Lab Report
Ryanjes21 
PrimarySourceOne.pdf
The globin family is comprised of small porphyrin�
containing proteins that can reversibly bind O2 via an iron
(Fe 2+
) ion of the heme prosthetic group [1]. Hemoglobin
(Hb) and myoglobin (Mb) are two members of the globin
family and function in storage and transportation of oxy�
gen in different tissues [2, 3]. However, in some mollusks
and arthropods, Hb is replaced by hemocyanin [4, 5],
which plays important roles in transporting oxygen via
copper ions [6], homeostatic and physiological processes
such as molting [7], hormone transport [8], osmoregula�
tion, and protein storage [9]. It has been reported that
increasing ambient temperature can lead to decreased
oxygen affinity of hemocyanin and a change in coopera�
tivity of the pigment [10], and low temperature signifi�
cantly downregulates hemocyanin content [11].
Besides the well�known Hb and Mb, the other two
globins, cytoglobin (Cygb) and neuroglobin (Ngb), have
also been identified in a wide range of species [12] and
possess the typical globin fold of eight helixes and a heme
prosthetic group whose physiological importance is pri�
marily related to its ability to reversibly bind molecular
oxygen [13]. Ngb is mainly expressed in the cytoplasm of
neurons (brain and retina) and some endocrine tissues
[14]. Several potential functions of Ngb have been report�
ed, such as the detoxification of reactive oxygen species
(ROS) and NO, as well as the role of oxygen sensor and
transporter [15, 16]. Cygb is found in heart, lung, liver,
and stomach [17�19] and shows oxygen�binding charac�
teristics like those of Mb [16], suggesting that Cygb facil�
ISSN 0006�2979, Biochemistry (Moscow), 2017, Vol. 82, No. 7, pp. 844�851. © Pleiades Publishing, Ltd., 2017.
Published in Russian in Biokhimiya, 2017, Vol. 82, No. 7, pp. 1097�1106.
844
Abbreviations: Cygb, cytoglobin; Hb, hemoglobin; LDH, lac�
tate dehydrogenase; Mb, myoglobin; Ngb, neuroglobin; ROS,
reactive oxygen species; SDH, succinate dehydrogenase.
* To whom correspondence should be addressed.
Effect of Low Temperature on Globin Expression, Respiratory Metabolic Enzyme Activities,
and Gill Structure of Litopenaeus vannamei
Meng Wu1, Nan Chen1, Chun�Xiao Huang1, Yan He1, Yong�Zhen Zhao2, Xiao�Han Chen3, Xiu�Li Chen3*, and Huan�Ling Wang1,2*
1Ministry of Education, Huazhong Agricultural University, College of Fishery, Key Lab of Freshwater Animal Breeding,
Key Laboratory of Agricultural Animal Genetics, Breeding, and Reproduction, 430070 Wuhan, PR China;
E�mail: [email protected] 2Freshwater Aquaculture Collaborative Innovation Center of Hubei Province, 430070 Wuhan, PR China
3Guangxi Academy of Fishery Sciences, 530021 Nanning, PR China; E�mail: [email protected]
Received January 22, 2017
Revision received March 20, 2017
Abstract—Low temperature frequently influences growth, development, and even survival of aquatic animals. In the pres� ent study, physiological and molecular responses to low temperature in Litopenaeus vannamei were investigated. The cDNA
sequences of two oxygen�carrying proteins, cytoglobin (Cygb) and neuroglobin (Ngb), were isolated. Protein structure
analysis revealed that both proteins share a globin superfamily domain. Real�time PCR analysis indicated that Cygb and Ngb
mRNA levels gradually increased during decrease in temperatures from 25 to 15°C and then decreased at 10°C in muscle,
brain, stomach, and heart, except for a continuing increase in gills, whereas they showed a different expression trend in the
hepatopancreas. Hemocyanin concentration gradually reduced as the temperature decreased. Moreover, the activities of
respiratory metabolic enzymes including lactate dehydrogenase (LDH) and succinate dehydrogenase (SDH) were meas�
ured, and it was found that LDH activity gradually increased while SDH activity decreased after low�temperature treatment.
Finally, damage to gill structure at low temperature was also observed, and this intensified with further decrease in temper�
ature. Taken together, these results show that low temperature has an adverse influence in L. vannamei, which contributes
to systematic understanding of the adaptation mechanisms of shrimp at low temperature.
DOI: 10.1134/S0006297917070100
Keywords: Litopenaeus vannamei, low temperature, Cygb, Ngb, respiratory enzymes, gill structure
RESPONSES OF Litopenaeus vannamei TO LOW TEMPERATURE 845
BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017
itates O2 diffusion to the respiratory chain. It also func�
tions in scavenging NO and ROS [20]. In addition, recent
studies have demonstrated that temperature influences
the affinity of Cygb and Ngb to O2 [21].
