BUSINESS MANAGEMENT GREAT WORK, ON TIME, NO PLAGARISM,

TRPM8 levels determine tumor vulnerability to channel agonists Alessandro Alaimo1 , Francesco Giuseppe Carbone2, Kristi Buzo3,4, Nicole Annesi1,

Sacha Genovesi1, Annalisa Lorenzato3, Karen Widmann2, Michela Libergoli1, Elisa Marmocchi1,

Giovanni Bertalot2,5, Alberto Brolese6, Mauro Giulio Papotti7, Luca Molinaro7, Orazio Caffo8,

Mattia Barbareschi2,5, Alberto Bardelli3,9 , Alessandro Romanel1, Sabrina Arena3,4 and

Andrea Lunardi1

1 Department of Cellular, Computational and Integrative Biology (CIBIO), University of Trento, Italy

2 Surgical Pathology, Santa Chiara Hospital-APSS, Trento, Italy

3 Department of Oncology, University of Torino, Torino, Italy

4 Candiolo Cancer Institute, FPO–IRCCS, Candiolo (TO), Italy

5 Centre for Medical Sciences-CISMed, University of Trento, Italy

6 Department of General Surgery & HPB Unit, Santa Chiara Hospital-APSS, Trento, Italy

7 Department of Pathology, University of Torino and AOU Citt�a della Salute e della Scienza di Torino, Italy

8 Medical Oncology, Santa Chiara Hospital-APSS, Trento, Italy

9 IFOM ETS – The AIRC Institute of Molecular Oncology, Milan, Italy

Keywords

breast cancer; colorectal cancer; D-3263; ion

channel; lung cancer; prostate cancer;

TRPM8

Correspondence

Alessandro Alaimo, Department of Cellular,

Computational and Integrative Biology

(CIBIO), University of Trento, Trento, Italy.

E-mail: [email protected]

and

Sabrina Arena, Department of Oncology,

University of Torino, Torino, Italy.

E-mail: [email protected]

and

Andrea Lunardi, Department of Cellular,

Computational and Integrative Biology

(CIBIO), University of Trento, Trento, Italy.

E-mail: [email protected]

Targeted therapies have pervasively enhanced clinical protocols and signif-

icantly improved survival and quality of life of cancer patients. Mostly

grounded on small molecules and antibodies targeting deregulated mecha-

nisms in cancer cells, precision oncology approaches are limited to a few

tumor types because of the paucity of clinically actionable targets. Here,

we report a comparative analysis of the cation channel transient receptor

potential melastatin 8 (TRPM8; also known as transient receptor potential

cation channel subfamily M member 8) in lung, breast, colorectal, and

prostate cancers. Our findings reveal high levels of channel expression in

cores of all four carcinomas, irrespective of reduced expression of its

RNA. Importantly, cancer cell lines that represent the various tumor

types consistently show that sub-lethal chemotherapy dosages combined

with the TRPM8 agonist D-3263 have a synergistic lethal effect. In addi-

tion, administration of D-3263 increases the cytotoxicity of 5-

FU/Oxaliplatin in patient-derived colorectal cancer organoids, depending

on the levels of TRPM8. Overall, our study strengthens the candidacy of

TRPM8 as a molecular target for precision oncology approaches and

Abbreviations

ATCC, American Type Culture Collection; BC, breast cancer; BME, basement membrane extract; BPE, bovine pituitary extract; BSA, bovine

serum albumin; CRC, Colorectal cancer; DAB, 3,30-Diaminobenzidine; ECL, enhanced chemiluminescence; EGF, epidermal growth factor;

FBS, fetal bovine serum; FFPE, formalin-fixed paraffin-embedded; FITC, fluorescein isothiocyanate; GAPDH, glyceraldehyde-3-phosphate

dehydrogenase; IR, ionizing radiation; KSFM, keratinocyte serum-free medium; NSCLC, non-small cell lung cancer; PARP, poly (ADP-ribose)

polymerase; PCa, prostate cancer; PDO, patient-derived organoid; PDXO, patient-derived xenoorganoid; PFA, paraformaldehyde; PI,

propidium iodide; PVDF, polyvinylidene difluoride; RNAseq, RNA sequencing; RPLP, ribosomal protein lateral stalk subunit P; RTK, receptor

tyrosine kinase; siRNA, short interfering RNA; TBS, tris-buffered saline; TCGA, The Cancer Genome Atlas; TMA, tissue microarray; TRPM2,

transient receptor potential melastatin 2; TRPM8, transient receptor potential melastatin 8; 5-FU, 5-fluorouracil.

Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

This is an open access article under the terms of the Creative Commons Attribution License, which permits use,

distribution and reproduction in any medium, provided the original work is properly cited.

2905

(Received 14 March 2024, revised 10

February 2025, accepted 30 March 2025,

available online 23 May 2025)

doi:10.1002/1878-0261.70049

paves the way for the design of basket trials for its clinical testing in

TRPM8-high tumors.

1. Introduction

Omics investigation through cutting-edge technologies

has proven crucial to unwind the molecular heterogene-

ity and the complexity of cancer biology [1,2]. Ever more

frequently, defined molecular signatures are used in the

clinic to classify solid and liquid tumors in actionable

categories and stratify patients on precise oncological

protocols [3,4]. Targeted therapeutic interventions

directed against specific oncogenic mechanisms or can-

cer cell vulnerabilities have significantly changed the

prognosis of lethal tumors such as lung, breast, prostate,

and colorectal cancers (https://www.cancer.gov/about-

cancer/treatment/types/targeted-therapies/approved-

drug-list). Inhibition of receptor tyrosine kinases

(RTKs), enzymes involved in DNA repair, and compo-

nents of the immune checkpoints are among the privi-

leged strategies adopted by modern oncology to

counteract cancer progression. Generally effective for

precise classes of molecularly stratified tumors, mecha-

nisms of resistance almost invariably arise, and the dis-

ease inevitably relapses [5]. To overcome therapy

resistance, a large portfolio of more potent and selective

drugs is under continuous clinical investigation

(https://clinicaltrials.gov/), while, on the other hand, a

tireless effort of pre-clinical research feeds the list with

novel promising druggable candidates.

In this frantic search for better treatments and novel

therapeutic strategies, pharmacological gating of ion

channels represents an inestimable resource for oncol-

ogy that deserves great attention [6].

The Transient Receptor Potential -TRP- genes encode

for cell membrane ion channels highly conserved from

yeast to mammals with critical roles in sensory percep-

tion and cellular physiology [7]. In mammals, the TRP

family is composed of multi-gene subfamilies including

TRPA1 (ankyrin), TRPCs (canonical), TRPMLs

(mucolipin), TRPMs (melastatin), TRPPs (polycystin),

and TRPVs (vanilloid) [8]. Most TRPs are non-selective

cation channels whose mechanisms of gating range from

variations in transmembrane potential or temperature

to binding of specific ligands. By depolarizing the cell

membrane when activated, some TRPs function as

intracellular Ca2+ release channels, thus having a crucial

role in cell biology. From a clinical perspective,

mutations in TRP genes have been implicated in heredi-

tary disorders (TRP channelopathies) such as skeletal

dysplasia, neurodegenerative syndromes, kidney dys-

functions, and pain [7,9,10]. Because of their location on

the cell surface and the presence of a specific ligand

binding pocket, several TRP channels are archetypal

drug targets whose pharmacological gating could have

relevant clinical implications ranging from pain relief to

respiratory diseases, from neurological and psychiatric

disorders to diabetes and cancer [7,11]. Among the

members of the TRP family, Transient Receptor Poten-

tial cation channel subfamily M member 8 -TRPM8- gene

is reported in literature as abundantly expressed in the

luminal compartment of normal prostate epithelium

[12–15]. Although its role remains poorly defined,

TRPM8 rises in prostate cancer (PCa) compared to nor-

mal adjacent tissue at both RNA and protein levels, sug-

gesting pro-tumorigenic activities of the channel.

