 sequence (Sequence 2).
68
Figure 3.4: The addition of the Kozak sequence to mdm1, mdm2, mdm4, and p53 zebrafish
sequences. (A) WT(AB) Zebrafish embryo RNA was used to RT-PCR the mdm1 sequence with a
modified forward primer to include the Kozak sequence directly upstream of the ATG-
Transcriptional Start site. The PCR products were run on an agarose gel, purified and cloned into
the pCR4 vector. Three RT-PCR reactions were set up to test the annealing temperatures (58oC,
60oC, and 62oC) for the new primer set. (B) Kozak cloning was performed for p53, mdm2, and
mdm4 in the same manner as shown for mdm1. Amplified gene sequences from zebrafish
embryo RNA were cloned into the pCR4 vector and verified by sequencing.
Upon further discussion with the technical support at Promega, it was
determined that the genes of interest should be subcloned into the Promega
vector, pCMVTnT, which was made specifically for this TNT kit (Figure 3.5B).
Full length mdm1, mdm2, mdm4 and p53 cDNA clones were excised from the
pCR4 vector by an EcoR1 digest and subcloned into the pCMVTnT vector using
T4 DNA ligase (New England BioLabs). The new pCMVTnT clones were
sequenced using both the T7 EEV promoter and internal primers to confirm that
the full sequence was present and correctly oriented within the vector.
69
Figure 3.5: Cloning vectors used for in vitro Transcription and Translation experiments. (A)
Invitrogen’s pCR4 TOPO-TA cloning vector which was initially used for the TnT experiments but
did not appear to function properly with the TnT kit (Promega). The clones in this vector were
shuttled to the (B) Promega pCMVTnT vector, which was created by Promega to be used
specifically with the TnT kit. This vector has a T7EEV promoter and 5’-β-Globin Leader directly
upstream of the Multiple Cloning Site. It also includes an SV40 late polyadenylation signal, which
ultimately allowed the TnT kit to work seamlessly with this vector. Figure B was created with the
Geneious v5.4 software program.
The confirmed pCMVTnT clones of mdm1, mdm2, mdm4, and p53 were
used in conjunction with the Promega Coupled in vitro Transcription and
Translation kit with the addition of biotinylated tRNA (lysine), so that all of the
translated products could be detected on a single western blot using the
Streptavidin-AP conjugated antibody (supplied in the Promega kit) and detected
70
with NBT-BCIP. As shown in Figure 3.6, protein did result from these reactions.
Two mdm1 clones in the pCMVTnT (Promega) vector were used for these TnT
reactions along with a single mdm2 and mdm4 pCMVTnT (Promega) clone. As
the results indicate, all of the reactions produced the expected size in vitro
translated protein product. The Mdm2 translated protein appears to have the
best expression with the colorimetric detection, which may be due to the number
of biotinylated lysines incorporated during the translation process. Confirming
that the TnT reaction worked correctly and produced the correct size protein was
an important and necessary step. These TnT products were then used to test
the custom Mdm1 antibodies and commercially available antibodies for Mdm2
and Mdm4 to correctly detect these proteins in zebrafish lysates.
Figure 3.6: In vitro Transcription and Translation results using the Promega vector, pCMVTnT,
coupled with the Promega TnT kit and biotin-labeled tRNA (lysine). Two mdm1 (kozak) samples
were used along with an mdm2 (kozak) and mdm4 (kozak) samples. The TnT reactions were
performed according to the Promega protocol (Chapter Six) with added biotin-labeled tRNA
(lysine). The TnT products were diluted 1:2 in 2X Sample buffer and run on a 10% SDS-PAGE
gel and transferred to nitrocellulose paper. Using Streptavidin-AP primary antibody, the TnT
products were colorimetrically detected with NBT-BCIP and shown above. Both Mdm1 products
appear around 74 kDa, while the Mdm2 and Mdm4 TnT products appear at 53 kDa and 55 kDa
respectively.
Using the in vitro Translated Mdm1 Product to Test the Custom Antibodies
Since the in vitro synthesized Mdm1 appeared to migrate at the expected
molecular mass (Figure 3.6), it was used as a control on the embryo lysate
71
western blots to determine the specificity of the custom Mdm1 antibodies; the
Promega TnT mastermix was also loaded on these gels as a control.
Representative results shown in Figure 3.7. The data indicate that the Mdm1-44
and Mdm1-2 antibodies do not detect the synthesized protein product but rather
detect proteins within the TnT mastermix. Furthermore, the custom Mdm1
antibodies do not appear to detect the appropriate size protein in embryo lysate
(expected size of Mdm1 is approximately 74 kDa).
Figure 3.7: Testing the Custom Monoclonal Mdm1 Antibodies by Western Blots. Identical gels
were loaded with TnT mastermix, verified Mdm1 TnT reaction product, and 24-72-hpf embryo
lysates (in duplicate). (A) Gel blot incubated in the Mdm1-2 monoclonal antibody overnight and
detected with CSPD. It is clear that this antibody is not detecting the synthesized protein product
in the TnT lane, but is detecting a 55 kDa protein in the embryo lysate. (B) Gel blot incubated in
the Mdm1-44 monoclonal antibody overnight and detected with CSPD. Similar results are seen
here, where the custom antibody is not detecting the synthesized Mdm1 protein or the correct
size protein in embryo lysate. These experiments were repeated several times for confirmation.
Since the Mdm1 antibodies did not appear to detect the Mdm1 protein in
embryo lysate or the synthesized product from the TnT reaction, the sensitivity
72
and specificity of the reagent was in question. The custom antibodies were
pooled together and used at a dilution of 1:500 (2.22 µg/µl) on a western blot
containing the TnT product and zebrafish embryo lysate (Figure 3.8A). Again, 74
kDa proteins were not detected in the lanes containing embryo lysate, although
protein was detected in the lysate around 55 kDa. Figure 3.8B shows two
western blots that were loaded with TnT mastermix and synthesized Mdm1,
Mdm2, and Mdm4. The first gel was incubated with custom Mdm1 antibody
mixture (1:500 dilution) while the second gel was incubated in a 1:1000 dilution of
the commercially available zebrafish anti-Mdm2 antibody (Anaspec). The results
suggest that the custom Mdm1 antibodies are solely detecting the TnT
mastermix (Figure 3.8B, Gel #1) whereas the anti-Mdm2 antibody also detects
some of the TnT mastermix proteins but clearly detects the zebrafish Mdm2
synthesized protein at approximately 53 kDa (Figure 3.8B, Gel #2). Based on
these results, it was apparent that using the custom Mdm1 antibodies for future
experiments such as Co-IPs would not be possible, since they were not detecting
endogenous or synthesized Mdm1 protein. In an attempt to identify proteins
associated with Mdm1 in zebrafish, embryos injected with a tagged version of
Mdm1 could be used for Co-IPs, which may provide further insight about
interacting protein partners and regulatory pathways during zebrafish
development.
73
Figure 3.8: Analysis of the Specificity of the Custom Mdm1 Antibodies. (A) The Mdm1-44 and
Mdm1-2 antibodies were both used to detect the Mdm1 in vitro translated protein and
endogenous Mdm1 protein from zebrafish embryo lysates at several developmental time points.
Each sample was loaded in duplicate to ensure quality of the results. The custom Mdm1
antibodies did not appear to detect the protein product in the TnT sample at 74-75 kDa, but did
appear to detect a band at approximately 55 kDa in the lysate samples (24-hpf lysates have a
very light band). (B) The in vitro transcribed products of Mdm1, Mdm2 and Mdm4 as well as TnT
mastermix were run on two separate gels. The custom Mdm1 antibodies were used on Gel #1,
which should have detected a 74-75 kDa band in the lane containing the Mdm1 TnT product.
Rather, the same results were apparent in all four lanes suggesting that the custom Mdm1
antibodies do not detect the zebrafish Mdm1 protein. The anti-Mdm2 antibody supplied by
Anaspec, was used on the Gel #2, which also showed some non-specific staining in the four
sample lanes, but a clear band was present at approximately 53 kDa in the Mdm2 TnT lane,
verifying that this antibody is detecting the correct protein.
FLAG and His-Tagging Mdm1
Based on the results from the custom Mdm1 antibody experiments, it was
necessary to use another method to detect the Mdm1 protein from zebrafish
embryos for possible protein-protein interaction studies. The FLAG peptide is a
widely utilized tag that can be used for affinity chromatography for the isolation of
protein complexes (Hopp, Gallis and Prickett 1988; Einhauer and Jungbaur
2001). In addition to the FLAG tag, polyhistidine or His-tags are another useful
74
tool that can be exploited and easily applied in protein purification and binding
assays (Hochuli et al. 1988; Hengen 1995). Thus, experiments were designed to
use tagged Mdm1 proteins that could be injected into embryos for subsequent
purification to identify possible binding partners of Mdm1, and also potentially
determine its functional and biological role in zebrafish. Since the Kozak
sequence and some restriction sites had already been added to the 5’- end of the
mdm1 gene with custom primers, it was decided that the tags would be
individually added to the 3’- end of the gene so that it would not interfere with the
previously adapted sequence. The methodology used to add these tags is
described below.
FLAG-Tagging mdm1 Clones in the pCR4 and pCMVTnT Vectors: The
pCR4 vector (Invitrogen) was used as a shuttle vector for these experiments
since it was known that the inserted gene sequences can be easily excised and
ligated into the pCMVTnT vector once they were verified by sequencing. Figure
3.9 shows the two-step primer process to insert the FLAG tag at the 3’-sequence
of the mdm1 gene by PCR. Since the mdm1 R9 primer was used in previous
experiments to amplify the full-length coding sequence of mdm1, it was modified
into two separate new primers that included a partial DNA sequence of the FLAG
tag (Figure 3.9B) and the complete DNA sequence of the FLAG tag (Figure
3.9C), primers mdm1 R12a and 12b respectively. The mdm1 coding sequence
was amplified by RT-PCR from embryo RNA using the mdm1 Kozak F2 primer in
combination with the mdm1 FLAG R12a primer to add the first portion of the
75
FLAG tag to the mdm1 gene sequence. The PCR product was run on an
agarose gel for size verification (Figure 3.10A), purified, then ligated into the
pCR4 vector and plated on ampicillin and carbenicillin plates in transformed in
Top 10 cells (Invitrogen). Plasmid DNA was isolated from individual colonies and
the second round of FLAG tagging was performed using this DNA and the
corresponding mdm1 primers (Figure 3.10B). Products from the second round of
FLAG amplification were ligated into the pCR4 vector (shuttle vector for cloning),
then excised out using an EcoR1 restriction digest and subcloned into the
pCMVTnT vector (Promega).
Figure 3.9: Experimental Design of the FLAG tag in the mdm1 sequence. (A) Peptide and DNA
sequence of the FLAG tag. A two-step PCR procedure was used to add portions of the tag to the
3’ end of the mdm1 coding sequence. (B) The first round of PCR inserts the 5’-
GACGACGATAAG-3’ just before the stop codon. This was done by modifying the R9 primer
(new R12a primer) to add the FLAG tag bases. (C) The second round of PCR completed the
FLAG tag by adding the 5’-GACTACAAGGAT-3’ to the tag sequence already in the coding
region. The new R12b primer was used for this.
76
Figure 3.10: PCR Results of FLAG Tagging the mdm1 Coding Sequence. (A) Round 1 PCR
using the mdm1 Kozak F2 primer with the FLAG Tag primer 12a. (B) Round 2 PCR results of
adding the FLAG tag using the R12b primer. Asterisks denote the portion of the gel that was
purified and ligated into the vector for cloning.
Analyzing the FLAG-Tag Clones in the pCMVTnT Vector: In order to
determine if the FLAG tag was successfully added to the 3’ end of the mdm1
coding sequence, the pCMVTnT clones were subjected to digests using the
Hpy99I restriction enzyme (New England BioLabs). Based on the vector
sequence information, plasmids containing the FLAG tag would show four bands
on an agarose gel since the enzyme cuts the vector itself in three locations, while
also recognizing a restriction site in the FLAG tag itself. Using this method
required very little time and effort, while quickly allowing for analysis of each
clone generated by the PCR and ligation process. It is important to note that in
77
addition to these digests, a representative sample of the FLAG tag clones were
also sent off for sequencing to verify the digest results. Not only would the
restriction digests verify the insertion of the FLAG tag, it would also identify the
direction of the mdm1 insert within the pCMVTnT vector. Hundreds of clones
were analyzed using the Hpy99I restriction enzyme and run on agarose gels.
Representative results of these digests are shown in Figure 3.12. Based on the
sequence map and the schematic of the pCMVTnT vector (Figure 3.11), if the
FLAG tag was correctly inserted into the mdm1 sequence, four bands were
expected on the agarose gels, sizes corresponding to the orientation of the insert
within the vector.
Figure 3.11: Restriction Analysis of the FLAG Tag Clones by Hpy99I. In addition to several
Hpy99I restriction sites within the pCMVTnT vector, a recognition site was also within the FLAG
tag, and used to identify clones containing the mdm1-FLAG insertion. (A) Shows the expected
fragment sizes following the digest if the mdm1-FLAG sequence was inserted in direction 1. This
was the desired result, since the insertion would be in the correct orientation for the TnT reaction.
(B) Shows the expected fragment sizes following the digest if the mdm1-FLAG sequence were
inserted in direction 2.
78
Figure 3.12: Results of the Hpy99I digests. All lanes contain three fragments following the
restriction digests, suggesting that the FLAG tag was never successfully inserted into the mdm1
coding sequence.
As shown in Figure 3.12, only three bands corresponding to the vector
appeared on the gels following the restriction digests using the Hpy99I enzyme.
To support these results, several of the clones were sent to Macrogen for
sequencing confirmation of the FLAG tag; the mdm1 insert was present without
the FLAG tag in each of the clones analyzed. Based on this evidence, it was
decided that the FLAG tag was too difficult to insert within the mdm1 coding
sequence, and therefore the efforts turned to using a 6X-His tag instead.
6X-His Tagging mdm1 Clones in the pCR4 Vector: Similar to the FLAG
tagging efforts, the 6X-His tag sequence was added to the mdm1 R9 primer, but
as a single-step amplification. Because the addition of the His tag significantly
increased the melting temperature of the primer, two different reverse primers
(R13 and R14) containing the His tag, were designed to be used with the Kozak
79
F2 forward primer. Figure 3.13 shows the location of the His tag within the
coding sequence of the mdm1 gene.
Figure 3.13: Schematic of adding the 6X-His Tag to the mdm1 Coding Sequence. (A) DNA
sequence of the 6X-His Tag, which was added to the R9 primer (new R13 and R14 primers). (B)
Location of the tag, just before the STOP codon in the mdm1 coding sequence.
Since the His tag was added in a single step by RT-PCR using zebrafish
embryo RNA, the PCR products were run on an agarose gel, purified and ligated
into the pCR4 vector (Figure 3.14). Due to the difficulties with the FLAG tagging
effort, the products were analyzed within the pCR4 vector, rather than shuttling
the gene inserts into the pCMVTnT vector (Figure 3.15). Similar to the restriction
analysis of the FLAG tag, the 6X-His tag insertion was also analyzed within the
pCR4 vector by restriction digests of hundreds of clones using the Ase1 enzyme
along with sequencing several samples of the clones (New England BioLabs).
Based on the restriction site analysis of the vector and mdm1-His insert, and the
orientation of the insert within the vector, upon digestion with Ase1, three bands
80
would appear on an agarose gel if the clones were positive for the 6X-His tag
(Figure 3.15).
Figure 3.14: RT-PCR results of adding the 6X-His Tag to mdm1. Each of the fragments were gel
purified and ligated into the pCR4 vector (Invitrogen) for cloning and analysis.
Figure 3.15: Schematic of the Ase1 digests to confirm the insertion of the 6X-His tag in mdm1.
Similar to the restriction analysis of the FLAG tags, the expected fragment sizes were dependent
on the orientation of the insert within the vector. In this case, orientation was not important, as
positive clones would be shuttled into the pCMVTnT vector for TnT reactions. (A) Shows the
expected fragment sizes if the mdm1-His were inserted in the T3 direction. (B) Shows the
expected fragment sizes if the mdm1-His were inserted in the T7 direction. Restriction site
locations in the vector were based on the information provided by Invitrogen.
81
After restriction mapping hundreds of pCR4 clones, it was evident that
none of the clones contained the 6X-His tag, since only two bands were apparent
on all of the agarose gels following the restriction digests. Representative results
of these digests are shown in Figure 3.16. Based on the restriction mapping and
sequencing evidence, it was determined that none of the clones contained either
the FLAG or His tag in the mdm1 coding sequence, and thus could not be used
for future experiments such as injections into embryos for Co-IPs.
Figure 3.16: Restriction Analysis Results of the 6X-His tag mdm1 Clones in the pCR4 Vector.
All clones that were examined by Ase1 restriction digests appeared to only have two fragments
on the agarose gels, suggesting that the His tag was not added to the 3’ mdm1 coding sequence.
82
Summary of Experimental Results
• The in vitro Transcription and Translation requires delicate handling and
specific vector qualities to synthesize proteins of interest. This can also be
a powerful tool in determining the quality and specificity of commercially
available and custom antibodies. In these studies, the synthesized proteins
were used as a control to determine the ability of the custom Mdm1
zebrafish antibodies to detect the correct protein on a western blot. Without
this control, the custom antibodies may have been inappropriately used in
other protein experiments, such as Co-IPs, leading to costly results.