Litopenaeus vannamei, also known as Penaeus van�
namei, which originates from the Pacific coast between
the Gulf of California and Northern Peru, grows at tem�
peratures between 25 and 35°C [22]. This popular cul�
tured shrimp species has experienced a dramatic increase
in aquaculture production from 2,161,008 tons in 2006 to
3,668,682 tons in 2014 [23]. Studies have revealed that
the changes in temperature and oxygen content in differ�
ent altitudes can affect some respiratory metabolic
enzymes in lizards, such as lactate dehydrogenase (LDH)
and succinate dehydrogenase (SDH) [24]. Additionally,
low temperature significantly affects shrimp immune
functions [25], growth [26], metabolic rates [27], and
even survival [28]. However, the physiological and molec�
ular responses to low temperature in L. vannamei based
on analysis of two globins and respiratory metabolic
enzymes are unclear. Therefore, in this study we cloned
and characterized the Cygb and Ngb genes and deter�
mined their expression patterns under different tempera�
ture conditions. The relative respiratory physiological
indexes were also determined.
MATERIALS AND METHODS
Sample collection. Litopenaeus vannamei (5.66 ± 1.02 g, 7.2 ± 0.78 cm) were collected from Guangxi
Fisheries Research Institute, Nanning, China. After accli�
mation for 7 days, the shrimps were randomly divided into
four groups, and each group had three repetitions (n = 15
in each repetition). After the temperature reached the set
values at 12 h by linear cooling, the shrimps were treated
at different temperatures (25 – control, 20, 15, and 10°C)
for 6 h with saturated dissolved oxygen. Then, the shrimps
were anesthetized with MS�222 (150 mg/ liter), sampled,
and stored at –80°C for extraction of total RNA or fixed in
Bouin’s solution for hematoxylin–eosin staining.
Total RNA extraction and cDNA synthesis. Total RNA was extracted by TRIzol reagent (TaKaRa, Japan)
following the manufacturer’s instructions. RNA concen�
tration was measured using a NanoDrop 2000 instrument
(Thermo Fisher Scientific, USA). First�strand cDNA
was synthesized using a reverse�transcriptase kit
(Promega, USA) as follows: 5 μg of total RNA and 10 μl
of oligo(dT)20 primer (50 pmol) were reacted for 5 min at
70°C. After incubation for 2 min on ice, the mixture was
reverse�transcribed into cDNA at 42°C for 60 min in a
volume of 25 μl containing 1 μl of 5× M�MLV buffer, 2 μl dNTPs, 200 units of M�MLV reverse transcriptase, and
40 units RNasin.
Gene cloning. The primers used for amplifying the core sequence of Cygb were designed based on the EST sequence
of L. vannamei (FE137590.1). The degenerate primers used
for amplifying the core sequence of Ngb were designed in
conserved regions of homologs in Cherax destructor
(KP299991.1), Cephus cinctus (XM_015731629.1), and
Neodiprion lecontei (XM_015663169.1). The 3′� and 5′�end sequences were amplified based on an efficient full�length
Primer name
Cygb�F1 Cygb�R1
Ngb�F1 Ngb�R1
AD1 AD2 AD3
Cygb�3utr�1 Cygb�3utr�2 Cygb�5utr�1 Cygb�5utr�2 Cygb�5utr�3
Ngb�3utr�1 Ngb�3utr�2
Cygb�Qpcr�F Cygb�Qpcr�R
Ngb�Qpcr�F Ngb�Qpcr�R
Application
amplifying the core sequence of Cygb
amplifying the core sequence of Ngb
TAIL�PCR for amplifying UTR of Ngb
amplifying UTR of Cygb
Ngb primers for UTR
Cygb primers for qRT�PCR
Ngb primers for qRT�PCR
Primers used for PCR and mRNA expression
Primer sequence (5′�3′)
GGTTGGTGGACTGCTGG GGCGTTTATTCGTCTTCA
GGCCACGTCCATGGAGCTGGCNGARCACG CCAGGAAGGGCTTCTCGATYTTCCARAA
NTCGASTWTSGWGTT NGTCGASWGANAWGAA WGTGNAGWANCANAGA
CTGCCTGGTGGAAATGCTGAACGCTAC ACTGAAGACGAATAAACGCCTTGCTGC TCGCCCTCAGGACCCAGGTCACCGTCTT AGAAGACTCCACATTGCTCCCATCGTCT AGTCCCAGCAGTCCACCAACCCCACAGA
ACTTCTTCTTCGACCTCCTGCACCAGAT ATCCCAGGGTTCAAGAAGGAGTATTTTT
AGGTGAGCAGCGTCCAGT CAGCAAGGCGTTTATTCGT
CAGGGTTCAAGAAGGAGT TGATGGTTATGCGGTAGA
846 MENG WU et al.
BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017
cDNA amplification strategy with modified nested�PCR
and thermal asymmetric interlaced (TAIL) PCR [29]. All
the primer information is shown in the table. After these
PCR products were cloned into pGEM�T Easy vector and
sequenced, the full�length or partial cDNA sequences of
Cygb and Ngb were assembled by the DNAStar software,
respectively.
