Ethics reflection paper
Article
Interspecies ChimerismwithMammalian Pluripotent
Stem Cells
Graphical Abstract
Highlights
d Naive rat PSCs robustly contribute to live rat-mouse
chimeras
d A versatile CRISPR-Cas9 mediated interspecies blastocyst
complementation system
d Naive rodent PSCs show no chimeric contribution to post-
implantation pig embryos
d Chimerism is observed with some human iPSCs in post-
implantation pig embryos
Wu et al., 2017, Cell 168, 473–486 January 26, 2017 ª 2017 Elsevier Inc. http://dx.doi.org/10.1016/j.cell.2016.12.036
Authors
Jun Wu, Aida Platero-Luengo,
Masahiro Sakurai, ..., Emilio A. Martinez,
Pablo Juan Ross,
Juan Carlos Izpisua Belmonte
Correspondence [email protected]
In Brief
Human pluripotent stem cells robustly
engraft into both cattle and pig pre-
implantation blastocysts, but show
limited chimeric contribution to post-
implantation pig embryos.
Article
Interspecies Chimerism with Mammalian Pluripotent Stem Cells Jun Wu,1 Aida Platero-Luengo,1 Masahiro Sakurai,1 Atsushi Sugawara,1 Maria Antonia Gil,2 Takayoshi Yamauchi,1
Keiichiro Suzuki,1 Yanina Soledad Bogliotti,3 Cristina Cuello,2 Mariana Morales Valencia,1 Daiji Okumura,1,7
Jingping Luo,1 Marcela Vilariño,3 Inmaculada Parrilla,2 Delia Alba Soto,3 Cristina A. Martinez,2 Tomoaki Hishida,1
Sonia Sánchez-Bautista,4 M. Llanos Martinez-Martinez,4 Huili Wang,3 Alicia Nohalez,2 Emi Aizawa,1
Paloma Martinez-Redondo,1 Alejandro Ocampo,1 Pradeep Reddy,1 Jordi Roca,2 Elizabeth A. Maga,3
Concepcion Rodriguez Esteban,1 W. Travis Berggren,1 Estrella Nuñez Delicado,4 Jeronimo Lajara,4 Isabel Guillen,5
Pedro Guillen,4,5 Josep M. Campistol,6 Emilio A. Martinez,2 Pablo Juan Ross,3 and Juan Carlos Izpisua Belmonte1,8,* 1Salk Institute for Biological Studies, 10010 N. Torrey Pines Road, La Jolla, CA 92037, USA 2Department of Animal Medicine and Surgery, University of Murcia Campus de Espinardo, 30100 Murcia, Spain 3Department of Animal Science, University of California Davis, One Shields Avenue, Davis, CA 95616, USA 4Universidad Católica San Antonio de Murcia (UCAM) Campus de los Jerónimos, N� 135 Guadalupe 30107 Murcia, Spain 5Clinica Centro Fundación Pedro Guillén, Clı́nica CEMTRO, Avenida Ventisquero de la Condesa 42, 28035 Madrid, Spain 6Hospital Clı́nico de Barcelona-IDIBAPS, Universitat de Barcelona, 08007 Barcelona, Spain 7Present address: Graduate School of Agriculture, Department of Advanced Bioscience, Kinki University, 3327-204 Nakamachi,
Nara 631-8505, Japan 8Lead Contact
*Correspondence: [email protected]
http://dx.doi.org/10.1016/j.cell.2016.12.036
SUMMARY
Interspecies blastocyst complementation enables organ-specific enrichment of xenogenic pluripotent stem cell (PSC) derivatives. Here, we establish a ver- satile blastocyst complementation platform based on CRISPR-Cas9-mediated zygote genome editing and show enrichment of rat PSC-derivatives in several tissues of gene-edited organogenesis- disabled mice. Besides gaining insights into species evolution, embryogenesis, and human disease, inter- species blastocyst complementationmight allow hu- man organ generation in animals whose organ size, anatomy, and physiology are closer to humans. To date, however, whether human PSCs (hPSCs) can contribute to chimera formation in non-rodent spe- cies remains unknown. We systematically evaluate the chimeric competency of several types of hPSCs using a more diversified clade of mammals, the un- gulates. We find that naı̈ve hPSCs robustly engraft in both pig and cattle pre-implantation blastocysts but show limited contribution to post-implantation pig embryos. Instead, an intermediate hPSC type ex- hibits higher degree of chimerism and is able to generate differentiated progenies in post-implanta- tion pig embryos.
INTRODUCTION
Embryonic pluripotency has been captured in vitro at a spectrum
of different states, ranging from the naive state, which reflects
unbiased developmental potential, to the primed state, in which
cells are poised for lineage differentiation (Weinberger et al.,
2016; Wu and Izpisua Belmonte, 2016). When attempting to
introduce cultured pluripotent stem cells (PSCs) into a devel-
oping embryo of the same species, recent studies demonstrated
that matching developmental timing is critical for successful
chimera formation. For example, naive mouse embryonic stem
cells (mESCs) contribute to chimera formation when injected
into a blastocyst, whereas primed mouse epiblast stem cells
(mEpiSCs) efficiently engraft into mouse gastrula-stage em-
bryos, but not vice versa (Huang et al., 2012; Wu et al., 2015).
Live rodent interspecies chimeras have also been generated us-
ing naive PSCs (Isotani et al., 2011; Kobayashi et al., 2010; Xiang
et al., 2008). However, it remains unclear whether naive PSCs
can be used to generate chimeras between more distantly
related species.
The successful derivation of human PSCs (hPSCs), including
ESCs from pre-implantation human embryos (Reubinoff et al.,
2000; Thomson et al., 1998), as well as the generation of induced
pluripotent stem cells (iPSCs) from somatic cells through cellular
reprograming (Takahashi et al., 2007; Park et al., 2008; Wernig et
al., 2007; Yu et al., 2007; Aasen et al., 2008), has revolutionized
the way we study human development and is heralding a new
age of regenerative medicine. Several lines of evidence indicate
that conventional hPSCs are in the primed pluripotent state,
similar to mEpiSCs (Tesar et al., 2007; Wu et al., 2015). A number
of recent studies have also reported the generation of putative
naive hPSCs that molecularly resemble mESCs (Gafni et al.,
2013; Takashima et al., 2014; Theunissen et al., 2014). These
naive hPSCs have already provided practical and experimental
advantages, including high single-cell cloning efficiency and
facile genome editing (Gafni et al., 2013). Despite these
advances, it remains unclear how the putative higher develop-
mental potential of naive hPSCs can be used to better
Cell 168, 473–486, January 26, 2017 ª 2017 Elsevier Inc. 473
A B
C D
E F
Figure 1. Interspecies Rat-MouseChimeras
Derived from Rat PSCs
(A) Rat-mouse chimeras generated by rat ESCs
(DAC2). Left, anE18.5 rat-mouse chimeric fetus.Red,
hKO-labeled rat cells. Right, a 12-month-old (top) and
24-month-old (bottom) rat-mouse chimera.
(B) Chimera forming efficiencies with rat ESC lines
(DAC2 and DAC8) and rat iPSC lines (SDFE and
SDFF). n, number of embryo transfers.
(C) Representative fluorescence images showing
hKO-labeled rat ESCs (DAC2) contributed to
different tissues in the 24-month-old rat-mouse
chimera. Red, hKO-labeled rat cells. Blue, DAPI.
Scale bar, 100 mm.
(D) Representative immunofluorescence images
showing the expression of aging-related histone
marks, including H3K9me3 and H4K20me3, in the
kidney tissue of neonatal and 24-month-old chi-
meras. Scale bar, 10 mm.
(E) Levels of chimerism of rat ESCs (DAC2) in
different tissues of the 24-month-old rat-mouse
chimera. Error bars indicate SD.
(F) Rat iPSCs (SDFE) contributed to the neonatal
mouse gall bladder. Left, bright-field (top) and
fluorescence (bottom) images showing a neonatal
mouse gallbladder contained cells derived from rat
iPSCs. White arrowheads indicate the gallbladder.
Right, representative immunofluorescence images
showing the expression of a gallbladder epithelium
marker (EpCAM) by rat cells. Red, hKO-labeled rat
cells; blue, DAPI. Scale bar, 50 mm.
See also Figure S1 and Table S2.
understand human embryogenesis and to develop regenerative
therapies for treating patients.
Like naive rodent PSCs, naive hPSCs can potentially be used to
generate interspecies chimeras for studying human development
and disease, and producing functional human tissues via interspe-
cies blastocyst complementation. To date, however, all reported
attempts on generating hPSC-derived interspecies chimeras
have used the mouse as the host animal, and the results obtained
suggest that this process is rather inefficient (Gafni et al., 2013;
Theunissen et al., 2014, 2016). Although the mouse is one of the
most important experimental models for stem cell research, there
are considerable differences between humans andmice (e.g., early
post-implantation development, embryo size, gestational length,
and developmental speed), which may hinder not only the effi-
ciency but also the usefulness of human-mouse chimeric studies.
Thus, expanding the repertoire of host species may complement
this incipient but promising area of research in the field of regener-
ative medicine. In particular, interspecies chimera research of
474 Cell 168, 473–486, January 26, 2017
hPSCs using ungulates, e.g., pigs, cattle,
and sheep, could lead to improved
research models, as well as novel in vivo
strategies for (1) generating human organs
and tissues, (2) designing new drug
screening methodologies, and (3) devel-
oping new human disease models (Wu
and Izpisua Belmonte, 2015). Experiments
to empirically test and evaluate the
chimeric contribution of various types of hPSCs in the ungulates
are thus imperative, but currently lacking. To start filling this void,
we tested different types of hPSCs for their chimeric contribution
potential in two ungulate species, pigs and cattle.
RESULTS
Naive Rat PSCs Robustly Contribute to Rat-Mouse Interspecies Chimera Formation We first used rodentmodels to gain a better understanding of the
factors and caveats underlying interspecies chimerism with
PSCs. To this end, we used two chimeric-competent rat ESC
lines, DAC2 and DAC8 (Li et al., 2008). We labeled both lines
with a fluorescent marker, humanized kusabira orange (hKO),
for cell tracking and injected them into mouse blastocysts.
Following embryo transfer (ET) into surrogate mouse mothers,
both DAC2 and DAC8 lines gave rise to live rat-mouse chimeras
(Figures 1A and S1A). Many of the chimeras developed into
adulthood, and one chimera reached 2 years of age (Figure 1A),
indicating that the xenogeneic rat cells sustained the physiolog-
ical requirements of themouse host without compromising its life
span. We also generated two rat iPSC lines (SDFE and SDFF)
from tail tip fibroblasts (TTFs) isolated from a neonatal
Sprague-Dawley rat and used them to generate rat-mouse chi-
meras. Similar to rat ESCs, rat iPSCs could also robustly
contribute to chimera formation in mice (Figure S1B). Overall,
the chimera forming efficiencies of all rat PSC lines tested
were �20%, consistent with a previous report (Figure 1B) (Ko- bayashi et al., 2010).
We observed contribution of rat cells to a wide range of tissues
and organs in both neonatal and aged rat-mouse chimeras (Fig-
ures 1C, S1A, and S1B). We examined aging-related histone
marks in both neonatal and aged chimeras and found that the
2-year-old chimera exhibited histone signatures characteristic
of aging (Figure 1D). We quantified the degree of chimerism in
different organs of the aged chimera via quantitative qPCR anal-
ysis of genomic DNA using a rat-specific primer (Table S2). We
found that different tissues contained different percentages of
rat cells, with the highest contribution observed in the heart
(�10%) (Figure 1E). One anatomical difference between mice and rats is that rats
lack a gallbladder. In agreement with a previous report (Kobaya-
shi et al., 2010), we also observed the presence of gallbladders in
rat-mouse chimeras (chimeras derived from injecting rat PSCs
into a mouse blastocyst). Interestingly, rat cells contributed to
the chimeric gallbladder and expressed the gallbladder epithe-
lium marker EpCAM (Figures 1F and S1C), which suggests that
the mouse embryonic microenvironment was able to unlock a
gallbladder developmental program in rat PSCs that is normally
suppressed during rat development.
A Versatile CRISPR-Cas9-Mediated Interspecies Blastocyst Complementation System Chimeric contribution of PSCs is random and varies among
different host blastocysts and donor cell lines used. To selec-
tively enrich chimerism in a specific organ, a strategy called
blastocyst complementation has been developed where the
host blastocysts are obtained from a mutant mouse strain in
which a gene critical for the development of a particular lineage
is disabled (Chen et al., 1993; Kobayashi et al., 2010; Wu and
Izpisua Belmonte, 2015). Mutant blastocysts used for comple-
mentation experiments were previously obtained from existing
lines of knockout mice, which were generated by gene targeting
in germ-line-competent mouse ESCs—a time-consuming pro-
cess. To relieve the dependence on existing mutant strains,
we developed a blastocyst complementation platform based
on targeted genome editing in zygotes. We chose to use the
CRISPR-Cas9 system, which has been harnessed for the effi-
cient generation of knockout mouse models (Wang et al.,
2013) (Figure 2A).
For proof-of-concept, we knocked out the Pdx1 gene in
mouse by co-injecting Cas9 mRNA and Pdx1 single-guide
RNA (sgRNA) into mouse zygotes. During mouse development,
Pdx1 expression is restricted to the developing pancreatic
anlagen and is a key player in pancreatic development. Mice ho-
mozygous for a targeted mutation in Pdx1 lack a pancreas and
die within a few days after birth (Jonsson et al., 1994; Offield
et al., 1996). Similarly, Pdx1�/� mice generated by the zygotic co-injection of Cas9 mRNA and Pdx1 sgRNA were apancreatic,
whereas other internal organs appeared normal (Figure S2A).
These mice survived only a few days after birth. We observed
the efficiency for obtaining Pdx1�/� mouse via CRISPR-Cas9 zygote genome editing was �60% (Figure S2F). Next, we com- bined zygotic co-injection of Cas9/sgRNA with blastocyst injec-
tion of rat PSCs, and found that rat PSC-derivatives were
enriched in the neonatal pancreas of Pdx1�/� mice and ex- pressed a-AMYLAYSE, a pancreatic enzyme that helps digest
carbohydrates (Figures 2B and S2B). Of note is that in these an-
imals the pancreatic endothelial cells were still mostly of mouse
origin, as revealed by staining with an anti-CD31 antibody (Fig-
ure 2B). Importantly, pancreas enriched with rat cells supported
the successful development of Pdx1�/� mouse host into adult- hood (>7 months), and maintained normal serum glucose levels
in response to glucose loading, as determined using the glucose
tolerance test (GTT) (Figure S2C).