• The use of tags is not novel, especially in zebrafish research. It was,
however, unfortunate that with all of the effort put forth, neither FLAG nor
6X-His tags were inserted into the coding sequence of the mdm1 gene.
The combination of restriction mapping and sequencing clearly identified
mdm1 clones without tags. A 5’ tag was never attempted since the Kozak
and in some cases, an Xho1 site for cloning purposes were already added
in this region.
• The mdm1 gene remains an important focus in the lab. Based on the
results of the westerns with the custom antibodies, and the inefficiency of
Tag cloning, it was decided that the gene function and expression should
be examined before looking at the protein expression.
83
CHAPTER FOUR
INVESTIGATING THE ROLE OF MDM1 IN ZEBRAFISH DEVELOPMENT
Experimental Design and Rationale
Similar to the gin-10 candidate studies, the gin-12 mutation was identified
on zebrafish chromosome 4 by ENU mutagenesis studies and half-tetrad
mapping (Moore et al. 2006). Within this region that maintains synteny with
human chromosome 12, several genes were identified as candidate genes for
gin-12, including mdm1. The aim of this chapter is to determine the expression
patterns of the mdm1 gene and identify its role in zebrafish development.
To formally investigate this candidate gene, the ability to study transcript
expression within the embryo was explored by in situ hybridization techniques, as
well as the ability to knockdown gene function by Morpholino oligonucleotides
(MOs). Embryos injected with biotin-labeled mdm1-Ex2 MO were stained to
identify the exact regions of the MO targets, leading to the identification of mdm1
gene expression and developmental function in zebrafish embryos. The use of
MOs to knockdown mdm1 gene expression was verified by RNA rescue, as well
as RT-PCR and in vitro protein studies. Additionally some of the knockdown
experiments were designed to further explore the potential genomic instability
activity of the mdm1 gene (Figure 4.1).
84
Figure 4.1: Schematic of the Experimental Design to Establish the Role of mdm1 in Zebrafish
Development.
Temporal and Spatial Expression Analysis of mdm1 in Zebrafish Embryos
Background: In addition to the full-length cloning of mdm1 that was
described in Chapter Three, RT-PCR was also used to amplify several smaller
fragments of this gene, which were cloned into the pCR4 vector. The amplified
cDNA products were sequenced for confirmation and orientation within the
plasmid, and kept in a library. These small mdm1 gene clones were later used
as templates for RNA and DNA probes in various experiments.
Developmental Expression Analysis of the mdm1 Gene: Preliminary RT-
PCR amplification of mdm1 had suggested that expression of mdm1 transcripts
was variable during zebrafish development (data not shown). In order to further
85
explore the temporal expression patterns of mdm1, semi-quantitative RT-PCR
was performed. This method utilizes the low-cycle RT-PCR reaction from
WT(AB) zebrafish RNA and a modified Southern blotting technique to detect
expression of the mdm1 cDNA with a DIG-labeled DNA probe (Figure 4.2).
Figure 4.2: Results of the mdm1 semi-quantitative expression analysis from developing zebrafish
embryo RNA. (A) Blot results detected with CSPD following hybridization with an mdm1 DIG-
labeled DNA probe. Expression of the transcript appears to vary significantly from maternal
expression (4-hpf) through larval stage (7-dpf). (B) ImageJ software (NIH) was used to
graphically represent the blot data from this analysis. Units indicate detection above that seen in
the negative control lane.
As shown in Figure 4.2, mdm1 transcript levels appear to vary during
zebrafish development. At 4-hpf, the maternal expression of mdm1 was very
robust suggesting that it plays a critical role in the earliest stages of
embryogenesis. The apparent decrease in mdm1 expression at 8-hpf occurs
86
shortly after the Mid-Blastula Transition (MBT), suggesting that the maternal
transcript of this gene has been depleted and the zygotic gene is not yet active.
The zygotic mdm1 gene is activated after this transition, which is seen in the
increased expression level at 12-hpf. This is also the time that the optic vesicle
and Kupffer’s vesicle develops in zebrafish embryos. Expression of this gene
appears to decline around 18-hpf before increasing in quantity again by 24-hpf.
At 72-hpf, mdm1 was expressed at the highest level. 72-hpf is the period of the
completion of rapid morphogenesis of the embryo into the early larval stage. By
7-dpf observed a low but consistent level of mdm1 gene expression observed in
the larval zebrafish.
Since the temporal expression of mdm1 was carried out through the semi-
quantitative analysis of the cDNA, it was important to further investigate the
expression of the mdm1 gene by identifying specific tissue expression of mdm1
mRNA in zebrafish embryos of different ages (spatial expression analysis).
Although little is known about the mdm1 gene in zebrafish or mammals, recent
studies suggest that mdm1 may be involved in the development of the retina
and/or optic nerves and may also play a role in retinal degenerative diseases
(Chang et al. 2008). To investigate the role of mdm1 in these processes,
experiments were carried out using WT(AB) embryos treated with phenylthiourea
(PTU) to inhibit pigment formation, and golden embryos. Several DIG-labeled
mdm1 RNA probes were generated (approximately 600bp-1200bp) with the
Ambion MaxiScript T3/T7 kit. As shown in Figure 4.3, the mdm1 transcript is
expressed ubiquitously around 12-hpf and appears to be concentrated near the
87
anterior portion of the embryo from 24-hpf through 72-hpf. In the 24-hpf embryo,
staining appears to be the darkest in the diencephalic roof, near the epiphysis
(midline, dorsal region of the diencephalon), the dorsal tectum, telencephalon,
and within the otic primordium. By 48-hpf, there has been a rapid
morphogenesis of the embryo, and it appears that the expression of the mdm1
gene is prominent in the midbrain (dorsal region), the midbrain tegmentum
(ventral region), and optic tectum. Staining appears to be consistent in the CNS
at 72-hpf, when the embryo enters the larval stage. Each set of in situ
hybridization experiments also included control embryos for no RNA probe (no
hybridization), no RNA probe/no antibody, and no antibody. These control
embryos remained translucent indicating that the staining observed in the
experimental embryos was due to mdm1 transcript targeting.
The combined results of these experiments indicate that the mdm1 gene
is expressed at different levels throughout the developmental process.
Expression begins as a maternal transcript that is ubiquitously expressed
throughout the early embryo followed by zygotic gene expression that is
ultimately confined to the anterior portion of the embryo. Specifically, based on
the location of the mdm1 transcript it appears that mdm1 may play a role in the
development of the otic primordium, optic cup, and other components of the brain
and CNS as shown in the figures above. Thus, it is important to confirm these
analyses with experiments to study and identify the function of the mdm1 gene in
vivo.
88
Figure 4.3: Results from the Whole-Mount in situ Hybridization Expression Analysis of mdm1
Transcripts in Zebrafish Embryos. (A) Ubiquitous expression of mdm1 in 12-hpf embryos (B)
Expression appears to be localized in the CNS of 24-hpf embryos, including midbrain, hindbrain
and otic primordium (C) Localization of mdm1 transcripts in the anterior region of the zebrafish
embryo continues at 48-hpf and also includes staining for mdm1 in the optic cup and optic tectum
(D) Robust staining for the mdm1 transcripts remain in the CNS as well as within the eyes and
cerebellum in 72-hpf embryos.
Using Morpholinos to Determine the Role of mdm1 During Zebrafish
Development
The use of synthetic antisense morpholino oligonucleotides (MOs) is the
standard method for creating gene knockdowns in zebrafish, Xenopus, and other
model systems. Successful binding of a morpholino to a gene of interest
89
requires identifying a region that is within 20 bp of the initiating AUG that allows
the MO to effectively block translation of mature mRNA molecules in vivo. It is
also possible to decrease expression of a gene by designing MOs that target
splice junctions of pre-mRNA. For developmental biology, the translation-
blocking MOs are especially useful for knocking down maternal mRNA, while
splice-blocking MOs are more effective on actively transcribed zygotic RNA.
Two transcripts produced from the mdm1 gene have been identified in
zebrafish embryos and adults. The long mdm1 transcript (VEGA mdm1-001) is
2193bp long and includes 14 exons. The short mdm1 transcript (VEGA mdm1-
002) is 2160bp long and is a splice variant that does not include exon 8.
Additionally, there is a third transcript that exists, but does not code for protein,
and therefore was not explored further.
Table 4.1: Morpholinos Used for the Gene Function Experiments
Target
Sequence
Comments
mdm1-ATG
5’-TGATTGCCTTGAAACGGACAGGCAT-3’
Translation Blocking
MO – targets the
maternal products
mdm1-Ex1
5’-TTTACAAAGCTTACCTTGAAACGGA-3’
Splice-blocker that
targets Exon 1
mdm1-Ex2
5’-CGCTGATTCCCTATTAGGAATATAT-3’
Splice-blocker that
targets Exon 2.
Labeled with Biotin
mdm1-Ex8
5’-AGTAACAGGTGAAATGTTACCTCAT-3’
Splice-blocker that
targets Exon 8/9 to
knockdown the long
transcript only
p53
5’-AGTAACAGGTGAAATGTTACCTCAT-3’
Standard supplied by
Gene-Tools, LLC.
Negative Control
5’-CCTCTTACCTCAgTTACAATTTATA-3’
Standard supplied by
Gene-Tools, LLC.
90
A translation-blocking MO was designed (mdm1-ATG) that would bind to
maternal mRNA from both mdm1 transcripts. Several MOs were also generated
to target specific splice junctions. These MOs allowed for the knockdown of both
zygotically active mdm1 transcripts or the knockdown of a single transcript
depending on the target (Table 4.1, Figure 4.4). For all injection experiments,
not-injected embryos, dye-only injected embryos and embryos injected with the
standard negative morpholino were also raised as controls.
Figure 4.4: Schematic of the mdm1 Coding Sequence (Long Transcript from VEGA), showing the
locations of exons, 5’-UTR, 3’UTR, Start and Stop Codons and approximate Morpholino Target
Sites. The mdm1-Ex1 MO is not shown here since it was designed to target Exon 1 in the 5’UTR
sequence that was originally not included in the gene sequence.
91
Effects of the mdm1 ATG-Blocking Morpholino in WT(AB) Embryos: To
investigate the role of mdm1 in zebrafish development, the processed maternal
transcript was first knocked down by a translation blocking MO, mdm1-ATG, in 1-
to 8-cell stage embryos. Since both mdm1 protein-coding transcripts have
identical 5’-coding sequence, using this MO allowed for the knockdown of both
transcripts to occur simultaneously. This MO appeared to be most effective
when 8-10nL of solution was injected at concentrations of 200-350µM. As
described in Chapter Two, the mdm1-ATG MO was also supplemented with
50µM p53 MO to reduce necrosis in the injected embryos. Following the mdm1-
ATG MO injections, a range of phenotypes was observed in 24-hpi embryos
(Figure 4.5). Headless embryos that died shortly after 24-hpi were the most
extreme of the observed phenotypes, while most of the injected embryos
appeared to have defects in head and eye development, typically resulting in an
embryo with a smaller than average head and tiny, underdeveloped eyes.
Defects in tail development were also noted in approximately 50% of the
embryos.
Injected embryos that survived to 72-hpi were also photographed and any
abnormal phenotypes were recorded. The most obvious and consistent
phenotype was that of embryos with eye deformities that ranged from small
underdeveloped retina to embryos with completely missing eyes (Figure 4.6).
This was noted in a large percentage of the injected embryos, as well as tail and
some head irregularities (Table 4.2). This information was critical, since it
appeared to be consistent with the previous in situ data, suggesting that the
92
mdm1 gene is expressed during the development of the primordial eye and CNS,
and specifically within those tissues in the 24- to 72-hpf embryo.
Figure 4.5: Photos of 48-hpi WT(AB) zebrafish embryos that were injected with the mdm1-ATG
Morpholino supplemented with 50µM p53 Standard Morpholino. (A) Embryo injected with 200µM
mdm1-ATG MO exhibits a small head/small eyes phenotype following injection. (B) Embryo
injected with 250µM mdm1-ATG MO displays an abnormal tail and small head, and does not
appear to have any eye development. (C) Embryo injected with 300µM of mdm1-ATG MO
appears to have a small head with only one developing eye; this embryo also displays defects in
tail development.
Figure 4.6: Results of 250µM mdm1-ATG Morpholino Injections supplemented with the p53
Morpholino into WT(AB) Embryos shown at 72-hpi. (A) Embryo has obvious MO effects in eye
and tail development causing an abnormally stubby appearing tail and underdeveloped eyes. (B)
Embryo shown has no eye development in addition to a severe shortening of the tail. (C) Embryo
has a small, abnormal sized head and severely underdeveloped eyes; tail is of normal length
although it is slightly twisted.
Effects of the mdm1 Splice-Blocking Morpholinos in WT(AB) Embryos:
Since the Mdm1 custom antibodies analyzed in Chapter Three did not properly
detect the in vitro synthesized Mdm1 protein or Mdm1 in the embryo lysate,
93
verification of the knockdown by western blot analysis was not an available
option. Fortunately, RT-PCR can be used to determine the effectiveness of
splice-blocking MOs (Morcos 2007). Therefore, if the phenotypes observed
following knockdown by a splice-blocking MO are identical to the results
observed following the translation blocking MO, and the RT-PCR results suggest
that the mdm1 transcripts were knocked down, it can be concluded that the
translation-blocking MO results are valid. Three different splice-blocking MOs
(Table 1) were custom ordered from Gene-Tools to inhibit splicing at different
intron-exon boundaries (mechanisms of MO action are explained in Chapter
Two). Figure 4.4 shows the location of MO target sites within the mdm1 gene.
Splice-blocking MOs were first designed to target both of the mdm1
transcripts. The mdm1-Ex1 MO was injected into WT(AB) embryos at a range of
concentrations from 200-550µM with and without p53 MO supplementation.
Regrettably, none of the injected embryos presented with any effects from the
injections, implying that this particular MO did not work. Experiments continued
by injecting the embryos with the mdm1-Ex2 MO that blocks splicing of Exon 2 of
the mdm1 mRNA. Eight-10nL of this MO at a concentration of 250-300µM was
injected into embryos as described above (Figure 4.7). Knockdown of the mdm1
mRNA was successful with the mdm1-Ex2 MO resulting in the same range of
phenotypes in the morphants as observed from the translation-blocking MO
experiments. These results not only confirmed the translation-blocking MO
results, but also resulted in approximately 50% of the mdm1-Ex2 MO injected
embryos exhibiting spontaneous rescue between 24- to 48-hpi. This result may
94
be due to the significant increase in mdm1 transcripts after 24hpf that may titrate
down the amount of the MO, resulting in a decrease the effectiveness of the
splice-blocker after 24-hpi.
Figure 4.7: Results from Injection Experiments of the mdm1-Ex2 MO into Zebrafish Embryos.
All embryos shown were injected with the mdm1-Ex2 MO, and are approximately 48-hpi. (A)
Injected with 200µM MO and has obvious defects in eye and tail development. (B) Embryo
injected with 250µM MO and also shows severe defects in eye and tail development. (C) Embryo
injected with 300µM MO and appears to have a delay in development of the tail and eyes. All
embryos shown also have pericardial edema, which is most likely a result of the injection process.
To determine whether there were any differences in resulting phenotypes
when knocking down both mdm1 transcripts as opposed to knocking down just
the long transcript, the mdm1-Ex8 MO was specifically designed to target the
mdm1-001 (VEGA) transcript and test this hypothesis. When injected into
embryos, even at extremely low doses (50µM), this particular MO was completely
lethal within a few hours following the injection. This was an unexpected result
since none of the other mdm1 MOs showed this level of lethality. Therefore the
sequence of the mdm1-Ex8 MO was re-evaluated to determine if it may be
targeting other sequences. BLAST analysis of the mdm1-Ex8 MO sequence
revealed that it actually targeted multiple transcripts on a majority of the zebrafish
chromosomes and was most likely knocking down multiple genes in the embryos.
95
The only difference between the two protein-coding mdm1 transcripts is exon 8,
which is very small, consisting of 11 amino acids. In an attempt to design
another MO that would target just the longer transcript, it appeared that any MO
designed around the 5’ and 3’ splice sites of exon 8 would result in a MO that
targets multiple genes, based on BLAST analysis.
Since both mdm1-ATG MO and mdm1-Ex2 MO had similar results when
injected into WT(AB) embryos, they were co-injected in combination with and
without the p53 MO (mdm1-ATG/mdm1-Ex2 combination). Interestingly, even at
very low concentrations (50-100µM), the combination of these MOs was
extremely lethal, and resulted in 0% survival after 24-hpi. A summary of the MO
injection experiments is presented in Table 4.2. It is important to note that the
total number of injected embryos does not include the embryos used for controls
including the dye-only, buffer-only and standard negative control injected
embryos. These embryos did not exhibit any developmental abnormalities
following control injections. Additionally, several clutches of embryos injected
with dye or buffer only were raised and bred, indicating that the injections did not
interfere with development and fertility.