Sequence analysis. The amino acid sequences of L. vannamei Cygb and Ngb were predicted using Open
Reading Frame Finder on the NCBI database (http://www.
ncbi.nlm.nih.gov./grof/gorf.html). Homologous analysis
and multiple alignment of amino acid sequences were
achieved using BLAST and BLASTX on the NCBI data�
base (http://blast.ncbi.nlm.nih.gov/Blast.cgi). The phy�
logenetic tree was constructed by the neighbor�joining
method using the MEGA 5.0 package. The protein
domains were noted according to the UniProt (http://www.
uniprot.org) and SMART (http://smart.embl�heidelberg.
de) databases.
Quantitative real�time PCR (qRT�PCR). The tran� scription levels of Ngb and Cygb in different tissues of L.
vannamei after low�temperature treatment were deter�
mined by qRT�PCR. The primer sequences are shown in
the table. The qRT�PCR was carried out in 20�μl total
reaction volume containing 10 μl of 2× SYBR Green PCR Master Mix (Takara), 0.8 μl of each primer, 7.4 μl of H2O,
and 1 μl of cDNA template. The following three�step
reaction was performed at 95°C for 5 min, followed by 40
cycles at 95°C for 10 s, 60°C for 10 s, and 72°C for 20 s.
The melting curve was analyzed to demonstrate the speci�
ficity of the PCR reaction. The β�actin gene was chosen as the internal reference gene. All samples from each group
were examined in triplicate on the same plate. The relative
expression of Ngb and Cygb was calculated using the com�
parative Ct method with the formula 2 –ΔΔCt
[30].
Hematoxylin–eosin (HE) staining. The gills of L. vannamei from the different groups fixed in Bouin’s solu�
tion were embedded in paraffin after a series of dehydra�
Fig. 1. Effect of temperature on gill structure of L. vannamei. Thick arrows, short arrows, and thin arrows, respectively, represent epithelium cells, cuticle membrane, and lymphocyte.
RESPONSES OF Litopenaeus vannamei TO LOW TEMPERATURE 847
BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017
tions steps in a gradient of alcohol and hyalinization in
xylene. Paraffin blocks of specimen were cut into contin�
uous 5�μm sections and then stained with HE. Finally,
the gill structure was observed under an optical micro�
scope.
Hemocyanin measurement. Hemolymph was with� drawn from the shrimp cardio coelom with a 1�ml syringe
filled with an equal volume of anticoagulant solution
(30 mM trisodium citrate including 0.34 M NaCl, 10 mM
EDTA, and 0.115 M glucose, pH 7.55) and then quickly
transferred to precooled microcentrifuge tubes. Anti�
coagulant hemolymph was centrifuged at 800g for 10 min
at 4°C. Then 100 μl of supernatant was diluted (1 : 30)
with Tris�Ca buffer (50 mM Tris�HCl, 10 mM CaCl2, pH
8.0). The absorbance values of the diluted plasma were
measured at 334 nm using a UV spectrophotometer, and
hemocyanin concentration (mM) was calculated using
the following formula: E334 (mM) = 2.69 × OD334 (E stands for hemocyanin) [31].
Activity assay of SDH and LDH. Total proteins in gill, muscle, and hepatopancreas tissues were extracted by
the tissue homogenate method and determined for con�
centration based on the BCA method. The SDH and
LDH activities were measured using the SDH and LDH
activity assay kits (Nanjing Jiancheng Bioengineering
Institute, Nanjing, China) according to the supplier’s
instructions. Briefly, the SDH activity was measured
spectrophotometrically at 600 nm by the rate of 2,6�
dichlorophenolindophenol reduction coupled with oxi�
dation of FADH (the product of the SDH reaction).
LDH can produce reddish�brown pyruvate dinitroben�
zene hydrazine through a series of reaction, and thus the
LDH activity was determined using lactic acid and 2,4�
dinitrophenylhydrazine based on the Beer–Lambert law.