Notably, a growing number of publications highlight a

keen sensitivity of different pre-clinical models of PCa

to the pharmacologic tuning of TRPM8 [16–18]. Our

previous works [12–14] demonstrate a massive apoptotic

response of aggressive cross-species cellular models of

PCa to a combination of sub-lethal standard-of-care

treatments (IR, chemo-, hormone-therapy) with potent

TRPM8 agonists (WS-12 and D-3263).

Here, we describe the efficacy of TRPM8 targeting

in three other major human killers such as lung,

breast, and colorectal cancers. Despite the low amount

of TRPM8 RNA reported by The Cancer Genome

Atlas (TCGA) for tumors other than PCa, immunolo-

calization of TRPM8 identified breast, lung, and colo-

rectal cancer cores on a multi-tumor microarray

(TMA) with levels of the channel comparable to PCa.

Importantly, the combination of sub-lethal doses of

standard chemotherapy with the potent TRPM8 ago-

nist D-3263 induces a pervasive apoptotic program in

breast, lung, colon, and prostate cancer cell lines.

Knock-down of TRPM8 prevents cell death in all

cell lines, thus proving D-3263 specificity. Similarly,

D-3263 increases 5-FU/Oxaliplatin cytotoxicity in

patient-derived colorectal cancer organoids, depending

on TRPM8 levels of protein expression.

2906 Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

Targeting ion channels for cancer therapy A. Alaimo et al.

Overall, these results shed light on the value of

TRPM8 as a molecular target for the treatment of dis-

tinct tumor types, regardless of tissue of origin and

RNA amount, but selected based on high levels of

channel expression.

2. Materials and methods

2.1. Cell culture

LNCaP (#CRL-1740; RRID:CVCL_0395), PC-3

(#CRL-1435; RRID:CVCL_0035), VCaP (#CRL-2876;

RRID:CVCL_2235), RWPE-1 (#CRL-11609; RRID:

CVCL_3791), A549 (#CCL-185; RRID:CVCL_0023),

HCT116 (#CCL-247; RRID:CVCL_0291), MCF7

(#HTB-22; RRID:CVCL_0031), SK-MEL5 (#HTB-70;

RRID:CVCL_0527), G361 (#CRL-1424; RRID:

CVCL_1220), and A375 (#CRL-1619; RRID:

CVCL_0132) cell lines were purchased from the Ameri-

can Type Culture Collection (ATCC, LGC Standards).

The cells were grown in RPMI medium (Sigma, St.

Louis, MO, USA) or in DMEM medium (MCF7,

VCaP, A375, G361, SK-MEL5; Invitrogen, Thermo-

Fisher Sci, Waltham, MA, USA) either supplemented

with 10% fetal bovine serum (FBS; Sigma),

100 U�mL�1 penicillin, and 100 lg�mL�1 streptomycin

(Pen/Strep; Invitrogen and 2 mM L-Glutamine (Invitro-

gen)). RWPE-1 cells were cultured in KSFM medium

(Invitrogen) supplemented with 0.05 mg�mL�1 bovine

pituitary extract (BPE), 5 ng�mL�1 EGF, and 1% Pen/-

Strep. All cells were cultured in a humidified incubator

at 37 °C and 5% CO2 and were passaged in conformity

with the manufacturer’s protocols. Cell lines were rou-

tinely tested for Mycoplasma (MycoAlert Mycoplasma

Detection Kit, Lonza) and authenticated for specific

markers by western blot and RT-qPCR.

2.2. Human samples

A high-density tissue microarray (TMA) of colon, rec-

tum, breast, lung, and prostate tumors, containing 208

cases/208 cores (192 cases of tumor and 16 cases of

normal tissues) was purchased from US Biomax, Inc.

(MC2081a). Eight colorectal cancer TMAs containing

80 cases (160 cores, 1 core of tumor tissue and 1 core

of control normal mucosa from each patient) were

generated from FFPE stored samples at the Operative

Unit of Anatomy Pathology of the Santa Chiara Hos-

pital (Trento, Italy) upon study approval of the local

Ethical Committee of the Santa Chiara Hospital

(Trento, Italy) (Prot.:1946 I.D.:112786962). Samples

were collected randomly with regard to stage and

grade. Human colorectal cancer and prostate speci-

mens were derived from segmental resections of the

large bowel at the Santa Chiara Hospital of Trento

(August–November 2011) and radical prostatectomy at

the Molinette Hospital of Turin (Italy) (January– February 2020), respectively. Prostate cancer patients

were enrolled with written informed consent on a

study protocol approved by the Ethical Committee of

the Molinette Hospital, Turin (Rep. Int. 0009136).

Frozen colorectal tumor samples collected with

patients’ written informed consent were recovered

from the tissue bank of the Santa Chiara Hospital

(Trento, Italy). Study methodologies conforming to

the standards set by the Declaration of Helsinki were

approved by the local ethics committees of Molinette

Hospital in Turin, Italy, and Santa Chiara Hospital in

Trento, Italy, respectively.

2.3. RNA isolation and quantitative PCR

RNA extraction was performed using the RNAeasy

Micro Kit (Qiagen) following the manufacturer’s

instructions. The concentration and quality of the

RNA were evaluated by NanoDropTM 2000c spectro-

photometer (ThermoFisher Sci, Waltham, MA, USA)

and agarose electrophoresis. Total RNA (1 lg) was

reverse transcribed into cDNA using iScriptTM cDNA

synthesis Kit (Biorad) according to the manufacturer’s

protocol. Quantitative Real-time PCR was carried out

on a CFX96 qPCR Thermal cycler (Biorad) using

KAPA SYBR� FAST qPCR Master Mix (Kapa

biosystems, Wilmington, MA, USA). The data were

normalized to the housekeeping genes Glyceraldehyde-

3-phosphate dehydrogenase (GAPDH ) or beta-ACTIN

(b-ACTIN) transcripts for the analysis of TRPM8

expression in cancer cell lines or to the geometrical

mean of GAPDH, RPLP, and 18S transcripts for the

analysis of TRPM8 expression in human prostate and

colorectal samples, analyzed as relative RNA levels of

the cycle threshold (Ct) value, then converted to fold

change. PCR analyses were performed with at least

n = 2 independent biological replicates. Specific sense

and antisense PCR primers used in the study were:

TRPM8, GATTTTCACCAATGACCGCCG (Fw),

CCCCAGCAGCATTGATGTCG (Rv); GAPDH, AG

CCACATCGCTCAGACACC (Fw), GTACTCAGCG

CCAGCATCG (Rv); RPLP, CGTCCTCGTGGAAG

TGACAT (Fw), TAGTTGGACTTCCAGGTCGC

(Rv); 18S, CAGCCACCCGAGATTGACA (Fw),

TAGTAGCGACGGGCGGTGTG (Fw); bACTIN,

AGAGATGGCCACGGCTGCTT (Fw), ATTTG

CGGTGGACGATGGAG (Rv).

Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

2907

A. Alaimo et al. Targeting ion channels for cancer therapy

2.4. Western blot

Immunoblotting was performed as previously reported

[12,14]. Briefly, equal amounts of proteins were sepa-

rated by SDS/PAGE, transferred onto a PVDF mem-

brane (AmershamTM HybondTM; Fisher Scientific,

Buckinghamshire, UK) and blocked with 5% BSA or

5% non-fat dry milk in 19 TBS-Tween. The following

primary antibodies were used: anti-TRPM8 (ACC-049,

Alomone Labs and ab3243; Abcam), -TRPM2 (PA5-

102844, ThermoFisher Science), -PARP (9542; Cell

Signaling Technology, Danvers, MA, USA), -Cleaved

PARP (Asp214, 5625, Cell Signaling Technology),

-Cleaved Caspase-3 (Asp175, 9661, Cell Signaling

Technology) and -b-Actin (A2228, Sigma). The reac-

tion was revealed by using ECL Select WB Detection

Reagent (GE Healthcare, Little Chalfont, UK) with an

Alliance LD2 system and software (UVITEC).

Immunoblots were performed in three independent

biological replicates and quantified with ImageJ

(v2.0.0-rc-69/1.52i); representative data are shown.