96
Table 4.2: Overview of Morpholino Injection Results.
mdm1-ATG MO
mdm1-Ex1
MO
mdm1-Ex2
MO
mdm1-Ex8
MO
+ p53
- p53
+ p53
- p53
+ p53
- p53
+ p53
- p53
Survival at
24-hpi
78%
52%
20%
14%
62%
32%
0%
0%
Survival at
48-hpi
89%
80%
98%
96%
95%
88%
-
-
No Head
Development
9%
13%
-
-
16%
16%
-
-
Small Heads
Only
15%
21%
-
-
11%
28%
-
-
Small
Heads/Small
Eyes
62%
56%
-
-
64%
51%
-
-
Small
Head/No Eyes
10%
7%
-
-
6%
4%
-
-
Tail Defects
43%
56%
2%
4%
43%
56%
-
-
No
Abnormalities
Observed
4%
3%
98%
96%
3%
1%
-
-
Total Injected
1926
882
305
298
2792
455
764
510
Results include all of the experimental injections for the above-mentioned mdm1 MOs with and
without the supplementation of the p53 Standard MO (the p53 supplementation was 50µM
concentration of the p53 MO added to the experimental mdm1 MO solution). The mdm1-ATG
MO was injected into 1-2 cell zebrafish embryos at a range of concentrations between 200-
350µM in a 0.1% Phenol Red solution. The mdm1-Ex1 MO was injected into 1-2 cell zebrafish
embryos at a range of concentrations between 200-550µM in a 0.1% Phenol Red solution.
Following these injections, it was apparent that the mdm1-Ex1 MO was not correctly targeting the
mdm1 mRNA, as determined by observing 96-98% of injected zebrafish embryos with no defects
or abnormalities following the injections. The mdm1-Ex2 MO was injected into 1-2 cell zebrafish
embryos at a range of concentrations between 250-300µM in a 0.1% Phenol Red solution. The
mdm1-Ex8 MO was injected into 1-2 cell zebrafish embryos at 50µM (initial injections for this MO
were concentrations between 200-400µM, but the concentration was reduced based on the
lethality of this MO). Due to the lethality of this MO at low concentrations, the MO sequence was
analyzed using BLAST, which revealed that it targets multiple transcripts on several
chromosomes. Based on the data and observations noted above, it appeared that both the
mdm1-ATG MO and the mdm1-Ex2 MO were causing similar defects during the development of
zebrafish, which focused on the development of the head and eyes. Interestingly, approximately
50% of the injected embryos were observed to have defects in tail development.
Whole-mount Antibody Staining of mdm1-Ex2 Injected Embryos: In
addition to confirming the morpholino injections by RT-PCR analysis, embryos
injected with the mdm1-Ex2 MO were also subject to an in situ antibody staining
97
procedure that was used to detect the biotin label of that particular morpholino.
This technique allowed for the visualization of morpholino target tissues within
the whole injected embryo, and also enabled the verification of earlier whole-
mount in situ hybridization data. The 3’- biotin label on the mdm1-Ex2 MO is a
394kDa affinity tag that can be detected with avidin or streptavidin conjugated
with alkaline phosphatase.
Figure 4.8: Structure of the Biotin label added to the mdm1-Ex2 MO (from Gene Tools, LLC.).
Embryos were injected with the mdm1-Ex2 MO with p53 MO
supplementation as previously described. Injected embryos were kept at 26-
27oC in petri dishes containing aquarium water with Methylene Blue, and
collected at several developmental stages including 18-somite (18-hpi) through
prim-6 (25-hpi). Following photodocumentation of the injected embryos, they
were euthanized in Tricaine-S on ice and prepared accordingly for the antibody
staining protocol described in Chapter Six. Colorimetric detection with
Streptavidin-AP and NBT-BCIP was terminated after several minutes of
treatment. The embryos were placed in glycerol to clear and were subsequently
photographed.
98
Since the morpholino specifically targets mdm1 RNA, it was expected that
the results from the antibody staining procedure would be similar to the in situ
hybridization data from previous experiments where the mdm1 transcript
expression within the embryo tissue was identified. As Figure 4.9 shows, there is
a striking similarity between the antibody staining results and the initial in situ
hybridization data. In both experiments mdm1 RNA appeared to be expressed
significantly in the anterior portion of the embryo, specifically in the CNS and
primordial eye tissues. The morpholino injection and rescue results also
suggested that mdm1 may also be involved in the development of the tail, based
on the observed phenotypes. In a 19-hpi embryo (Figure 4.9A), the morpholino
appears to localize to regions of the CNS, specifically the diencephalon,
midbrain, telencephalon and otic primordium. At approximately 22-hpi (Figure
4.9B), staining continues to appear robust within the diencephalon, midbrain and
telecephalon. Additionally, the morpholino appears to localize within the optic
cup, epiphysis and cerebellum. Similar staining was also observed in the 25-hpi
embryos (Figure 4.9C and 4.9D), although the most intense staining occurred
within the optic cup, lens, epiphysis and hindbrain. It is also important to note
that all of the embryos had noticeable staining in the posterior portion of the tail,
that may correspond to the tail defect phenotype that was observed during the
injection experiments.
99
Figure 4.9: Whole-mount Antibody Staining of Morpholino Injected Zebrafish Embryos (A) 19-hpi
injected embryo shows very distinct staining in the diencephalon, telencephalon and midbrain (B)
Robust staining in the 22-hpi injected embryo indicates localization of the MO in the cerebellum,
optic cup and epiphysis (C) Staining is also noted in the lens and hindbrain in the 25-hpi injected
embryo (D) Lateral view of the 25-hpi injected embryo also shows staining in the optic cup and
lens.
RNA Rescue of the Morphants: Although the results from the translation
and splice blocking morpholinos were exciting, it was important to confirm that
the phenotypes observed were due to the knockdown of the mdm1 gene and not
due to non-specific effects of the morpholino injections. One method to validate
the results is to utilize RNA rescue experiments. The mMessage mMachine T7
kit (Ambion) was used to synthesize in vitro capped mRNA of the full-length
mdm1 gene with the Kozak sequence. A pCR4 clone containing the confirmed
sequence was used for the transcription reaction (cloning and sequencing of the
100
gene is described in Chapter Three). Following the transcription reaction, the
RNA was diluted 1:5 in 0.1M KCl and stored in 5µl aliquots at -80oC. Prior to
storage, the concentration of one aliquot was determined by spectrophotometry.
In order to control the RNA rescue experiments, the embryos were
injected twice; first they were injected with the morpholino and then they were
injected with the specific RNA (Ekker & Larson 2001; Nasevicius & Ekker 2000).
Up to 100 embryos at a time were placed under the dissecting microscope and
injected with the appropriate concentration of either the mdm1-ATG or mdm1-
Ex2 MOs with p53 MO supplementation. Once the embryos were injected with
the morpholino solution, half of the embryos were removed and placed in a petri
dish containing aquarium water with Methylene Blue and stored at approximately
27oC in an incubator. The remaining embryos were then injected with 8-10nL of
a 50-75pg dose of the capped mRNA. This procedure was repeated until all
embryos were injected, and continued over a several week period. Additionally,
not-injected embryos, dye-only injected embryos and embryos injected with the
standard negative morpholino were also raised during each weekly injection
session as controls. The embryos were then compared to each other to identify
whether the morpholino effects were rescued.
Figure 4.10 shows a WT(AB) not-injected embryo, an mdm1-Ex2
morphant, and the RNA rescued embryo. Based on the observed phenotypes of
the RNA rescued embryos, 98% of the RNA injected embryos appeared to have
wildtype characteristics, including appropriate developing tails, heads and eyes,
as compared to the morphants. Since the tail phenotype was also rescued in
101
these experiments, it can be concluded that the mdm1 gene may be involved in
the development of the tail as well as the eye in the early zebrafish embryo.
Figure 4.10: Zebrafish embryo morpholino rescue experiments (A) Not-injected 48-hpf golden
heterozygous embryo control (B) mdm1 MO knockdown in a golden heterozygous embryo (C) 48-
hpi golden heterozygous embryo first injected with the mdm1-Ex2 MO, then injected with
synthesized mdm1 mRNA for a full rescue of the normal phenotype.
Confirming the Injection Experiments and Validating the mdm1 Gene
Analysis
It was important to verify that the mdm1 MOs were actually targeting the
mdm1 mRNA within the zebrafish embryo. Two approaches were taken to
explore the specificity of the knockdown experiments. First, embryos injected
with the mdm1-Ex2 MO were collected and analyzed for mdm1 transcript
expression by RT-PCR. Second, an in vitro experiment was designed to test
whether the mdm1-ATG MO successfully targeted the processed mdm1
transcript. This allowed for the visualization of decreasing Mdm1 protein
expression with the addition of morpholino to the reaction mix.
102
RT-PCR Analysis of Injected Embryos: All embryos from the knockdown,
rescue, and overexpression experiments were collected into RNA Later (Qiagen),
along with non-injected embryos, and used for analysis by RT-PCR. Total RNA
was isolated from each set of embryos, and primers for mdm1 were used to
amplify the full-length coding sequence from each set of RNA. The prediction
was that embryos injected with mdm1 MOs will show decreased levels of mRNA
from the gene. These experiments to confirm the specificity of the effect of the
MO in the injected embryos were performed in triplicate, using embryo RNAs
from 14 injection sets. Representative data from the RT-PCR experiments is
shown in Figure 4.11.
The RT-PCR results suggest that the mdm1-Ex2 MO knockdowns were
efficient in targeting the mdm1 transcripts in the zebrafish embryos. The
observed level of the mdm1 transcripts in Lane 4 is significantly reduced from the
normal expression shown in Lane 3 from the non-injected WT(AB) embryos.
Although there is a weak band in Lane 4, which shows amplification from the
morphant RNA, it is reasonable to conclude that the phenotypes observed
following the MO injection was due to the mdm1-Ex2 MO. Additionally, the
results in Lane 5 suggest that the RNA rescue phenotypic effects observed
following the injections were also a result of successful knockdown and rescue of
the mdm1 gene in the zebrafish embryos, since the resultant cDNA band on the
gel is consistent with the band in Lane 3. Interestingly, the embryos only injected
with the mdm1 synthesized capped mRNA, had approximately the same RT-
103
PCR expression results of mdm1 as the non-injected and RNA rescued embryos.
This result was observed numerous times.
Figure 4.11: RT-PCR Confirmation of the Injection Experiments in Zebrafish Embryos.
Applying the in vitro Transcription and Translation System to Confirm the
Translation-blocking Effects of the mdm1-ATG Morpholino: By knocking down
mdm1 mRNA, the MDM protein is presumed to also be depleted in the injected
embryos, which would give the resulting phenotypes that were observed in the
morphants (Figures 4.5 - 4.7). Without antibodies specific to the zebrafish Mdm1
protein, verifying MDM protein appeared to be a difficult undertaking in vivo. For
this reason, the question was asked if it was possible to study the effect of the
mdm1-ATG MO on protein levels in vitro. Previous experiments that utilized the
Promega TnT kit resulted in the expression of the synthesized Mdm1 protein on
104
a western blot, which utilized biotinylated tRNA (lysine) and was then detected
with Streptavidin-AP and stained with NBT-BCIP (Chapter Three). Using various
dilutions of the mdm1-ATG MO in nuclease-free water, 0.5µl of each dilution was
added to a 10µl reaction containing the TnT mastermix, amino acid mixture,
biotinylated tRNA (lysine), and the full-length mdm1 clone in the pCMVTnT
Vector (Promega). The reaction products were then diluted 1:10 in Sample
Buffer, run on an SDS-PAGE gel, and transferred to a nitrocellulose membrane.
The TnT products were detected as previously described (Chapter Three) and
the results are shown in Figure 4.12.
As Figure 4.12A indicates, the increased concentration of the mdm1-ATG
MO added to the TnT reaction appears to decrease the expression of the
synthesized Mdm1 protein on the western blot. These results were very exciting
since they illustrate a novel way to confirm the MO targeting in vitro without a
specific antibody. Importantly, the approximate concentrations of the mdm1-ATG
MO injected into the live zebrafish embryos correspond with the total
concentration of MO in lanes 10-12 in Figure 4.12A. Since the MO added to the
TnT reaction significantly decreased the expression of the Mdm1 protein in vitro,
it is likely that the resulting phenotypes from the mdm1-ATG MO injections are
due to the decrease in maternal mdm1.
105
Figure 4.12: In vitro Synthesis of the Mdm1 Protein with Various Concentrations of the mdm1-
ATG MO to Test for Specificity. (A) The western blot of the Mdm1 TnT products with an
increasing amount of MO added to each reaction. (B) The concentration added to each TnT
reaction.
Testing mdm1 for Genomic Instability and Overexpression Experiments
Testing for Genomic Instability: Based on previous studies and mapping
experiments, the mdm1 gene is located within the gin-12 candidate region on
chromosome 4. While the interest of the experiments described throughout this
chapter were designed to determine the developmental role of the mdm1 gene, it
was also important to continue investigating mdm1 as a potential gin-12
candidate by exploiting the knockdown coupled with the mosaic eye assay. For
these experiments, golden heterozygous embryos were injected with various
concentrations of the mdm1-ATG MO with and without the supplementation of
the p53 MO. Embryo survival at 24-hpi was maximized by the addition of the p53
106
MO, as described in Chapter Two, specifically when embryos were injected with
8-10nL of 250µM MO solution in Danieau Buffer with 0.1% Phenol Red.
Unfortunately, mosaic eyes did not result in any of the golden heterozygous
injections, suggesting that the mdm1 gene was no longer a gin-12 candidate.
Overexpression Analysis of the mdm1 Gene in Zebrafish Embryos: Since
the mdm1 gene was originally identified in transformed 3T3DM cells that
expressed the gene, it was of interest to determine the effect of overexpression
of mdm1 mRNA in embryos. These experiments were carried out by injecting
both WT(AB) and golden heterozygous embryos so that the mosaic eye assay
could be used to observe potential genomic instability. The same in vitro
synthesized capped full-length mdm1 mRNA was utilized for this experiment that
was used in the previous RNA rescue experiments. Approximately 100pg of
mdm1 mRNA was injected into 1-8 cell golden heterozygous and WT(AB)
embryos, which were then kept in aquarium water at 26-27oC in an incubator and
monitored daily to remove any debris or decayed embryos and replenish the
water. At 48-hpi, the golden heterozygous embryos were placed in 2X Tricaine
solution (anesthetized) and screened for mosaicism. The injected WT(AB)
embryos were screened for any abnormalities, then subsequently photographed
and collected into RNA Later (Qiagen).
107
Figure 4.13: Injection of synthesized full-length mdm1 mRNA into golden heterozygous
zebrafish embryos. (A) 48-hpf Not-Injected embryo (B) Embryo injected with RNA.
Figure 4.13 shows that the embryos injected with an abundance of mdm1
mRNA exhibit a fully wildtype phenotype. There appears to be a slight delay in
pigment cell migration that is often a result from the injection itself and has been
observed in all of the previous injection experiments. In the golden
heterozygotes, some areas of the RPE appear lighter in color; however these are
not the expected golden-colored patches observed in true mosaics, but rather
layers of cells that have not developed pigment. By 72-hpi, these embryos had
completely black-pigmented eyes, confirming that the mdm1 gene did not have
genomic instability activity in developing embryos by overexpression.
Summary of Experimental Results:
• The semi-quantitative RT-PCR results suggest that the expression of the
mdm1 gene in developing zebrafish embryos is quite varied. Interestingly,
although this procedure was repeated several times using various embryo
RNA samples, the RT-PCR results indicated that the expression of mdm1
108
transcripts is quite low in 18-hpf embryos. It has been shown with other
experiments that there is in fact, mdm1 expression in 18-hpf embryos and
that it may potentially be involved in CNS and eye development at this
stage.
• Whole-mount in situ hybridization was used to identify the spatial
expression of the mdm1 transcript within specific embryo tissues. These
results suggested that the mdm1 transcripts were initially expressed
ubiquitously throughout the embryo, and then became confined to the
anterior or cephalic region. This indicated that the mdm1 gene may play a
role in CNS development.
• Several morpholino oligonucleotides were designed to specifically target
one or both mdm1 transcripts within the zebrafish embryo. Unfortunately,
two of the splice-blocking morpholinos did not appear to effectively target
the mdm1 gene as they either gave a “no effect” or “completely lethal”
result. However, defects in eye, head and tail development were observed
in embryos injected with either the mdm1-ATG MO or the mdm1-Ex2 MO,
suggesting that these morpholinos are both correctly targeting the mdm1
gene, and that it is in fact involved in the development of the CNS,
particularly the eye.
• RNA rescue experiments were performed in order to confirm the observed
morpholino phenotypes that occurred from the mdm1 morpholino injections.
Embryos that were co-injected with morpholino and the in vitro transcribed
109
capped mdm1 mRNA displayed a full rescue phenotype of eye, head and
tail development.
• Staining for the biotin label in whole embryos also confirmed much of the
results from previous experiments that the mdm1 gene is expressed
significantly in the anterior portion of the embryo, particularly the CNS and
eye. These results also verified the in situ data of RNA expression.
Interestingly, it also suggested that the mdm1 RNA is expressed in
primordial eye and CNS at approximately 19-hpi, which is a slightly different
result than the earlier semi-quantitative RT-PCR findings. Overall, these
results confirm the expression of the mdm1 RNA and the targeting ability of
the morpholino within the embryo. Additionally, these results imply that the
mdm1 gene is a key component in the development of the eye in zebrafish
embryos.