Taking advantage of the flexibility of the CRISPR-Cas9 zy-
gotic genome editing, we next sought to enrich xenogenic rat
cells toward other lineages. Nkx2.5 plays a critical role in early
stages of cardiogenesis, and its deficiency leads to severe
growth retardation with abnormal cardiac looping morphogen-
esis, an important process that leads to chamber and valve for-
mation (Lyons et al., 1995; Tanaka et al., 1999). Mice lacking
Nkx2.5 typically die around E10.5 (Lyons et al., 1995; Tanaka
et al., 1999). Consistent with previous observations, CRISPR-
Cas9 mediated inactivation of Nkx2.5 resulted in marked
growth-retardation and severe malformation of the heart at
E10.5 (Figure S2D). In contrast, when complemented with rat
PSCs, the resultant Nkx2.5�/� mouse hearts were enriched with rat cells and displayed a normal morphology, and the em-
bryo size was restored to normal (Figures 2C and S2D). Of note
is that although rat PSCs rescued embryo growth and cardiac
formation in E10.5 Nkx2.5�/� mouse embryos, to date we still have not obtained a live rescued chimera (n = 12, where n is
the number of ETs). Pax6 is a transcription factor that plays
key roles in development of the eye, nose and brain. Mice ho-
mozygous for a Pax6 loss-of-function mutation lack eyes, nasal
cavities, and olfactory bulbs, and exhibit abnormal cortical
plate formation, among other phenotypes (Gehring and Ikeo,
1999). Pax6 is best known for its conserved function in eye
development across all species examined (Gehring and Ikeo,
1999). In agreement with the published work, CRISPR-Cas9
mediated Pax6 inactivation disrupted eye formation in the
E15.5 mouse embryo (Figure S2E). When complemented with
rat PSCs, we observed the formation of chimeric eyes enriched
with rat cells in Pax6�/� mouse neonate (Figures 2D and S2E). Similar to Pdx1�/�, we observed efficient generation of homo- zygous Nkx2.5�/� and Pax6�/� mouse embryos via zygotic co-injection of Cas9 mRNA and sgRNAs (Figure S2F). All DNA
sequencing results of CRISPR-Cas9 mediated gene knockouts
and gRNA sequences are summarized in Tables S1 and S2,
respectively.
In sum, for the pancreas, heart, and eye, as well as several
other organs (data not shown), we successfully generated chi-
merized organs that were enriched with rat cells, demonstrating
Cell 168, 473–486, January 26, 2017 475
A
B
C D
Figure 2. Interspecies Blastocyst Complementation via CRISPR-Cas9-Mediated Zygote Genome Editing
(A) Schematic of the CRISPR-Cas9 mediated rat-mouse blastocyst complementation strategy.
(B) Left, bright-field (top) and fluorescence (bottom) images showing the enrichment of rat cells in the pancreas of an E18.5 Pdx1�/�mouse. Li, liver; St, stomach; Sp, spleen. Yellow-dotted line encircles the pancreas. Red, hKO-labeled rat cells. Middle and right (top), representative immunofluorescence images showing rat
cells expressed a-amylase in the Pdx1�/� mouse pancreas. Blue, DAPI. Right (bottom), a representative immunofluorescence image showing that some pancreatic endothelial cells, as marked by a CD31 antibody, were not derived from rat PSCs. Scale bar, 100 mm.
(C) Bright field (left) and fluorescence (right) images showing the enrichment of rat cells in the heart of an E10.5 Nkx2.5�/� mouse. Red, hKO-labeled rat cells. (D) Bright field (top) and fluorescence (bottom) images showing the enrichment of rat cells in the eye of a neonatal Pax6�/�mouse. Red, hKO-labeled rat cells. WT, mouse control; WT+rPSCs, control rat-mouse chimera without Cas9/sgRNA injection.
See also Figure S2 and Tables S1 and S2.
476 Cell 168, 473–486, January 26, 2017
A
B C
Figure 3. Naive Rodent PSCs Fail to Contribute to Chimera Formation in Pigs
(A) Schematic of the generation and analyses of post-implantation pig embryos derived from blastocyst injection of naive rodent PSCs.
(B) Summary of the pig embryos recovered between day 21–28 of pregnancy.
(C) Genomic PCR analyses of pig embryos derived from blastocyst injection of mouse iPSCs or rat ESCs. Mouse- and rat- specific mtDNA primers were used for
the detection of chimeric contribution from mouse iPSCs and rat ESCs, respectively. Pig-specific mtDNA primers were used for the control.
See also Tables S2 and S3.
the efficacy and versatility of the CRISPR-Cas9 mediated inter-
species blastocyst complementation platform.
Naive Rodent PSCs Do Not Contribute to Chimera Formation in Pigs It is commonly accepted that the key functional feature of naive
PSCs is their ability to generate intraspecies germline chimeras
(Nichols and Smith, 2009). Studies in rodents also support the
notion that attaining the naive pluripotent state is the key step
in enabling chimera formation across species boundaries (Xiang
et al., 2008; Isotani et al., 2011; Kobayashi et al., 2010). However,
it has not yet been tested whether naive rodent PSCs can
contribute to chimera formation when using a non-rodent host.
To further examine the relationship between naive PSCs and
interspecies chimerism, we injected rat ESCs into pig blasto-
cysts followed by ET to recipient sows. In addition to rat ESCs,
we also used a germline competent mouse iPSC line (Okita
et al., 2007). Several criteria were used to determine the chimeric
contribution of rodent cells in pig embryos, namely, (1) detection
of fluorescence (hKO) signal, (2) immunohistochemical (IHC) la-
beling of embryo sections with an anti-hKO antibody, and (3)
genomic PCRwithmouse- or rat-specific primers targetingmito-
chondrial DNA (mtDNA) (Figure 3A). We terminated the preg-
nancy between day 21–28 of pig development and collected
embryos derived from the injection of mouse iPSCs or rat
ESCs into pig blastocyst (26 and 19 embryos, respectively) (Fig-
ure 3B; Table S3). We failed to detect any hKO signal in both
normal size and growth retarded embryos (Figure 3B). We next
sectioned the pig embryos and stained them with an antibody
against hKO. Similarly, we did not detect any hKO-positive cells
in the embryonic sections examined (data not shown). Finally, we
employed a more sensitive test, using genomic PCR to amplify
rat- or mouse-specific mtDNA sequences (pig-specific mtDNA
primers served as the loading control) (Table S2). Consistently,
genomic PCR analyses did not detect any rodent contribution
to the pig embryos (Figure 3C). Taken together, although naive
rodent PSCs can robustly contribute to rodent-specific interspe-
cies chimeras, our results show that these cells are incapable of
contributing to normal embryonic development in pigs.
Generation of Naive, Intermediate, and Primed hiPSCs Next, we sought to systematically evaluate the chimeric compe-
tency of hPSCs in ungulate embryos. We generated hiPSCs
using several reported naive PSC culture methods, a culture
protocol supporting a putative intermediate pluripotent state
between naive mESCs and primed mEpiSCs (Tsukiyama and
Ohinata, 2014), and a primed culture condition (Figure 4A).
Mouse ground state culture condition (2iL) induces the differen-
tiation of primed hPSCs. However, when combined with the
forced expression of NANOG and KLF2 (NK2), transcription fac-
tors that help to maintain murine naive pluripotency, 2iL culture
can stabilize hPSCs in an immature state (Takashima et al.,
2014; Theunissen et al., 2014). We generated doxycycline
(DOX)-inducible NK2-expressing naive hiPSCs cultured in 2iL
medium from primed hiPSCs (2iLD-hiPSCs). Transgene-free
primed hiPSCs were reprogramed from human foreskin fibro-
blasts (HFFs) using episomal vectors (Okita et al., 2011). For
comparison, we also generated naive hiPSCs from HFFs
using the NHSM culture condition (Gafni et al., 2013) (NHSM-
hiPSCs). It has been shown that cells grown in 4i medium, a
Cell 168, 473–486, January 26, 2017 477
A
B
C
D
Figure 4. Generation and Interspecies ICM
Incorporation of Different Types of hiPSCs
(A) Schematic of the strategy for generating naive,
intermediate, and primed hiPSCs.
(B) (Top) Representative bright-field images
showing the colony morphologies of naive (2iLD-,
4i-, and NHSM-hiPSCs) and intermediate (FAC-
hiPSCs) hiPSCs. Bottom, representative immu-
nofluorescence images of naive and intermediate
hiPSCs stained with an anti-OCT4 antibody. Red,
OCT4; blue, DAPI. Scale bar, 100 mm.
(C) Schematic of the experimental procedures for
producing cattle and pig blastocysts obtained
from in vitro fertilization (IVF) and parthenoactiva-
tion, respectively. Blastocysts were subsequently
used for laser-assisted blastocyst injection of
hiPSCs. After hiPSC injection, blastocysts were
cultured in vitro for 2 days before fixation and
analyzed by immunostaining with an anti-HuNu
and an anti-SOX2 antibodies. Criteria to evaluate
the survival of human cells, as well as the degree
and efficiency of ICM incorporation are shown in
the blue box.
(D) Number of hiPSCs that integrated into the
cattle (left) and pig (right) ICMs after ten hiPSCs
were injected into the blastocyst followed by
2 days of in vitro culture. Red line, the average
number of ICM-incorporated hiPSCs. Blue dot,
the number of ICM-incorporated hiPSCs in each
blastocyst.
See also Figure S3 and Table S4.
478 Cell 168, 473–486, January 26, 2017
simplified version of NHSM, have a significant potential for germ
cell induction, a distinguishing feature between naive mESCs
and primed mEpiSCs (Irie et al., 2015). Thus, we also culture-
adapted NHSM-hiPSCs in 4i medium (4i-hiPSCs), resulting in
stable 4i-hiPSCs with similar morphological and molecular char-
acteristics to parental NHSM-hiPSCs (Figure 4B). In addition, we
generated another type of hiPSC by direct reprogramming of
HFFs in a modified mEpiSC medium containing bFGF, Activin-
A, and CHIR99021 (FAC; Figure 4A). mEpiSCs cultured in FAC
medium exhibited features characteristic of both naive mESCs
and primed mEpiSCs, supporting an intermediate pluripotent
state (Tsukiyama and Ohinata, 2014). hiPSCs generated and
cultured in FAC medium (FAC-hiPSCs) displayed a colony
morphology intermediate between that of 2iLD- and primed
hiPSCs, with less defined borders (Figure 4B). 2iLD-hiPSCs,
NHSM-hiPSCs, 4i-hiPSCs, and FAC-hiPSCs could all be stably
maintained long term in culture, preserving normal karyotypes
and the homogeneous, nuclear localization of OCT4 protein
(Figure 4B; data not shown). Notably, similar to hiPSCs grown
in naive cultures (2iLD-hiPSCs, NHSM-hiPSCs, 4i-hiPSCs),
FAC-hiPSCs could also be efficiently propagated by single-cell
dissociation without using a ROCK kinase inhibitor. After inject-
ing cells into the kidney capsule of immunodeficient NSG mice,
all of these hiPSCs formed teratomas that consisted of tissues
from all three germ layers: endoderm, mesoderm, and ectoderm
(Figure S3A). To facilitate the identification of human cells in sub-
sequent chimera experiments, we labeled hiPSCs with either
green fluorescence protein (GFP) or hKO fluorescence markers.
Chimeric Contribution of hiPSCs to Pig and Cattle Blastocysts The ability to integrate into the inner cell mass (ICM) of a blasto-
cyst is informative for evaluating whether hiPSCs are compatible
with pre-implantation epiblasts of the ungulate species. This is
also one of the earliest indicators of chimeric capability. We
therefore evaluated interspecies chimeric ICM formation by in-
jecting hiPSCs into blastocysts from two ungulate species, pig
and cattle.
Cattle-assisted reproductive technologies, such as in vitro
embryo production, are well established given the commercial
benefits of improving the genetics of these animals. Cattle also
serve as a research model because of several similarities to hu-
man pre-implantation development (Hansen, 2014; Hasler,
2014). Using techniques for producing cattle embryos in vitro,
we developed a system for testing the ability and efficiency of
hiPSCs to survive in the blastocyst environment and to integrate
into the cattle ICM (Figure 4C). Cattle embryos were obtained by
in vitro fertilization (IVF) using in vitro matured oocytes collected
from ovaries obtained from a local slaughterhouse. The tightly
connected cells of the blastocyst trophectoderm from large live-
stock species, such as pig and cattle, form a barrier that compli-
cates cell microinjection into the blastocoel. Thus, microinjection
often results in embryo collapse and the inability to deposit the
cells into the embryo. To facilitate cell injection we employed a
laser-assisted approach, using the laser to perforate the zona
pellucida and to induce damage to a limited number of trophec-
toderm cells. This allowed for easy access into the blastocyst
cavity for transferring the human cells (Figure S3B). Furthermore,
the zona ablation and trophectoderm access allowed use a
blunt-end pipette for cell transfer, thus minimizing further em-
bryo damage. This method resulted in a nearly 100% injection
effectiveness and >90% embryo survival.
To determine whether hiPSCs could engraft into the cattle
ICM, we injected ten cells from each condition into cattle blasto-
cysts collected 7 days after fertilization. After injection, we
cultured these blastocysts for additional 2 days before analysis.
We used several criteria to evaluate the chimeric contribution of
hiPSCs to cattle blastocysts: (1) average number of human cells
in each blastocyst, (2) average number of human cells in each
ICM, (3) percentage of blastocysts with the presence of human
cells in the ICM, (4) percentage of SOX2+ human cells in the
ICM, and (5) percentage of human cells in the ICM that are
SOX2+ (Figure 4C). Our results indicated that both naive and in-
termediate (but not primed) hiPSCs could survive and integrate
into cattle ICMs, albeit with variable efficiencies (Figures 4D
and S3C–S3E; Table S4). Compared with other cell types,
4i-hiPSCs exhibited the best survival (22/23 blastocysts con-
tained human cells), but the majority of these cells lost SOX2
expression (only 13.6% of human cells remained SOX2+). On
average, 3.64 4i-hiPSCs were incorporated into the ICM.
NHSM-hiPSCs were detected in 46 of 59 injected blastocysts,
with 14.41 cells per ICM. Of these, 89.7% remained SOX2+.
For 2iLD-hiPSCs, 40 of 52 injected blastocysts contained human
cells, with 5.11 cells per ICM, and 69.9% of the ICM-incorpo-
rated human cells remained SOX2+. FAC-hiPSCs exhibited
moderate survival rate (65/101) and ICM incorporation efficiency
(39/101), with an average of 2.31 cells incorporated into the ICM,
and 89.3% remaining SOX2+.