2.5. Small interfering RNA silencing

Cells were plated on a six-well plate (2 9 105 cells/well)

and transiently transfected at about 60% confluence

with targeting siRNAs against human TRPM8 or

TRPM2 (100 nM) or negative control siRNA (see

below) using Lipofectamine� LTX Reagent (Life Tech,

ThermoFisher Sci, Waltham, MA, USA) and OptiMEM

media (Invitrogen) as described in the manufacturer’s

protocol. For TRPM8, the following siRNA sequences

were used: siRNA1 GGUGCUUUGGAUUCU-

CACGG (Ambion 104 796, Life Tech), siRNA2

GGAUGCCCUGACAUCUUUCU (Ambion 104 798,

Life Tech), siCtr Silencer� Negative Control #1

(Ambion AM4611, Life Tech). The sequences of

TRPM2 siRNA (si-TRPM2#1, si-TRPM2#, si-NC)

were obtained from [19] and purchased from Eurofins

Genomics.

2.6. Drugs

Docetaxel (01885, 10 mM), Oxaliplatin (09512, 50 mM)

and 5-Fluorouracil (F6627, 500 mM), and WS-12

(W0519, 10 mM) were purchased from Sigma; D-3263

(D-195, 10 mM) was obtained from Alomone Labs and

was resuspended in dimethyl sulfoxide (DMSO) to

achieve the indicated stock concentrations. All drugs

were maintained as stock solutions and stored at

�80 °C or �20 °C. In each experiment, the same vol-

ume of solvent used for tested drugs and chemicals

was added to the control solution.

2.7. FACS analysis

Cells were cultured at about 60% confluence in six-well

dishes and treated for 24 h as indicated in the figures.

Cell death and apoptotic rates were determined with

Annexin-V-FITC and propidium iodide (PI) staining

according to the manufacturer’s instructions

(Annexin-V FITC Kit; Miltenyi Biotec, Bergisch Glad-

bach, Germany). For FACS analysis, a BD

FACSymphonyTM A1 Cell Analyzer (BD Biosciences,

Franklin Lakes, NJ, USA) was used, and data were ana-

lyzed with FLOWJO software (Treestar, Ashland, USA).

2.8. Crystal violet cell cytotoxicity assay

Six-well plates with 70% confluent cells were treated

as indicated in the figures. Twenty-four hours later,

cells were washed with PBS, fixed with 10% formalin

(Sigma), washed again with PBS, and stained with

0.1% Crystal Violet (Sigma) solution (in 20% metha-

nol) for 30 min. Afterward, cells were washed with

dH20, dried, and Crystal Violet was extracted

with 10% acetic acid for 30 min. For quantification,

absorbance was measured at 595 nm. The experiments

were performed in triplicates, and images were taken

with a Chemidoc XRSF (Biorad).

2.9. Immunohistochemistry

Cells were grown on coverslips, fixed with 4% PFA,

incubated with peroxidase inhibitor solution, saturated

for 1 h at RT and, finally, incubated with primary anti-

bodies (anti-TRPM8 Alomone Labs ACC-049 or

Abcam Ab3243) O/N at 4 °C. Coverslips were washed

and then incubated with biotin-conjugated secondary

antibody (Jackson ImmunoResearch, West Grove, PA,

USA) for 1 h at RT, washed again, and incubated for

1 h at RT with Avidin-Biotin complex (Vectastain� Elite ABC Peroxidase kit, Vector Labs, PK-6100, Bur-

lington, CA, USA) according to the manufacturer’s

instructions. Samples were incubated with DAB revela-

tion solution and counterstained with hematoxylin

before mounting the coverslips. TMAs were subjected

to immunohistochemical analyses carried out at the

Department of Histopathology (S. Chiara Hospital,

Trento, Italy) using an automatic immunostainer

(BOND-III platform, Leica Biosystems, Wetzlar, Ger-

many). Antigen retrieval was carried out with optimized

BOND reagents (Bond epitope retrieval solution 1,

Leica Biosystems) at pH 6 for 20 min. BOND compact

polymer detection solution (Leica Biosystems) was used

for the detection, as previously described [12–14]. The primary antibodies used to detect TRPM8 were the

2908 Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

Targeting ion channels for cancer therapy A. Alaimo et al.

Alomone Labs ACC-049 or Abcam Ab3243 diluted at

1:800 for use on the BOND system. Samples histology

and TRPM8 immunostaining were independently

reviewed by three pathologists (M.B., F.G.C., and

G.B.) to ensure appropriate assignment of the following

scores: absence of staining (0), weak (1), moderate (2),

and high (3) signal intensity.

2.10. Colorectal organoids

The PDOs and patient-derived xenoorganoids

(PDXOs) were established and maintained in the cul-

ture as described in full details in [20]. Briefly, tumor

samples were obtained from patients enrolled at

Niguarda Cancer Center (Milan, Italy) (patient #2–5) and from University of Rostock (Germany)

(patient#1) in a timeframe between 2006 and 2019. All

patients provided informed written consent, samples

were procured, and the study was conducted in accor-

dance with the Declaration of Helsinki and under the

approval of the local Independent Ethical Committee

(protocol 194/2010), Italian Ministry of the Health

and the Ethics Committee of the Medical faculty of

the University of Rostock, in accordance with gener-

ally accepted guidelines for the use of human material.

Patient #1 and patient #3 organoids were initially

established in the laboratory of Prof. Bardelli from

PDX models (PDXOs) as fully described in [20].

Patient #2, patient #4, and patient #5 organoids were

established directly from tissue biopsy obtained at the

time of surgery. Organoids from patient#2 were estab-

lished at INGM (Istituto Nazionale Genetica Moleco-

lare “Romeo ed Enrica Invernizzi”, Milan, Italy),

whereas organoids from patients #4 and #5 were

established at Candiolo Cancer Institute. Organoids

were processed and treated following the protocol pre-

viously described in [20,21]. Briefly, organoids were

seeded as single cell at a density of 4000 to 6000 cells

per well in 96-well plates precoated with basement

membrane extract (BME; Cultrex BME Type 2; Ams-

bio, Cambridge, MA, USA). Treatment was performed

4 days after seeding, once grown organoids were visi-

ble. Indicated concentrations of drugs, D-3263

(1.5 lM) and 5-Fluorouracil (0.5 lM) + Oxaliplatin

(1 lM) were added automatically by Tecan D300e Dig-

ital Dispenser in fresh 150 lL medium containing 2%

BME. A total of 4 lmol/L MG-132 was used as a pos-

itive control; DMSO served as a negative control. The

viability was assayed at the end of the experiment after

5 days of treatment by CellTiter-Glo Luminescent Cell

Viability assay (Promega, Madison, WI, USA) with

modifications (full details in [21]). The results derive

from two independent biological experiments, each

with six technical replicates.

2.11. Statistics

Data are expressed as mean � sd of three biological

replicates, unless otherwise indicated. Statistical ana-

lyses were carried out using GraphPad Prism 8.0, with

the threshold of significance set at <0.05.

3. Results

3.1. TRPM8 immunostaining reveals

underestimated channel expression in human

lung, breast, and colorectal carcinomas

Transcriptional profiling of the TRPM8 gene based on

the Cancer Genome Atlas RNAseq datasets defines

prostate tissue and, even more, prostate carcinoma as

the primary sites for TRPM8 expression (Fig. 1A) [12].

Hepatocellular carcinoma follows, while all other

tumors show TRPM8 RNA levels close to the detec-

tion threshold in almost the totality of samples

(Fig. 1A) [12]. Experimental evidence accrued over the

past years by our group has frequently pointed out a

sharp dichotomy between the levels of TRPM8 tran-

script and the amount of the protein in prostate cell

lines and human samples [12,14], raising doubts about

the predictability of TRPM8 channel expression based

on its RNA levels. To analyze the status of the

TRPM8 channel in a group of solid tumors other than

prostate cancer, a Tissue Microarray was purchased

from US Biomax, Inc. (MC2081a) and stained with a

validated antibody against TRPM8 (Alomone #ACC-

049; [12–14]) at the Anatomic Pathology Operative

Unit of the Santa Chiara Hospital of Trento. Blind

analyses by three experienced pathologists (MB, FGC,

GB) defined TRPM8 channel expressed at very low

levels in normal lung, breast, and intestinal epithelium

with a marked increase in corresponding tumors fre-

quently associated with the tumor stage (Fig. 1B,C).