• The injection experiments were validated by RT-PCR analysis using total
RNA from non-injected, mdm1-Ex2 injected, RNA Rescued, and RNA
overexpressed embryos. The results confirmed that the mdm1 gene is:
o Expressed in non-injected embryos
o Was knocked down in the morpholino injected embryos
o Can be rescued in the morpholino-injected embryos with the mdm1
RNA. Additionally, the mdm1 transcript expression did not appear
to change in the embryos injected with the in vitro transcribed
mRNA.
110
• Novel use of the in vitro Transcription and Translation kit to detect the
effectiveness of the mdm1-ATG MO targeting proved to be successful.
This allowed for the verification of the translation-blocking MO without
having a specific antibody reactive to zebrafish Mdm1. Since there are
relatively few zebrafish antibodies available, this technique is extremely
useful for rapid confirmation of decreased protein expression levels in vitro.
• Morpholinos were also used to test for genomic instability activity of mdm1
in golden heterozygous embryos, as mdm1 was currently a candidate gene
on the gin-12 list. In embryos with at least one developing eye, mosaics
were not observed, resulting in mdm1 no longer being considered a gin-12
candidate gene. Overexpression of the mRNA was also performed in
golden heterozygous embryos to determine if this caused genomic
instability activity in the embryo. Again, mosaics were not observed in any
of the injected embryos. Thus, it appears that mdm1 has no potential
genomic instability activity.
111
CHAPTER FIVE
CONCLUSIONS, IMPLICATIONS, AND FUTURE DIRECTIONS
Conclusions and Implications
The overall purpose of this research was to identify and characterize a
unique set of genomic instability mutants in the freshwater zebrafish. These gin
mutants exhibit increased incidence of somatic mutation during early
embryogenesis. Identifying the genes responsible for these modifications in the
zebrafish model will eventually lead to a better understanding of the development
and disease in humans.
The data presented throughout this dissertation demonstrate an in depth
investigation into the developmental expression and function of several genes,
located within known regions of genomic instability activity in the zebrafish model
organism. This project had three distinct objectives.
1. Chapter Two focused on the first objective, which was to explore
candidate genes within the gin-10 region of chromosome 18. Specifically,
the RNA expression and developmental function of synbl, rfx4, and sir2
genes were examined.
112
2. Chapter Three, dealt with the optimization of Mdm1 protein expression
experiments and determining the specificity of custom zebrafish Mdm1
antibodies.
3. Chapter Four focused specifically on the expression and function of the
mdm1 gene, a candidate for the gin-12 studies, during the early zebrafish
developmental stages.
All of the gin-10 Candidate Genes showed both Maternal and Zygotic
Gene Expression: Preliminary genetic studies determined that the gin mutants
required both maternal and zygotic expression in developing zebrafish. Using
RT-PCR, ten candidate genes were analyzed in WT(AB) embryos for maternal
and zygotic gene expression using 4-hpf and 24-hpf embryo RNA. Interestingly,
all of the candidate genes tested appeared to have both maternal and zygotic
transcript expression (Table 2.1). Predicted Sanger and NCBI orthology
information for the gin-10 candidate genes was used to select the top three
candidate genes, synbl, rfx4, and sir2 for future experimental focus. Transcript
expression analyses of these genes utilized the semi-quantitative RT-PCR and
whole-mount in situ hybridization techniques (Figures 2.5, 2.7, and 2.8). The rfx4
and sir2 transcripts appeared to have very distinct patterns of expression
throughout the zebrafish embryogenesis according to the semi-quantitative RT-
PCR data.
While exploring the synbl candidate gene, a paralog, ric8a, was found
during the database searches. Since it appeared that these paralogs were
113
involved in asymmetric cell division in other organisms, it was important to look
for any variations in the temporal and spatial expression of these genes during
development to determine whether they function cooperatively or have diverged
in function during teleost evolution. There was a very interesting difference in the
pattern of expression between the synbl paralogs during early zebrafish
development. The maternal expression of synbl is robust at 4-hpf, then a distinct
transitional period occurs when active zygotic transcription of the synbl gene
appears around 12-hpf. Expression levels appear to peak at 24-hpf but are still
detectable through 7-dpf. The ric8a gene does not appear to have maternal
expression or be actively transcribed in the embryo until approximately 18-hpf
and peaks at 72-hpf. It is clear that there is some divergence in the expression
of these genes during zebrafish development.
The Developmental Functions of Several gin-10 Candidate Genes were
Identified by Morpholino Injections: Translation-blocking MOs were designed to
target each of the gin-10 candidate genes and the ric8a gene (Table 2.2).
Additionally, a splice-blocking MO was designed for the synbl gene, which was
used alone and in combination with the ric8a MO and synbl-ATG MO. Injections
were performed in both WT(AB) and golden heterozygous embryos, which
allowed for the use of the mosaic eye assay to determine if the gene knockdown
led to mosaic eyes. The results of the MO injections suggested that none of the
targeted genes had genomic instability activity, since mosaic eyes were never
observed at 48- through 72-hpi (Figure 2.11). However, these experiments were
114
important to understand the general role of each of these genes in zebrafish
development. For example, based on the injection experiments and the resulting
phenotypes of the morphants, it appears that the sir2 gene is involved in
metabolic activity and had a 90-100% lethality rate in the injected embryos by 48-
hpi. These results further suggest that the zebrafish sir2 gene is more closely
related to the human sirt3 gene, which has been implicated in the regulation of
metabolic processes. Based on the morpholino and cloning data, it has been
concluded that the zebrafish sir2 gene is no longer a gin-10 candidate, but may
become useful for studying metabolic regulation and adaptive thermogenesis in
zebrafish.
When using the MOs to determine differences in the function of the synbl
and ric8a genes, it was determined that although some off-target effects occurred
in the development of the tail, both MOs caused cerebral edema and the general
abnormal development in the brain, as compared to the non-injected embryos.
Some published data had suggested that the synbl gene is involved in the
migration of pigment cells of the developing zebrafish. Interestingly, all of the
synbl, ric8a and combination injected embryos had normal looking melanocytes
that appeared to migrate properly. Based on these results, it is unclear whether
the morpholinos used (synbl-ATG, synbl-splice, and ric8a-ATG) were correctly
targeting the appropriate transcripts. However, it is important to note that similar
phenotypes were observed from each of these MO injections and when injected
in combination, which suggests the reported data is consistent with synbl and
ric8a function in the developing embryo. When applying the mosaic eye assay to
115
all of the knockdowns performed, it appears that none of the genes tested had
genomic instability activity.
Re-Mapping the Viral Insert of the ZIRC Transgenic Fish Line Led to an
Unexpected Result: To continue the research on the synbl paralogs, zebrafish
embryos containing a transgenic viral insert were purchased from the Zebrafish
International Research Center in Oregon. Self-crosses of the Tg-synbl fish were
performed and the resulting embryos were injected with synbl-ATG, ric8a-ATG or
synbl-splice/ric8a-ATG MOs to determine the effect of these knockdowns in a
synbl null background. The phenotypic results of these morphants did not vary
from the initial synbl injection experiments, which was an unexpected result
(Figure 2.12). Furthermore, the self-crosses did not result in a 25% dead-loss of
homozygous mutants, and therefore the transgenic insert was remapped in order
to determine the exact chromosomal location. Genomic PCR and cloning
analyses repeatedly suggested that the transgenic insert was not affecting the
synbl gene, but rather it was located within the second intron of the cry1b gene
(Figure 2.15, Table 2.3). The cry1b gene is also on chromosome 18 and is
located within the gin-10 region; however, it is on the adjacent contig to the
location of the synbl gene, and appears to be involved in circadian rhythms
according to recent published reports. Without having the appropriate transgenic
fish for these studies, moving forward to determine the developmental
differences of these genes in vivo was not plausible at the time.
116
Protein Expression Studies were Optimized in the Zebrafish Model for
Future Experiments to Study Mdm1 Protein Interactions: Studying protein
expression by western blotting and other techniques is a trivial component in
many research laboratories. However, it is highly underused in the zebrafish
community due to the unavailability of zebrafish specific antibodies and
protocols. For this reason, custom Mdm1 antibodies were designed and ordered
to look at the expression of this protein during zebrafish development, and use it
for protein-protein interaction studies to determine whether the Mdm1 protein is
involved in the regulation of the p53 tumor suppressor or another component of
its pathway. As Chapter Three describes, much of the initial effort was placed on
optimizing the lysate preparation and western blotting techniques using various
stage zebrafish embryos (Figure 3.1). Once a protocol was defined, it was
imperative to ensure the quality and specificity of the custom antibodies. The
use of the in vitro transcription and translation kit was utilized for this purpose, to
synthesize the Mdm1 protein and several control proteins that were run on the
western blots with embryo lysate to test for the specificity of the custom
antibodies (Figure 3.5). Repeatedly, the results indicated that the custom Mdm1
antibodies did not detect the Mdm1 protein (74 kDa), but rather a protein at
approximately 55 kDa; the custom antibodies also did not detect the synthesized
Mdm1 protein on any of the blots (Figures 3.6 and 3.7).
To further study the Mdm1 protein interactions in vivo without an antibody,
injecting embryos with FLAG or 6X-His tagged Mdm1 protein would potentially
allow for the co-immunoprecipitation of the tagged Mdm1 and interacting proteins
117
for analysis. It was unfortunate that during the time spent on cloning these tags
into the full-length mdm1 sequence, none of the clones analyzed by restriction
digests or sequencing contained the tags (Figures 3.11 and 3.15). Rather than
struggle with the protein expression studies, analyzing the developmental
function and expression of the gene was pursued. Since little was known about
the mdm1 in zebrafish or other organisms, using knockdown technologies and
developing novel techniques for these studies was crucial in identifying it’s
biological role during development.
The mdm1 Gene is Involved in the Development of the Zebrafish Eye and
CNS: Using many of the techniques described in Chapter Two, the
developmental expression patterns (both temporal and spatial) of the mdm1
gene were explored specifically in Chapter Four. Expression analysis results
consistently showed that the transcript expression of mdm1 was extremely varied
during development, implying that the transcription of this gene was highly
regulated during specific developmental time points (Figure 4.2). The in situ
hybridization data also suggested that the gene expression of mdm1 was
localized to the head of the embryo from approximately 24-hpf through 72-hpf
(Figure 4.3).
Morpholinos were also used for the targeted knockdown of the mdm1
transcripts in vivo (Table 4.1). Two of the mdm1 MOs, a translation-blocker and
a biotin-labeled splice-blocker, reliably gave the same phenotypic results in the
morphants. This data showed that the mdm1 gene is involved in the
118
development of the eye and CNS, since the knockdowns caused abnormal
development of the eyes and portions of the brain (Figures 4.5, 4.6, and 4.7). In
higher concentrations of the MOs, embryos would develop without eyes;
however, the survival of these was limited. To prove that the effects of these
MOs were not due to off-target events, RNA rescue, biotin staining for the splice-
blocking MO, and RT-PCR experiments were performed (Figures 4.9, 4.10, and
4.11). The combined results of these experiments were exciting in that they all
appeared to confirm the appropriate targeting of the mdm1 splice-blocking MO
and even the earlier in situ expression analysis. Importantly, these results imply
that the mdm1 gene is a key component in zebrafish eye development.
It was also important to show that the mdm1-ATG MO was also correctly
targeting the mdm1 gene. However, the only known way to determine this is by
using western blot analysis to look at the decrease of protein expression
following the injection. Using the tools available to the lab, a novel approach was
developed that allowed for the visualization of the MO effects on the synthesized
Mdm1 protein. By adding different concentrations of the mdm1-ATG MO to TnT
reaction samples, along with the biotin labeled tRNA (lysine), the final products
were run on a gel and detected with streptavidin. The results demonstrated the
successful targeting of the MO to the Mdm1 protein by decreasing protein
expression, which corresponded to the addition of increasing concentrations of
MO (Figure 4.12). The success of this technique to show direct targeting of the
MO in vitro should prove to be a rapid and useful tool for the zebrafish research
community. In addition to this in vitro approach to testing for morpholino
119
specificity, it may be possible to also show a rescue in this system by imitating an
in vivo rescue experiment by adding synthesized mRNA to the reactions.
Although this method has not yet been tested, it may prove to be an invaluable
step in assessing the specificity and quality of morpholinos prior to embryo
injections.
Finally, the underlying goal was to determine whether the mdm1 gene had
any genomic instability activity in the developing zebrafish embryo, as it was
identified within the gin-12 region of chromosome 4. Knockdown and RNA
overexpression experiments of the mdm1 gene in golden heterozygous embryos
did not give rise to mosaics. Additionally, the phenotype of the mdm1 RNA
injected embryos was normal as compared to non-injected embryos (Figure
4.13). From these results, it can be concluded that the mdm1 gene is no longer
a gin-12 candidate.
Future Directions
The gin-10 Project: Since the genes that were focused on in the current
project did not lead to any genomic instability activity in the zebrafish embryos
with the knockdowns, it is important to reevaluate the genes within the mapped
gin-10 region. The most recent annotated zebrafish chromosome 18 information
had suggested that some of the candidates listed in Table 2.1 are actually
located outside the gin-10 region, while new genes have recently been identified.
Some preliminary RT-PCR for those genes has been done (Appendix A)
although much more work is needed for the continuation of this project. While
120
knocking down individual candidate genes is a necessary component of this
project, it may not be an effective way to identify the cause of genomic instability
activity since it can be expensive to design the MOs and is very time consuming.
An alternative approach may be to use microarrays and comparative genomics
with cDNA from the known gin-10 carriers and either WT(AB) or golden fish to
determine the location of the loss of expression on chromosome 18 that leads to
the mosaic phenotype. It would also be interesting to look at the upstream and
promoter regions of the genes within the mapped gin-10 area, to identify
important transcription factor binding sites and other regulatory elements that
may be involved in the cause of genomic instability in these gin mutants.
Another direction that can be taken, although difficult in the zebrafish, is to
fluorescently label specific genes within the gin-10 region for fluorescent in situ
hybridization (FISH) analysis of chromosome spreads. It is possible that the
genomic instability is caused by a loss of function of more than one gene in this
region, which may not be found by individual gene knockdowns or even
microarrays.
The Mdm1 Protein Expression and Interaction Studies: Given that the
custom Mdm1 antibodies failed to detect the appropriate size protein in the
embryo lysate and the TnT product, it is reasonable to continue by designing
other peptides that target other regions of the Mdm1 protein. By looking at the
Mdm1 peptide sequences, it may be possible to find better epitope sites for
western blotting and co-IP techniques with zebrafish embryo lysates. While
121
having an effective antibody is important for these studies, it would be interesting
to determine what protein the custom Mdm1 antibodies were detecting at 55 kDa
protein on the western blots. Running an SDS-PAGE with zebrafish embryo
lysate and cutting out the 55 kDa proteins for mass spectrometry analysis or
using the antibody for an immunoprecipitation (IP) combined with mass
spectrometry may allow for this determination.
Another experimental approach that was partly explored in these studies
was adding a tag to the mdm1 sequence for protein interaction studies. Since
the 5’-region of the mdm1 sequence was modified by the addition of the Kozak
sequence and restriction sites, the research efforts focused on adding a FLAG or
6X-His tag to the 3’ sequence before the stop codon. Unfortunately, the tags
were not successfully added to the mdm1 sequence, although it did not appear
that there should be any sequence issues to complicate cloning based on the
sequence information. Another method would be to clone the full-length mdm1
gene without the stop codon (insert a restriction site immediately before the stop
codon), and insert this sequence into a vector containing the tag of choice. Upon
verification of the correct reading frame, this can be synthesized in vitro and the
tagged protein can be injected into zebrafish embryos and used for co-IPs to look
at potential Mdm1 protein interactions. Although this would not allow for
exploring the endogenous Mdm1 protein interactions, it could give rise to
pertinent preliminary protein data and lead to the identification of the pathways
that Mdm1 is involved in. Additionally, other tags could be incorporated into the
mdm1 sequence for the same purposes.
122
Further Analysis of the Zebrafish mdm1 Gene Function: While the results
described in Chapter Four have implicated the zebrafish mdm1 gene as having a
role in eye development, and recently published data have suggested its
involvement in age-related retinal degeneration in mouse models, the next step
should be to determine the mechanisms by which the mdm1 gene functions
within the development of the eye. One approach would be to evaluate the gene
and protein expression of Mdm1 in various known zebrafish eye mutants, such
as cyclops, chokh and pax6, which are used in studying eye development and
diseases. It was clear from our studies that mdm1 plays a role in the proper
development of the eye during early zebrafish development. The wnt11 and shh
gene families are well studied and known to be involved in the development of
the eye in zebrafish. It may be possible that the Mdm1 protein functions within
these pathways or is part of a protein complex that gives way to some of the
known zebrafish eye mutant phenotypes.
Another experimental approach would be to work across species using the
arrd (retinal degeneration) mice and try to rescue the phenotype with the
zebrafish Mdm1. By doing so, it would show that the zebrafish model is useful
for evaluating human/mammalian diseases and would also provide insight into
the cause of this age-related eye disorder. Evaluating the functional role of this
gene in zebrafish and the mechanism underlying eye development may reveal
critical biological pathways that operate in maintaining the normal functioning of
the eye, or future therapeutic targets for those affected by retinal degenerative
disorders.