Statistical analysis. The data were statistically ana� lyzed by one�way analysis of variance (one�way ANOVA)
followed by Duncan’s multiple range tests using the SPSS
16.0 software (SPSS Inc., USA). Data are presented as
mean ± S.D; p < 0.05 is taken as statistically significant.
RESULTS
Low temperature damaged gill structure of L. van� namei. To analyze the effect of low temperature on the respiratory organ of L. vannamei, the gill structure was
observed. In the study, the shrimps moved more slowly as
the temperature decreased. The gill filaments at the nor�
mal temperature of 25°C were arranged in a neat, clear
structure, and blood cells in the hemocoel were also
observed (Fig. 1). However, after the temperature
decreased, the gill filaments swelled and were somewhat
randomly arranged. Additionally, a significant cell rup�
ture was also observed in the gill filament at low temper�
ature. The degree of damage to the gill structure was fur�
ther intensified as the temperature decreased (Fig. 1).
Low temperature affected activities of SDH and LDH and hemocyanin concentration. To analyze the changes of aerobic and anaerobic respiration in shrimp at low temper�
atures, the relative respiratory physiological indexes were
also determined. The LDH activity showed gradually
increased trend in the gill, muscle, and hepatopancreas with
temperature decrease, except for a decrease at 10°C in mus�
cle and hepatopancreas (Fig. 2A). The SDH activity gradu�
ally decreased and reached the lowest value at 10°C in gill,
muscle, and hepatopancreas (Fig. 2B). The hemocyanin
concentration in the hemolymph was measured at different
temperatures, and the results revealed that hemocyanin
gradually decreased as the temperature decreased (Fig. 3).
Sequence analysis of L. vannamei Cygb and Ngb. Cygb and Ngb participate in several processes such as
oxygen sensing and transport, ROS scavenging, etc.
However, there are few studies on Cygb and Ngb in
shrimp. Therefore, the cDNA sequences of the two genes
were determined in this study. The full�length cDNA of
Cygb consisted of 1059 bp (GenBank accession number
KX839668) including a 173�bp 5′�UTR, a 313�bp 3′�
Fig. 2. Effect of temperature on SDH (A) and LDH (B) activities of L. vannamei. Different letters indicate significant differences at
level p < 0.05.
4000
3000
2000
1000
Gill Muscle Hepatopancreas
ab
S D
H a
c ti
vi ty
, U
/g p
ro te
in
60
40
20
0
Gill Muscle Hepatopancreas
A
ab
b b
b
b b
a
a a
a
a
a
a
a
ab bc
bc ac
c
c
c
b
b
25 °С 20 °С 15 °С 10 °С
0
L D
H a
c ti
vi ty
, U
/g p
ro te
in
B
848 MENG WU et al.
BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017
UTR with a polyA signal sequence, and a 573�bp open
reading frame (ORF). The predicted protein consisted of
190 a.a. with molecular weight of 21.2 kDa and predicted
isoelectric point of 5.57. We attempted to obtain the 5′� UTR and partial coding sequences of Ngb, but failed; so,
only the partial cDNA sequence (892 bp, GenBank
accession number KX839669) was obtained, including a
528�bp coding sequence and a 364�bp 3′�UTR. Multiple sequence alignment of Ngb and Cygb amino acid
sequences of L. vannamei with other species revealed the
presence of a shared globin superfamily domain.
The phylogenetic tree with the amino acid sequences
of Mb, Cygb, and Ngb (three members of the globin fam�
ily) was constructed. The result showed that the three glo�
bins generally fell into three distinct clades, where Mb
and Cygb were first clustered into one branch, and then
clustered with Ngb.
Effect of low temperature on L. vannamei Cygb and Ngb expression. To analyze the effect of low temperature on L. vannamei Cygb and Ngb expression, qRT�PCR was
performed. The Cygb and Ngb genes were constitutively
expressed in the detected tissues of L. vannamei at the
normal temperature of 25°C. The Cygb mRNA expression
gradually increased with temperature decrease from 25 to
15°C and then decreased at 10°C in muscle, brain, stom�
ach, and heart. In the gill, the expression gradually
increased, but in the hepatopancreas there was no signif�
icant change with decrease in temperature (Fig. 4A). The
Ngb mRNA level showed a similar expression trend with
Cygb expression in muscle, brain, stomach, and heart. In
the hepatopancreas and gill, the Ngb expression increased
at 20°C, decreased to the lowest level at 15°C, and then
increased at 10°C (Fig. 4B).
DISCUSSION
Temperature is one of the most important environ�
mental factors, and its change has striking effects on
many physiological processes in aquatic organisms. For
example, temperature stress can induce ROS and signifi�
cantly influence metabolism, growth, and survival [32,
33]. Our study investigated the physiological and molec�
ular responses to low temperature in L. vannamei.