Notably, comparative analysis of lung, breast, colorec-

tal, and prostate carcinoma cores spotted on the same

TMA defined high levels of TRPM8 protein in differ-

ent cores of all four tumor types analyzed (Fig. 1B;

Tables S1, S2), regardless of the relative expression of

TRPM8 RNA across them (Fig. 1D). To further inves-

tigate the TRPM8 channel in solid tumors other than

prostate cancer, RNA and protein amounts were stud-

ied in a set of three matched normal and tumor pros-

tate samples collected from patients undergoing radical

prostatectomy and five colorectal cancer samples

Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

2909

A. Alaimo et al. Targeting ion channels for cancer therapy

2910 Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

Targeting ion channels for cancer therapy A. Alaimo et al.

collected from patients after segmental resection of the

large bowel (Fig. 1E–G). As expected, both TRPM8

RNA and protein were expressed in normal prostate

tissues and raised in matched neoplastic lesions

(Fig. 1E,G, Fig. S1A). In sharp contrast to the RNA-

seq data showing almost undetectable levels of

TRPM8 RNA in CRC (Fig. 1A,D), all five CRC sam-

ples were characterized by TRPM8 RNA and protein

expression, as also indicated by immunohistochemistry

studies (Fig. 1B). Of note, in both types of tumor, the

relative amounts of TRPM8 protein between samples

do not reflect the relative amount of its RNA in the

same samples.

3.2. TRPM8 activation twists sub-lethal

chemotherapy into effective cancer treatment

Classical cell line models of colorectal cancer (CRC,

HCT116), breast cancer (BC, MCF7), and non-small

cell lung cancer (NSCLC, A549) were chosen to study

TRPM8 expression and cellular response to the admin-

istration of the channel agonist D-3263, compared to

widely used TRPM8-positive (VCaP and LNCaP) and

TRPM8-negative (PC3) prostate cancer (PCa) cell lines

[12]. Analysis of the NCI-60 cell lines and Cancer Cell

Line Encyclopedia datasets ([22–24]) defined the

amount of TRPM8 RNA in HCT116, MCF7, and

A549 comparable to that of TRPM8-negative PC3 and

DU-145 prostate cancer cells (Fig. 2A). RT-qPCR

studies showed slightly more TRPM8 transcript in

HCT116, MCF7, and A549 cells compared to PC3,

but significantly less (five to ten times) compared to

TRPM8-positive VCaP and LNCaP prostate cancer

cells (Fig. 2B, Fig. S1B). Regardless of the amount of

RNA, HCT116, MCF7, and A549 express levels

of TRPM8 protein ranging between those expressed in

VCaP and LNCaP cells (2 times more than VCaP, half

compared with LNCaP; Fig. 2C–F, Fig. S1C), which have been shown to be highly sensitive to the combi-

nation of sub-lethal doses of standard cancer

treatments (e.g., IR, HT, CT) with the potent TRPM8

agonists WS-12 or D-3263 [12]. Interestingly, the study

of SK-MEL5, G361, and A375 melanoma cell lines

further pointed out the unpredictability of TRPM8

protein expression depending on the levels of its tran-

script (Fig. S1D).

Clinical protocols define Docetaxel as the standard

genotoxic agent for advanced PCa, BC, and NSCLC,

while advanced CRC is often treated with FOLFOX,

a combination of 5-FU and Oxaliplatin. To test the

possible contribution of TRPM8 activation to the anti-

tumor efficacy of selected chemotherapies, LNCaP,

MCF7, and A549 cells were treated for 12 and 24 h

with sub-lethal doses of Docetaxel (10 nM) or TRPM8

agonist D-3263 (1 lM) as single agents or with the

combination of both. HCT116 cells received sub-lethal

doses of 5-FU (10 lM)/Oxaliplatin (2 lM), D-3263

(1 lM) or WS-12 (1 lM) as single agents or a combina-

tion of all three. None of the TRPM8-positive cell

lines showed marks of cell death after 12 h of treat-

ments (Fig. S2A). Twelve hours later (24 h of

treatment), no signs of toxicity were found in D-3263

or WS-12-treated cells; Docetaxel induced a slight

cleavage only of Caspase 3 in LNCaP, MCF7, and

A549, while the combination of chemotherapy and D-

3263 or WS-12 triggered terminal apoptosis in more

than 70% of the populations in all cell lines (Fig. 3A– C, Figs S2B,C, S3, S4A). TRPM8-null PC3 cells, as

well as LNCaP, MCF7, A549, and HCT116 cells with

knocked down levels of the TRPM8, were refractory

to the combination (Fig. 3A–E, Figs S2B–G, S3, S4A).

According to the literature, TRPM2 is the closest

member of the TRPM subfamily to TRPM8. The two

channels share the structure and prevalent permeability

to calcium ions; moreover, based on their amino acid

sequence, most of the key residues involved in agonist

binding are conserved [25–28]. To investigate the speci-

ficity of D-3263 targeting of TRPM8 for cancer cell

response, we profiled the expression of the TRPM2

ion channel in LNCaP, PC3, HCT116, MCF7, and

Fig. 1. TRPM8 RNA and protein expression in solid cancers. (A) Landscape of TRPM8 transcript levels in primary tumor samples across

different tissues (horizontal axis) was retrieved from The Cancer Genome Atlas (TCGA) datasets of cBioPortal. Panel display boxplots

illustrating data distributions; boxes represent the median and interquartile range, while whiskers indicate variability beyond the quartiles,

with individual data points shown above the plots. (B) Representative images of TRPM8 immunolocalization in healthy and malignant

prostate, colorectal, breast, and lung tissue samples spotted on a commercial tissue microarray (TMA). TRPM8 immunostaining was scored

as absent (0), weak (1), moderate (2) or high (3) (scale bar 20 lm). (C) TRPM8 score related to tumor stage (n = 48 cores per cancer type;

n = 4 cores per normal tissue type). (D) Direct comparison of TRPM8 RNA expression across prostate, colorectal, breast, and lung cancers.

Panel display boxplots illustrating data distributions; boxes represent the median and interquartile range, while whiskers indicate variability

beyond the quartiles, with individual data points shown above the plots. (E, F) Quantification of TRPM8 RNA expression and protein

amount in matched normal prostate tissue (N) and prostate cancer (T) samples isolated from n = 3 radical prostatectomies of prostate

cancer (PCa) patients (E), and n = 5 independent colorectal cancer (CRC) samples (F). (G) Western blot of TRPM8 protein in the samples

described in (E, F).

Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

2911

A. Alaimo et al. Targeting ion channels for cancer therapy

2912 Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

Targeting ion channels for cancer therapy A. Alaimo et al.

A549 cancer cell lines. Western blotting showed com-

parable expression of TRPM2 in LNCaP, PC3, and

HCT116 cell lines; A549 cells were characterized by a

very low amount of TRPM2 channel, whereas the

channel was not detected in MCF7 (Fig. S4B).

The expression of TRPM2 in PC3 cells, which are

TRPM8-null and refractory to D-3263, and its absence

in MCF7 cells, which are TRPM8-positive and sensi-

tive to D-3263, suggest the negligibility of TRPM2 for

D-3263 activity. In line with this, TRPM2 knock-down

in D-3263-sensitive TRPM8-positive LNCaP and

HCT116 cancer cells did not alter the ability of D-

3263 to raise the cancer cell killing activity of standard

chemotherapy (Fig. S4C–F).