123
CHAPTER SIX
MATERIALS AND METHODS
Materials:
Tricaine-S (Tricaine Methanesulfonate) was obtained from Western
Chemicals Inc. (Ferndale, WA) and was reconstituted in deionized water (1.5g/L)
to make the 10X stock. CSPD (chemiluminescence substrate) and NitroBlock II
were obtained from Roche and prepared as directed from the manufacturer. 1-
phenyl-2-thiourea (PTU) was obtained from Sigma and stored as a 10mM
solution in deionized water.
Buffers and Solutions:
Embryo bleach solution is 65µl/100ml bleach in aquarium water.
Methylene blue solution is 0.0015M Methylene Blue in aquarium water. 10X
Tricaine is 1.5g of Tricaine powder dissolved in 1 liter of distilled water. 10X
Loading dye is 0.41% Bromophenol Blue, 50% Glycerol. Semi-quantitative RT-
PCR wash buffer is 0.1M Maleic Acid, 0.15M NaCl, 0.3% Tween-20 pH 7.5.
Semi-quantitative RT-PCR Detection buffer is 1M Tris pH 9.5, 1M NaCl.
Denaturing solution is 1.5M NaCl, 0.5M NaOH. Neutralizing solution is 1M Tris
pH 8.0, 1.5M NaCl. Low-stringency buffer is 2X SSC, 0.1% SDS. High-
124
stringency buffer is 0.5X SSC, 0.1% SDS. In situ Full Hybridization mix is 50%
Formamide, 5X SSC, 0.1% Tween-20, 50µg/ml Heparin, 500µg/ml tRNA,
adjusted to pH 6.0 with citric acid. In situ 1X blocking buffer is 1X PBT, 2%
Sheep Serum, 2 mg/ml BSA. AP buffer is 1M Tris pH 9.5, 1M MgCl2, 5M NaCl,
0.1% Tween-20. Stop solution is 1X PBT pH 5.5, 1mM EDTA. 1X Danieau
solution is 58mM NaCl, 0.7mM KCl, 0.4mM MgSO4, 0.6mM Ca(NO3)2, 5.0mM
HEPES pH 7.6. Embryo lysis buffer is 10mM Tris pH 8.1, 1mM EDTA, 0.3%
Tween-20, 0.3% NP-40. Ringer’s solution is 116mM NaCl, 2.9mM KCl, 1.8mM
CaCl2, 5mM HEPES pH 7.2. Deyolking buffer is 55mM NaCl, 1.8mM KCl,
1.25mM NaHCO2 pH7.5. Wash buffer for embryo lysate preparation is 110mM
NaCl, 35mM KCl, 27mM CaCl2, 10mM Tris pH8.5. SDS Sample buffer is 63mM
Tris pH 6.8, 10% Glycerol, 2% SDS, 5% β-ME. 2X sample buffer for western
blots is 125mM Tris, 4mM EDTA, 0.005% Bromophenol Blue, 4% SDS, 25%
Glycerol. Tobin buffer is 192mM Glycine, 25mM Tris, 0.038% SDS, 20% MeOH.
1X PBS is 137mM NaCl, 27mM KCl, 4.3mM Na2HPO4, 1.47mM KH2PO4. TBST
is 50mM Tris pH 7.5, 150mM NaCl 0.2% Tween-20. 1X assay buffer is 20mM
Tris, 1mM MgCl2. CSPD detection solution is 0.1M Diethanolamine, 1mM MgCl2,
0.25mM CSPD, 5% NitroBlock II.
Zebrafish Husbandry
Fish are raised in a modular system consisting of 1-, 3-, and 10-liter
overflow style tanks. Water conditions are maintained by the addition of sodium
bicarbonate and instant ocean solutions to pure reverse osmosis (RO) water.
125
System water is also run through a variety of filters including biofilters, carbon,
and ultraviolet (UV) light. The general conditions of the fish system water are pH
between 6.8-7.2, conductivity of approximately 350mS and a temperature of 25-
27oC. Weekly tests are also performed on the system water to check for
ammonia, nitrite and nitrate levels, and alkalinity. The facility itself has a timed
overhead lighting system that allows for a 14-hour light, 10-hour dark cycle.
Maintenance of the fish system is relatively easy and inexpensive when
compared to other facilities housing mice, rats, rabbits and other model
organisms. Due to the modularity of the system, it is very easy to change and
clean tanks and maintain consistent water conditions.
Figure 6.1: Modular Fish System
126
Typically, larvae will be raised in small dishes in a 27oC incubator until
approximately 7 days post fertilization (dpf), when they can be placed in a larger
tank and fed an algae diet. Over several weeks, the fish diet is gradually
changed over to adult food, which includes live brine shrimp, flake food, and
bloodworms, and the fish will be at breeding age within approximately six months
Primers:
Numerous oligonucleotide primers were generated (IDT) in order to obtain
the results described in this report. The primers that were used are listed below
by primer name, grouped by gene of interest.
Table 6.1: List of Primers for gin-10, synbl and mdm1 projects.
Primer
Name
Sequence
Project
BTB F1
5'- ACAGGAACCAGCAGTGCTCAAGTA -3'
gin-10
BTB F2
5'- TCTTCACCGCCTCCAACAGGTTTA -3'
gin-10
BTB F3
5'- ACAACAGCCTAGACACCGTCAACA -3'
gin-10
BTB R1
5'- TGAGCATTCGGAAACCCAGATCCT -3'
gin-10
BTB R2
5'- AGTTCGGGTGCCTCCAG AATTTA -3'
gin-10
BTB R3
5'- TACTTGAGCACTGCTGGTTCCTGT -3'
gin-10
cirh1a F1
5'- AATGGCAGCTGCGAAGATGAATGG -3'
gin-10
cirh1a F2
5'- ATGATGTTCGAGCTGTGGCTGAGA -3'
gin-10
cirh1a R1
5'- ATCTCAGCCACAGCTCGAACATCA -3'
gin-10
cirh1a R2
5'- TACTATCAGGCAGTGGCTGGCTTT -3'
gin-10
cry1b F1
5'- TGGAGATGCCAGCAGAGACAATCA -3'
gin-10
cry1b F2
5'- ATGTGGCTTTCGTGCAGCTCATTC -3'
gin-10
cry1b F3
5'- TTGCTTCCATGTTGTTGACGTGCG -3'
gin-10
cry1b R1
5'- AATGAGCTGCACGAAAGCCACATC -3'
gin-10
cry1b R2
5'- ACCACATGACACTGCAAATGCTGG -3'
gin-10
cry1b R3
5'- TCTGGCGAAGCGTTTGATTTAGCC -3'
gin-10
Hi2039A
F1
5'- CCATCATCGCAGGCTAACTAAG -3'
synbl
Hi2039A
R1
5'- ACCCGTGTATCCAATAAACCC -3'
synbl
127
liprin F1
5'- TCAGTCCTGGAACACATGCAGTCA -3'
gin-10
liprin F2
5'- ATTGAGGAGTTGCGGCAGTCACTA -3'
gin-10
liprin F3
5'- TGGGACTGTATGTGACTTTGGCGA -3'
gin-10
liprin R1
5'- TCGCCAAAGTCACATACAGTCCCA -3'
gin-10
liprin R3
5'- TGATGCCCTCAGAGAAAGCTCCAA -3'
gin-10
mapk12 F1
5' - CAGGCTGCTCAAACACATGAAGCA - 3'
gin-10
mapk12 F2
5' - TAGACGATCAGCCTGTTGTGTGCT - 3'
gin-10
mapk12
R1
5' - TCCAGGTGGTCGTGTCCTTTGAAT - 3'
gin-10
mapk12
R2
5' - GAATGCCTGCTGTGCCAGCTTTAT - 3'
gin-10
mdm 1 R8
5'- CCTCAGACGCCATGGAGCATGAAG -3'
mdm1
mdm1 F1
5' - TGCGCTCTGACCAGTCAGGAATTA - 3'
mdm1
mdm1 F10
5'- ACGCCTCACCA GGTAACAG -3'
mdm1
mdm1 F2
5' - ACACATCACGATCGAACCACTCCA -3'
mdm1
mdm1 F3
5'- AGAAGAAGAAGGAGCGACCACACA -3'
mdm1
mdm1 F8
5'- CTTCATGCTCCATGGCGTCTGAGG -3'
mdm1
mdm1 F9
5'- CCCTAGTCACTACCGGCGTA -3'
mdm1
mdm1 koz
F1
5'- CTCGAGCTGAAAGCCGCCATGCCTGTCCGTTTCAAG -3'
mdm1
mdm1 koz
F2
5'- CTGAAAGCCGCCATGCCTGTCCGTTTCAAG -3'
mdm1
mdm1 R1
5' - AAGGGTGGGATGGCTCTGTTGTTA -3'
mdm1
mdm1 R10
5'- ACGTTTCCTCGTGAGATCAGGCTT -3'
mdm1
mdm1 R2
5'- AATTCCGCGTTTCTCATTGTGCCC -3'
mdm1
mdm1 R3
5'- AATATGGCTTGTGCTTCTGCAGGC -3'
mdm1
mdm1 R9
5'- TTGCATAGTTGAAGTGTGCTTTGACAGATTAGC -3'
mdm1
mdm1-
rHis1
5'-
TTAATGATGATGATGATGATGTTGAGGAAGCACAAACAGCTC
-3'
mdm1
mdm1-
rHis2
5'-
TTAATGATGATGATGATGATGTGAGGAAGCACAAACAGCTC -
3'
mdm1
mdm1a F4
5'- TCTCCTAATCTGTTGACAAACCAAAGCAAG -3'
mdm1
mdm1a F5
5'- GCCTGCAGAAGCACAAGCCATATT -3'
mdm1
mdm1a F6
5'- TGCGCTCTGACCAGTCAGGAATTA -3'
mdm1
mdm1a F7
5'- CGGAGCTGTTTGTGCTTCCTCAAT -3'
mdm1
mdm1a R4
5'- ACCAACCCAATCTCACGGCAATTC -3'
mdm1
mdm1a R5
5'- AATATGGCTTGTGCTTCTGCAGGC -3'
mdm1
mdm1a R6
5'- AAGGTGGATGTCTGAGCTGCTTCT -3'
mdm1
mdm1a R7
5'- ACGTTTCCTCGTGAGATCAGGCTT -3'
mdm1
mdm1a R8
5'- CCATTTGTTGTCTATGCACAATACTGGTC -3'
mdm1
mdm2 F1
5'- CAACGGTCACCAGCAGATAA -3'
mdm1
mdm2 F3
5'- GATTCGCGCAACGGTCACCAGCAGATAACTACCAA -3'
mdm1
mdm2 F4
5'- TCTCGGTGCTGTTCTTGGAGTGAA -3'
mdm1
128
mdm2 F5
5'- TCGCACGTGCTGGAAGTGAACAAT -3'
mdm1
mdm2 F6
5'- ACGGTCACCAGCAGATAACTACCA -3'
mdm1
mdm2 koz
F7
5'- CTACCAAAGCCGCCATGGCAACAGAGA -3'
mdm1
mdm2 koz
F8
5'- CTCGAGCTACCAAAGCCGCCATGGCAACAGAGA -3'
mdm1
mdm2 R1
5'- AGTTTGGGAGTTGCCTTGTG -3'
mdm1
mdm2 R2
5'- TCAGTGCCTCAGCTCATGTAAGTC -3'
mdm1
mdm2 R3
5'- ACAACCACAAGGCAACTCCCAAACTTC -3'
mdm1
mdm2 R4
5'- TCCCGGGACAGAATCCACATCATT -3'
mdm1
mdm2 R5
5'- AGACAGTCTTCGCAGCCGAAAT -3'
mdm1
mdm2 R6
5'- ATCAATACAGCACCTCACAAGC -3'
mdm1
mdm2 R7
5'- CAGTGCCTCAGCTCATGTAAGTCA -3'
mdm1
mdm2 R7b
5'- GGTATATTTCAGTGCCTCAGCTCATGTAAGTC -3'
mdm1
mdm4 F1
5'- CACACACACGTCTCCCTTTC -3'
mdm1
mdm4 F2
5'- ACGTGACGACATACACCACGTCAA -3'
mdm1
mdm4 F4
5'- CTTTCAGGGTTGCCTTGGTGGTTT -3'
mdm1
mdm4 koz
F5
5'- GAGTGAAAAGCCGCCATGACCTCATTGGCA -3'
mdm1
mdm4 koz
F6
5'- CTCGAGGAGTGAAAAGCCGCCATGACCTCATTGGCA -3'
mdm1
mdm4 R1
5'- CTAGCCTCGCATTGATGGTT -3'
mdm1
mdm4 R2
5'- TCTTCCCACTCAGGCAGTAGCAAA -3'
mdm1
mdm4 R4
5'- CTGGGCAAGGAGCGTGAAATTTGT -3'
mdm1
mdm4 R5
5'- GATTTGTTGCTCATGCAATGAAGGT -3'
mdm1
mdm4 R5b
5'- AGATTTGTTGCTCATGCAATGAAGGTTTTGATGA -3'
mdm1
p53 F1
5'- GGCAATCCGAAAGTCGATAA -3'
mdm1
p53 F1b
5'- TCCGGGCAATCCGAAAGTCGATAA -3'
mdm1
p53 koz F2
5'- GCAAAGCAGCCGCCATGGCGCAAAACGA -3'
mdm1
p53 R1
5'- GCTCTTTTTGGACTGCCTTTT -3'
mdm1
p53 R2
5'- GCACAGTTGTCCATTCAGCACCAA -3'
mdm1
p53 R3
5'- ATCGGCTTGCAACCAATTCCGATG -3'
mdm1
p53 R4
5'- ACAAAGGTCCCAGTGGAGTGAACA -3'
mdm1
p53 R5
5'- GCATCCCATCACCTTAATCAGAGTCGCT -3'
mdm1
p53 R5b
5'- TAGCATCCCATCACCTTAATCAGAGTCGCTTCTTCC -3'
mdm1
pME F1
5'- CATTGTGCTGGCGCGGATTCTTTA -3'
mdm1
pME F2
5'- TTGCAGCCGAATACAGTGATCCGT -3'
mdm1
pME F3
5'- GGATCCGGTGGTGCAAATCAAAGA -3'
mdm1
pME F4
5'- TGTTCTGCGCCGTTACAGATCCAA -3'
mdm1
pME R1
5'- AGCGAGGAAGCGGAAGAGGAATTA -3'
mdm1
pME R3
5'- TTATAGTCCTGTCGGGTTTCGCCA -3'
mdm1
PS20 F1
5'- AAGAAGGACGGTCAGGCTGAATGA -3'
gin-10
PS20 F2
5'- ACCGAGGACAGTGCATCAAACAGA -3'
gin-10
129
PS20 R1
5'- TGGGTTGATGATGTGGCACTCGTA -3'
gin-10
PS20 R2
5'- AATAGTTGGCGGTTCATTCCGCTG -3'
gin-10
PS20b F3
5'- TACGAGTGCCACATCATCAACCCA -3'
gin-10
PS20b R3
5'- AATGCGGTCACCAACAGAAACTGG -3'
gin-10
ptn F1
5'- TGCATTCAGTCTGTCGCTCTCACA -3'
in situ
control
ptn F2
5'- ACCACAGGAATGAAGACTCGCACT -3'
in situ
control
ptn R1
5'- AGTGCGAGTCTTCATTCCTGTGGT -3'
in situ
control
ptn R2
5'- ACAGCAGCCTCTGGTGGATTTACA -3'
in situ
control
rfx4 F5
5' - TGATGCTGATGAGCTCCACTCCAA - 3'
gin-10
rfx4 F6
5' - TGGCTCGTTTCATCTGATTCACCT - 3'
gin-10
rfx4 F7
5' - ACTGGATACTGTCATACGCGCCAA - 3'
gin-10
rfx4 R10
5'- AGGTGATGTCTGCACTGTGGATCA -3'
gin-10
rfx4 R11
5'- CAGCTGCTTGGCAAACTTCCTGAT -3'
gin-10
rfx4 R13
5'- TGCTCGTATTCAGAGTTCCTGCGT -3'
gin-10
rfx4 R5
5' - AGTTTACCCACATCGGGATGAGCA - 3'
gin-10
rfx4 R6
5' - TGATCCACAGTGCAGACATCACCT - 3'
gin-10
rfx4 R9
5'- TGCTCATCCCGATGTGGGTAAACT -3'
gin-10
ric8a F1
5'- GTTTGATTCCAACCGACGCCATGT -3'
synbl
ric8a F2
5'- ACAGAGAGGCCAAACCACACATCA -3'
synbl
ric8a F3
5'- TTCTGGATCGCCCAGATAAAGCCA -3'
synbl
ric8a R1
5'- TCTCCATGAACTCCACCAGCACTT -3'
synbl
ric8a R2
5'- ATTGGACTCTCCGAACTGTTGGCT -3'
synbl
ric8a R3
5'- TGATCAGGAACGTAAGGCGCAGAT -3'
synbl
Rp11 F2
5'- TCTGGACAGGCTGAAGGTGTTTGA -3'
in situ
control
Rp11 F3
5'- TTTCCGCTATTGTGGCCAAGCAAG -3'
in situ
control
Rp11 R2
5'- GTGGATGCAGCCTTTATGACGCAA -3'
in situ
control
Rp11 R3
5'- ACAATCTTGAGAGCAGCTGGGACA -3'
in situ
control
RPB5 F1
5'- ACGAGGCGACAAATTGAGTGCAAC -3'
gin-10
RPB5 F2
5'- ATGGTGGCAGTGATGTCCAGGTTA -3'
gin-10
RPB5 R1
5'- GGCATGAAAGCCAAGGGACCAAAT -3'
gin-10
RPB5 R2
5'- TTGGTTCTCCATTCACCAGGTCCA -3'
gin-10
rpc2 F1
5'- GCGCAAACTTCCGTTCTGAGTGTT -3'
gin-10
rpc2 F2
5'- TTACTTTAGCAGGACTTGCCCGGA -3'
gin-10
rpc2 F3
5'- TGATGCCGACCCAATGTGGTATCT -3'
gin-10
rpc2 F4
5'- TCGCTGTAATGGTTCGCAGAGTGA -3'
gin-10
rpc2 F5
5'- TGAATAAGTCCATGCCCACCGTCA -3'
gin-10
rpc2 R1
5'- TCACTCTGCGAACCATTACAGCGA -3'
gin-10
130
rpc2 R3
5'- ACTTCTCTGTATTGTGGCTGGCCT -3'
gin-10
rpc2 R4
5'- TCCTGAATATCCCAGCAAGCCACA -3'
gin-10
rpc2 R5
5'- GCTTCGCAGCATTATTGGCATCCT -3'
gin-10
rpc2 R6
5'- ACATCGGTCAGTCAGGTTGGTTGA -3'
gin-10
rpc2 R7
5'- CAGTTTGAGGCGAGGGATGATGTT -3'
gin-10
Zrpc2 F2
5'- TCAACCAACCTGACTGACCGATGT -3'
gin-10
Zrpc2 F6
5'- AGGCCAGCCACAATACAGAGAAGT -3'
gin-10
Zrpc2 R2
5'- TGATCTGGTCCTGCCTCATGTGTT -3'
gin-10
Sir2 F1
5'- TGTGGTAGTTGCTGGAGCAGGAAT -3'
gin-10
Sir2 F2
5'- TTTGACGGTCTTCCCTTCATCCCT -3'
gin-10
Sir2 F3
5'- CAGCAGTCCTCATTGGCTGTTGAT -3'
gin-10
sir2 F4
5'- GTGTCGTGATGAGCAAGGCGAGGTTGAGCAG -3'
gin-10
Sir2 R1
5'- CAAGCTGGCAAAGGGCTCAATCTT -3'
gin-10
Sir2 R2
5'- TGCTGATTCCTGCTCCAGCAACTA -3'
gin-10
Sir2 R3
5'- ATGGCTGTTCATCAGGGTCTGGAT -3'
gin-10
Sir2 R4
5'- AGTCTTCCTGCAGACAGCCTCAAT -3'
gin-10
sir2 R5
5'- TCTCCGCTGTTCTCACCACTGCTGCTGATGTATG -3'
gin-10
synbl F1
5'- AAGAATTTGGCCTCCGTCCAGGTA -3'
synbl
synbl F10
5'- AGCAGAGTCCCTTGCTGTCTTCAA -3'
synbl
synbl F11
5'- TCTCTGCCTGCCTGTCAGACATTT -3'
synbl
synbl F12
5'- CGGATGCAACTGCAAGAGGGTTTA -3'
synbl
synbl F13
5'- GAAGCGAGAAGCGAACTGATTGGT -3'
synbl
synbl F14
5'- AGCTGTTCCATCTGTTCCTGACCT -3'
synbl
synbl F2
5'- TTACTTTAGCAGGACTTGCCCGGA -3'
synbl
synbl F3
5'- CATTTGGTCAGCGCGTCACATCAT -3'
synbl
synbl F4
5'- TGACACCTGTGCTGAGTCTGTTGA -3'
synbl
synbl F5
5'- TGAAGCCCAGAGGCTTGTCAGTAT -3'
synbl
synbl F6
5'- GACAGTGTTTCTAAGTGGACGGCA -3'
synbl
synbl F7
5'- TGAAGCCCAGAGGCTTGTCAGTAT -3'
synbl
synbl F8
5'- GACAATTTCCCTCCATGCACCGTT -3'
synbl
synbl F9
5'- TTCCCGAACTCCCAAATCTTCCCA -3'
synbl
synbl R1
5'- GATGCCTGCAATCAGCCGAAGTTT -3'
synbl
synbl R12
5'- GTATGCACAGATTCCATGTGGACC -3'
synbl
synbl R13
5'- CTGTTCCTACAGGAATAACTTGGGT -3'
synbl
synbl R14
5'- GACTTTCCAAGGAACATGGTTTCA -3'