We also performed ICM incorporation assays by injecting
hiPSCs into pig blastocysts. Because certain complications
are frequently associated with pig IVF (Abeydeera, 2002;
Grupen, 2014) (e.g., high levels of polyspermic fertilization), we
used a parthenogenetic activation model, which enabled us to
efficiently produce embryos that developed into blastocysts
(King et al., 2002). Pig oocytes were obtained from ovaries
collected at a local slaughterhouse. Once the oocytes were
matured in vitro, we removed the cumulus cells and artificially
activated the oocytes using electrical stimulation. They were
then cultured to blastocyst stage (Figure 4C). We injected ten
hiPSCs into each pig parthenogenetic blastocyst and evaluated
their chimeric contribution after 2 days of in vitro culture (Figures
4C and S3C–S3E; Table S4). Similar to the results in cattle, we
found that hiPSCs cultured in 4i and NHSM media survived bet-
ter and yielded a higher percentage of blastocysts harboring
human cells (28/35 and 37/44, respectively). Also, among all
blastocysts containing human cells, we observed an average
of 9.5 cells per blastocyst for 4i-hiPSCs and 9.97 cells for
NHSM-hiPSCs. For NHSM-hiPSCs, 19/44 blastocysts had
human cells incorporated into the ICM. In contrast, only 6/35
blastocysts had 4i-hiPSCs localized to the ICM. For 2iLD-
hiPSCs, we observed an average of 5.7 cells per blastocyst,
with 2.25 human cells localized to the ICM. For FAC-hiPSCs,
an average of 3.96 and 1.62 human cells were found in the blas-
tocyst and ICM, respectively. Once incorporated into the ICM,
82.2%, 72%, 60.9%, and 40% of 2iLD-, 4i-, NHSM-, and FAC-
hiPSCs, respectively, stained positive for the pluripotency
Cell 168, 473–486, January 26, 2017 479
marker SOX2. These results indicate that both naive and inter-
mediate hiPSCs seem to perform better when injected into cattle
than pig blastocysts. This suggests a different in vivo blastocyst
environment in pig and cattle, with the cattle blastocysts
providing an environment that is more permissive for hiPSC inte-
gration and survival.
Chimeric Contribution of hiPSCs to Post-implantation Pig Embryos Although ICM incorporation of hiPSCs is the necessary first step
to contribute to the embryo proper of host animals, it has limited
predictive value for post-implantation chimera formation, as
other factors are involved. Next, we investigated if any of the
naive and intermediate hiPSCs that we generated, which
showed robust ICM incorporation in pre-implantation blasto-
cysts, could contribute to post-implantation development
following ET. The pig has certain advantages over cattle for ex-
periments involving post-implantation embryos, as they are a
polytocus species, and are commonly used as a translational
model given their similarities to humans concerning organ phys-
iology, size, and anatomy. We thus chose the pig for these ex-
periments. Since there was little to no contribution of primed
hiPSCs, even at the pre-implantation blastocyst stage, we
excluded these cells from the ET experiments. Pig embryos
were derived in vivo or through parthenogenesis. A total of 167
embryo donors were used in this study, from which we collected
1,298 zygotes, 1,004 two-cell embryos and 91 morulae (Table
S5). Embryos were cultured in vitro until they reached the blasto-
cyst stage (Figures S4AA and S4B). Overall, 2,181 good quality
blastocysts with a well-defined ICM were selected for subse-
quent blastocyst injections, of which 1,052were derived from zy-
gotes, 897 from two-cell embryos, 91 from morulae, and 141
from parthenogenetic activation (Table S5). We injected 3-10
hiPSCs into the blastocoel of each of these blastocysts (Figures
5A, S4A, and S4C; Table S6). After in vitro embryo culture, a total
of 2,075 embryos (1,466 for hiPSCs; Table S6; 477 for rodent
PSCs; Table S3) that retained good quality were transferred to
surrogate sows. A total of 41 surrogate sows received 30–50 em-
bryos each, resulting in 18 pregnancies (Table S6). Collection of
embryos between day 21-28 of development resulted in the har-
vesting of 186 embryos: 43 from 2iLD-hiPSCs, 64 from FAC-
hiPSCs, 39 from 4i-hiPSCs, and 40 from NHSM-hiPSCs (Figures
5B, S4A, S4D, and S4F). In addition, 17 control embryos were
collected from an artificially inseminated sow (Figure 5B).
Following evaluating the developmental status of the obtained
embryos, more than half showed retarded growth and were
smaller than control embryos (Figures 5B and S4B), as was
seen when pig blastocysts were injected with rodent PSCs (Fig-
ure 3B). Among different hiPSCs, embryos injected with FAC-
hiPSCsweremore frequently found to be normal size (Figure 5C).
From the recovered embryos, and based on fluorescence imag-
ing (GFP for 2iLD-hiPSCs and FAC-hiPSCs; hKO for 4i-hiPSCs
and NHSM-hiPSCs), we observed positive fluorescence signal
(FO+) in 67 embryos among which 17 showed a normal size
and morphology, whereas the rest were morphologically under-
developed (Figures 5B). In contrast, among fluorescence nega-
tive embryos we found the majority (82/119) appeared normal
size (Figure 5E), suggesting contribution of hiPSCs might have
480 Cell 168, 473–486, January 26, 2017
interfered with normal pig development. Closer examination of
the underdeveloped embryos revealed that 50 out of 87 were
FO+ (Figures 5B). Among all the FO+ embryos the distribution
of normal size versus growth retarded embryos for each cell lines
was: 3:19 for 2iLD-hiPSCs, 7:14 for FAC-hiPSCs, 2:12 for 4i-
hiPSCs, and 5:5 for NHSM-hiPSCs (Figure 5D). Among normal
size embryos we found 3/13 from 2iLD-hiPSCs, 7/47 from
FAC-hiPSCs, 2/14 from 4i-hiPSCs, and 5/25 from NHSM-
hiPSCs that were FO+ (Figure 5B). All normal size FO+ embryos
derived from 2iLD-hiPSCs, 4i-hiPSCs, or NHSM-hiPSCs showed
a very limited fluorescence signal (Figure S5A). In contrast,
normal size FO+ FAC-hiPSC-derived embryos typically ex-
hibited a more robust fluorescence signal (Figures 6A and S5A).
Detecting fluorescence signal alone is insufficient to claim
chimeric contribution of donor hiPSCs to these embryos, as
auto-fluorescence from certain tissues and apoptotic cells can
yield false positives, especially when chimerism is low. We
thus sectioned all normal size embryos deemed positive based
on the presence of fluorescence signal and subjected them to
IHC analyses with antibodies detecting GFP or hKO. For 2iLD-
hiPSC-, 4i-hiPSC-, and NHSM-hiPSC-derived embryos, in
agreement with fluorescence signals observed in whole-embryo
analysis, we detected only a few hKO- or GFP-positive cells in
limited number of sections (Figure S5A). This precluded us
from conducting further IHC analysis using lineage markers.
For FAC-hiPSC-derived embryos, we confirmed via IHC analysis
(using an anti-GFP antibody) that they contained more human
cells (Figures 6A, S5A, and S5B).We then stained additional sec-
tions using antibodies against TUJ1, EPCAM, SMA, CK8, and
HNF3b (Figures 6B and S5C) and observed differentiation of
FAC-hiPSCs into different cell lineages. In addition, these cells
were found negative for OCT4, a pluripotency marker (data not
shown). Moreover, the presence of human cells was further veri-
fied with a human-specific HuNu antibody staining (Figure 6B)
and a sensitive genomic PCR assay using a human specific
Alu sequence primer (Figure 6C; Table S2). Together, these re-
sults indicate that naive hiPSCs injected into pig blastocysts inef-
ficiently contribute to chimera formation, and are only rarely
detected in post-implantation pig embryos. An intermediate
hPSC type (FAC-hiPSCs) showed better chimeric contribution
and differentiated to several cell types in post-implantation
human-pig chimeric embryos. It should be noted that the
levels of chimerism from all hiPSCs, including the FAC-hiPSCs,
in pig embryos were much lower when compare to rat-mouse
chimeras (Figures 1C, 1E, S1A, and 1B), which may reflect the
larger evolutionary distance between human-pig than between
rat-mouse.
DISCUSSION
Our study confirms that live rat-mouse chimeras with extensive
contribution from naive rat PSCs can be generated. This is in
contrast to earlier work in which rat ICMs were injected into
mouse blastocysts (Gardner and Johnson, 1973). One possible
explanation for this discrepancy is that cultured PSCs acquire
artificial features that make themmore proliferative and/or better
able to survive than embryonic ICM cells, which in turn leads to
their more robust xeno-engraftment capability in a mouse host.
A
B C
D
E
Figure 5. Generation of Post-implantation Human-Pig Chimeric Embryos
(A) Schematic of the experimental procedures for the generation and analyses of post-implantation pig embryos derived from blastocyst injection of naive and
intermediate hiPSCs.
(B) Summary of the pig embryos recovered between day 21–28 of pregnancy.
(C) Bar graph showing proportions of normal size and growth retarded embryos, as well as the proportion of fluorescence-positive and -negative embryos,
generated from different types of hiPSCs.
(D) Bar graph showing the proportion of normal size and growth-retarded embryos (among those exhibiting a fluorescence signal) generated from different types
of hiPSCs.
(E) Bar graph showing the proportion of normal-sized and growth-retarded embryos (among those without exhibiting a fluorescence signal) generated from
different types of hiPSCs.
See also Figure S4 and Tables S5 and S6.
Rat-mouse chimeras generated by injecting donor rat PSCs into
a mouse host were mouse-sized and developed into adulthood
with apparently normal appearance and physiology. We further
show in this study that a rat-mouse chimera could live a full
mouse lifespan (about 2 years) and exhibit molecular signatures
characteristic of aged cells. This demonstrates that cells from
two different species, which diverged �18 million years ago, can live in a symbiotic environment and are able to support
normal organismal aging. The fact that rat PSCs were able to
contribute to the mouse gallbladder, an organ that is absent in
the rat, highlights the importance of embryonic niches in orches-
trating the specification, proliferation, and morphogenesis of
tissues and organs during organismal development and evolu-
tionary speciation (Izpisúa-Belmonte et al., 1992).
Previous interspecies blastocyst complementation experi-
ments generated host embryos by crossing heterozygous
mutant mouse strains, which were themselves generated
through targeted gene disruption in germline competent ESCs.
Cell 168, 473–486, January 26, 2017 481
(legend on next page)
482 Cell 168, 473–486, January 26, 2017
These experiments are labor intensive and time consuming.
Moreover, only �25% of blastocysts derived from genetic crosses are homozygousmutants, posing a limitation for efficient
complementation. CRISPR-Cas9mediated zygote genome edit-
ing offers a faster andmore efficient one-step process for gener-
ating mice carrying homozygous mutations, thereby providing a
robust interspecies blastocyst complementation platform. Addi-
tionally, the multiplexing capability of CRISPR-Cas9 (Cong et al.,
2013; Yang et al., 2015) could potentially be harnessed for multi-
lineage complementation. For example, in the case of the
pancreas, one might hope to eliminate both the pancreatic pa-
renchyma and vasculature of the host to generate a more com-
plete xenogeneic pancreas. Despite the advantages, there are
several technical limitations of the CRISPR-Cas9 blastocyst
complementation system that need to be overcome before un-
locking its full potential. First, gene inactivation relies on the
error-prone, non-homologous end joining (NHEJ) pathway,
which is often unpredictable. In-frame mutations and mosaicism
are among the factors thatmay affect outcomes. Amore predict-
able targeted gene inactivation strategy that utilizes homologous
recombination (HR) is still inefficient in the zygote. Second, each
embryo must be injected twice when using this system and em-
bryosmust be cultured in vitro for several daysbefore ET, thereby
compromising embryo quality. Technical advancements that
include a more robust gene-disruption strategy (e.g., targeted
generation of frameshift mutations via homology independent
targeted integration [Suzuki et al., 2016]), alternative CRISPR/
Cas9 delivery methods, and improved culture conditions for
manipulated embryos will likely help improve and optimize the
generation of organogenesis-disabled hosts.
We observed a slower clearance of an intraperitoneally in-
jected glucose load for Pdx1�/� than Pdx1+/� rat-mouse chi- meras, while both were slower than wild-type mouse controls
(Figure S2C). While this result may seem to contradict a previ-
ous report (Kobayashi et al., 2010), the discrepancy is likely
due to the development of autoimmune type inflammation that
is often observed in adult rat-mouse (chimeras made by injec-
tion of rat PSCs into mouse blastocyst, data not shown)
(>7 months, this study) and mouse-rat chimeras (chimeras
made by injection of mouse PSCs into rat blastocyst; H. Nakau-
chi, personal communication), which is less evident in young
chimeras (�8 weeks; Kobayashi et al. 2010). Interestingly though, we did observe a similarly slower clearance of glucose
load in wild-type rats, although the initial spike was much lower
in rats compared to mice or chimeras (Figure S2C). Thus, the rat
cellular origin might also have played a role in the different GTT
responses observed.
Figure 6. Chimeric Contribution of hiPSCs to Post-implantation Pig Em
(A) Representative bright field (left top) fluorescence (left bottom andmiddle) and i
normal size day 28 pig embryo (FAC #1). Scale bar, 100 mm.
(B) Representative immunofluorescence images showing chimeric contribution a
FAC-hiPSC derivatives are visualized by antibodies against GFP (top), TUJ1, SMA
magnification images of boxed regions. Scale bar, 100 mm.
(C) Representative gel images showing genomic PCR analyses of pig embryos d
and FAC-hiPSCs (surrogates #9159 and #18771) using a human specific Alu prim
with no genomic DNA loaded. pc, positive controls with human cells. Pig 1D, 1G
See also Figure S5 and Table S2.
Rodent ESCs/iPSCs, considered as the gold standard cells for
defining naive pluripotency, can robustly contribute to intra- and
inter-species chimeras within rodent species. These and other
results have led to the assumption that naive PSCs are the cells
of choice when attempting to generate interspecies chimeras
involving more disparate species. Here, we show that rodent
PSCs fail to contribute to chimera formation when injected into
pig blastocysts. This highlights the importance of other contrib-
uting factors underlying interspecies chimerism that may
include, but not limited to, species-specific differences in
epiblast and trophectoderm development, developmental ki-
netics, and maternal microenvironment.
To date, and taking into consideration all published studies
that have used the mouse as the host species, it is probably
appropriate to conclude that interspecies chimera formation
involving hPSCs is inefficient (De Los Angeles et al., 2015). It
has been argued that this apparent inefficiency results from spe-
cies-specific differences between human and mouse embryo-
genesis. Therefore, studies utilizing other animal hosts would
help address this important question. Here we focused on two
species, pig and cattle, from a more diverse clade of mammals
and found that naive and intermediate, but not primed, hiPSCs
could robustly incorporate into pre-implantation host ICMs.
Following ET, we observed, in general and similar to the mouse
studies, low chimera forming efficiencies for all hiPSCs tested.