3.3. D-3263 enhances 5-FU/oxaliplatin toxicity in

patient-derived CRC organoids

Colorectal cancer is the solid tumor showing the

highest divergence between TRPM8 RNA and protein

expression. Although the increased amount of

TRPM8 in tumors is supposed to promote cancer cell

fitness through activation of Ca2+-dependent path-

ways, we recently demonstrated a tight connection of

TRPM8 RNA with anti-cancer immunity [29].

Because of the extensive interaction of the intestinal

tissue with the immune system, we decided to gain

knowledge of TRPM8 in colorectal cancer. We

assembled a dedicated TMA bearing 80 independent

cores representing different stages of disease, each

paired with a core from the corresponding adjacent

normal tissue (Table S3). TMA sections were stained

with two independent specific antibodies against

TRPM8 (Alomone ACC-049 and Abcam Ab3243)

and analyzed by three experienced pathologists (MB,

FGC, GB). The analyses confirmed the increased

amount of the channel in cancer lesions compared with

healthy tissue (Fig. 4A,B, Fig. S5, Table S3), with no

obvious correlations between the amount of TRPM8

and cancer stage.

To simulate a possible approach of precision

oncology exploiting TRPM8 targeting, five well-

characterized CRC organoid lines [20,21] were enrolled

in a pre-clinical trial testing D-3263 and 5-

FU/Oxaliplatin as single agents or in combination.

Immunolocalization studies showed different amounts

of TRPM8 across the five organoid lines (Fig. 4C).

Western blotting confirmed the heterogeneity of chan-

nel expression between the organoid lines, but also

underlined substantially less expression of TRPM8 in

CRC organoids compared to unrelated CRC tissues

derived from the tissue bank of the Santa Chiara Hos-

pital of Trento (Fig. 4D). Similar to cell lines, D-3263

was ineffective when administered as a single agent

(Fig. 4E). Treatment with 5-FU and Oxaliplatin

slightly reduced the viability of three CRC organoid

lines PDO #2, PDO #3, and PDO #5 by ~10%, while

the PDO #1 and PDO #4 lines exceeded 20%. Note-

worthy, D-3263 synergized with 5-FU/Oxaliplatin in

PDO #1 and PDO #4 expressing higher amounts of

TRPM8, leaving the effect of chemotherapy unaffected

in the organoid lines with lower levels of the channel

(Fig. 4C–E).

4. Discussion

Genomics and transcriptomics profiling of thousands

of human cancers coupled with accurate functional

studies have substantially increased our knowledge of

cancer biology and significantly improved the clinical

approach to different forms of tumors. However, the

lack of cutting-edge technologies allowing a deep char-

acterization of the cancer proteome in wide cohorts of

patients downsizes the discovery of the molecular

mechanisms involved in tumorigenesis and, in turn,

the landscape of possible strategies to defeat cancer. In

the list of underestimated contributors to cancer prog-

nosis, ion channels sit in the front row. Rarely

mutated, deleted, or amplified in cancer, their tran-

scriptional deregulation in neoplastic lesions compared

to healthy tissues is generally mediocre and not

enough to raise deep interest in the scientific commu-

nity. This oversimplified reasoning can lead to misjud-

ging the clinical relevance of seemingly negligible

puzzles of the mosaic, which could instead represent

valuable oncologic targets [12–14,18,30].

Fig. 2. Variable amounts of TRPM8 channel in tumor cells with low levels of its coding transcript. (A) TRPM8 RNA expression in cancer cell

lines described in the NCI-60 cell lines and Cancer Cell Lines Encyclopedia projects (retrieved from cBioPortal). (B) Quantitative reverse

transcription polymerase chain reaction (RT-qPCR) comparative analysis of TRPM8 RNA expression in prostate (VCaP, LNCaP, PC3), colon

(HCT116), breast (MCF7) and lung (A549) cancer cells. (C–F) Western blot replicas I and II of TRPM8 in VCaP, LNCaP, PC3, HCT116, MCF7,

A549 cell lines with the Alomone ACC-049 (C) and Abcam Ab3243 (E) antibodies, and relative quantification of TRPM8 protein (D, F) in the

n = 4 independent replicas shown in C–E and Fig. S2C. b-Actin is used as loading control and normalizer. Data are presented as

mean � standard deviation (sd) of three (Alomone ACC-049 antibody) and four (Abcam Ab3243 antibody) independent experiments.

***P ≤ 0.001, **P ≤ 0.01, *P ≤ 0.05. Statistical analysis was performed using Student’s t-test.

Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

2913

A. Alaimo et al. Targeting ion channels for cancer therapy

2914 Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

Targeting ion channels for cancer therapy A. Alaimo et al.

TRPM8 gene expression highly characterizes the

luminal compartment of normal prostate. Almost

invariably, RNA levels increase in hormone-sensitive

primary tumors and metastases but then decrease sig-

nificantly in castration-resistant tumors [12–14]. The

amount of TRPM8 protein parallels its transcript and

rises in hormone-sensitive primary and metastatic

tumors with respect to no-tumoral cells but, unexpect-

edly, it remains well-expressed in castration-resistant

PCa [12–14]. The dichotomy between RNA levels and

protein amount of TRPM8 is also evident in different

prostate cell lines, thus defining protein detection a

more reliable method than RNA profiling for study-

ing TRPM8. Consistent with these observations, we

demonstrate that breast, lung, and colorectal cancers

exhibit variable amounts of TRPM8 regardless of the

very low level of the RNA reported by the Cancer

Genome Atlas (TCGA) RNAseq datasets. According

to the TCGA data, RNA expression of TRPM8 in

normal tissues is generally low (except for prostate

tissue) with minimal variability among samples, which

consistently mirrors the amount of the channel

detected for IHC in healthy epithelia, thus suggesting

that the RNA/TRPM8 discrepancy might be a tumor-

specific event rather than a generalized condition. In

widely used colorectal, breast, and lung cancer cell

lines, TRPM8 channel is functional and stimulation

with the potent agonist D-3263 drives lethal cytotox-

icity when combined with sub-lethal doses of standard

chemo-agents routinely used in the clinic for the treat-

ment of advanced stages of disease [31]. Identification

of novel therapeutic routes improving cancer progno-

sis implies finding treatments with an acceptable effi-

cacy/toxicity ratio. Knock-down experiments in all

cell lines define a net correlation between levels of the

channel and efficacy of D-3263, as also previously

shown for prostate cell lines treated with a different

agonist of TRPM8 (WS-12, [12]). The reduced

amount of TRPM8 protein in normal tissues can thus

justify the negligible toxicity described in both rats

and humans treated with D-3263 [32,33]. Noteworthy,

Dendreon Pharmaceuticals in 2009 pioneered a small

interventional Phase I clinical trial (NCT00839631)

enrolling cancer patients diagnosed with different

types of advanced solid tumors (prostate, colon,

breast, and lung cancer, among others) to test D-

3263. Side effects were limited to cold sensations,

while three advanced prostate cancers showed signs of

disease stabilization [33]. These findings support the

relevance that TRPM8 targeting may have in oncol-

ogy, particularly for the treatment of those tumors

that, by immunohistochemistry, express high levels of

the channel. The formal demonstration that D-3263

works in TRAMP-C1 and C2 mouse cell line models

of PCa [14] paves the way for pre-clinical in vivo trials

in orthotopically transplanted immune-competent syn-

geneic C57BL/6 mice. A similar characterization of

Trpm8 expression and function in mouse C57BL/6

MC-38 and BALB/c CT-26 is ongoing and will poten-

tially expand our in vivo pre-clinical platform to colo-

rectal cancer. On the other hand, the ability to

rapidly study the amount of TRPM8 and the contri-

bution to therapy of channel agonists in patient-

derived tumor organoids perfectly meets the principles

of precision oncology based on co-clinical strategies

[34–38]. From a mechanistic perspective, TRPM8 activation

in cells characterized by higher expression of the channel

is expected to drive inward calcium currents with the

consequent emptying of the intracellular Ca2+ stores

and, finally, calcium cytotoxicity [12]. However, experi-

ments aimed at detecting and quantifying free cytosolic

Ca2+ through the ratiometric fluorescent dye Fura-2

have often proved inconclusive in cancer cells treated

with WS-12 and D-3263 [12,14]. The calcium-sensitive

bioluminescent protein Aequorin could help carefully

evaluate Ca2+ flux at the level of specific subcellular

compartments [39,40]. Of note, these studies did not

include concomitant treatment of cancer cells with a

therapy, which might instead integrate TRPM8 action

and promote emptying of intracellular Ca2+ stores.