synbl
synbl R2
5'- CACAGAGTGCCACAAACACACGTT -3'
synbl
synbl R3
5'- ATGATGTGACGCGCTGACCAAATG -3'
synbl
synbl R4
5'- TAAAGGTGCCAGAGTCCCGTCTTT -3'
synbl
synbl R5
5'- TAGCCAACGGCTAACTCGCTAACA -3'
synbl
synbl R6
5'- ACCTGGACGGAGGCCAAATTCTTA -3'
synbl
synbl R7
5'- ACACTGTCAGTCCTTCTGCACACA -3'
synbl
131
synbl R8
5'- ATGGAACCCTGAGGCGACGTTTAT -3'
synbl
synbl R9
5'- TTGTAGCCGGTCAACCAGCAAATG -3'
synbl
synbl sh
F1
5'- AGAGCGATTGTGTGTTCAGTTGAGTCAT -3'
synbl
synbl.sh
R1
5'- AGGAGGAGGTGTCTGTTAGGTTGT -3'
synbl
zActin F1
5'- TTGGCATGGGACAGAAAGACTCCT -3'
control
zActin F2
5'- TCACACCTTCTACAACGAGCTGCG -3'
control
zActin F3
5'- CACCACGGCCGAAAGAGAAATTGT -3'
control
zActin F4
5'- TTGCGGTATCCATGAGACCACCTT -3'
control
zActin R1
5'- ACTCCTGCTTGCTGATCCACATCT -3'
control
zActin R2
5'- GAAGCTGTAGCCTCTCTCGGTCAG -3'
control
zActin R3
5'- AAATGCATGGCAAGGAACTCACCC -3'
control
zActin R4
5'- TACCTCCCTTTCCAGTTTCCGCAT -3'
control
Antibodies:
Polyclonal rabbit antibodies against zebrafish p53 and mdm2 were
purchased from Anaspec (Freemont, CA). Polyclonal rabbit antibody against
zebrafish β-actin was purchased from Cell Signaling Technologies. Polyclonal
Goat Anti-Rabbit Alkaline Phosphatase Conjugated antibodies were purchased
from both Anaspec and Southern Biotech (Birmingham, AL). Streptavidin
Alkaline Phosphatase Conjugated antibody was purchased from Thermo
Scientific as a ready-to-use solution. Digoxigenin Alkaline Phosphatase antibody
was purchased from Roche.
Embryo Collection for RNA:
Embryos were collected from breeding tanks and brought over to the lab
in system water. They were then transferred into a glass bowl and washed using
embryo bleach solution, rinsed several times in aquarium water then stored in
Methylene Blue solution. Developing embryos were sorted into new petri dishes
132
(100 embryos per dish) and allowed to develop at approximately 27oC in an
incubator until appropriate age was reached. Embryos were collected in aliquots
of 50 per 1.5ml tube. Aquarium water was removed using a pulled glass pipette
and 1ml of 10X Tricaine was added to each tube on ice and allowed to incubate
10-15 minutes. The tricaine was then removed using a pulled glass pipette and
300µl of RNA Later was added to each tube and the embryos were stored at -
80oC.
RT-PCR Recipe and PCR Machine Program:
After RNA was isolated from the frozen embryos, it was quantified using a
spectrophotometer (A260) and a 1µg/µl dilution was made. The RT-PCR recipe is
based on the recommended recipe from Invitrogen, but modified for a 20µl
reaction:
Table 6.2: Standard RT-PCR Recipe
Component
Volume µl
RNA (1µg)
1
PCR Water
7.24
2X Buffer
10
Forward Primer
(20µM)
0.68
Reverse Primer
(20µM)
0.68
Platinum Taq
0.4
Total
20µl
133
Table 6.3: RT-PCR Program
Temperature
Time
Reverse Transcription
50
30 minutes
Pre-Denaturation
94
2 minutes
Denature
94
45 seconds
Anneal
55 (varied slightly
based on primer Tm)
45 seconds
Extension
72
1 minute 30 seconds
Repeat 35 Cycles
Final Extension
72
10 minutes
Hold
4
--
Once finished, 2.3µl of 10X loading dye was added to each PCR tube and
the products were run on an agarose gel (0.7-2.5% depending on the expected
size of the fragment). All gels were photographed and recorded by date and
PCR number. Primers that gave a robust band on the initial gel were repeated
with 24-hpf and 72-hpf RNA and run on a 0.7-1% low-melting temperature
agarose gel for extraction. The bands were purified using Qiagen’s MinElute
PCR purification kit and stored at -20oC for several days or used immediately.
TOPO TA Cloning with pCR4 and Top10 Cells:
Cloning fragments of candidate genes was done using RT-PCR and
TOPO TA Cloning kit (Invitrogen). Purified PCR product was ligated into pCR4
(sequencing) vector at room temperature for 30 minutes. The ligated plasmid
was then transformed into chemically competent Top 10 E.coli cells on ice for 30
minutes; the cells were heat shocked for 30 seconds at 42oC and placed
immediately on ice. SOC medium was added to the cells and they were shaken
at 37oC for 1 hour prior to plating on either ampicillin or carbenicillin plates, which
134
were then incubated at 37oC overnight. The plates were removed from the
incubator, checked for colony growth, sealed in parafilm, and stored at 4oC.
Sequencing Preparation:
In order to sequence the candidate gene, plasmid DNA was isolated from
the E. coli cells using Qiagen’s miniprep kit and the insert was verified by an
EcoRI digest. The EcoRI digest was performed because there are restriction
sites flanking the insert region in the pCR4 vector. So far, there have not been
any issues with digest sites within the inserts themselves, and this remains the
best way to determine if there is an appropriate insert in the plasmid prior to
sequencing. Once the digests were analyzed, the plasmid DNA was quantified
by spectrophotometry and dilutions of 5ng/µl were made and sent to Macrogen
Inc.
Sequencing Analysis:
Sequences were downloaded from the Macrogen website and analyzed
using the Geneious software program (Biomatters, Ltd.). Primers used for
sequencing and any internal primers were identified, sequences assembled, and
consensus sequences verified by NIH BLAST analysis.
DNA Probe Synthesis for Semi-quantitative RT-PCR:
DNA probes for semi-quantitative expression analysis were made using
the DIG High Prime Labeling Kit from Roche. Plasmid DNA was linearized using
135
a restriction enzyme that did not cut the insert itself, usually SpeI, NotI, or PstI
based on the vector map. The digest was performed for 3-4 hours and the
product was run on a 1% low-melting temperature agarose gel for 90 minutes,
photographed, extracted, and purified using Qiagen’s MinElute Kit. The plasmid
DNA was quantified by spectrophotometry before DIG labeling.
Only 1µg of linearized plasmid (up to 16µl) was needed for the probe and
was denatured in a boiling water bath for 10 minutes prior to labeling. DIG-High
Prime was added to the denatured DNA mixed briefly and collected at the bottom
of the tube by centrifugation and incubated overnight at 37oC according to the
Roche Protocol. The reaction was stopped the next day by adding 0.2M EDTA
to the tube and heating to 65oC for 10 minutes.
Labeling efficiency of the probe was determined before using in a semi-
quantitative experiment. A series of probe dilutions was made from 1ng/µl to
0.01pg/µl in supplied dilution buffer. A 1µl spot of each dilution was placed on a
positively charged nylon membrane and allowed to air dry. The membrane was
UV cross-linked then placed into a small container of Maleic Acid Buffer and
incubated for 2 minutes. The membrane was then placed in blocking solution for
30 minutes at room temperature. Once blocked, the membrane was placed in a
1:10,000 anti-DIG antibody solution for 30 minutes at room temperature. The
membrane was then transferred to a dish containing wash buffer and incubated
with agitation twice for 15 minutes. The Wash Buffer was poured off and
Detection Buffer was added to the membrane for 5 minutes. The membrane was
then placed on a piece of clear transparency film and covered with 1 ml of CSPD
136
for 5 minutes. A second piece of transparency film was placed on top of the
membrane and it was exposed to x-ray film for several minutes. The probes that
worked at the 0.1pg/µl dilution well were used for semi-quantitative analysis.
Semi-quantitative RT-PCR:
To further assess the expression of candidate genes in wildtype embryos,
semi-quantitative RT-PCR analysis was performed. The number of PCR cycles
varied between 15 and 21 for each of the candidate genes; this was tested by
using two different time points of embryo RNA (usually 24-hpf and 72-hpf) in a
normal 20µl RT-PCR reaction with primers specific to a particular candidate gene
and varying the number of cycles for each set. Once all of the reactions were
complete, the products were loaded onto an agarose gel and run for 90 minutes.
If bands were present on the gel with Ethidium Bromide staining then the
reactions were repeated and the number of PCR cycles were decreased until
bands were faint and difficult to see on the gel. Once the appropriate number of
cycles was determined for each candidate, an RT-PCR developmental profile
was performed using primers for the candidate gene that only amplified a single
band and was approximately 500-1000 base pairs.
Gels were run for 90 minutes at 80 Volts and placed on the
transilluminator to verify faint or no bands and photographed. The wells were
removed from the gel and the top left corner was notched for directionality. Gels
were placed in Denaturing Solution on a rocker for 30 minutes, rinsed briefly with
sterile deionized water, then washed in Denaturing Solution for another 30
137
minutes. The Denaturing Solution was discarded and the gel was placed in
Neutralizing Solution for 30 minutes on a rocker, rinsed briefly with sterile
deionized water and washed with Neutralizing Solution for another 30 minutes.
While the gel was in the last wash, the blot transfer stack was prepared by
soaking a positively charged nylon membrane (Roche) and two pieces of
Whatman paper in 2X SSC, and a long piece of Whatman paper in 20X SSC.
The transfer set-up was made by placing a large pipette tip box lid in a glass
baking dish and placing a piece of glass on top of the lid to create a platform.
The long piece of Whatman paper was laid across the glass creating a bridge;
20X SSC was then poured onto the platform and halfway up the baking so that
both ends of the Whatman paper were submerged. The two smaller pieces of
Whatman paper that had been soaking were placed onto the center of the
platform and air bubbles were removed prior to the next step. Once the gel was
ready, it was placed facedown onto the Whatman paper. The membrane was
placed directly on top of the gel. A glass pipette was rolled across the membrane
to remove any air bubbles between it and the gel at this point. Two more pieces
of Whatman paper was placed on top of the membrane, and then approximately
3-4 inches of cut paper towels were stacked on top. The stack was finished by
placing another piece of glass on top of the paper towels, covering with saran
wrap to keep it in place and adding a weight (two heating block inserts). Another
piece of saran wrap was added to keep the weight centered on the stack, and it
was allowed to sit over night, approximately 20 hours.
138
Once the transfer was complete, the stack was carefully disassembled
and the membrane was labeled with pencil and washed in 5X SSC with agitation
for 5 minutes. The membrane was then air dried for several minutes and was UV
cross-linked (1200J) and stored between two pieces of clean Whatman paper
until hybridization. The hybridization temperature was determined by calculating
the Tm and Topt for the probe being used. The membrane was then soaked in 5X
SSC and placed in a glass hybridization tube with 10ml of warm hybridization
solution. The tube was tightly capped and placed in the pre-warmed
hybridization oven for 1-2 hours. When pre-hybridization was almost complete,
the probe was denatured by placing it in a 15ml conical tube and boiling the
probe for 5 minutes then placing the probe on ice for 1-2 minutes. The pre-
hybridization solution was removed from the glass tube and the denatured probe
was added (approximately 10 ml). Blots were hybridized overnight and the total
hybridization time was recorded.
Figure 6.2: Calculation of Hybridization Temperature for each Probe. Melting temperature of the
probe was calculated then a range of hybridization temperatures was determined by the formulas
above.
Following hybridization, the probe was poured back into a 15ml conical
tube and stored at -20oC for future use. The blot was briefly washed in a low-
stringency buffer at 68oC. The buffer was removed and replaced with fresh low-
139
stringency buffer and washed with agitation at 68oC for 5 minutes; this step was
repeated twice. Once the low-stringency washes were complete, the membrane
was washed twice in high-stringency buffer at 68oC with agitation. The
membrane was then placed in a Wash Buffer at room temperature for 5 minutes
with agitation.