Interestingly, injected hiPSCs seemed to negatively affect
normal pig development as evidenced by the high proportion
of growth retarded embryos. Nonetheless, we observed that
FAC-hiPSCs, a putative intermediate PSC type between naive
and primed pluripotent states, displayed a higher level of chime-
rism in post-implantation pig embryos. IHC analyses revealed
that FAC-hiPSCs integrated and subsequently differentiated in
host pig embryos (as shown by the expression of different line-
age markers, and the lack of expression of the pluripotency
marker OCT4). Whether the degree of chimerism conferred by
FAC-hiPSCs could be sufficient for eliciting a successful inter-
species human-pig blastocyst complementation, as demon-
strated herein between rats and mice, remains to be demon-
strated. Studies and approaches to improve the efficiency and
level of hPSC interspecies chimerism (Wu et al., 2016), such as
matching developmental timing, providing a selective advantage
for donor hPSCs, generating diverse hPSCs with a higher
chimeric potential and selecting a species evolutionarily closer
to humans, among others parameters, will be needed.
The procedures and observations reported here on the capa-
bility of human pluripotent stem cells to integrate and differentiate
in a ungulate embryo, albeit at a low level and efficiency, when
bryos
mmunofluorescence (right) images of GFP-labeled FAC-hiPSCs derivatives in a
nd differentiation of FAC-hiPSCs in a normal size, day 28 pig embryo (FAC #1).
, CK8 and HuNu (middle). (Bottom) Merged images with DAPI. Insets are higher
erived from blastocyst injection of 2iLD-iPSCs (surrogates #8164 and #20749)
er. A pig specific primer Cyt b was used for loading control. nc, negative control
, and 1I, pig controls. ID, surrogate and pig embryos.
Cell 168, 473–486, January 26, 2017 483
optimized, may constitute a first step towards realizing the poten-
tial of interspecies blastocyst complementation with hPSCs. In
particular, they may provide a better understanding of human
embryogenesis, facilitate the development and implementation
of humanized animal drug test platforms, as well as offer new in-
sightson theonsetandprogressionofhumandiseases inan invivo
setting. Ultimately, these observations also raise the possibility of
xeno-generating transplantable human tissues and organs to-
wards addressing the worldwide shortage of organ donors.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d CONTACT FOR REAGENT AND RESOURCE SHARING
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Rodents
B Pigs
B Human iPSC Culture Media
B Culture and maintenance of rat ESCs/iPSCs and
mouse iPSCs
d METHOD DETAILS
B Chemicals Unless Otherwise Indicated, Chemicals
Were Obtained from Sigma-Aldrich
B Rat iPSC Generation
B Human iPSC Generation
B Generation of Fluorescently Labeled Rat PSCs and
hiPSCs
B Mouse Embryo Collection
B sgRNA Design and In Vitro Transcription
B Microinjection of Cas9 mRNA and sgRNAs to Mouse
Zygotes
B Microinjection of Rat PSCs to Mouse Blastocysts
B Mouse Embryo Transfer
B Genomic PCR
B Quantitative Genomic PCR
B Genotyping and DNA Sequencing
B Glucose Tolerance Test
B Cattle In Vitro Embryo Production
B Pig Parthenogenetic Embryo Production
B Microinjection of PSCs to Cattle and Pig Blastocysts
and Embryo Culture
B Pig and Cattle Blastocyst Immunostaining
B Pig In Vivo Embryo Recovery and Transfer
B Pig Parthenogenetic Embryo Transfer
B Immunocytochemistry
d QUANTIFICATION AND STATISTICAL ANALYSIS
SUPPLEMENTAL INFORMATION
Supplemental Information includes five figures and six tables and can be found
with this article online at http://dx.doi.org/10.1016/j.cell.2016.12.036.
AUTHOR CONTRIBUTIONS
J.W. and J.C.I.B. conceived the study. J.W. generated and characterized all
naive and intermediate hiPSC lines. K.S. generated and characterized primed
484 Cell 168, 473–486, January 26, 2017
hiPSCs. J.W. and T.H. generated rat iPSCs. J.W., A.P.-L., T.Y., M.M.V., D.O.,
A.O., P.R., C.R.E., J.W., and P.M.R. performed immunohistochemistry ana-
lyses of mouse and pig embryos. K.S., T.Y., E.S., A.P.-L., and M.M.V. per-
formed genotyping, genomic PCR, and genomic qPCR analyses. A.S., M.S.,
and J.P.L. performed mouse Cas9/sgRNA injection, blastocyst injection,
and embryo transfer. Y.S.B., M.S., and M.V. prepared hiPSCs, performed
morulae and blastocyst injections, and analyzed hiPSC contribution to cattle
and ppig ICMs. H.W. produced parthenogenetic pig embryos. D.A.S.,
Y.S.B., and M.V. produced cattle embryos. Work at UC Davis and University
of Murcia was performed under the supervision of P.J.R. and E.A.M., respec-
tively. E.A.M., M.A.G., C.C., I.P., C.A.M., S.S.B., A.N., and J.R. designed,
coordinated, performed, and analyzed data related to pig embryo collection,
embryo culture, blastocyst injection, embryo transfer, and embryo recover.
E.N.D., J.L., I.G., P.G., T.B., M.L.M.-M., and J.M.C. coordinated work
between Salk, and University of Murcia. J.W., P.J.R., and J.C.I.B. wrote the
manuscript.
ACKNOWLEDGMENTS
J.C.I.B. dedicates this paper to Dr. Rafael Matesanz, Director of the Spain’s
National Organ Transplant Organization. Rafael’s work has helped save thou-
sands of patients in need of an organ. He constitutes a relentless inspiration for
those of us trying to understand and alleviate human disease. The authors are
grateful to Xiomara Lucas, Maria Dolores Ortega, Moises Gonzalvez, Jose An-
tonio Godinez, and Jesus Gomis for their assistance throughout this work. We
thank the staff of the Agropor S.A. and Porcisan S.A. piggeries (Murcia, Spain)
for the help and excellent management of animals. We thank Joan Rowe, Bret
McNabb, Aaron Prinz, and Kent Parker and their crews for excellent assistance
with embryo transfers and pig care at UCDavis.We thankMako Yamamoto for
help with mouse embryo dissection. We would like to thank Uri Manor of the
Salk Waitt Advanced Biophotonics Core for technical advice on imaging anal-
ysis. We would like to thank the Salk Stem Cell Core for providing cell culture
reagents. We would like to thank May Schwarz and Peter Schwarz for admin-
istrative help. We thank David O’Keefe for critical reading and editing of the
manuscript. This experimental studywas supported by The Fundación Séneca
(GERM 19892/GERM/15), Murcia, Spain. The MINECO is acknowledged for
their grant-based support (BES-2013-064087 and BES-2013-064069) (to
C.A.M and A.N.). P.J.R was supported by a UC Davis Academic Senate
New Research grant. Work in the laboratory of J.C.I.B. was supported by
the UCAM, Fundacion Dr. Pedro Guillen, G. Harold and Leila Y. Mathers Char-
itable Foundation, and The Moxie Foundation.
Received: February 2, 2016
Revised: October 30, 2016
Accepted: December 22, 2016
Published: January 26, 2017
REFERENCES
Aasen, T., Raya, A., Barrero, M.J., Garreta, E., Consiglio, A., González, F., Vas-
sena, R., Bili�c, J., Pekarik, V., Tiscornia, G., et al. (2008). Efficient and rapid
generation of induced pluripotent stem cells from human keratinocytes. Nat.
Biotechnol. 26, 1276–1284.
Abeydeera, L.R. (2002). In vitro production of embryos in swine. Theriogenol-
ogy 57, 256–273.
Chen, J., Lansford, R., Stewart, V., Young, F., and Alt, F.W. (1993). RAG-2-
deficient blastocyst complementation: an assay of gene function in lympho-
cyte development. Proc. Natl. Acad. Sci. USA 90, 4528–4532.
Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X.,
Jiang, W., Marraffini, L.A., and Zhang, F. (2013). Multiplex genome engineering
using CRISPR/Cas systems. Science 339, 819–823.
De Los Angeles, A., Ferrari, F., Xi, R., Fujiwara, Y., Benvenisty, N., Deng, H.,
Hochedlinger, K., Jaenisch, R., Lee, S., Leitch, H.G., et al. (2015). Hallmarks
of pluripotency. Nature 525, 469–478.
Dull, T., Zufferey, R., Kelly, M., Mandel, R.J., Nguyen, M., Trono, D., and Nal-
dini, L. (1998). A third-generation lentivirus vector with a conditional packaging
system. J. Virol. 72, 8463–8471.
Funahashi, H., Ekwall, H., and Rodriguez-Martinez, H. (2000). Zona reaction in
porcine oocytes fertilized in vivo and in vitro as seen with scanning electron
microscopy. Biol. Reprod. 63, 1437–1442.
Gafni, O., Weinberger, L., Mansour, A.A., Manor, Y.S., Chomsky, E., Ben-Yo-
sef, D., Kalma, Y., Viukov, S., Maza, I., Zviran, A., et al. (2013). Derivation of
novel human ground state naive pluripotent stem cells. Nature 504, 282–286.
Gardner, R.L., and Johnson, M.H. (1973). Investigation of early mammalian
development using interspecific chimaeras between rat and mouse. Nat.
New Biol. 246, 86–89.
Gehring, W.J., and Ikeo, K. (1999). Pax 6: mastering eye morphogenesis and
eye evolution. Trends Genet. 15, 371–377.
Grupen, C.G. (2014). The evolution of porcine embryo in vitro production. Ther-
iogenology 81, 24–37.
Hansen, P.J. (2014). Current and future assisted reproductive technologies for
mammalian farm animals. In Current and Future Reproductive Technologies
and World Food Production, G. Cliff Lamb and N. DiLorenzo, eds. (Springer
New York), pp. 1–22.
Hasler, J.F. (2014). Forty years of embryo transfer in cattle: a review focusing
on the journal Theriogenology, the growth of the industry in North America, and
personal reminisces. Theriogenology 81, 152–169.
Hishida, T., Nozaki, Y., Nakachi, Y., Mizuno, Y., Okazaki, Y., Ema, M., Takaha-
shi, S., Nishimoto, M., and Okuda, A. (2011). Indefinite self-renewal of ESCs
through Myc/Max transcriptional complex-independent mechanisms. Cell
Stem Cell 9, 37–49.
Hockemeyer, D., Soldner, F., Cook, E.G., Gao, Q., Mitalipova, M., and Jae-
nisch, R. (2008). A drug-inducible system for direct reprogramming of human
somatic cells to pluripotency. Cell Stem Cell 3, 346–353.
Holm, P., Booth, P.J., Schmidt, M.H., Greve, T., and Callesen, H. (1999). High
bovine blastocyst development in a static in vitro production system using
SOFaa medium supplemented with sodium citrate and myo-inositol with or
without serum-proteins. Theriogenology 52, 683–700.
Huang, Y., Osorno, R., Tsakiridis, A., and Wilson, V. (2012). In vivo differentia-
tion potential of epiblast stem cells revealed by chimeric embryo formation.
Cell Rep. 2, 1571–1578.
Irie, N., Weinberger, L., Tang, W.W.C., Kobayashi, T., Viukov, S., Manor, Y.S.,
Dietmann, S., Hanna, J.H., and Surani, M.A. (2015). SOX17 is a critical specifier
of human primordial germ cell fate. Cell 160, 253–268.
Isotani, A., Hatayama, H., Kaseda, K., Ikawa, M., and Okabe, M. (2011). For-
mation of a thymus from rat ES cells in xenogeneic nude mouse4rat ES chi-
meras. Genes Cells 16, 397–405.
Izpisúa-Belmonte, J.C., Brown, J.M., Crawley, A., Duboule, D., and Tickle, C.
(1992). Hox-4 gene expression in mouse/chicken heterospecific grafts of sig-
nalling regions to limb buds reveals similarities in patterning mechanisms.
Development 115, 553–560.
Jonsson, J., Carlsson, L., Edlund, T., and Edlund, H. (1994). Insulin-promoter-
factor 1 is required for pancreas development in mice. Nature 371, 606–609.
King, T.J., Dobrinsky, J.R., Zhu, J., Finlayson, H.A., Bosma, W., Harkness, L.,
Ritchie, W.A., Travers, A., McCorquodale, C., Day, B.N., et al. (2002). Embryo
development and establishment of pregnancy after embryo transfer in pigs:
coping with limitations in the availability of viable embryos. Reproduction
123, 507–515.
Kobayashi, T., Yamaguchi, T., Hamanaka, S., Kato-Itoh, M., Yamazaki, Y.,
Ibata, M., Sato, H., Lee, Y.-S., Usui, J., Knisely, A.S., et al. (2010). Generation
of rat pancreas in mouse by interspecific blastocyst injection of pluripotent
stem cells. Cell 142, 787–799.
Kutner, R.H., Zhang, X.-Y., and Reiser, J. (2009). Production, concentration
and titration of pseudotyped HIV-1-based lentiviral vectors. Nat. Protoc. 4,
495–505.
Li, P., Tong, C., Mehrian-Shai, R., Jia, L., Wu, N., Yan, Y., Maxson, R.E.,
Schulze, E.N., Song, H., Hsieh, C.-L., et al. (2008). Germline competent embry-
onic stem cells derived from rat blastocysts. Cell 135, 1299–1310.
Lyons, I., Parsons, L.M., Hartley, L., Li, R., Andrews, J.E., Robb, L., and Har-
vey, R.P. (1995). Myogenic and morphogenetic defects in the heart tubes of
murine embryos lacking the homeo box gene Nkx2-5. Genes Dev. 9,
1654–1666.
Martinez, E.A., Angel, M.A., Cuello, C., Sanchez-Osorio, J., Gomis, J., Parrilla,
I., Vila, J., Colina, I., Diaz, M., Reixach, J., et al. (2014). Successful non-surgical
deep uterine transfer of porcine morulae after 24 hour culture in a chemically
defined medium. PLoS ONE 9, e104696.
Nichols, J., and Smith, A. (2009). Naive and primed pluripotent states. Cell
Stem Cell 4, 487–492.
Offield, M.F., Jetton, T.L., Labosky, P.A., Ray, M., Stein, R.W., Magnuson,
M.A., Hogan, B.L., and Wright, C.V. (1996). PDX-1 is required for pancreatic
outgrowth and differentiation of the rostral duodenum. Development 122,
983–995.
Okita, K., Ichisaka, T., and Yamanaka, S. (2007). Generation of germline-
competent induced pluripotent stem cells. Nature 448, 313–317.
Okita, K., Matsumura, Y., Sato, Y., Okada, A., Morizane, A., Okamoto, S.,
Hong, H., Nakagawa, M., Tanabe, K., Tezuka, K., et al. (2011). A more efficient
method to generate integration-free human iPS cells. Nat. Methods 8,
409–412.