Although calcium remains the main suspect, we cannot

rule out the possibility that cytotoxicity associated with

potent channel agonists may depend on the deregulation

of the homeostasis of Na2+ and K+ to which TRPM8 is

also permeable.

Fig. 3. Lethal synergy between TRPM8 agonist D-3263 and chemotherapy in cancer cells. (A) Representative crystal violet staining of

LNCaP, HCT116, MCF7, A549, and PC3 cells untreated or treated with the indicated drugs for 24 h (chemotherapy = Docetaxel for LNCaP,

MCF7, A549, and PC3; 5-fluorouracil (5-FU + Oxaliplatin for HCT116). TRPM8 knock-down (siRNA1 and siRNA2) confirmed D-3263

specificity. (B) Quantification of the viability of treated cells compared with untreated controls. Data are presented as mean � standard

deviation (sd) of n = 3 independent experiments (A, Fig. S2C). ***P < 0.001. Statistical analysis was performed using Student’s t-test. (C, D)

Western blot analysis of Caspase 3 and Parp cleavage in LNCaP, HCT116, MCF7, A549, and PC3 cells untreated or treated with the

indicated drugs for 24 h (C). TRPM8 knock-down (siRNA2) confirmed D-3263 specificity (D). (E) Direct comparison of D-3263 efficacy in wild

type and TRPM8 knocked down (KD) cancer cells. Western blot analysis in C–E was repeated with n = 2 sets of biologically independent

samples.

Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

2915

A. Alaimo et al. Targeting ion channels for cancer therapy

5. Conclusions

Overall, this work demonstrates the lethal synergy

of TRPM8 agonists and standard chemotherapy in

the four major killers among human cancers, shed-

ding light on the importance that ion channels

may have as molecular targets for precision

oncology.

Fig. 4. Efficacy of D-3263 + 5-FU + Oxaliplatin in CRC organoids raises with the amount of TRPM8. (A) TRPM8 immunolocalization in a

dedicated homemade tissue microarray (TMA) of colorectal cancer (scale bar 100 lm; ACC-049). Representative images of colorectal cancer

(CRC) with different levels of TRPM8 staining and relative scores. Score 1: weak expression, score 2: moderate expression, score 3: high

expression. (B) Distribution of TRPM8 immunostaining scores across the colorectal cancer (CRC) specimens (n = 79 independent cores). (C)

Immunolocalization of TRPM8 in n = 5 different lines of patient-derived colorectal cancer (CRC) organoids (scale bar 20 lm). (D) Western

blot of TRPM8 from colorectal cancer (CRC) specimens (n = 5 independent samples) derived from the tissue bank of the Santa Chiara

Hospital of Trento and—independent—n = 5 patient-derived organoids (PDO). Western blot analysis in D was repeated twice. (E) Relative

viability of colorectal cancer (CRC) organoids subjected to the indicated treatments or left untreated to serve as control pooled together

based on TRPM8 protein amount (high (Hi): PDO #1 and PDO #4; low (Lo): PDO #2, PDO #3 and PDO #5). Distribution of viability

measures across the different conditions and stratifications is shown using boxplots. Paired two-sample t-test was used to compare the

viability of organoid lines. Data are presented as mean � standard deviation (sd) of two independent biological experiments, each with six

technical replicates.

2916 Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

Targeting ion channels for cancer therapy A. Alaimo et al.

Acknowledgements

We thank current and former members of the Lunardi

laboratory for experimental support and advice. We

are grateful to all the staff at the CIBIO core facilities

for their help. Department CIBIO Core Facilities are

supported by the European Regional Development

Fund (ERDF) 2014–2020. This work has been sup-

ported by the initiative “Dipartimenti di Eccellenza

2023-2027 (Legge 232/2016)” funded by the Italian

Ministry of University and Research (MUR). Further-

more, we thank all the staff at the Department of His-

topathology (S. Chiara Hospital, Trento, Italy) for

their technical support with histology. This work was

supported by Associazione Italiana per la Ricerca sul

Cancro (AIRC) Associazione Italiana per la Ricerca

sul Cancro (AIRC) under IG 2023 -ID 29286 project

to S. Arena (SA); FPRC 5 9 1000 Ministero della

Salute 2022 CARESS to S. Arena (SA); FPRC

5 9 1000 Ministero della Salute 2021 EmaGen to S.

Arena; Italian Ministry of Health, Ricerca Corrente

2025 to S. Arena (SA); Prin 2022 PNRR finanziato

dall’Unione Europea NextGenerationEU M4 C2

I.1.1.- P2022E3BTH to S. Arena (SA); MUR Diparti-

mento di Eccellenza 2023-2027 14586 DIORAMA to

S. Arena (SA); AIRC under 5 per Mille 2018 – ID.

21091 program – P.I. A. Bardelli (ABa); AIRC under

IG 2023 – ID. 28922 project to A. Bardelli (ABa);

European Research Council (ERC) under the Euro-

pean Union‘s Horizon 2020 research and innovation

programme (TARGET, grant agreement n. 101020342)

to A. Bardelli (ABa); IMI contract n. 101007937 PER-

SIST-SEQ to A. Bardelli (ABa); PRIN 2022 – Prot.

2022CHB9BA financed by European Union – Next

Generation EU to A. Bardelli (ABa); AIRC under IG

2022 ID. 27893 project to A. Lunardi (ALu); Lega

Italiana per la Lotta ai Tumori to A. Lunardi (ALu);

E. Marmocchi (EM) is supported by Pezcoller Foun-

dation doctoral fellowship; A. Alaimo (AA) was

granted the University of Trento Starting Grant

Young Researcher 2019. Open access publishing facili-

tated by Universita degli Studi di Trento, as part of

the Wiley - CRUI-CARE agreement.

Conflict of interest

S. Arena (SA) reports personal fees from MSD Italia

and a patent (Italian patent application No.

102022000007535) outside the submitted work. A. Bar-

delli (ABa) declares the following competing financial

interests: receipt of grants/research support from Neo-

phore, AstraZeneca, Boehringer; receipt of honoraria

or consultation fees from Guardant Health; stock

shareholder: Neophore, Kither Biotech; member of the

SAB of Neophore. No disclosures were reported by

the other authors.

Author contributions

AA: Conceptualization, data curation, validation,

investigation, visualization, methodology, writing-

original draft; FGC: Data curation, validation, investi-

gation, visualization, methodology; KB: Data curation,

validation, investigation, methodology; NA: Data

curation, formal analysis, visualization, methodology;

SG: Data curation, investigation, methodology; ALo.:

investigation; KW: Data curation, methodology; ML:

Data curation, methodology; EM: Data curation, vali-

dation, visualization; ABr: Data curation, investiga-

tion; MGP: Data curation, investigation; LM: Data

curation, investigation; OC: Data curation, investiga-

tion; GB: Data curation, investigation. MB: Data

curation, investigation; ABa: investigation, funding

acquisition; AR: Data curation, investigation; SA:

Data curation, investigation, validation, funding acqui-

sition, reviewing; ALu: Conceptualization, data cura-

tion, visualization, supervision, funding acquisition,

writing original draft, reviewing, and editing.

Peer review

The peer review history for this article is available at

https://www.webofscience.com/api/gateway/wos/peer-

review/10.1002/1878-0261.70049.

Data accessibility

All data needed to evaluate the conclusions in the

paper are presented in the paper and/or Supplemen-

tary Materials. Additional data is available upon

request from the corresponding authors.