The membrane was placed in a shallow dish containing 50ml of Roche 1X
Blocking Buffer and allowed to incubate with agitation for 1 hour. Once the
membrane was blocked, it was placed in a 1:10,000 anti-DIG antibody solution
and incubated for 1 hour at room temperature. To remove the excess antibody,
the membrane was rinsed with Wash Buffer briefly then incubated in fresh Wash
Buffer at room temperature twice for 15 minutes. The Wash Buffer was removed
and the membrane was soaked in detection buffer for 5 minutes. The membrane
was placed on a clean piece of Whatman paper to remove excess Detection
Buffer, then immediately transferred onto a piece of clear transparency film.
Approximately 1-2ml of CSPD was pipetted onto the membrane then a second
piece of clear transparency film was placed on top of the membrane spreading
out the CSPD. The membrane was incubated at 37oC for 10-15 minutes to
activate the CSPD and exposed to x-ray film.
Embryo Collection for In Situ Hybridization Experiments:
Embryos were collected from breeding tanks and brought over to the lab
in system water. They were then transferred into a glass bowl and washed using
an embryo bleach solution, rinsed several times in aquarium water then stored in
140
a 0.003% PTU solution, which inhibits pigment formation. Developing embryos
were sorted into new petri dishes (100 embryos per dish) and allowed to develop
at approximately 27oC in an incubator until appropriate age was reached.
Embryos were collected in aliquots of 50 per 1.5ml tube. Aquarium water was
removed using a pulled glass pipette and 1ml of 10X Tricaine was added to each
tube on ice and allowed to incubate 10-15 minutes. The tricaine was then
removed using a pulled glass pipette and 300µl of 4% PFA in PBS was added to
each tube and stored at 4oC overnight.
The next day, the PFA was removed and the embryos were washed
several times in 1X PBS with agitation (until all of the PFA was removed, usually
3-4 washes). Embryos were then manually dechorionated in 1X PBS on an
agar-coated plate if needed and dehydrated by washing in increasing MeOH in
PBS solution (25% MeOH, 50% MeOH, 75% MeOH and 100% MeOH).
Embryos were stored in 100% MeOH at -20oC.
RNA Probe Synthesis for In Situ Hybridization Experiments:
DIG-labeled RNA probes were used for in situ hybridization experiments in
zebrafish embryos. Plasmids containing the appropriate gene fragment
(approximately 600-800bp) were linearized by restriction digest, either NotI or
SpeI depending on the orientation of the insert in the plasmid. The digest ran
approximately 3-4 hours and the product was run on a 1% low-melting
temperature agarose gel for 90 minutes, extracted, and purified using Qiagen’s
141
MinElute kit. The linearized plasmid was quantified by spectrophotometry prior to
the transcription reaction.
Ambion’s MAXIScript Transcription reaction kit was used to prepare RNA
Probes for in situs with 1µg of the linearized plasmid DNA. The transcription
reaction using a DIG-labeled UTP and either T3 or T7 enzyme was prepared
depending on the orientation of the fragment in the plasmid. The transcription
reaction was incubated at 37oC for 1 hour then Turbo DNase (from kit) was
added to the reaction and incubated at 37oC for an additional 15 minutes. The
reaction was stopped by the addition of 0.5M EDTA followed by purification of the
reaction using NucAway Spin Columns. Probes were stored at -20oC.
Whole Mount In Situ Hybridization:
Since the purpose of this experiment was to see spatial expression of
candidate gene transcripts in whole embryos, it was essential to properly and
carefully handle the embryos that were extremely fragile at this point. Embryos
were removed from the freezer, thawed on ice, placed in 6-well culture dishes
according to age, and rehydrated in PBT with increasing MeOH solution (25%
PBT, 50% PBT, 75% PBT and 100% PBT). The embryos were washed in 100%
PBT several times with gentle swirling at room temperature then treated with
Proteinase K diluted in PBT at room temperature.
142
Table 6.4: Proteinase K treatment of zebrafish embryos for in situ hybridization experiments
(From Thisse & Thisse 2008).
Developmental Stage
Duration of Proteinase K Treatment
1 cell – 1 somite stage
30 seconds
1-8 somite stage
1 minute
9-18 somite stage
3 minutes
18 somite – 24hpf
10 minutes
24hpf – 7dpf
30 minutes
The Proteinase K was removed from the embryos and a second PFA fix at
room temperature was done. The PFA was removed and the embryos were
washed in 100% PBT several times with gentle swirling to prepare embryos for
pre-hybridization. The PBT was removed and the embryos were incubated in
Full hybridization mix at 65oC for 5 hours without rocking. Prior to hybridization,
the RNA probe was boiled for 10 minutes and placed on ice. The probe was
added to each well of embryos, they were gently swirled for several seconds and
incubated for 1-2 days in a 65oC oven.
The probe was removed and stored at -80oC for future use. Embryos
were briefly washed in Full hybridization mix, then in a hybridization mix that did
not contain tRNA or heparin. Embryos continued to be washed in an increasing
2X SSC solution (25% 2X SSC, 50% 2X SSC, 75% 2X SSC and 100% 2X SSC).
The 2X SSC solution was removed from the embryos and they were washed
twice in a 0.2X SSC with 0.01% Tween-20 solution for 30 minutes. The embryos
were then washed in increasing PBT in 0.2X SSC solutions (25% PBT, 50%
PBT, 75% PBT and 100% PBT) in preparation for blocking.
The PBT was removed from the wells and the embryos were incubated at
room temperature in 1X blocking buffer for 4 hours. A 1:10,000 anti-DIG
143
antibody solution was made in 1X blocking buffer; the blocking buffer was
removed from the embryos and the antibody was added and incubated at 4oC
with gentle rocking overnight.
The following day, the antibody solution was removed and the embryos
were washed several times with PBT at room temperature. The PBT was
removed and the embryos were allowed to briefly dry in the wells to reduce the
formation of precipitate in the wells. Embryos were washed several times in AP
buffer at room temperature. BM Purple was used to stain the embryos; the AP
buffer was removed and fresh AP buffer added to each well. The BM Purple was
briefly centrifuged and added to each well, the entire dish was covered in foil and
placed in a drawer until color developed. The color development was stopped by
removing the BM Purple solution and adding fresh Stop Solution, incubating for
15 minutes at room temperature, and repeating this process. Embryos were
stored in Stop solution at 4oC or cleared in glycerol and photographed.
Fish Breeding for Injections:
Adult fish (1-2 females with 1 male) were placed in a breeding tank
containing a divider the evening prior to injections. The next morning, the
dividers were pulled out of the tanks and the fish were allowed to breed. As soon
as the females laid eggs, the divider was replaced and the eggs were collected
into a small plastic container and transported to the microinjection room.
Dividers were subsequently re-pulled and replaced until the fish stopped
144
breeding for that day. Females were given a minimum of two weeks rest
between injection experiments while the males were bred every 1-2 weeks.
Morpholino Injections:
Custom MOs were designed to the 5’ UTR and early coding sequence of
the specific candidate genes in order to block translation. The morpholino
powder was first resuspended in 1X Danieau solution to a concentration of 1mM
stock MO. Once the stock solution was prepared, MOs were diluted in 1%
phenol red and 1X Danieau at various concentrations. Prior to injections, the
MOs were heated to 65oC for 10 minutes, vortexed, and briefly centrifuged so
that any precipitate that may have formed was at the bottom of the tube.
Approximately 10µl of MO was loaded into a 1.2mm pulled glass capillary tube
containing filament using a gel-loading tip. The needle was placed in a vertical
mount (beaker with a mound of clay along the edge) until the MO solution
migrated to the tip of the needle. It was then placed in the micromanipulator and
the tip was broken using forceps in aquarium water.
Embryos were brought over from the fishroom and were immediately
transferred into glass bowls containing 0.0015M MeBlue in aquarium water.
Embryos were briefly observed under dissecting microscope to make sure that
they were all less than 8-cell stage and approximately all the same age for
consistency. 100 embryos were transferred to an area of a large petri dish lid
containing MeBlue water placed on the dissecting scope with a black
background. Embryos were held with a pair of forceps while the needle was
145
carefully extended through the chorion and into the yolk just below the
developing cell(s). The MO solution was released using a remote foot pedal
(pressure and volume settings were adjusted based on the needle) and a red
spot was seen in the yolk once the solution was injected. Embryos were
transferred to a new petri dish containing MeBlue water and allowed to develop
in a 27oC incubator.
Figure 6.3: Morpholino Injection set up.
Screening Morphants:
Although mosaicism can be seen at 48-72hpf, the morphant embryos
were screened daily for any obvious phenotypic changes. Any dead or decayed
embryo (which is often seen since it is difficult to differentiate 1-cell embryos from
water-activated eggs at the time of injection) were removed from the dishes and
recorded. The MeBlue water was also changed daily to keep the embryos as
clean as possible.
At 48-72hpf, embryos were placed in 2X Tricaine and viewed under the
dissecting scope. Embryos were scored for mosaicism and any developmental
146
abnormalities observed; the embryos were then grouped together by phenotype
and placed into a 6-well culture dish. Groups and/or single embryos were
photographed then collected into either 4% PFA in PBS or RNA Later for future
use.
Fin Clipping Adult Zebrafish:
Adult fish were placed in a 1X Tricaine solution until anesthetized. Each
fish was then removed from the solution, briefly blotted on a paper towel and
placed on a small cutting board. Using a scalpel, a small portion of the lower tail
fin was cut and placed in a 0.5ml thin-walled tube containing 50µl of embryo lysis
buffer on ice. The fish was promptly placed in a 1L tank and swirled around until
it began swimming on its own.
Genomic DNA Preps from Fin Clips:
After the fin clips were obtained, the 0.5ml tubes were incubated at 98oC
for 10 minutes. Then 5µl of Proteinase K (10mg/ml) was added to each tube;
they were briefly vortexed, centrifuged, and then placed in a 55oC incubator
overnight. The next day, the tubes were vortexed and re-centrifuged, and an
additional 45µl of lysis buffer and 5µl of Proteinase K were added to each tube.
Tubes were spun down and incubated at 55oC overnight. The DNA was then
stored at -20oC.
147
Genomic DNA PCR:
Before PCR was performed on the genomic samples, they were diluted
1:20 with Nuclease-free water and incubated at 98oC to inactivate the Proteinase
K. The PCR recipe is based on the recommended usage from Takara, but
modified for a 20µl reaction.
Table 6.5: Genomic DNA PCR recipe used to amplify a portion of the transgenic insert and
flanking genomic DNA in ZIRC fish.
Component
Volume (µl)
Diluted DNA
2.4
PCR Water
11.8
Takara 10X Buffer
2
Takara dNTPs
1.6
Forward Primer
1
Reverse Primer
1
Takara Taq
0.2
Total
20µl
A standard 35-cycle PCR program was used to amplify fragments from
genomic DNA. Once finished, 2.3µl of 10X loading dye was added to each
sample, and the products were run on an agarose gel.
Embryo Collection and Lysate Preparation for Western Blot Analysis:
Embryos were collected from breeding tanks and brought over to the lab
in system water. They were then transferred into a glass bowl and washed using
an embryo bleach solution, rinsed several times in aquarium water then stored in
Methylene Blue solution. Developing embryos were sorted into new petri dishes
(100 embryos per dish) and allowed to develop at approximately 27o C in an
incubator until appropriate age was reached. Embryos were dechorionated
manually using #5 Forceps in a 10X Tricaine solution. Embryos remained in the
148
10X Tricaine on ice for 10-15 minutes, and then were transferred to a 1.5ml tube.
While on ice, the Tricaine was removed using a pulled glass pipette and 1ml of
cold Ringer’s Solution was added to the tube. The embryos were gently rocked
for 2 minutes to wash and the Ringer’s Solution was removed with the glass
pipette. 1ml of Deyolking Buffer was then added to the tube and the embryos
were shaken for 5 minutes at 1100rpm. The embryos were centrifuged at 300 x
g for 30 seconds and the supernatant was discarded. A wash buffer was then
added to the embryos, shaken for 2 minutes at 1100rpm, and centrifuged to
pellet the embryos. The supernatant was discarded and embryos were
centrifuged again in order to remove any excess liquid that remained in the tube.
Once the excess liquid was removed, 200µl of SDS Sample Buffer was added to
the tube. The embryos were homogenized with a pestle and power
homogenizer. The sample was then boiled for 5 minutes then centrifuged at high
speed for 2 minutes. The supernatant was transferred to a new tube and stored
at -20oC (Link et al. 2006, O’Shea 1993).
Western Blot Analysis of Zebrafish Embryo Lysate:
Embryo lysates were diluted in 2X Cracking Buffer for a total volume of
15µl and incubated at 95oC for 5 minutes. The samples were then loaded onto a
10% SDS-Polyacrylamide gel and run at 180 Volts for approximately 45-50
minutes. Once the gel was finished, the blocking stack was assembled in a
shallow dish containing Tobin Buffer by placing two pieces of thick Whatman
paper on the bottom of the dish then the gel was carefully placed on top of the
149
blotting paper. The nitrocellulose membrane was hydrated in a shallow dish
containing deionized water then placed on top of the gel. Finally two more
pieces of thick blotting paper was placed on top of the membrane to complete the
stack. The stack was then removed from the dish and flipped over (membrane
side down) and placed in a Hoefer Scientific Blotter; the blotter was run at
110mAmps for 1 hour. Once the gel transfer was complete, the membrane was
stained with 0.1% Ponceau S to verify the protein transfer. Stained membranes
were also scanned or photographed for documentation. The membrane was
then rinsed several times in 1X PBS then blocked in 5% Nonfat Milk in TBST
overnight at 4oC. The membrane was then brought up to room temperature in
the blocking solution prior to the addition of antibody. The primary antibody was
diluted in blocking solution (1:500 – 1:4000 depending on the antibody), and the
membrane was incubated in primary antibody for 1-2 hours at room temperature.
The membrane was then washed several times in TBST then incubated for 1
hour at room temperature in AP-Conjugated secondary antibody (1:3000 dilution)
in blocking solution. Prior to detection with CSPD, the blot was washed several
times in TBST then in 1X Assay buffer. The membrane was placed on a piece of
transparency film on a flat surface, and 1-2ml of CSPD detection solution was
pipetted on and allowed to incubate for 5 minutes. A second piece of
transparency film was then placed on top of the membrane and exposed to x-ray
film.
150
In Vitro Expression of Protein:
Recombinant protein was produced from full-length clones in the
pCMVTnT expression vector (Promega) using the TnT Coupled Reticulocyte
Lysate System as detailed by the manufacturer (Promega). Upon completion of
the 90-minute TnT reaction, a portion of the sample was combined with an equal
volume of 2X cracking buffer and boiled for 5 minutes for western blotting; the
remaining sample was stored at -80oC for future use.
Whole-mount Antibody Staining of Morpholino Injected Embryos
Following the morpholino injections, embryos were placed in cold 2X
Tricaine-S solution in petri dishes and dechorionated with forceps. The embryos
were then rinsed four times in cold 1X PBS for 15 minutes, then fixed overnight in
4% PFA in PBS at 4oC. The following day, the fixed embryos were washed
several times in 1X PBT for 5 minutes. Embryos were then blocked in 10%
Normal Goat Serum (NGS) in 1X PBT for 1 hour at room temperature with gentle
rocking. The NGS block was then removed and the embryos were incubated
overnight at 4oC with the primary antibody (Streptavidin-AP) in 10% NGS in 1X
PBT. The primary antibody solution was removed the next day, and the embryos
were washed 4 times in 1X PBT for 5 minutes each. Secondary antibody (AP-
Conjugate) in 10% NGS/1X PBT (1:1000 dilution) was then added to the
embryos and incubated at room temperature for 2 hours. The antibody solution
was removed and the embryos were rinsed several times in 1X PBS for 10
151
minutes. The antibody was detected using NBT-BCIP and the reaction was
stopped after successful color development with several washes of 1X PBS.
152
LITERATURE CITED
Aguilera, A., and Gómez-González, B. (2008). Genome instability: a mechanistic
view of its causes and consequences. Nat Rev Genet 3, 204-217.
Amatruda, J., Shepard, JL., Stern, HM., and Zon, LI (2002). Zebrafish as a
cancer model system. Cancer Cell 1, 229-231.
Amsterdam, A., Nissen, RM., Sun, Z., Swindell, EC., Farrington, S. and Hopkins,
N. (2004). Identification of 315 genes essential for early zebrafish
development. Proc Natl Acad Sci U S A 101, 12792-12797.
Beckman, R.A., and Loeb, L.A. (2005). Genetic Instability in Cancer: Theory and
Experiment. Seminars in Cancer Biology 15, 423-435.
Beckwith, L.G., Moore, J.L., Tsao-Wu, G.S., Harshbarger, J.C., and Cheng, K.C.
(2000). Ethylnitrosurea induces neoplasia in zebrafish (Danio rerio).
Laboratory Investigation 80, 379-385.
Bilotta, J., Barnett, J.A., Hancock, L. and Saszik, S. (2004). Ethanol Exposure
alters zebrafish development: A novel model of fetal alcohol syndrome.
Neurotoxicology and Teratology 26, 737-743.
Blackshear, P., Graves, JP., Stumpo, DJ., Cobos, I., Rubenstein, JL. and Zeldin,
DC. (2003). Graded phenotypic response to partial and complete
deficiency of a brain-specific transcript variant of the winged helix
transcription factor RFX4. Development 130, 4539-4552.