Park, I.H., Zhao, R., West, J.A., Yabuuchi, A., Huo, H., Ince, T.A., Lerou, P.H.,
Lensch, M.W., and Daley, G.Q. (2008). Reprogramming of human somatic
cells to pluripotency with defined factors. Nature 451, 141–146.
Parrish, J.J., Susko-Parrish, J.L., Leibfried-Rutledge, M.L., Critser, E.S., Eye-
stone, W.H., and First, N.L. (1986). Bovine in vitro fertilization with frozen-
thawed semen. Theriogenology 25, 591–600.
Parrish, J.J., Susko-Parrish, J., Winer, M.A., and First, N.L. (1988). Capacita-
tion of bovine sperm by heparin. Biol. Reprod. 38, 1171–1180.
Petters, R.M., andWells, K.D. (1993). Culture of pig embryos. J. Reprod. Fertil.
Suppl. 48, 61–73.
Pursel, V.G., and Johnson, L.A. (1975). Freezing of boar spermatozoa: fertil-
izing capacity with concentrated semen and a new thawing procedure.
J. Anim. Sci. 40, 99–102.
Reubinoff, B.E., Pera, M.F., Fong, C.Y., Trounson, A., and Bongso, A. (2000).
Embryonic stem cell lines from human blastocysts: somatic differentiation
in vitro. Nat. Biotechnol. 18, 399–404.
Ross, P.J., Ragina, N.P., Rodriguez, R.M., Iager, A.E., Siripattarapravat, K.,
Lopez-Corrales, N., and Cibelli, J.B. (2008). Polycomb gene expression and
histone H3 lysine 27 trimethylation changes during bovine preimplantation
development. Reproduction 136, 777–785.
Suzuki, K., Tsunekawa, Y., Hernandez-Benitez, R., Wu, J., Zhu, J., Kim, E.J.,
Hatanaka, F., Yamamoto, M., Araoka, T., Li, Z., et al. (2016). In vivo genome
editing via CRISPR/Cas9 mediated homology-independent targeted integra-
tion. Nature 540, 144–149.
Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K.,
and Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human
fibroblasts by defined factors. Cell 131, 861–872.
Takashima, Y., Guo, G., Loos, R., Nichols, J., Ficz, G., Krueger, F., Oxley, D.,
Santos, F., Clarke, J., Mansfield,W., et al. (2014). Resetting transcription factor
control circuitry toward ground-state pluripotency in human. Cell 158,
1254–1269.
Tanaka, M., Chen, Z., Bartunkova, S., Yamasaki, N., and Izumo, S. (1999). The
cardiac homeobox gene Csx/Nkx2.5 lies genetically upstream of multiple
genes essential for heart development. Development 126, 1269–1280.
Tesar, P.J., Chenoweth, J.G., Brook, F.A., Davies, T.J., Evans, E.P., Mack,
D.L., Gardner, R.L., and McKay, R.D.G. (2007). New cell lines from mouse
epiblast share defining features with human embryonic stem cells. Nature
448, 196–199.
Theunissen, T.W., Powell, B.E., Wang, H., Mitalipova, M., Faddah, D.A.,
Reddy, J., Fan, Z.P., Maetzel, D., Ganz, K., Shi, L., et al. (2014). Systematic
Cell 168, 473–486, January 26, 2017 485
identification of culture conditions for induction and maintenance of naive hu-
man pluripotency. Cell Stem Cell 15, 471–487.
Theunissen, T.W., Friedli, M., He, Y., Planet, E., O’Neil, R.C., Markoulaki, S.,
Pontis, J., Wang, H., Iouranova, A., Imbeault, M., et al. (2016). Molecular
criteria for defining the naive human pluripotent state. Cell Stem Cell 19,
502–515.
Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J.,
Marshall, V.S., and Jones, J.M. (1998). Embryonic stem cell lines derived from
human blastocysts. Science 282, 1145–1147.
Tsukiyama, T., andOhinata, Y. (2014). Amodified EpiSC culture condition con-
taining aGSK3 inhibitor can support germline-competent pluripotency inmice.
PLoS ONE 9, e95329.
Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F.,
and Jaenisch, R. (2013). One-step generation of mice carrying mutations in
multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153,
910–918.
Weinberger, L., Ayyash, M., Novershtern, N., and Hanna, J.H. (2016). Dynamic
stem cell states: naive to primed pluripotency in rodents and humans. Nat.
Rev. Mol. Cell Biol. 17, 155–169.
Wernig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger,
K., Bernstein, B.E., and Jaenisch, R. (2007). In vitro reprogramming of fibro-
blasts into a pluripotent ES-cell-like state. Nature 448, 318–324.
Wu, J., and Izpisua Belmonte, J.C. (2015). Dynamic pluripotent stem cell states
and their applications. Cell Stem Cell 17, 509–525.
486 Cell 168, 473–486, January 26, 2017
Wu, J., and Izpisua Belmonte, J.C. (2016). Stem cells: a renaissance in human
biology research. Cell 165, 1572–1585.
Wu, J., Okamura, D., Li, M., Suzuki, K., Luo, C., Ma, L., He, Y., Li, Z., Benner,
C., Tamura, I., et al. (2015). An alternative pluripotent state confers interspecies
chimaeric competency. Nature 521, 316–321.
Wu, J., Greely, H.T., Jaenisch, R., Nakauchi, H., Rossant, J., and Belmonte,
J.C. (2016). Stem cells and interspecies chimaeras. Nature 540, 51–59.
Xiang, A.P., Mao, F.F., Li, W.-Q., Park, D., Ma, B.-F., Wang, T., Vallender, T.W.,
Vallender, E.J., Zhang, L., Lee, J., et al. (2008). Extensive contribution of em-
bryonic stem cells to the development of an evolutionarily divergent host.
Hum. Mol. Genet. 17, 27–37.
Yang, L., Güell, M., Niu, D., George, H., Lesha, E., Grishin, D., Aach, J., Shrock,
E., Xu, W., Poci, J., et al. (2015). Genome-wide inactivation of porcine endog-
enous retroviruses (PERVs). Science 350, 1101–1104.
Yoshioka, K., Noguchi, M., and Suzuki, C. (2012). Production of piglets from
in vitro-produced embryos following non-surgical transfer. Anim. Reprod.
Sci. 131, 23–29.
Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L.,
Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R., et al. (2007). Induced
pluripotent stem cell lines derived from human somatic cells. Science 318,
1917–1920.
Zou, J., Maeder, M.L., Mali, P., Pruett-Miller, S.M., Thibodeau-Beganny, S.,
Chou, B.-K., Chen, G., Ye, Z., Park, I.H., Daley, G.Q., et al. (2009). Gene target-
ing of a disease-related gene in human induced pluripotent stem and embry-
onic stem cells. Cell Stem Cell 5, 97–110.
STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Rabbit monoclonal anti-SOX2 BioGenex Cat# NU579-UC
Mouse anti-HuNu (Clone 235-1) Millipore Cat# MAB1281; RRID: AB_11212527
Rabbit anti-monomeric Kusabira-Orange 2 MBL Code# PM051M
Rabbit anti-GFP MBL Code# 598
Rat monoclonal anti-cytokeratin 8/18 (TROMA-I) DSHB RRID: AB_531826
Mouse monoclonal anti-epithelial antigen DAKO Cat# M0804; RRID: AB_2335685
Mouse monoclonal anti-Ep-CAM Santa Cruz Cat# sc-25308; RRID: AB_627531
Mouse monoclonal anti-actin a-smooth muscle
(Clone 1A4)
Sigma-Aldrich Cat# A5228; RRID: AB_262054
Rabbit polyclonal anti-Histone H3 (tri methyl K9) Abcam Cat# ab8898; RRID: AB_306848
Rabbit polyclonal anti-Histone H4 (tri methyl K20) Abcam Cat# ab9053; RRID: AB_306969
Rat anti-Mouse CD31 (Clone MEC13.3) BD PharMingen Cat# 553370; RRID: AB_394816
Mouse monoclonal anti-Oct3/4 (C-10) Santa Cruz Cat# sc-5279; RRID: AB_628051
Mouse anti-Tubulin b3 (Clone TUJ1) BioLegend Cat# 801202; RRID: AB_10063408
Chemicals, Peptides, and Recombinant Proteins
Y-27632 dihydrochloride Torcris Cat# 1254
Recombinant human FGF-basic (FGF2) Peprotech Cat# 100-18B
Recombinant human LIF Peprotech Cat# 300-05
CHIR99021 Selleckchem Cat# S2924
PD035901 Selleckchem Cat# S1036
L-ascorbic acid 2-phosphate Sigma-Aldrich Cat# A8960
Recombinant human IGF-I LR3 Peprotech Cat# 100-11R3
Recombinant human TGF-b1 Peprotech Cat# 100-21C
SB203580 Selleckchem Cat# S1076
SP600125 Selleckchem Cat# S1460
LDN193189 Selleckchem Cat# S2618
Recombinant human/murine/rat Activin A Peprotech Cat# 120-14P
Doxycycline hyclate (dox) Stemgent Cat# 04-0016
Critical Commercial Assays
MEGAshortscript T7 Transcription Kit Invitrogen Cat# AM1354
MEGAclear Transcription Clean-up Kit Ambion Cat# AM1908
Cas9 mRNA Sigma-Aldrich Cat# CAS9MRNA-1EA
P2 Primary Cell 4D-Nucleofector kit Lonza Cat# V4XP-2024
NucleoSpin Gel and PCR Clean-up MACHEREY-NAGEL Cat# 740609
DNeasy Blood and Tissue kit QIAGEN Cat# 69506
PicoPure DNA Extraction Kit Thermo Fisher Scientific Cat# KIT0103
SYBR Green PCR Master Mix Thermo Fisher Scientific SKU# 4309155
Experimental Models: Cell Lines
DAC2 Li et al., 2008 N/A
DAC8 Li et al., 2008 N/A
SDFE This paper N/A
SDFF This paper N/A
iPS-MEF-Ng-20D-17 RIKEN BRC Cat# APS001
(Continued on next page)
Cell 168, 473–486.e1–e8, January 26, 2017 e1
Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
HFF hiPSCs This paper N/A
NHSM-hiPSCs This paper N/A
2iLD-hiPSCs This paper N/A
4i-hiPSCs This paper N/A
FAC-hiPSCs This paper N/A
Human foreskin fibroblast (HFF) ATCC CRL-2429
Experimental Models: Organisms/Strains
Mouse: C57BL/6J The Jackson Laboratory Stock No: 000664
Mouse: B6D2F1/J The Jackson Laboratory Stock No: 100006
Mouse: ICR (CD1) Envigo Order code: 030
Mouse: NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory Stock No: 005557
Rat: Sprague Dawley Envigo Order code: 002
Pig: Large-White 3 Landrace Murcia, Spain N/A
Pig: Pietrain Murcia, Spain N/A
Pig: Yorkshire University of California Davis N/A
Pig: Yorkshire cross University of California Davis N/A
Recombinant DNA
pCXLE-hOCT3.4-shp53-F Okita et al., 2011 Addgene Plasmid #27077
pCXLE-EGFP Okita et al., 2011 Addgene Plasmid #27082
pCXLE-hSK Okita et al., 2011 Addgene Plasmid #27078
pCXLE-hUL Okita et al., 2011 Addgene Plasmid #27080
pFUW-tetO-hKlf2 This paper N/A
pFUW-tetO-hNanog This paper N/A
pCAG-IP-humanized Kusabira Orange This paper N/A
pmKO1-MC1 MBL Code No. AM-V0052M
LV-tetO-FU-Oct3/4 Hockemeyer et al., 2008 Addgene Plasmid #20726
LV-tetO-FU-Sox2 Hockemeyer et al., 2008 Addgene Plasmid #20724
LV-tetO-FU-KLF4 Hockemeyer et al., 2008 Addgene Plasmid #20725
LV-tetO-FU-Myc Hockemeyer et al., 2008 Addgene Plasmid #20723
LV-FUW-M2rtTA Hockemeyer et al., 2008 Addgene Plasmid #20342
pEGIP Zou et al., 2009 Addgene Plasmid#26777
pMDLg/pRRE Dull et al., 1998 Addgene Plasmid #12251
pRSV-Rev Dull et al., 1998 Addgene Plasmid #12253
pMD2.G pMD2.G was a gift from Didler Trono Addgene Plasmid #12259
Sequence-Based Reagents
sgRNA sequences, see Table S2 This paper N/A
Genomic PCR primers, see Table S2 This paper N/A
DNA sequencing primers, see Table S2 This paper N/A
Genomic qPCR primers, see Table S2 This paper N/A
Software and Algorithms
CRISPR Design MIT http://crispr.mit.edu
CONTACT FOR REAGENT AND RESOURCE SHARING
Further information and requests for reagents may be directed to and will be fulfilled by Lead Contact Juan Carlos Izpisua Belmonte
e2 Cell 168, 473–486.e1–e8, January 26, 2017
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Rodents All the rodent experiments were performed under the ethical guidelines of the Salk Institute, and animal protocols were reviewed and
approved by the Salk Institute Institutional Animal Care and Use Committee (Protocol #12-00021). All mice (C57BL/6J, B6D2F1/J,
ICR and NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ) and rats (Sprague Dawley) used in this study were purchased from Envigo (Harlan) or
The Jackson Laboratory, and bred in the animal facility of the Salk Institute.
Pigs The pig experiments at University of Murcia, Spain, were performed in accordance with Directive 2010/63/EU EEC for animal exper-
iments and were reviewed and approved by the Ethical Committee for Experimentation with Animals (code: 69/2014), the Research
Ethics Committee (code: 1086/2015), and the Biosafety Committee (code:) of the University of Murcia, Spain; and by the Murcia
Regional Ministry of Agriculture and Water (code: 273.705), and the Murcia Regional Ministry of Health (code: 061015), Spain.
Day 21-28 gestation stages were selected to analyze the chimeric contribution of hiPSC to the pig post implantation embryo. Stop-
ping development at this stage will also prevent that embryos with potentially high hiPSC contribution develop a mature central ner-
vous system. The pig experiments in Spain were conducted in two commercial pig farms located in Southeastern Spain (Murcia,
Spain) and in the pig experimental unit of the University ofMurcia (Murcia, Spain). Weaned crossbred sows (Landrace3 Large-White)
from the same genetic line (2-6 parity) were used as embryo donors and recipients. The sows were kept individually in crates in a
mechanically ventilated confinement facility. The semen donors were sexually mature Pietrain boars (2-3 years of age) housed in
climate- controlled individual pens (20-25�C) at a commercial insemination station in Murcia (Spain). Animals had ad libitum access to water and were fed commercial diets according to their nutritional requirements.