Low temperature influenced gill structure in L. van� namei. The gill is a multifunctional organ involved in a wide variety of physiological functions, including oxygen
uptake, carbon dioxide release, osmoregulation, nitrogen
excretion, hormone metabolism, etc. [34]. It has been
revealed that when the temperature is changed, the gills
show uneven arrangement, hyperplasia, and hypertrophy
[35]. In this study, low temperature caused swelling and
malalignment of the gills. Additionally, the hemolymph
cells in the gill hemocoel also swelled and were even bro�
ken. This phenomenon became more and more serious
with the decrease in temperature. It was suggested that
the damage of gill structure and the rupture of
hemolymph cells probably affected oxygen uptake in the
gill, which was similar with the previous studies that the
gill tissue of Penaeus japonicus can be destroyed and the
hemolymph function for oxygen transportation reduced
after ammonia�N stress [36].
Low temperature induces transition of aerobic respi� ration to anaerobic. SDH is an important enzyme in aer� obic metabolism and is involved in both the citric acid
cycle and the respiratory electron transfer chain [37]. Its
activity can roughly reflect the level of aerobic metabo�
lism [38]. LDH can catalyze the conversion of pyruvate
and lactic acid and is regarded as a marker of anaerobic
metabolism [39]. Our results showed an increasing trend
for LDH activities but decrease for SDH activities with
decrease in temperature, indicating that aerobic metabo�
lism of L. vannamei was probably weakened instead of the
enhancement of anaerobic metabolism. Similarly, hypox�
ia can result in downregulation of aerobic metabolism
[40]. Low temperature and hypoxia at high altitude also
leads to decrease in LDH and increase in SDH [24, 41].
On the other hand, in our study the hemocyanin content
was gradually reduced as the temperature decreased,
which was similar with a previous study in shrimp [11].
Hemocyanin, a respiratory protein, is a major protein
component of shrimp hemolymph, c.a. from 50 to >90% [42], and plays an important role in binding and trans�
porting O2 and CO2 [43]. Therefore, its decrease may
indicate a decrease in oxygen uptake in shrimp.
Combined with these results, it is reasonable to presume
that the changes in LDH and SDH were caused by respi�
ratory disorder under low�temperature conditions.
Low temperature affected the expression of Cygb and Ngb. Globins usually bind an oxygen molecule between the iron ion of the porphyrin ring and a histidine of the
Fig. 3. Effect of temperature on hemocyanin concentrations of L. vannamei. Different letters indicate significant differences at level
p < 0.05.
ab H
e m
o c
ya n
in c
o n
c e
n tr
a ti
o n
, m
M /L
0.6
0.4
0.2
0
b
a
c
25 °С 20 °С 15 °С 10 °С
RESPONSES OF Litopenaeus vannamei TO LOW TEMPERATURE 849
BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017
polypeptide chain. Crystal structures suggest that these
globins are heme�containing proteins [18, 44]. To analyze
the effect of temperature on globin expression, here two
members, Cygb and Ngb, were obtained from L. van�
namei. The multiple alignments indicated that Cygb was
evolutionarily non�conserved in crustaceans due to only
62% of even with C. destructor. The phylogenetic tree
showed that Cygb was first clustered with Mb and then
into a large branch with Ngb, indicating that Cygb and
Mb have a closer evolutionary relationship and separated
from each other more than 450 million years ago [45].
Furthermore, Cygb and Mb shared several key amino
acid residues that are important for the structure and
function of all hemoproteins [19, 46].
Cygb and Ngb participate in several processes such
as oxygen sensing and transport and ROS scavenging [16,
47]. In this study, the expression of Cygb and Ngb roughly
increased in muscle, brain, stomach, heart, and gill in
response to low temperature, which was similar with pre�
vious studies indicating that some environment factors
such as hypoxia and oxidative stress induce upregulated
expression of globins including Cygb, Ngb, and Mb [17,
48�50]. Therefore, a similar potential function of Cygb
and Ngb in protecting shrimp from hypoxia injury caused
by respiratory disorder was also conceivable for L. van�
namei under low temperature stress. The expression levels
in most tissues including muscle, brain, stomach, and
heart decreased at 10°C as a result of the organism’s adap�
Fig. 4. Expression patterns of Cygb (A) and Ngb (B) in different tissues of L. vannamei at different temperatures determined using qRT�PCR. Different letters above bars represent significant difference among different groups with different temperatures in the same tissue (p < 0.05), and the same letters above bars indicate no significant difference.