References

1 Heo YJ, Hwa C, Lee G-H, Park J-M, An J-Y.

Integrative multi-omics approaches in cancer research:

from biological networks to clinical subtypes. Molecules

and Cells. 2021;44(7):433–43. 2 Raufaste-Cazavieille V, Santiago R, Droit A. Multi-omics

analysis: paving the path toward achieving precision

medicine in cancer treatment and immuno-oncology.

Frontiers in Molecular Biosciences. 2022;9:962743.

3 Sammut S-J, Crispin-Ortuzar M, Chin S-F, Provenzano

E, Bardwell HA, Ma W, et al. Multi-omic machine

learning predictor of breast cancer therapy response.

Nature. 2022;601(7894):623–9.

Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

2917

A. Alaimo et al. Targeting ion channels for cancer therapy

4 Jim�enez-Santos MJ, Nogueira-Rodr�ıguez A, Pi~neiro-

Y�a~nez E, L�opez-Fern�andez H, Garc�ıa-Mart�ın S,

G�omez-Plana P, et al. PanDrugs2: prioritizing cancer

therapies using integrated individual multi-omics data.

Nucleic Acids Research. 2023;51(W1):W411–8. 5 Labrie M, Brugge JS, Mills GB, Zervantonakis IK.

Therapy resistance: opportunities created by adaptive

responses to targeted therapies in cancer. Nature

Reviews. Cancer. 2022;22(6):323–39. 6 Capatina AL, Lagos D, Brackenbury WJ. Targeting ion

channels for cancer treatment: current Progress and

future challenges. In: Stock C, Pardo LA, editors.

Targets of cancer diagnosis and treatment. Cham:

Springer International Publishing; 2020. p. 1–43. 7 Zhang M, Ma Y, Ye X, Zhang N, Pan L, Wang B.

TRP (transient receptor potential) ion channel family:

structures, biological functions and therapeutic

interventions for diseases. Signal Transduction and

Targeted Therapy. 2023;8(1):261.

8 Nilius B, Owsianik G. The transient receptor potential

family of ion channels. Genome Biology. 2011;12(3):218.

9 Kaneko Y, Szallasi A. Transient receptor potential

(TRP) channels: a clinical perspective. British Journal of

Pharmacology. 2014;171(10):2474–507. 10 Chubanov V, K€ottgen M, Touyz RM, Gudermann T.

TRPM channels in health and disease. Nature Reviews.

Nephrology. 2024;20(3):175–87. 11 Koivisto A-P, Belvisi MG, Gaudet R, Szallasi A.

Advances in TRP channel drug discovery: from target

validation to clinical studies. Nature Reviews. Drug

Discovery. 2022;21(1):41–59. https://doi.org/10. 1038/s41573-021-00268-4

12 Alaimo A, Lorenzoni M, Ambrosino P, Bertossi A,

Bisio A, Macchia A, et al. Calcium cytotoxicity

sensitizes prostate cancer cells to standard-of-care

treatments for locally advanced tumors. Cell Death &

Disease. 2020;11(12):1039.

13 Lunardi A, Barbareschi M, Carbone FG, Morelli L,

Brunelli M, Fortuna N, et al. TRPM8 protein expression

in hormone na€ıve local and lymph node metastatic

prostate cancer. Pathologica. 2021;113(2):95–101. 14 Genovesi S, Moro R, Vignoli B, De Felice D, Canossa

M, Montironi R, et al. Trpm8 expression in human and

mouse castration resistant prostate adenocarcinoma

paves the way for the preclinical development of

TRPM8-based targeted therapies. Biomolecules. 2022;12

(2):193. https://doi.org/10.3390/biom12020193

15 Palchevskyi S, Czarnocki-Cieciura M, Vistoli G,

Gervasoni S, Nowak E, Beccari AR, et al. Structure of

human TRPM8 channel. Communications Biology.

2023;6(1):1065.

16 Di Donato M, Ostacolo C, Giovannelli P, Di Sarno V,

Monterrey IMG, Campiglia P, et al. Therapeutic

potential of TRPM8 antagonists in prostate cancer.

Scientific Reports. 2021;11(1):23232.

17 Ochoa SV, Casas Z, Albarrac�ın SL, Sutachan JJ,

Torres YP. Therapeutic potential of TRPM8 channels

in cancer treatment. Frontiers in Pharmacology.

2023;14:1098448. https://doi.org/10.3389/fphar.2023.

1098448

18 Alaimo A, De Felice D, Genovesi S, Lorenzoni M,

Lunardi A. Tune the channel: TRPM8 targeting in

prostate cancer. Oncoscience. 2021;8:97–100. 19 Chen L, Zhu L, Lu X, Ming X, Yang B. TRPM2

regulates autophagy to participate in hepatitis B virus

replication. Journal of Viral Hepatitis. 2022;29(8):627–36. 20 Arena S, Corti G, Durinikova E, Montone M, Reilly

NM, Russo M, et al. A subset of colorectal cancers

with cross-sensitivity to Olaparib and oxaliplatin.

Clinical Cancer Research. 2020;26(6):1372–84. 21 Durinikova E, Reilly NM, Buzo K, Mariella E, Chil�a

R, Lorenzato A, et al. Targeting the DNA damage

response pathways and replication stress in colorectal

cancer. Clinical Cancer Research. 2022;28(17):3874–89. 22 Barretina J, Caponigro G, Stransky N, Venkatesan K,

Margolin AA, Kim S, et al. The cancer cell line

encyclopedia enables predictive modelling of anticancer

drug sensitivity. Nature. 2012;483(7391):603–7. https://doi.org/10.1038/nature11003

23 Ghandi M, Huang FW, Jan�e-Valbuena J, Kryukov GV,

Lo CC, McDonald ER, et al. Next-generation

characterization of the cancer cell line encyclopedia.

Nature. 2019;569(7757):503–8. https://doi.org/10. 1038/s41586-019-1186-3

24 Reinhold WC, Varma S, Sunshine M, Elloumi F,

Ofori-Atta K, Lee S, et al. RNA sequencing of the

NCI-60: integration into CellMiner and CellMiner

CDB. Cancer Research. 2019;79(13):3514–24. 25 Yin Y, Le SC, Hsu AL, Borgnia MJ, Yang H, Lee S-Y.

Structural basis of cooling agent and lipid sensing by

the cold-activated TRPM8 channel. Science. 2019;363

(6430):eaav9334.

26 Wang L, Fu T-M, Zhou Y, Xia S, Greka A, Wu H.

Structures and gating mechanism of human TRPM2.

Science. 2018;362(6421):eaav4809.

27 Bandell M, Dubin AE, Petrus MJ, Orth A, Mathur J,

Hwang SW, et al. High-throughput random

mutagenesis screen reveals TRPM8 residues specifically

required for activation by menthol. Nature

Neuroscience. 2006;9(4):493–500. 28 Winking M, Hoffmann DC, K€uhn C, Hilgers R-D,

L€uckhoff A, K€uhn FJP. Importance of a conserved

sequence motif in transmembrane segment S3 for the

gating of human TRPM8 and TRPM2. PLoS One.

2012;7(11):e49877.

29 Alaimo A, Genovesi S, Annesi N, De Felice D, Subedi

S, Macchia A, et al. Sterile inflammation via TRPM8

RNA-dependent TLR3-NF-kB/IRF3 activation

promotes antitumor immunity in prostate cancer. The

EMBO Journal. 2024;43(5):780–805.

2918 Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

Targeting ion channels for cancer therapy A. Alaimo et al.

30 Prevarskaya N, Skryma R, Shuba Y. Ion channels in

cancer: are cancer hallmarks Oncochannelopathies?

Physiological Reviews. 2018;98(2):559–621. 31 Anand U, Dey A, Chandel AKS, Sanyal R, Mishra A,

Pandey DK, et al. Cancer chemotherapy and beyond:

current status, drug candidates, associated risks and

progress in targeted therapeutics. Genes & Diseases.

2023;10(4):1367–401. 32 Duncan D, Stewart F, Frohlich M, Urdal D. Preclinical

evaluation of the TRPM8 ion channel agonist D-3263

for benign prostatic hyperplasia. The Journal of

Urology. 2009;181(4S):503.