Pig experiments performed at the University of California Davis, were reviewed and approved by the Institutional Animal Care and
Use Committee (IACUC# 18158) at the University of California, Davis. Experiments involving hiPSCs at the University of California
Davis were reviewed and approved by the StemCell Research Oversight Committee (SCRO# 1127) and Biological Use Authorization
(BUA# R1627). Day 28 or earlier gestation stages were selected to analyze the contribution of hiPSC to the pig post implantation em-
bryo. Stopping development at this stage will also prevent that embryos with potentially high hiPSC contribution develop a mature
central nervous system. For pig experiments performed at the University of California Davis, Yorkshire or Yorkshire cross females at
6-8months of agewere used as embryo recipients. The animals were kept in group penswith ad libitum access to water andwere fed
commercial diets according to their nutritional requirements.
Human iPSC Culture Media Conventional primed hiPSCs were either cultured on Matrigel (BD Biosciences) coated plates in mTeSR1 medium (StemCell Tech-
nologies) or on MEFs in CDF12 medium: DMEM/F12 (Life Technologies, 11330-032), 20% Knockout Serum Replacement (KSR,
Life Technologies, 10828), 2mM Glutamax (Life Technolgies, 35050-061), 0.1mM NEAA (Life Technologies, 11140-050), 0.1mM
b-mercaptoethanol (GIBCO, 21985) and 4ng/ml FGF2 (Peprotech). 2iL medium contains: N2B27 medium supplemented with hu-
man LIF (10ng/ml, Peprotech), 3 mM CHIR99021 (Selleckchem) and 1 mM PD035901 (Selleckchem). To prepare 500ml of NHSM
medium we added 500ml KnockOut DMEM (Invitrogen), 5ml Pen-strep (GIBCO), 5ml GlutaMax (GIBCO), 5ml NEAA (GIBCO), 5g
AlbumaxI (Invitrogen), 5ml N2 supplement (Invitrogen; 17502048), L-ascorbic acid 2-phosphate (Sigma), 20ng/ml human LIF (Pe-
protech), 20ng/ml human LR3-IGF1 (Peprotech), 8g/ml FGF2 (Peprotech), 2ng/ml TGFb1 (Peprotech), 3 mM CHIR99021 (Selleck-
chem), 1 mM PD0325901 (Selleckchem), 5 mM SB203580 (Selleckchem), 5 mM SP600125 (Selleckchem), 5 mM Y27632 (Torcris)
and 0.4 mM LDN193189 (Selleckchem). 4i medium is based on NHSM medium with only the following differences: L-ascorbic
acid 2-phosphate, Human LR3-IGF1 and LDN193189 were excluded from 4i medium. TGFb1 was used at 1 ng/ml and Y27632
at 5 mM. FAC medium contains: DMEM/F12 (Invitrogen, 11320) and Neurobasal medium (Invitrogen; 21103) were mixed at 1:1
ratio; N2 supplement (Invitrogen; 17502048); 1 3 B27 supplement (Invitrogen; 17504044); 2 mM GlutaMax; 1% NEAA; 0.1mM
b-mercaptoethanol (Sigma); 1 3 Pen-Strep; 50 mg/ml BSA (Sigma); 12 ng/ml FGF2, 10 ng/ml Activin-A (Peprotech) and 3 mM
CHIR99021.
Culture and maintenance of rat ESCs/iPSCs and mouse iPSCs Dr. Qilong Ying, University of Southern California, provided rat ESC lines DAC2 and DAC8. Rat iPSCs, SDFE and SDFF, were
generated in house with tail tip fibroblasts derived from Sprague Dawley rat (Envigo). Rat ESCs/iPSCs were cultured either on
MEFs or FBS-coated plates in rat ESC medium: N2B27 basal medium supplemented with human LIF (10ng/ml, Peprotech),
1.5uM or 3uM CHIR99021 (Selleckchem) and 1uM PD035901 (Selleckchem). Rat ESCs/iPSCs were passaged every 4-5 days
at a split ratio of 1:10. The male mouse iPSCs (MEF-Ng-20D-17) were obtained from RIKEN BRC and were cultured either on
MEFs or Matrigel-coated plates in mouse ESC medium: N2B27 basal medium supplemented with human LIF (10ng/ml, Pepro-
tech), 3uM CHIR99021 (Selleckchem) and 1uM PD035901 (Selleckchem). Mouse iPSCs were passaged every 3-4 days at a split
ratio of 1:20.
Cell 168, 473–486.e1–e8, January 26, 2017 e3
METHOD DETAILS
Chemicals Unless Otherwise Indicated, Chemicals Were Obtained from Sigma-Aldrich Plasmids Construction
For pFUW-tetO-hNanog and pFUW-tetO-hKlf2, PCR-amplified ORF of human NANOG and KLF2 from human H9 ESCs was
sequenced and subcloned into the EcoRI site of pFUW-tetO inducible lentivirus vector. To generate pCAG-IP-humanized Kusabira
Orange (hKO), as described previously (Hishida et al., 2011), the ORF was amplified from pmKO1-MC1 (MBL) by PCR, sequenced
and subcloned into the XhoI/NotI sites of the pCAG-IP.
Rat iPSC Generation Rat iPSC reprograming was performed as descried previously. Briefly, LV-tetO-FU-Oct3/4 (addgene#20726), LV-tetO-FU-Sox2
(addgene#20724), LV-tetO-FU-KLF4 (addgene#20725), LV-tetO-FU-Myc (addgene#20723) or LV-FUW-M2rtTA (addgene#20342)
was transfected into 293FT cells with packaging plasmids. Forty-eight hours after transfection, virus-containing supernatant was
collected from transfected 293FT cells and filtered through a 0.45 mm filer. Rat tail-tip fibroblasts were infected with a mixture of
collected viruses in the presence of 8 mg/ml of polybrene. One day after infection, culture medium was switched to 2 mg/ml Dox-con-
tainingmedium to induce the expression of reprogramming factors. The cells were passaged ontomitotically inactivatedMEFs at day
4 after infection, and, on the following day, the cells were cultured with Dox-containing rat ESC culture medium. Colonies started to
appear at day 9 after infection. Dox was withdrawn at day 13 and individual colonies were picked and transferred to newly prepared
MEF plates and further expanded into stable rat iPSC lines.
Human iPSC Generation Primed hiPSCs, NHSM-hiPSCs and FAC-hiPSCswere generated by reprogramming of human foreskin fibroblasts (HFF, ATCC, CRL-
2429) with episomal vectors. Episomal plasmids pCXLE-EGFP (addgene#27082), pCXLE-hOCT3.4-shp53-F (addgene#27077),
pCXLE-hSK (addgene#27078), pCXLE-hUL (addgene#27080) were obtained from Addgene. HFFs (2x106) were nucleofected with
the episomal vectors using a 4D-Nucleofector (Program EN150, Lonza) with the P2 Primary Cell 4D-Nucleofector kit (Lonza,
V4XP-2024). Five days post-nucleofection, HFFs were re-plated onto mitotically inactivated MEFs. The next day the medium was
changed to conventional hPSC culture medium (CDF12), NHSM medium or FAC medium. Putative iPSC colonies were picked be-
tween day 20 and 30 and transferred to newly prepared MEFs for further cultivation. For the generation of 2iLD-hiPSCs, primed
hiPSCs grown on Matrigel in mTeSR1 medium were pre-treated with 10 mM Y-27632 (Torcris) for 24 hr and then dissociated using
TrypLE (Invitrogen). Lentivirus was prepared as follows: pFUW-tetO-hNanog and pFUW-tetO-hKlf2 were transfected into 293FT cells
with packaging plasmids: pMDLg/pRRE (addgene#12251), pRSV-Rev (addgene#12253) and pMD2.G (addgene#12259). Forty-eight
hours after transfection, virus-containing supernatant was collected from transfected 293FT cells and filtered through a 0.45 mmfiler.
Primed hiPSCs were transduced in suspension with lentivirus in the presence of 10 mMY-27632 and 6 mg/ml polybrene for 1 hr. After
brief centrifugation, the cells were plated on irradiated DR4 MEF feeders (ATCC) in 2iL media containing 10 mMY-27632 and 2 mg/ml
DOX (Stemgent). Three days after transduction, puromycin (1 mg/ml; Invitrogen) was added to the medium. After 7–14 days, dome
shaped colonies were manually picked onto fresh MEF feeders and expanded as 2ILD-hiPSCs. Conversion of NHSM-hiPSCs to 4i-
hiPSCs was done by simply changing culture medium fromNHSM to 4i. Converted cells were passaged for more than 8 times before
further analysis and used for subsequent experiments.
Generation of Fluorescently Labeled Rat PSCs and hiPSCs We used pCAG-IP-humanized Kusabira Orange (hKO) for labeling rat PSCs, mouse iPSCs and hiPSCs (NHSM-hiPSCs), Briefly,
1-2 mg of pCAG-IP-hKO were transfected into 1-2 million of dissociated PSCs using an Amaxia 4D-nucleofector following the pro-
tocol recommended by the manufacture. 0.5-1 mg/ml of puromycin (Invitrogen) was added to the culture 2-3 days post-transfection.
Drug-resistant colonies were manually picked between 7-14 days and further expanded clonally. To label 2iLD-hiPSCs and FAC-
hiPSCs, briefly, pEGIP (addgene#26777) was co-transfected with pMDLg/pRRE, pRSV-Rev and pMD2.G, and packaged and puri-
fied as lentiviral vectors according to a published protocol (Kutner et al., 2009). hiPSCs were individualized with Accumax (Innovative
Cell Technologies). Cells were transduced in suspension with lentiviral pEGIP vector in the presence of 4 ug/ml polybrene for 1 hr.
After brief centrifugation to remove any residual lentiviral vector, the cells were seeded on irradiated DR4MEF feeders (ATCC) in 2iLD
and FACmedia. Three days after transduction, 1 ug/ml puromycin (Invitrogen) was added to the medium. After 2 weeks, Drug-resis-
tant colonies were manually picked onto fresh MEF feeders and expanded as EGFP-labeled hiPSC lines.
Mouse Embryo Collection C57BL/6 female mice (8-10 weeks old) were superovulated by intraperitoneal injection with 5 IU of PMSG (Millipore), followed by in-
jection of 5 IU of hCG (Millipore) 48 hr later. After mating with BDF1 male mice, zygotes were collected the next day at E0.5 in
mKSOM-HEPES medium from oviduct and cultured in the mKSOMaa until Cas9/sgRNA microinjection. mKSOMaa medium: NaCl
(95 mM), KCl (2.5 mM), KH2PO4 (0.35 mM), MgSO4 (0.2 mM), NaHCO3 (25 mM), CaCl2 (1.71 mM), Na2-EDTA (0.01 mM), L-glutamine
(1.0 mM), Na lactate (10 mM), Na pyruvate (0.2 mM), glucose (5.56 mM), essential amino acid (EAA; 10.0 ml/l), non-essential
amino acid (NEAA; 5.0ml/l), penicillin (0.06 g/l), streptomycin (0.05 g/l), and BSA (4 g/l). mKSOM-HEPES medium: same amount
e4 Cell 168, 473–486.e1–e8, January 26, 2017
of chemicals as KSOMaa, but include decreased amount of NaHCO3 (5 mM), HEPES-Na (20 mM), does not include EAA, NEAA, and
BSA substituted by PVA (0.1 g/l).
sgRNA Design and In Vitro Transcription Weused the online software (MIT CRISPRDesign Tool: http://crispr.mit.edu) to design sgRNAs. The sgRNAs containing T7 promoter
were amplified by PCR with the following primers (50-TAATACGACTCACTATA-G-[19bp sgRNA target sequence]-GTTTTAGAGCTA GAAATAGC-30 and 50-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCT CTAAAAC-30) using Q5 High-Fidelity DNA Polymerase (NEB). The PCR product was purified using NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL). To prepare sgRNA mRNA, the purified PCR product was in vitro transcribed by MEGAshortscript
T7 Transcription Kit (Invitrogen) following the manufacturer’s instruction. Prepared RNAs were purified using MEGAclearTM Kit
Purification for Large Scale Transcription Reactions (Ambion) and dissolved in water for embryo transfer (Sigma).
Microinjection of Cas9 mRNA and sgRNAs to Mouse Zygotes The zygotes show clear two pronuclei were selected and transferred into a 40 mL drop of KSOM-HEPES and placed on an inverted
microscope (Olympus, Tokyo, Japan) fittedwithmicromanipulators (Narishige, Tokyo, Japan).Mixture ofCas9mRNA (Sigma-Aldrich,
25-100u/g/ml) and sgRNA (25-50 ug/ml) was loaded to a blunt-end micropipette (Sutter Instrument, CA) of 2-3 mm internal diameter
(ID) connected to amanual hydraulic oil microinjector (Eppendorf, Hamburg, Germany). Then, the zygotes were secured by a holding
pipette and PiezoMicro Manipulator (Prime Tech Ltd, Japan) was used to create a hole in the zona pellucida. The zygote membranes
were broken with a single piezo pulse in the lowest intensity and the injection of themixture RNAwas confirmed by the bulge of mem-
brane. Groups of 10-12 zygotes were manipulated simultaneously and each session was limited to 10 min. After microinjection, the
zygotes were cultured in the 40 mL droplet of mKSOMaa for 3days in a humidified atmosphere of 5% CO2 in air at 37.0�C.
Microinjection of Rat PSCs to Mouse Blastocysts The embryos that have obvious blastocoel at E3.5were defined as blastocysts. Single cell suspensions were added to a 40 mL drop of
KSOM-HEPES containing the blastocysts to be injected. Individual cells were collected into a 20 mm ID ofmicropipette. Six cells were
introduced into the blastocoel near the ICM. Groups of 10-12 blastocysts were manipulated simultaneously and each session was
limited to 30 min. After microinjection, the blastocysts were cultured in mKSOMaa for at least 1 hr until the embryo transfer.
Mouse Embryo Transfer ICR female mice as surrogates (8 weeks old) in the estrus were mated with vasectomized ICRmale mice to induce pseudopregnancy
Embryo transfer to the surrogate at E2.5 was performed surgically under the anesthesia with ketamine (Putney) and xylazine (Akorn).
Injected blastocysts at E3.5 were loaded to the pipette with air bubble and transferred to the uterine horn, which were previously
punctured with a 27G needle connected to a 1.5 mL syringe. 14-22 blastocysts were transferred and performed within 20-30 min
per surrogate.
Genomic PCR Genomic PCR was carried out for the detection of rat, mouse or human cells in pig fetuses. Genomic DNAs were extracted using
DNeasy Blood and Tissue kit (QIAGEN) or PicoPure DNA Extraction Kit (Thermo Fisher Scientific). Genomic PCRs were performed
using PrimeSTAR GXL DNA polymerase (Takara). Primer sequences are provided in Table S2.