GillMuscle Hepatopancreas
ab
T h
e r
e la
ti ve
e xp
re s
s io
n o
f C
yg b
64
32
16
8
A
ab bb
b b
b
a
a
b a
a
a
a
a
ab
bc
ccc b
b
25 °С 20 °С 15 °С 10 °С
B
b b b
b
b
b
b
b
b
b
a
a
Brain Stomach Heart
4
2
1
0.5
0.25
0.125
b b
bab
b c
c
b
a
a
cd
b
cb
GillMuscle HepatopancreasBrain Stomach Heart
T h
e r
e la
ti ve
e xp
re s
s io
n o
f N
g b
32
16
8
4
2
1
0.5
0.25
a
850 MENG WU et al.
BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017
tation. The expression in the gill was still increasing at
10°C, which may be due to direct low temperature stress.
There was no significant change in the expression of Cygb
in hepatopancreas, which may be caused by the coopera�
tion of oxygen and ROS content in the organism, but the
mechanisms are still unclear.
In summary, low temperature damaged gill tissue,
which affects the transport of oxygen, resulting in changes
of respiratory related physiological indexes and the corre�
sponding regulation of globin genes. These results will
contribute to provide a reference for systematic under�
standing of the response mechanism of shrimp respiration
at low temperature.
Acknowledgments
This study was supported by the open fund of
Guangxi Key Laboratory of Aquatic Genetic Breeding
and Healthy Aquaculture.
REFERENCES
1. Weber, R. E., and Vinogradov, S. N. (2001) Nonvertebrate
hemoglobins: functions and molecular adaptations,
Physiol. Rev., 81, 569�628. 2. Brunori, M. (2001) Nitric oxide, cytochrome c oxidase and
myoglobin, Trends Biochem. Sci., 26, 21�23. 3. Bunn, H. F. (1981) Evolution of mammalian hemoglobin
function, Blood, 58, 189�197. 4. Decker, H., and Jaenicke, E. (2004) Recent findings on
phenoloxidase activity and antimicrobial activity of hemo�
cyanins, Dev. Comp. Immunol., 28, 673�687. 5. Pick, C., Hagner�Holler, S., and Burmester, T. (2008)
Molecular characterization of hemocyanin and hexamerin
from the firebrat Thermobia domestica (Zygentoma), Insect
Biochem. Molec., 38, 977�983. 6. Pan, J. Y., Zhang, Y. L., Wang, S. Y., and Peng, X. X. (2008)
Dodecamer is required for agglutination of Litopenaeus
vannamei hemocyanin with bacterial cells and red blood
cells, Mar. Biotechnol., 10, 645�652. 7. Glazer, L., Tom, M., Weil, S., Roth, Z., Khalaila, I.,
Mittelman, B., and Sagi, A. (2013) Hemocyanin with phe�
noloxidase activity in the chitin matrix of the crayfish gas�
trolith, J. Exp. Biol., 216, 1898�1904. 8. Jaenicke, E., Föll, R., and Decker, H. (1999) Spider hemo�
cyanin binds ecdysone and 20�OH�ecdysone, J. Biol.
Chem., 274, 34267�34271. 9. Paul, R., and Pirow, R. (1998) The physiological signifi�
cance of respiratory proteins in invertebrates, Zoology, 100, 298�306.
10. Zielinski, S., Sartoris, F. J., and Pörtner, H. O. (2001)
Temperature effects on hemocyanin oxygen binding in an
Antarctic cephalopod, Biol. Bull., 200, 67�76. 11. Fan, L., Wang, A., and Wu, Y. (2013) Comparative pro�
teomic identification of the hemocyte response to cold
stress in white shrimp, Litopenaeus vannamei, J. Proteomics,
80, 196�206.
12. Vinogradov, S. N., Hoogewijs, D., Bailly, X., Arredondo�
Peter, R., Gough, J., Dewilde, S., Moens, L., and
Vanfleteren, J. R. (2006) A phylogenomic profile of globins,
BMC Evol. Biol., 6, 31. 13. Bjørlykke, G. A., Kvamme, B. O., Slinde, E., and Raae, A.