Blander, G., and Guarente, L. (2004). The Sir2 Family of Protein Deacetylases.
Annu Rev Biochem 73, 417-435.
Brockerhoff, S.E., Dowling, J.E., and Hurley, J.B. (1998). Zebrafish retinal
mutants. Vision Research 38, 1335-1339.
153
Buck, S., Gallo, CM., and Smith, JS. (2004). Diversity in the Sir2 family of
protein deacetylases. J Leukoc Biol 75, 939-950.
Carroll, S., Grenier JK., Weatherbee, SD. (2000). From DNA to Diversity:
Molecular genetics and the evolution of animal design, 2nd edn (Oxford,
Blackwell Publishing).
Cavenee, W.K., Dryja, T.P., Phillips, R.A., Benedict, W.F., Godbout, R., Gallie,
B.L., Murphee, A.L., Strong, L.C., and White, R.L. (1983). Expression of
recessive alleles by chromosomal mechanisms in retinoblastoma. Nature
305, 779-784.
Chakrabarti, S., Streisinger, G., Singer, F. and Walker, C. (1983). Frequency of
gamma-ray induced specific locus and recessive lethal mutations in
mature germ cells of the zebrafish, Brachydanio rerio. Genetics 103, 109-
123.
Chang, B., Mandal, Md. N. A., Chavali, V. R. M., Hawes, N. L., Khan, N. W.,
Hurd, R. E., Smith, R. S., Davisson, M. L., Kopplin, L., Klein, B. E. K.,
Klein, R., Iyengar, S. K., Heckenlively, J. R. and Ayyagari, R. (2008). Age-
Related retinal degeneration (arrd2) in a novel mouse model due to a
nonsense mutation in the mdm1 gene. Hum Mol Genet 17, 3929-3941.
Chen, L., Gilkes, D.M., Pan, Y., Lane, W.S., and Chen, J. (2005). ATM and
Chk2-dependent phosphorylation of MDMX contribute to p53 activation
after DNA damage. EMBO 24, 3411-3422.
Cheng, K., and Moore, JL. (1997). Genetic dissection of vertebrate processes in
the zebrafish: a comparison of uniparental and two-generation screens.
Biochem Cell Biol 75, 525-533.
Couwenbergs, C., Spilker, AC. and Gotta, M. (2004). Control of embryonic
spindle positioning and Galpha activity by C. elegans RIC-8. Curr Biol 14,
1871-1876.
Currie, P.D. (1996). Zebrafish genetics: Mutant cornucopia. Current Biology 6,
1548-1552.
154
David, N., Martin, CA., Segalen, M., Rosenfeld, F., Schweisguth, F. and
Bellaïche, Y. (2005). Drosophila Ric-8 regulates Galphai cortical
localization to promote Galphai-dependent planar orientation of the mitotic
spindle during asymmetric cell division. Nat Cell Biol 7, 1083-1090.
Detrich, H.W., III,, Westerfield, M., and Zon, L.I. (1999). The Zebrafish: Genetics
and Genomics, Vol 60 (San Diego, Academic Press).
Dooley, K., and Zon, L.I. (2000). Zebrafish: a model system for the study of
human disease. Current Opinion in Genetics & Development 10, 252-256.
Driever, W., Solnica-Krezel, L., Schier, A.F., Neuhauss, S.C.F., Malicki, J.,
Stemple, D.L., Stainer, D.Y.R., Zwartkruis, F., Abdelilah, S., Rangini, Z.,
Belak, J. and Boggs, C. (1996). A Genetic Screen for Mutations Affecting
Embryogenesis in Zebrafish. Development 123, 37-46.
Drummond AJ, A.B., Buxton S, Cheung M, Cooper A, Duran C, Field M, Heled J,
Kearse M, Markowitz S, Moir R, Stones-Havas S, Sturrock S, Thierer T,
Wilson A (2011). www.geneious.com
Einhauer, A., and Jungbaur, A. (2001). The FLAG peptide, a versitile fusion tag
for the purification of recombinant proteins. J Biochem Biophys Methods
49, 455-465.
Eisen, J. (1996). Zebrafish make a big splash. Cell 87, 969-977.
Eisen, J.S., and Smith, J.C. (2008). Controlling morpholino experiments: don't
stop making antisense. Development 135, 1735-1743.
Ekker, S.C., and Larson, J.D. (2001). Morphant technology in model
developmental systems. Genesis 30, 89-93.
Emery, P., Durand, B., Mach, B. and Reith, W. (1996). RFX proteins, a novel
family of DNA binding proteins conserved in the eukaryotic kingdom.
Nucleic Acids Res 24, 803-807.
Feitsma, H., and Cuppen, E. (2008). Zebrafish as a Cancer Model. Mol Cancer
Res 6, 685-694.
155
Fornzler, D., Her, H., Knapik, E.W., Clark, M., Lehrach, H., Postlethwait, J.H.,
Zon, L.I., and Beier, D.R. (1998). Gene Mapping in Zebrafish Using
Single-Strand Conformation Polymorphism Analysis. Genomics 51, 216-
222.
Fox, E.J., and Loeb, L.A. (2010). Lethal Mutagenesis: Targeting the Mutator
Phenotype in Cancer. Seminars in Cancer Biology 20, 353-359.
Freedman, D., Wu, L. and Levine, AJ. (1999). Functions of the MDM2
oncoprotein. CMLS, Cell Mol Life Sci 55, 96-107.
Gasteiger, E., Gattiker, A., Hoogland, C., Ivanyi, I., Appel, R.D., Bairoch, A.
(2003) ExPASy: the proteomics server for in-depth protein knowledge and
analysis. Nuc Acids Res. 31, 3784-3788.
Gerhard, G. (2003). Comparitive aspects of zebrafish (Danio rerio) as a model
for aging research. Experimental Gerontology 38, 1333-1341.
Gerlai, R. (2003). Zebra fish: An uncharted Behavior Genetic Model. Behavior
Genetics 33, 461-468.
Gerlai, R., Lahav, M., Guo, S. and Rosenthal, A (2000). Drinks like a fish: zebra
fish (Danio rerio) as a behavior genetic model to study alcohol effects.
Pharmacology, Biochemistry and Behavior 67, 773-782.
Gestl, E.E., Kauffman, E.J., Moore, J.L., and Cheng, K.C. (1996). New conditions
for generation of gynogenetic half-tetrad embryos in zebrafish. J Hered
88, 76-79.
Gonzalez, C. (2007). Spindle orientation, asymmetric division and tumour
suppression in Drosophila stem cells. Nat Rev Genet 8, 462-472.
Greene, J. (1999). A little fish makes a big splash. In NCRR Reporter.
Grunwald, D.J., and Eisen, J.S. (2002). Headwaters of the zebrafish --
emergence of a new model vertebrate. Nat Rev Genet 3, 717-724.
156
Grunwald, D.J., and Streisinger, G. (1992). Induction of recessive lethal and
specific locus mutations in the zebrafish with ethyl nitrosurea. Genet Res
Camb 59, 103-116.
Guo, S. (2008). Animal Models for Anxiety Disorders. In Biomarkers for
Psychiatric Disorders, C.W. Turk, ed. (San Francisco, Springer Science),
pp. 203-216.
Haffter, P., Granato, M., Brand, M., Mullins, M.C., Hammerschmidt, M., Kane,
D.A., Odenthal, J., van Eeden, F. J. M., Jiang, Y-J., Heisenberg, C-P.,
Kelsh, R. N., Furutani-Seiki, M., Vogelsang, E., Beuchle, D., Schach, U.,
Fabian, C. and Nusslein-Volhard, C. (1996). The Identification of Genes
with Unique and Essential Functions in the Development of the Zebrafish,
Danio rerio. Development 123, 1-36.
Haffter, P., Odenthal, J., Mullins, M.C., Lin, S., Farrell, M.J., Vogelsang, E., Haas,
F., Brand, M., van Eeden, F.J.M., Furutani-Seiki, M., et al. (1996).
Mutations affecting pigmentation and shape of the adult zebrafish.
Developmental genes in evolution 206, 260-276.
Hampoelz, B., Hoeller, O., Bowman, SK., Dunican, D., and Knoblich, JA. (2005).
Drosophila Ric-8 is essential for plasma-membrane localization of
heterotrimeric G proteins. Nat Cell Biol 7, 1099-1105.
Hansen, C., Bartek, J., and Jensen, S. (2008). A functional link between the
human cell cycle-regulatory phosphatase Cdc14A and the atypical
mitogen-activated kinase Erk3. Cell Cycle 7, 325-334.
Hendricks, J.C., Sehgal, A. and Pack, A.I. (2000). The need for simple animal
model to understand sleep. Progress in Neurobiology 61, 339-351.
Hengen, P. (1995). Purification of His-Tag fusion proteins from Escherichia coli.
Trends Biochem Sci 20, 285-286.
Hochuli, E., Bannwarth, W., Döbeli, H., Gentz, R., and Stüber, D. (1988). Genetic
Approach to Facilitate Purification of Recombinant Proteins with a Novel
Metal Chelate Adsorbent. Nat Biotech 6, 1321-1325.
157
Hopp, T.P., Gallis, B., and Prickett, K.S. (1988). A short polypeptide marker
sequence useful for recombinant protein identification and purification.
Bio/Technology 6, 1204-1210.
Ingham, P. (2009). The power of the zebrafish for disease analysis. Hum Mol
Genet 18, R107-112.
Ito, A., Kawaguchi, Y., Lai, C-H., Kovacs, JJ., Higashimoto, Y., Appella, E., and
Yao, T-P. (2002). MDM2±HDAC1-mediated deacetylation of p53 is
required for its degradation. EMBO 21, 6236-6245.
Iwakuma, T., and Lozano, G. (2003). MDM2, an introduction. Molecular cancer
research : MCR 1, 993-1000.
Johnston, C., Afshar, K., Snyder, JT., Tall, GG., Gonczy, P., Siderovski, DP and
Willard, FS. (2008). Structural Determinants Underlying the Temperature-
sensitive Nature of a G Mutant in Asymmetric Cell Division of
Caenorhabditis elegans. J Biol Chem 283, 21550-21558.
Kari, G., Rodeck, U., and Dicker, AP. (2007). Zebrafish: an emerging model
system for human disease and drug discovery. Clin Pharmacol Ther 82,
70-80.
Karlovich, C., John, RM., Ramirez, L., Stainier, DYR., and Myers, RM. (1998).
Characterization of the Huntington’s disease (HD) gene homolog in the
zebrafish Danio rerio. Gene 217, 117-125.
Kawakami, K. (2005). Transposon Tools and Methods in Zebrafish.
Developmental dynamics : an official publication of the American
Association of Anatomists 234, 244-254.
Kelsh, R.N., Schmid, B., and Eisen, J.S. (2000). Genetic analysis of
melanophore development in zebrafish embryos. Developmental biology
225, 277-293.
Kimmel CB, B.W., Kimmel SR, Ullmann B and Schilling TF. (1995). Stages of
embryonoc development of the zebrafish. Developmental Dynamics 203,
253-310.
158
Knudson, A.G. (1971). Mutation and cancer: statistical study of retinoblastoma.
Proceedings of the National Academy of Sciences of the United States of
America 68, 820-823.
Knudson, A.G. (1985). Hereditary cancer, oncogenes, and antioncogenes.
Cancer Research 45, 1437-1443.
Krens, S., Spaink, HP., Snaar-Jagalska, BE. (2006). Functions of the MAPK
family in vertebrate-development. FEBS Lett 580, 4984-4990.
Langenau, D.M., Feng, H., Berghmans, S., Kanki, J.P., Kutok, J.L., and Look,
A.T. (2005). Cre/lox-regulated transgenic zebrafish model with conditional
myc-induced T cell acute lymphoblastic leukemia. Proceedings of the
National Academy of Sciences of the United States of America 102, 6068-
6073.
Langheinrich U, H.E., Stott G, Vacun G. (2002). Zebrafish as a model organism
for the identification and characterization of drugs and genes affecting p53
signaling. Curr Biol 12, 2023-2028.
Lele, Z., and Krone, P.H. (1996). The zebrafish as a model system in
developmental, toxicological and transgenic research. Biotechnology
Advances 14, 57-72.
Lieschke, G.J., and Currie, P.D. (2007). Animal models of human disease:
zebrafish swim into view. Nat Rev Genet 8, 353-367.
Link, V., Shevchenko, A., and Heisenberg, C-P. (2006). Proteomics of early
zebrafish embryos. BMC Developmental Biology 6.
Livingston, B.T. (2008), K. Griffett, ed. (Tampa).
Mach, B., Steimle, V., Martinez-Soria, E., and Reith, W. (1996). Regulation of
MHC class II genes: lessons from a disease. Annu Rev Immunol 14, 301-
331.
Marone, M., Mozzetti, S., De Ritis, D., Pierelli, L., and Scambia, G. (2001).
Semiquantitative RT-PCR analysis to assess the expression levels of
multiple transcripts from the same sample. Biol Proced Online 3, 19-25.
159
Maslow, T. (2010). Preparation of Zebrafish Embryo Protein Lysates, K. Griffett,
ed.
Matsushita, H., Uenaka, A., Ono, T., Hasegawa, K., Sato, S., Koizumi, F.,
Nakagawa, K., Toda, M., Shingo, T., Ichikawa, T., Noguchi, Y., Tamiya,
T., Furuta, T., Kawase, T., Date, I., and Nakayama, E. (2005).
Identification of glioma-specific RFX4-E and -F isoforms and humoral
immune response in patients. Cancer Sci 96, 801-809.
Matsuzaki, F. (2005). Drosophila G-protein signalling: intricate roles for Ric-8?
Nat Cell Biol 7, 1047-1049.
Matthews, M., Trevarrow, B., and Matthews, J. (2002). A virtual tour of the Guide
for zebrafish users. Lab animal 31, 34-40.
Miller, K., and Rand, JB. (2000a). A Role for RIC-8 (Synembryn) and GOA-1
(Goa) in Regulating a Subset of Centrosome Movements During Early
Embryogenesis in Caenorhabditis elegans. Genetics 156, 1649-1660.
Miller, K.G., Emerson, M.D., McManus, J.R., and Rand, J.B. (2000b). RIC-8
(Synembryn): A Novel Conserved Protein that Is Required for Gqa
Signaling in the C. elegans Nervous System. Neuron 27, 289-299.
Mizgireuv, I.V., and Revskoy, S.Y. (2006). Transplantable tumor lines generated
in clonal zebrafish. Cancer research 66, 3120-3125.
Moore, J., Gestl, EE., and Cheng, KC. (2004). Mosaic eyes, genomic instability
mutants, and cancer susceptibility. Methods Cell Biol 76, 555-568.
Moore, J., Rush, LM., Breneman, C., Mohideen, MA., and Cheng, KC. (2006).
Zebrafish genomic instability mutants and cancer susceptibility. Genetics
174, 585-600.
Morcos, P.A. (2007). Achieving targeted and quantifiable alteration of mRNA
splicing with Morpholino oligos. Biochem and Biophys Res Commun 358,
521-527.
160
Moreira, J., and Deutsch, A. (2005). Pigment pattern formation in zebrafish
during late larval stages: a model based on local interactions.
Developmental dynamics : an official publication of the American
Association of Anatomists 232, 33-42.
Morotomi-Yano, K., Yano, K., Saito, H., Sun, Z., Iwama, A., and Miki, Y. (2002).
Human regulatory factor X 4 (RFX4) is a testis-specific dimeric DNA-
binding protein that cooperates with other human RFX members. J Biol
Chem 277, 836-842.
Moulton, J.D. (2007). Using morpholinos to control gene expression. In Curr
Protoc Nucleic Acid Chem.
Muggerud, A., Edgren, H., Wolf, M., Kleivi, K., Dejeux, E., Tost, J., Sørlie, T., and
Kallioniemi, O. (2009). Data integration from two microarray platforms
identifies bi-allelic genetic inactivation of RIC8A in a breast cancer cell
line. BMC Med Genomics 11.
Mullins, M., Hammerschmidt, M., Haffter, P., and Nüsslein-Volhard, C. (1994).
Large-scale mutagenesis in the zebrafish: in search of genes controlling
development in a vertebrate. Curr Biol 4, 189-202.
Nagayoshi, S., Hayashi, E., Abe, G., Osato, N., Asakawa, K., Urasaki, A.,
Horikawa, K., Ikeo, K., Takeda, H., and Kawakami, K. (2008). Insertional
mutagenesis by the Tol2 transposon-mediated enhancer trap approach
generated mutations in two developmental genes: tcf7 and synembryn-
like. Development 135, 159-169.
Nasevicius, A., and Ekker, S.C. (2000). Effective Targeted Gene "Knockdown" in
Zebrafish. Nat Genet 26, 216-220.
Nawrocki, L., BreMiller, R., Streisinger, G. and Kaplan, M. (1985). Larval and
Adult Visual Pigments of the Zebrafish, Brachydanio rerio. Vision Res 25,
1569-1576.
North, B., and Verdin, E. (2004). Sirtuins: Sir2-related NAD-dependent protein
deacetylases. Genome Biology 5, 224.
Norton, W., and Bally-Cuif, L. (2010). Adult zebrafish as a model organism for
behavioural genetics. BMC Neuroscience 11.
Students also viewed