Quantitative Genomic PCR Quantitative PCR (qPCR) for quantifying rat contribution in rat-mouse chimera was performed using SYBR Green PCR Master Mix
(Applied Biosystems) and total genomic DNAs isolated from different tissues of the chimera, mouse tail tip and DAC2 rat ESCs. The
data were analyzed using the DDCT method, which were first normalized to the values of the mouse specific primers. A rat specific
primer was used for detecting rat cells. The levels of chimerism were determined based on the values generated from serial dilutions
of rat:mouse genomic DNA. The primers used for genomic qPCR are listed in Table S2.
Genotyping and DNA Sequencing To determine genotypes of gene modified mouse fetuses or neonates, yolk sac (fetus) or tail tip (neonates) were used for genomic
DNA extraction using DNeasy Blood and Tissue kit (QIAGEN) or PicoPure DNA Extraction Kit (Thermo Fisher Scientific). The genomic
DNA sequences including target site were amplified with PrimeSTAR GXL DNA Polymerase. Amplicons were sequenced using an
ABI 3730xl sequencer (Applied Biosystems). Primer sequences are provided in Table S2.
Glucose Tolerance Test Mice andRatswere fasted overnight for approximately 16 hr before the test. Fasted blood glucose levels weremeasured and used as
the baseline glucose levels. A solution of glucose is administered by intra-peritoneal (IP) injection (2g of glucose/kg body weight).
Subsequently, the blood glucose levels were measured at 15, 30, 60 and 120 min after glucose injection, by placing a small drop
of blood on a on the test strip of the blood glucose meter.
Cell 168, 473–486.e1–e8, January 26, 2017 e5
Cattle In Vitro Embryo Production Oocyte Recovery and In Vitro Maturation
Ovaries were collected from a slaughterhouse (Cargill Meat Solutions, Fresno, CA, USA) and transported to the laboratory in insu-
lated container filled with pre-warmed saline solution at �32�C. The ovaries were washed several times and placed in a water bath at (37�C) in saline solution for oocyte aspiration. Oocytes were aspirated from 2 to 6 mm antral follicles using a 21 G butterfly needle connected to a vacuum pump. Cumulus-oocyte complexes (COCs) containing compact and complete cumulus cell layers
were selected andmatured in groups of 50COCs in 400 ml ofM199medium supplementedwith ALA-glutamine (0.1mM), Na pyruvate
(0.2 mM), gentamicin (5 mg/ml), EGF (50 ng/ml), oFSH (50 ng/ml; National Hormone and Peptide Program), bLH (1 ug/ml; National
Hormone and Peptide Program), cysteamine (0.1 mM), and 10% fetal bovine serum (FBS; Hyclone, South Logan, UT, USA).
In vitro maturation (IVM) was performed for 22-24 hr in a humidified atmosphere of 5% CO2 in air at 38.5 �C.
In Vitro Fertilization
Fertilization (Day 0) was carried out using frozen-thawed semen. Straws were thawed at 37�C for 45 s and then semen layered onto a 90%/45%Percoll discontinuous density gradient for centrifugation (7003 g for 15min) at room temperature. A second centrifugation
(3003 g for 5 min) was performed after discarding the supernatant and re-suspending the spermatozoa pellet in TALP-Sperm (pH =
7.4, 295 mOsm) (Parrish et al., 1988; Parrish et al., 1986). Matured groups of 15-20 COCs were washed twice and placed in 50 mL of
fertilizationmedium. The final sperm concentration was adjusted to 1x106 sperm/ml using a hemocytometer. The fertilizationmedium
was supplemented with BSA (essentially fatty acid free, 6 mg/ml), fructose (90 mg/ml), penicillamine (3 mg/ml), hypotaurine (11 mg/ml)
and heparin (20 mg/ml). Oocytes were co-incubated with spermatozoa at 38.5�C in humidified atmosphere of 5%CO2 in air. Embryo culture (IVC): Presumptive zygotes were mechanically denuded by vortexing for 3-5 min in a 1.5mL tube and 100 uL of SOF-HEPES
medium (Holm et al., 1999) and cultured in groups of 15-20 in 50 mL drops of potassium simplex optimized medium supplemented
with amino acids and 4 mg/mL of BSA (KSOMaa, pH = 7.4, 275 mOsm) (Evolve ZEBV-100, Zenith Biotech, Guilford, CT, USA) for
7 days. On Day 3, 5% FBS was added. Culture conditions were 38.5�C in a humidified atmosphere of 5% CO2, 5% O2, and 90% N2. On Days 4 and 7 mourlae and blastocysts, respectively, were selected for cell injection.
Pig Parthenogenetic Embryo Production Oocyte Collection and IVM
Oocytes were aspirated from antral follicles (2–4 diameters) of ovaries from prepubertal gilt ovaries collected at a local slaughter-
house (Olson Meat Company, Orland, CA, USA). COCs were washed in TCM-199 (GIBCO) containing 0.1% polyvinyl alcohol
(PVA), and incubated at 38�C and 5% CO2 for 48 hr in TCM-199 containing 0.1% PVA, 3.05 mM D-glucose, 0.91 mM sodium pyru- vate, 0.5 mg/ml oFSH, 0.5 mg/ml bLH, 10 ng/ml EGF, 10 mg/ml gentamicin (GIBCO) and 10% porcine follicle fluid.
Parthenogenetic Activation
After IVM, maturated oocytes were stripped of their cumulus cells by incubation in 1 mg/ml hyaluronidase and gentle pipetting.
Denuded oocytes were washed with MEM containing 25 mM HEPES (GIBCO) and electrically activated with two pulses of
120 V/mm for 40 ms, delivered by a BTX Electro Cell Manipulator 2001 (BTX, San Diego, CA, USA) in a 0.5 mm chamber containing
0.3 M mannitol, 0.05 mM CaCl2, 0.1 mMMgSO4 and 0.1% bovine serum albumin (BSA). After washing with PZM-5 (Yoshioka et al.,
2012), the oocytes were incubated in the presence of 5 mg/ml cytochalasin B in PZM-5 for 3 hr to prevent second polar body extrusion
and thus generate diploid parthenogenetic embryos.
Embryo Culture
After activation, pig zygotes were cultured in the 500 mL of PZM-5 (Yoshioka et al., 2012) containing 0.3% BSA for 3-5 days. After
4 days of culture, the culture medium was supplemented with 10% FBS (Gemini Bio-Product, CA, USA) at 38.5�C in a humidified atmosphere of 5% CO2, 5% O2, and 90% N2.
Microinjection of PSCs to Cattle and Pig Blastocysts and Embryo Culture For morula injections, embryos withmore than eight blastomeres and before compaction were selected on days 3-4 for pig and day 4
for cattle embryos. For blastocyst injections, embryos with an obvious blastocoel on days 5-6 for the pig and 6-7 for cattle were used.
Single cell suspensions were added to a 50 mL drop of cell culture medium containing the embryos to be injected, and placed on an
inverted microscope fitted with micromanipulators. Individual cells were collected into a blunt-end micropipette of 20-30 mm internal
diameter (ID) connected to a manual hydraulic oil microinjector. Then, the embryo was secured by a holding pipette and a laser sys-
tem (Saturn 5 Active, Research Instruments, UK) was used to create a whole in the zona pellucida of the embryo. For blastocysts,
another laser pulse was applied to the trophectoderm in order to allow access to the blastocele. Then, the micropipette containing
the cells was advanced into the embryo and 10 cells deposited in the blastocoel or periviteline space, for blastocysts and morulae,
respectively. Groups of 10-20 embryos were manipulated simultaneously and each session was limited to 40 min. Following cell in-
jection, morulae and blastocysts were cultured in the respective cell culture medium for 4 hr, followed by culture for 20 hr in mix me-
dium (1:1) of each cell culturemedium and PZM-5 containing 10%FBS (for the porcine embryos) or KSOMaa containing 4mg/ml BSA
(for the cattle embryos). Then, embryoswere cultured in PZM-5 containing 10%FBSor KSOMaa containing 4mg/ml BSA, for pig and
cattle embryos respectively, for another 24 hr, except injected cattle morulae that were cultured for 96 hr. At the end of the culture
period, GFP or hKO signals were observed using an inverted fluorescencemicroscope (Nikon, Tokyo, Japan) and then embryos were
fixed for immunostaining.
e6 Cell 168, 473–486.e1–e8, January 26, 2017
Pig and Cattle Blastocyst Immunostaining Only blastocyst stage embryos at time of collection were processed for immunostaining as previously described (Ross et al., 2008).
Embryos were washed with phosphate buffered saline (PBS; GIBCO) containing 1 mg/mL PVA (PBS-PVA) three times and then fixed
in 4% paraformaldehyde containing 1 ml/mL PVA for 15 min at room temperature. After washing three times with PBS-PBA, blas-
tocysts were permeabilized with PBS-PVA containing 1% Triton X-100 for 30 min, washed in PBS-PVA containing 0.1% Triton
X-100 (washing buffer; WB), and blocked in PBS-PVA supplemented with 10% normal donkey serum. Embryos were incubated
with primary antibodies (rabbit anti-SOX2 antibody, BioGenex Cat# NU579-UC and mouse anti-human nuclei antibody, Millipore
Cat# MAB1281) overnight at 4�C. After repeated washes in WB, the embryos were incubated with secondary antibodies (Alexa Fluor 568 anti-rabbit IgG and Alexa Fluor 488 anti-mouse IgG, Invitrogen) at room temperature for 1 hr. Then, blastocysts were counter-
stained with 10 mg/ml Hoechst 33342 at room temperature for 20 min. Stained blastocysts were mounted on a glass slide containing
ProLong Gold antifade solution (Invitrogen), covered by a coverslip, and imaged using an inverted fluorescence microscope.
Pig In Vivo Embryo Recovery and Transfer This work was conducted in two commercial pig farms located in Southeastern Spain (Murcia, Spain), and in the pig experimental unit
of the University of Murcia (Murcia, Spain).
Superovulation and Detection of Estrus
Weaning was used to synchronize the estrus in donors and recipients. Only sows with a weaning-to-estrus interval of 3–4 days were
selected as donors and recipients. The superovulation of donors was induced by the intramuscular administration of 1000 IU equine
chorionic gonadotropin (eCG; Foligon, Intervet, Boxmeer, the Netherlands) 24 hr after weaning. Estrus was checked twice per day by
exposing sows to a mature boar (nose-to-nose contact) and applying manual back pressure. Females that exhibited a standing
estrous reflex were considered to be in estrus. Only sows with clear signs of estrus at 48–72 hr post-eCG administration were further
intramuscularly administered with 750 IU of human chorionic gonadotropin (Veterin Corion, Divasa, Farmavic S.A., Barcelona, Spain)
at the onset of estrus.
Insemination of Donors
The donors were post-cervically inseminated at 6 and 24 hr after the onset of estrus. The insemination doses (1.53 109 spermatozoa
in 45 mL) were prepared from sperm-rich fractions of the ejaculates extended in Beltsville thawing solution extender (Pursel and
Johnson, 1975) and were stored for a maximum of 72 hr at 18�C. Embryo Recovery and Evaluation
The collection of embryos was performed in a specifically designed surgical room located on the farm. The donors were subjected to
a mid-ventral laparotomy on Day 2 of the estrous cycle (Day 0: onset of estrus). The donors were sedated with azaperone (2 mg/kg
body weight, intramuscular; Stresnil, Lab. Dr. Esteve, Barcelona, Spain). General anesthesia was induced using sodium thiopental
(7 mg/kg body weight, intravenous; Tiobarbital 1g, B. Braun VetCare SA, Barcelona, Spain) and was maintained with isoflurane
(3.5%–5%; Isoflo; Lab. Abbot, Madrid, Spain). After exposure of the genital tract, the corpora lutea on the ovaries were counted. Zy-
goteswere collected by flushing each oviduct with 20mL of protein-free embryo recoverymedium consisting of Tyrode’s lactate (TL)-
HEPES-polyvinyl alcohol (PVA)- medium (TL-HEPES-PVA)(Funahashi et al., 2000) with some modifications (Martinez et al., 2014).
Collected embryos were washed three times in TL-HEPES-PVA, placed in sterile Eppendorf tubes containing 1.5 mL of the same
medium and transported in a thermostatically controlled incubator at 39�C to our laboratory at the University of Murcia within 1 hr after collection. Embryos were then evaluated for morphology under a stereomicroscope at a magnification of 60 x. In vivo collected
embryos used in this study include zygotes with a single cell and two visible polar bodies, 2-4 cell embryos, morulae, and blastocysts.
In Vitro Embryo Culture and Assessment of In Vitro Embryo Development
Zygotes were transferred (40 zygotes per well) to a 4-well multidish (Nunc) containing 500 mL of glucose-free NCSU-23 medium
(Petters and Wells, 1993) that was supplemented with 0.3 mM pyruvate and 4.5 mM lactate for 24 hr and then changed to fresh
NCSU-23 medium containing 5.5 mM glucose for an additional 5 days. Cultures were performed at 39�C, 5% CO2 in air and 95%–97% relative humidity. At Day 5, embryo culture wells were supplemented with 10% (v/v) fetal calf serum (FCS, Sigma-Aldrich
Quimica S.A.,Madrid, Spain; cat. no. F7524; lot no. 120M3395). In vitro embryo development was evaluated under a stereomicro-
scope at 24 hr and 6 days of culture to determine cleavage and blastocyst formation rates, respectively. An embryo that had cleaved
to the 2- to 4-cell stage was defined as cleaved, and an embryo with a well-defined blastocoel and an inner cell mass and trophoblast
totally discernible was defined as a blastocyst. Blastocysts were injected as described above.
Culture of hiPSC-Injected Blastocysts
Immediately after hiPSC injection, the blastocysts were incubated in 500 mL of medium used for the culture of hiPSCs for 3-4 hr and
then changed to NCSU-23 medium and hiPSC medium (1:1) for an additional 20-22 hr.