J. (2012) Cloning, expression and purification of Atlantic
salmon (Salmo salar L.) neuroglobin, Protein Expres. Purif.,
86, 151�156. 14. Zhu, Y., Sun, Y., Jin, K., and Greenberg, D. A. (2002)
Hemin induces neuroglobin expression in neural cells,
Blood, 100, 2494�2498. 15. Burmester, T., and Hankeln, T. (2004) Neuroglobin: a respi�
ratory protein of the nervous system, Physiology, 19, 110�113. 16. Pesce, A., Bolognesi, M., Bocedi, A., Ascenzi, P., Dewilde,
S., Moens, L., and Burmester, T. (2002) Neuroglobin and
cytoglobin, EMBO Rep., 3, 1146�1151. 17. Fordel, E., Geuens, E., Dewilde, S., Rottiers, P.,
Carmeliet, P., Grooten, J., and Moens, L. (2004)
Cytoglobin expression is upregulated in all tissues upon
hypoxia: an in vitro and in vivo study by quantitative real�
time PCR, Biochem. Biophys. Res. Commun., 319, 342�348. 18. Sanctis, D., Dewilde, S., Pesce, A., Moens, L., Ascenzi, P.,
Hankeln, T., Burmester, T., and Bolognesi, M. (2004)
Crystal structure of cytoglobin: the fourth globin type dis�
covered in man displays heme hexa�coordination, J. Mol.
Biol., 336, 917�927. 19. Schmidt, M., Gerlach, F., Avivi, A., Laufs, T., Wystub, S.,
Simpson, J. C., Nevo, E., Saaler�Reinhardt, S., Reuss, S.,
and Burmester, T. (2004) Cytoglobin is a respiratory protein
in connective tissue and neurons, which is up�regulated by
hypoxia, J. Biol. Chem., 279, 8063�8069. 20. Hankeln, T., Ebner, B., Fuchs, C., Gerlach, F.,
Haberkamp, M., Laufs, T. L., Roesner, A., Schmidt, M.,
Weich, B., and Wystub, S. (2005) Neuroglobin and cyto�
globin in search of their role in the vertebrate globin family,
J. Inorg. Biochem., 99, 110�119. 21. Fago, A., Hundahl, C., Dewilde, S., Gilany, K., Moens, L.,
and Weber, R. E. (2004) Allosteric regulation and tempera�
ture dependence of oxygen binding in human neuroglobin
and cytoglobin – molecular mechanisms and physiological
significance, J. Biol. Chem., 279, 44417�44426. 22. Menz, A., and Bowers, A. B. (1980) Bionomics of Penaeus
vannamei Boone and Penaeus stylirostris Stimpson in a
lagoon on the Mexican Pacific Coast, Estuar. Coast. Shelf,
10, 685�697. 23. FAO Year Book: Fishery and Aquaculture Statistics (2016)
FAO, Rome.
24. He, J., Xiu, M., Tang, X., Yue, F., Wang, N., Yang, S., and
Chen, Q. (2013) The different mechanisms of hypoxic
acclimatization and adaptation in lizard Phrynocephalus
vlangalii living on Qinghai�Tibet plateau, J. Exp. Zool. Part
A, 319, 117�123. 25. Qiu, J., Wang, W. N., Wang, L. J., Liu, Y. F., and Wang, A. L.
(2011) Oxidative stress, DNA damage and osmolality in the
Pacific white shrimp Litopenaeus vannamei exposed to acute
low temperature stress, Comp. Biochem. Phys. C, 154, 36�41. 26. Wyban, J., Walsh, W. A., and Godin, D. M. (1995)
Temperature effects on growth, feeding rate and feed con�
version of the Pacific white shrimp (Penaeus vannamei),
Aquaculture, 138, 267�279. 27. Villarreal, H., and Ocampo, L. (1993) Effect of size and
temperature on the oxygen consumption of the brown
RESPONSES OF Litopenaeus vannamei TO LOW TEMPERATURE 851
BIOCHEMISTRY (Moscow) Vol. 82 No. 7 2017
shrimp Penaeus californiensis (Holmes, 1900), Comp.
Biochem. Phys. A, 106, 97�101. 28. Paz, P. E., Roy, L. A., Davis, D. A., and Quintero, H. E.
(2011) Survival of post�larval Litopenaeus vannamei follow�
ing acclimation to low salinity waters at different tempera�
tures, J. World Aquacult. Soc., 42, 575�579. 29. Chen, N., Wang, W. M., and Wang, H. L. (2016) An effi�
cient full�length cDNA amplification strategy based on
bioinformatics technology and multiplexed PCR methods,
Sci. Rep., 5, 19420. 30. Livak, K. J., and Schmittgen, T. D. (2001) Analysis of rela�
tive gene expression data using real�time quantitative PCR
and the 2 −ΔΔCT
method, Methods, 25, 402�408. 31. Nickerson, K. W., and VanHolde, K. E. (1971) A compari�
son of molluscan and arthropod hemocyanin. I. Circular
dichroism and absorption spectra, Comp. Biochem. Phys. B,
39, 855�872. 32. An, M. I., and Choi, C. Y. (2010) Activity of antioxidant
enzymes and physiological responses in ark shell,
Scapharca broughtonii, exposed to thermal and osmotic
stress: effects on hemolymph and biochemical parameters,
Comp. Biochem. Phys. B, 155, 34�42. 33. Lushchak, V. I., and Bagnyukova, T. V. (2006) Temperature
increase results in oxidative stress in goldfish tissues. 2.