33 Tolcher A, Patnaik A, Papadopoulos K, Mays T,

Stephan T, Humble DJ, et al. 376 preliminary results

from a phase 1 study of D-3263 HCl, a TRPM8

calcium channel agonist in patients with advanced

cancer. European Journal of Cancer Supplements. 2010;8

(7):119. https://doi.org/10.1016/s1359-6349(10)72083-8

34 Nardella C, Lunardi A, Patnaik A, Cantley LC,

Pandolfi PP. The APL paradigm and the “Co-clinical

trial” project. Cancer Discovery. 2011;1(2):108–16. 35 Lunardi A, Ala U, Epping MT, Salmena L, Clohessy

JG, Webster KA, et al. A co-clinical approach identifies

mechanisms and potential therapies for androgen

deprivation resistance in prostate cancer. Nature

Genetics. 2013;45(7):747–55. 36 Lunardi A, Pandolfi PP. A co-clinical platform to

accelerate cancer treatment optimization. Trends in

Molecular Medicine. 2015;21(1):1–5. 37 Kim HR, Kang HN, Shim HS, Kim EY, Kim J, Kim DJ,

et al. Co-clinical trials demonstrate predictive biomarkers

for dovitinib, an FGFR inhibitor, in lung squamous cell

carcinoma. Annals of Oncology. 2017;28(6):1250–9. 38 Yagishita S, Nishikawa T, Yoshida H, Shintani D, Sato

S, Miwa M, et al. Co-clinical study of [fam-]

trastuzumab Deruxtecan (DS8201a) in patient-derived

xenograft models of uterine carcinosarcoma and its

association with clinical efficacy. Clinical Cancer

Research. 2023;29(12):2239–49. 39 Tanaka K, Choi J, Stacey G. Aequorin luminescence-

based functional calcium assay for heterotrimeric G-

proteins in Arabidopsis. In: Running MP, editor. G

protein-coupled receptor signaling in plants. Totowa,

NJ: Humana Press; 2013. p. 45–54. 40 Bonora M, Giorgi C, Bononi A, Marchi S, Patergnani S,

Rimessi A, et al. Subcellular calcium measurements in

mammalian cells using jellyfish photoprotein aequorin-

based probes. Nature Protocols. 2013;8(11):2105–18.

Supporting information

Additional supporting information may be found

online in the Supporting Information section at the end

of the article.

Fig. S1. Comparable amounts of TRPM8 protein in

prostate, colorectal, breast, and lung cancer cells. (A)

Uncropped western blot relative to Fig. 1F. As previ-

ously described in Alaimo et al. (2020), lysates of

LNCaP cells show both the full-length (128 kDa,

Plasma Membrane) and the shorter (35 kDa, Endo-

plasmic Reticulum) forms of TRPM8. (B) Amount of

TRPM8 RNA in cancer cell lines relative to MCF7.

Data are normalized using GAPDH (upper panel,

n = 3) or bACTIN (lower panel, n = 2) expression as

housekeeping genes. (C) Western blot replicas III and

IV of TRPM8 in VCaP, LNCaP, PC3, HCT116,

MCF7, A549 cell lines with the Alomone ACC-049

(upper panel ) and Abcam Ab3243 (lower panel ) anti-

bodies. b-Actin is used as loading control. (D) TRPM8

RNA and protein quantification in melanoma cancer

cell lines SK-MEL5, G361, and A375 (n = 2).

Fig. S2. Activation of TRPM8 promotes chemotoxicity

in cancer cells. (A) Western blot analysis of Caspase 3

and Parp cleavage in untreated or treated LNCaP,

HCT116, MCF7, and A549 cell lines with the indi-

cated drugs for 12 h. (B) Schematic representation of

the experiments in C (chemotherapy = Docetaxel for

LNCaP, MCF7, A549, and PC3; 5-fluorouracile (5-

FU) + Oxaliplatin for HCT116. TRPM8 knock-

down = siTRPM8 #1 and siTRPM8 #2). (C) Crystal

violet staining of LNCaP, HCT116, MCF7, A549, and

PC3 cells untreated or treated for 24 h with the indi-

cated drugs. (D, E) Western blotting of TRPM8 in

LNCaP (D), HCT116, MCF7, and A549 (E) cell lines

untransfected (Unt), transfected with control siRNA

(siCtrl) or siRNAs targeting TRPM8 (siRNA1 and

siRNA2). b-Actin is used as loading control. Quantifi-

cation is relative to the untreated (Untr) condition for

each cell line. (F, G) Western blotting (F) and immu-

nohistochemistry (G) of TRPM8 in HCT116, MCF7,

and A549 cell lines transfected with control siRNA

(�) or siRNA1 targeting TRPM8 (+). b-Actin is used

as loading control. Secondary antibody alone (Ab-

IIary) is used as negative control.

Fig. S3. Combination of D-3263 with chemotherapy

induces apoptosis in TRPM8 positive cancer cells. Cell

death rate by fluorescence-activated cell sorting

(FACS) with Annexin-V-FITC and propidium iodide

(PI) staining of LNCaP, HCT116, MCF7, A549, and

PC3 cells untreated or treated with the indicated drugs

for 24 h (chemotherapy = Docetaxel for LNCaP,

MCF7, A549, and PC3; 5-fluorouracile (5-FU) + Oxa-

liplatin for HCT116. TRPM8 knock-

down = siTRPM8 #2).

Fig. S4. TRPM2 ion channel in cancer cell lines. (A)

Western blotting analysis of TRPM8, PARP, and

Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

2919

A. Alaimo et al. Targeting ion channels for cancer therapy

Caspase 3 in HCT116 cancer cell line treated with WS-

12 (1 M) and chemotherapy. (B) Western blotting

analysis of TRPM2 expression in LNCaP, PC3,

HCT116, MCF7 and A549 cancer cell lines. (C) West-

ern blotting analysis showing TRPM2 knock-down by

specific siRNAs (siRNA1 and siRNA2) in LNCaP,

PC3, HCT116 cancer cell lines. (D, E) Western blot

analysis of Caspase 3 and PARP cleavage in LNCaP,

HCT116, MCF7 cells transfected with control siRNA

(siCtr) (D) or TRPM2 siRNA (siRNA1) (E) and

untreated or treated with the indicated drugs for 24 h.

(F) Western blotting analysis showing TRPM2 knock-

down by siRNA1 in LNCaP, PC3, HCT116 cancer cell

lines treated with D-3263 and chemotherapy in D

and E.

Fig. S5. TRPM8 ion channel expression in colorectal

cancer specimens. (A) TRPM8 in a serial section to

that shown in Fig. 4A of a homemade dedicated

colorectal cancer tissue microarray (scale bar 100 lm;

Ab3243). Representative images of CRC with different

levels of TRPM8 staining and relative scores. Score 0:

no expression; score 1: weak expression, score 2: mod-

erate expression, score 3: high expression. (B) Distribu-

tion of TRPM8 immunostaining scores in colorectal

cancer (CRC) samples with Alomone ACC-049 and

Abcam AB-3243 antibodies, showing higher detection

efficiency of ACC-049 than Ab-3243 at the same dilu-

tion, but consistent distribution of relative scores

across samples.

Table S1. Multi-organ tissue microarray US Biomax,

Inc. (MC2081a) and TRPM8 immunostaining score.

Table S2. Clinical description of multiple organ tumor

tissue array.

Table S3. Clinical description of Colorectal Cancer tis-

sue microarray (TMA) and TRPM8 immunostaining

score.

2920 Molecular Oncology 19 (2025) 2905–2920 ª 2025 The Author(s). Molecular Oncology published by John Wiley & Sons Ltd on behalf of

Federation of European Biochemical Societies.

Targeting ion channels for cancer therapy A. Alaimo et al.

© 2025. This work is published under http://creativecommons.org/licenses/by/4.0/(the "License"). Notwithstanding the ProQuest Terms and Conditions, you may use this content in accordance

with the terms of the License.