Surgical Embryo Transfer
Injected blastocysts were loaded into a Gynétics embryo transfer catheter (Gynétics Medical Products N.V., Lomel, Belgium) con-
nected to a 1mL syringe for transfer into the recipients. The embryo transfer medium was NCSU-23 supplemented with 10 mM
HEPES, 0.4% (v/v) BSA and 10% (v/v) FCS. The embryo transfer catheter was loaded with air bubbles that separated the 30 mL
drop of medium that contained the embryo from two drops of medium before and after the embryo. All transfers were conducted
in asynchronous (�24 hr to embryo collection) recipients. One hour before the transfer, each recipient received a single intramuscular injection of a long-acting amoxicillin suspension (Clamoxyl LA; Pfizer, Madrid, Spain) at a dose of 15 mg/kg. The transfers were
Cell 168, 473–486.e1–e8, January 26, 2017 e7
conducted using the same procedure described previously for embryo collection. The embryoswere transferred to the tip of a uterine
horn (15 to 20 cm from the uterotubal junction) with the embryo transfer catheter inserted through the uterine wall, which was pre-
viously punctured with a blunt Adson forcep. Post transfer, all recipients were evaluated daily for behavioral changes, including signs
of estrus beginning at 12 days post transfer. Pregnancy was diagnosed by transabdominal ultrasonography (Logiq Book XP, General
Electric, Solingen, Germany) onDays 20 to 22 post-transfer. All pregnant sowswere deeply anesthetized on days 23 to 25 post-trans-
fer and subsequently euthanized by using a captive bolt pistol. Immediately, a midline longitudinal incision was made between the
posterior pair of nipples and the ovaries and uterus were located. The cervix and the ovarian stalks were occluded with transfixing
ligatures and the reproductive tract removed. The genital tract was then placed in water tight plastic bags kept on ice and transported
to the laboratory within 20 min. Once in the laboratory the uterus was opened and fetuses removed from the placenta tissues and
numbered in sequential order. Fetuseswere individuallymeasured andweighed. Afterward, each fetuswas checked for fluorescence
emission using an epifluorescence stereomicroscope (Nikon SMZ 18, Japan).
Pig Parthenogenetic Embryo Transfer This work was conducted at the University of California Davis animal facilities.
Estrus Induction and Synchronization
Estrus and ovulation was induced by intramuscular administration of 400 I.U equine chorionic gonadotropin and 800 I.U. of human
chorionic gonadotropin. (PG600; Merck Animal Heath, Summit, NJ, USA) followed 72 hr later by an intramuscular administration of
750 I.U. of hCG (Choluron, Merck Animal Health, Summit, NJ, USA). Estrus was checked twice per day by exposing sows to amature
boar (nose-to-nose contact) and applying manual back pressure. Females that exhibited a standing estrous reflex were used as re-
cipients of surgical embryo transfer 5 to 6 days after hCG administration. Prior to surgical procedure the animals were fasted (food
andwater) for 24 hr. Anesthesia was induced by intramuscular administration of 2mg/kg of Telazol (Zoetis, Kalamazoo,MI, USA) prior
to intubation and thenmaintained at a surgical plane by inhalation of Isoflurane (0.5%–5%as need tomaintain anesthesia). TheOvary
and uterus was exposed by a ventral medial laparotomy. The embryos were transferred to the tip of a uterine horn (15 to 20 cm from
the uterotubal junction) with the embryo transfer catheter inserted through the uterine wall, which was previously punctured with a
blunt needle. Pregnancy was diagnosed by transabdominal ultrasonography (WED-2000AV, Welld, Shenzhen, China) 17 to 20 days
after embryo transfer. On days 23 to 28 of gestation all pregnant gilts were deeply anesthetized by intramuscular administration of
2 mg/kg of Telazol (Zoetis, Kalamazoo, MI, USA) and subsequently euthanized by intracardiac administration of 2.25 mL/kg eutha-
nasia solution (Fatal Plus Solution, Vortex Pharmaceutical Ltd, Dearborn, MI, USA). Then, the reproductive tract was removed and
transported to the laboratory within 20 min. Once in the laboratory the uterus was opened and fetuses removed from the placenta
tissues and numbered in sequential order. Fetuses were individually measured and weighed. Afterward, each fetus was checked for
fluorescence emission using an epifluorescence stereomicroscope (Zeiss, Germany).
Immunocytochemistry Between day 21-28 of gestation, surrogates were euthanized and embryos were dissected and immerse in paraformaldehyde and
incubated at 4�C during 4 hr for small-sized embryos and overnight for normal-sized embryos. After overnight cryoprotection in 30% sucrose solution (Sigma), the embryos were embedded in OCT compound (Sakura Finetek) and frozen in dry ice. Sections (10 mm
thick for small-sized embryos and 20 mm for normal-sized embryos) of the different embryos were cut on a Leica cryostat. For immu-
nohistochemistry, we used standard staining procedures and antigen retrieval solution (HistoVT one, Nacali Tesque, INC) according
to manufacturer’s instructions. The primary antibodies used were rabbit anti-monomeric Kusabira-Orange 2 (MBL Code # PM051M,
1:500), rabbit anti-GFP (MBL Code# 598, 1:500), rat anti-cytokeratin 8 (TROMA-I, DSHB Antibody Registry ID: AB_531826, 1:20),
mouse anti-epithelial antigen (Dako Cat# M0804, 1:200), Mouse monoclonal anti-Ep-CAM (Santa Cruz Cat# sc-25308, 1:50), mouse
anti-actin a-smoothmuscle (Sigma Cat# A5228, 1:200), Rabbit polyclonal anti-Histone H3 (tri methyl K9) (AbcamCat# ab8898, 1:50),
Rabbit polyclonal anti-Histone H4 (tri methyl K20) (Abcam Cat# ab9053, 1:50), Mouse monoclonal anti-Oct3/4 (C-10) (Santa Cruz
Cat# sc-5279, 1:200), Rat anti-Mouse CD31(Clone MEC13.3) (BD PharMingen Cat# 553370, 1:200), Mouse anti-Tubulin b3 (Clone
TUJ1) (Biolegend Cat# 801202, 1:500).
QUANTIFICATION AND STATISTICAL ANALYSIS
For Figure 1E, qPCR for quantifying rat contribution in rat-mouse chimera was performed using SYBR Green PCR Master Mix
(Applied Biosystems) and total genomic DNAs isolated from different tissues of the chimera, mouse tail tip and DAC2 rat ESCs.
The data were analyzed using the DDCT method, which were first normalized to the values of the mouse specific primers. A rat spe-
cific primer was used for detecting rat cells. The levels of chimerism were determined based on the values generated from serial di-
lutions of rat:mouse genomic DNA. The primers used for genomic qPCR are listed in Table S2. For Figures 1E, S2C, and S3E data are
presented as mean (SD). For Figure 1B, n represents number of embryo transfers.
e8 Cell 168, 473–486.e1–e8, January 26, 2017
Supplemental Figures
(legend on next page)
Figure S1. Chimeric Contribution of Rat PSCs to Different Organs of Rat-Mouse Chimeras, Related to Figure 1
(A) Bright field (top) and fluorescence (bottom) images showing hKO-labeled rat ESCs (DAC8) contributed to different organs of a neonatal rat-mouse chimera.
Control organs from a wild-type neonatal mouse were showing on the left.
(B) Representative fluorescence images showing hKO-labeled rat iPSCs (SDFF) contributed to different tissues in a 3-week-old rat-mouse chimera. Red, hKO-
labeled rat cells; blue, DAPI. Scale bar is 100 mm.
(C) Bright field (left) and fluorescence (right) images showing an isolated neonatal mouse gallbladder contributed by hKO-labeled rat iPSCs (SDFE), as shown in
Figure 1F.
Figure S2. CRISPR-Cas9-Mediated Rat-Mouse Blastocyst Complementation, Related to Figure 2
(A) Bright field images showing a wild type (P0, left) mouse and a Pdx1-/- (E18.5, right) mouse fetus generated by zygotic co-injection of Cas9 mRNA and Pdx1
sgRNA. Li, liver; St, stomach; Sp, spleen. Yellow-dotted line encircles the pancreas in the wild type, and indicates the lack of a pancreas in the Pdx1-/- fetus.
(B) Bright field (top) and fluorescence (bottom) images showing more chimeric contribution of rat cells in a Pdx1-/- mouse pancreas than a wild type mouse
pancreas. Li, liver; St, stomach; Sp, spleen. Yellow-dotted line encircles the pancreases. Red, hKO-labeled rat cells.
(C) Glucose tolerance test results of adult (>7 months) Pdx1-/- and Pdx1+/- mice complemented with rat PSCs. Age-matched wild type mice and rats were
included as controls. Error bars indicate s.d.
(D) Top, a representative bright field image showing a wild type (left) and Nkx2.5-/- (right) E10.5 mouse embryos Middle, rat ESC-derivatives rescued retarded
growth of E10.5Nkx2.5-/-mouse embryo and were enriched in the heart. H, heart. Bottom, an E10.5Nkx2.5-/- embryo showing retarded growth with little to no rat
cells contribution to the heart. Yellow-dotted line encircles the heart. Scale bar is 100mm.
(E) Top, a representative bright field image showing a wild type (left) and a Pax6-/- (right) E15.5 mouse fetuses. Bottom, fluorescence images showing more
chimeric contribution of rat cells in the eye of Pax6-/- (right) than wild type (left) chimeras. WT+rPSCs, control rat-mouse chimera without Cas9/sgRNA injection.
Red, hKO-labeled rat cells. Blue, DAPI. Scale bar is 100mm.
(F) Frequencies of wild type, homozygous, heterozygous mutants and mosaic mutant mice generated by zygotic co-injection of Cas9 mRNA and sgRNAs for
Pdx1, Nkx2.5, or Pax6.
Figure S3. Teratoma Assay and Interspecies ICM Incorporation of Different Types of hiPSCs to Cattle and Pig Blastocysts, Related to
Figure 4
(A) Representative images showing hematoxylin and eosin staining of histological sections derived from teratomas generated by 2iLD-hiPSCs, 4i-hiPSCs,
NHSM-hiPSCs and FAC-hiPSCs. hiPSC-derived teratomas contained tissues from all three germlineages: endoderm (top), mesoderm (middle) and ectoderm
(bottom). Scale bar is 100 mm.
(legend continued on next page)
(B) Laser-assisted microinjection of hiPSCs into a bovine blastocyst. Left, before injection laser beamwas used to perforate the zona pellucida. Right, a blunt end
pipette was used to transfer hiPSCs to the blastocoel. Red color indicates hKO-labeled hiPSCs (bottom).
(C) Representative immunofluorescence images showing ICM incorporation of naive and intermediate hiPSCs. Top, SOX2; Middle, HuNu, Bottom, merged
images. Blue, DAPI. Scale bar is 100 mm.
(D) Number of hiPSCs remained in the cattle (left) and pig (right) blastocysts after injection of 10 hiPSCs followed by 2 days in vitro culture. Red line, average
number of cells. Blue dot, number of ICM-incorporated hiPSCs in each blastocyst. BL, blastocyst.
(E) Comparison of several parameters of ICM incorporation for each type of hiPSCs between pig and cattle. Error bars indicate s.d.
Figure S4. Generation of Post-implantation Pig Embryos Derived from Blastocyst Injection of hiPSCs, Related to Figure 5
(A) Representative bright field images showing: a) freshly collected pig zygotes; b) in vitro derived pig blastocysts; c) hiPSCs are being injected into a pig
blastocyst; d) Pig female reproductive tract at day-28 of pregnancy; e) a day 28 pig conceptus displaying the embryo proper and the amniotic and allantoic
membranes; f) a magnified image of the day-28 pig embryo showing in e.
(B) Representative bright field images showing a normal size day-28 pig embryo (left) and growth retarded day-28 embryos (middle and right).
A
B
NHSM NHSM
!"!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!""""""""""""""""""""""""""""""""""""""""""
2iLD 2iLD
FAC FAC
C
FAC #2 FAC #3 FAC #4
FAC #5 FAC #6 FAC #6
FAC #7
2nd only
GFP
GFP
GFP
GFP
EpCAM
CK8 Merge
Merge
Merge
Merge
SMA
HNF3
Figure S5. Chimeric Contribution of hiPSCs to Post-implantation Pig Embryos, Related to Figure 6
(A) Representative bright field (left), fluorescence (middle) and immunofluorescence (right) images showing the contribution of hKO-labeled NHSM-hiSPCs, GFP-
labeled 2iLD-hiPSCs and FAC-hiPSCs to normal size day 28 pig embryos. Scale bar is 200 mm.
(B) Representative immunofluorescence images showing the contribution of FAC-hiPSCs to six additional normal size day 21-28 pig embryos (FAC #2-#7). Scale
bar is 200 mm.
(C) Representative immunofluorescence images showing the chimeric contribution and differentiation of FAC-hiPSCs within a normal size, day 28 pig embryo
(FAC #3). Embryo sections were stained with antibodies against GFP (green, left), EpiCAM, HNF3b, CK8 and SMA (red, middle). Right, merged images. Insets are
higher magnification images of boxed regions. Scale bar is 100 mm.
- Interspecies Chimerism with Mammalian Pluripotent Stem Cells
- Introduction
- Results
- Naive Rat PSCs Robustly Contribute to Rat-Mouse Interspecies Chimera Formation
- A Versatile CRISPR-Cas9-Mediated Interspecies Blastocyst Complementation System
- Naive Rodent PSCs Do Not Contribute to Chimera Formation in Pigs
- Generation of Naive, Intermediate, and Primed hiPSCs
- Chimeric Contribution of hiPSCs to Pig and Cattle Blastocysts
- Chimeric Contribution of hiPSCs to Post-implantation Pig Embryos
- Discussion
- Supplemental Information
- Author Contributions
- Acknowledgments
- References
- STAR★Methods
- Key Resources Table
- Contact for Reagent and Resource Sharing
- Experimental Model and Subject Details
- Rodents
- Pigs
- Human iPSC Culture Media
- Culture and maintenance of rat ESCs/iPSCs and mouse iPSCs
- Method Details
- Chemicals Unless Otherwise Indicated, Chemicals Were Obtained from Sigma-Aldrich
- Plasmids Construction
- Rat iPSC Generation
- Human iPSC Generation
- Generation of Fluorescently Labeled Rat PSCs and hiPSCs
- Mouse Embryo Collection
- sgRNA Design and In Vitro Transcription
- Microinjection of Cas9 mRNA and sgRNAs to Mouse Zygotes
- Microinjection of Rat PSCs to Mouse Blastocysts
- Mouse Embryo Transfer
- Genomic PCR
- Quantitative Genomic PCR
- Genotyping and DNA Sequencing
- Glucose Tolerance Test
- Cattle In Vitro Embryo Production
- Oocyte Recovery and In Vitro Maturation
- In Vitro Fertilization
- Pig Parthenogenetic Embryo Production
- Oocyte Collection and IVM
- Parthenogenetic Activation
- Embryo Culture
- Microinjection of PSCs to Cattle and Pig Blastocysts and Embryo Culture
- Pig and Cattle Blastocyst Immunostaining
- Pig In Vivo Embryo Recovery and Transfer
- Superovulation and Detection of Estrus
- Insemination of Donors
- Embryo Recovery and Evaluation
- In Vitro Embryo Culture and Assessment of In Vitro Embryo Development
- Culture of hiPSC-Injected Blastocysts
- Surgical Embryo Transfer
- Pig Parthenogenetic Embryo Transfer
- Estrus Induction and Synchronization
- Immunocytochemistry
- Quantification and Statistical Analysis