Antioxidant and associated enzymes, Comp. Biochem. Phys.
C, 143, 36�41. 34. Evans, D. H., Piermarini, P. M., and Choe, K. P. (2005)
The multifunctional fish gill: dominant site of gas
exchange, osmoregulation, acid�base regulation, and
excretion of nitrogenous waste, Physiol. Rev., 85, 97�177. 35. Salazar�Lugo, R., Mata, C., Oliveros, A., Rojas, L. M.,
Lemus, M., and Rojas�Villarroel, E. (2011)
Histopathological changes in gill, liver and kidney of
neotropical fish Colossoma macropomum exposed to
paraquat at different temperatures, Environ. Toxicol. Phar.,
31, 490�495. 36. Chen, J. C., Cheng, S. Y., and Chen, C. T. (1994) Changes
of haemocyanin, protein and free amino acid levels in the
haemolymph of Penaeus japonicus exposed to ambient
ammonia, Comp. Biochem. Phys. A, 109, 339�347. 37. Rutter, J., Winge, D. R., and Schiffman, J. D. (2010)
Succinate dehydrogenase assembly, regulation and role in
human disease, Mitochondrion, 10, 393�401. 38. Simon, L. M., and Robin, E. D. (1971) Relationship of
cytochrome oxidase activity to vertebrate total and organ
oxygen consumption, Int. J. Biochem. Cell B, 2, 569�573.
39. Viru, M. (1994) Differences in effects of various training
regimens on metabolism of skeletal muscles, J. Sports Med.
Phys. Fit., 34, 217�227. 40. Hicks, J. W., and Wang, T. (2004) Hypometabolism in rep�
tiles: behavioural and physiological mechanisms that
reduce aerobic demands, Resp. Physiol. Neurobiol., 141, 261�271.
41. Punkt, K., Adams, V., Linke, A., and Welt, K. (1997) The
correlation of cytophotometrically and biochemically
measured enzyme activities: changes in the myocardium
of diabetic and hypoxic diabetic rats, with and without
Ginkgo biloba extract treatment, Acta Histochem., 99, 291� 299.
42. Coates, C. J., Bradford, E. L., Krome, C. A., and Nairn, J.
(2012) Effect of temperature on biochemical and cellular
properties of captive Limulus polyphemus, Aquaculture, 334, 30�38.
43. Coates, C. J., and Nairn, J. (2014) Diverse immune func�
tions of hemocyanins, Dev. Comp. Immunol., 45, 43�55. 44. Sugimoto, H., Makino, M., Sawai, H., Kawada, N.,
Yoshizato, K., and Shiro, Y. (2004) Structural basis of
human cytoglobin for ligand binding, J. Mol. Biol., 339, 873�885.
45. Kugelstadt, D., Haberkam, M., Hankeln, T., and
Burmester, T. (2004) Neuroglobin, cytoglobin, and a novel,
eye�specific globin from chicken, Biochem. Biophys. Res.
Commun., 325, 719�725. 46. Garry, D. J., Kanatous, S. B., and Mammen, P. P. (2003)
Emerging roles for myoglobin in the heart, Trends
Cardiovasc. Med., 13, 111�116. 47. Fang, J., Ma, I., and Allalunis�Turner, J. (2011)
Knockdown of cytoglobin expression sensitizes human
glioma cells to radiation and oxidative stress, Radiat. Res.,
176, 198�207. 48. Fordel, E., Thijs, L., Martinet, W., Lenjou, M., Laufs, T.,
VanBockstaele, D., Moens, L., and Dewilde, S. (2006)
Neuroglobin and cytoglobin overexpression protects
human SH�SY5Y neuroblastoma cells against oxidative
stress�induced cell death, Neurosci. Lett., 410, 146�151. 49. Guo, X., Philipsen, S., and Tan�Un, K. C. (2007) Study of
the hypoxia�dependent regulation of human Cygb gene,
Biochem. Biophys. Res. Commun., 364, 145�150. 50. Tiedke, J., Cubuk, C., and Burmester, T. (2013)
Environmental acidification triggers oxidative stress and
enhances globin expression in zebrafish gills, Biochem.
Biophys. Res. Commun., 441, 624�629.
Biochemistry (00062979) is a copyright of Springer, 2017. All Rights Reserved.
-
- 2017-07-07T10:56:40+0300
- Preflight Ticket Signature
