Sensation and perception

profilemalakhassoun
Neuropsychology_Stimulating_i.pdf

‘O ut-of-body’ experiences (OBEs) are curious, usually brief sensa- tions in which a person’s con-

sciousness seems to become detached from the body and take up a remote viewing position1–3. Here we describe the repeated induction of this experience by focal electrical stimulation of the brain’s right angular gyrus in a patient who was under- going evaluation for epilepsy treatment. Stimulation at this site also elicited illusory transformations of the patient’s arm and legs (complex somatosensory responses) and whole-body displacements (vestibular responses), indicating that out-of-body experiences may reflect a failure by the brain to integrate complex somatosensory and vestibular information1–3.

Our patient was a 43-year-old, right- handed woman who had suffered from complex partial seizures for 11 years; right temporal-lobe epilepsy was implicated. As magnetic-resonance imaging did not reveal any lesion, invasive monitoring was under- taken to localize the seizure focus precisely. Subdural electrodes were implanted to record seizures, and focal electrical stimula- tion was used to identify the vital cortex4.

Figure 1 shows the results of stimulation mapping and the electrode site on the right angular gyrus where stimulation repeatedly induced OBEs, as well as vestibular and complex somatosensory responses. Map- ping of motor, somatosensory and auditory functions revealed no deviant brain pathol- ogy in this patient with respect to anatomi- cal representations of cortical functions. The epileptic focus was located more than 5 cm anterior to the stimulation site, in the medial temporal lobe; electrical stimulation of this site did not induce OBEs, and these experiences were not part of the patient’s habitual seizures.

Initial stimulations (n43; 2.0–3.0 mA) induced vestibular responses, in which the patient reported that she was “sinking into the bed” or “falling from a height”. Increas- ing the current amplitude (3.5 mA) led to an OBE (“I see myself lying in bed, from above, but I only see my legs and lower trunk”). Two further stimulations induced the same sensation, which included an instantaneous feeling of “lightness” and “floating” about two metres above the bed, close to the ceiling.

The patient was then asked to watch her (real) legs during the electrical stimulation (n42; 4.0, 4.5 mA). As before, she was lying down (upper body supported at an angle of 457, legs outstretched). This time, she reported seeing her legs “becoming shorter”.

If the patient’s legs were bent before the stimulation (907 knee angle; n42; 4.0, 5.0 mA), she reported that her legs appeared to be moving quickly towards her face, and took evasive action.

When asked to look at her outstretched arms during the electrical stimulation (n42; 4.5, 5.0 mA), the patient felt as though her left arm was shortened; the right arm was unaffected. If both arms were in the same position but bent by 907 at the elbow, she felt that her left lower arm and hand were moving towards her face (n42; 4.5, 5.0 mA). When her eyes were shut, she felt that her upper body was moving towards her legs, which were stable (n42; 4.0, 5.0 mA).

These observations indicate that OBEs and complex somatosensory illusions can be artificially induced by electrical stimula- tion of the cortex. The association of these phenomena and their anatomical selectivity suggest that they have a common origin in body-related processing1–3, an idea that is supported by the restriction of these visual experiences to the patient’s own body.

During her OBE, the patient only ‘saw’ that part of her body that she also felt was modified during her body-transformation experiences. This contrasts with the non- corporeal visual hallucinations that are commonly induced by electrical stimula- tion at the parieto-temporal junction5. As suggested by previous neurological investiga- tions on OBEs1–3 and other body-cognition disorders6–8, the angular gyrus could be a

crucial node in a larger neural circuit that mediates complex own-body perception.

Out-of-body and body-transformation experiences are transitory and may disap- pear when a person attempts to inspect the illusory body or body part1–3. Our findings suggest that changes in visual attention and/or current amplitude in the angular gyrus4,9 could bring about these phenom- enological modifications.

Although we do not fully understand the neurological mechanism that causes OBEs, our results imply that vestibular pro- cessing2 may be important. Although trans- lational vestibular responses were evoked initially without an OBE and can be pro- duced in isolation4, vestibular sensations of levitation and lightness1–3 accompanied OBEs in our patient. Also, the core region of the human vestibular cortex is situated close to the angular gyrus10. It is possible that the experience of dissociation of self from the body is a result of failure to integrate complex somatosensory and vestibular information. Olaf Blanke*†, Stéphanie Ortigue†, Theodor Landis†, Margitta Seeck* *Laboratory of Presurgical Epilepsy Evaluation, Program of Functional Neurology and Neurosurgery, University Hospitals of Geneva and Lausanne, Geneva 1211 and Lausanne 1011, Switzerland e-mail: [email protected] †Functional Brain Mapping Laboratory, Department of Neurology, Geneva University Hospital, 1211 Geneva, Switzerland

brief communications

NATURE | VOL 419 | 19 SEPTEMBER 2002 | www.nature.com/nature 269

Stimulating illusory own-body perceptions The part of the brain that can induce out-of-body experiences has been located.

Figure 1 Three-dimensional

surface reconstruction of the

right hemisphere of the

brain from magnetic-reso-

nance imaging. Subdural elec-

trodes were implanted in the

brain of an epileptic patient

undergoing presurgical evalu-

ation; the locations at which

focal electrical stimulation (ES)

evoked behavioural responses

are shown: magenta, motor;

green, somatosensory cortex;

turquoise, auditory cortex.

Yellow, site at which out-of-

body experience (OBE), body-

part illusions and vestibular

responses were induced

(arrow). Stars indicate the

epileptic focus in the medial

temporal lobe. Informed con-

sent was obtained from the patient and ES procedures conformed to the Declaration of Helsinki. Constant current (0.5–5.0 mA, 2-s train

duration) was applied at 50 Hz in a bipolar manner through adjacent contacts 4. Since undergoing a right anterior temporal lobectomy in

2000, the patient has been free of complex partial seizures.

© 2002 Nature Publishing Group

Carpediemonas membranifera, that have boundary sequences of the normal eukary- otic type, indicating that canonical introns are likely to have arisen very early in eukaryotic evolution.

Carpediemonas membranifera is a poorly studied, free-living microbial eukaryote that is considered to be a relative of Giardia on the basis of its morphology4. Using the polymerase chain reaction (PCR) with Car- pediemonas genomic DNA as template, we determined the partial sequences of two distinct carbamate kinase genes from this organism. In both genes, an insertion of 33 or 31 nucleotides interrupts the similar protein-coding sequence shared with carba- mate kinase genes from other organisms (Fig. 1a). These insertions are bounded by guanine and thymine (GT) nucleotides at the 58 end and adenine and guanine (AG) nucleotides at the 38 end, which is a charac- teristic of most of the spliceosomal introns that interrupt protein-coding genes in other eukaryotes.

We used PCR with reverse transcription to recover the messenger RNA sequence of one of the two Carpediemonas carbamate kinase genes. This sequence lacks the inser- tion, which is presumably removed (spliced) from the messenger RNA before translation. We conclude that the insertions in the Car- pediemonas carbamate kinase genes are canonical ‘GT…AG’ spliceosomal introns, albeit comparatively small ones.

To determine the evolutionary affinities of Carpediemonas, we used PCR to amplify near-complete sequences for two genes that encode cytosolic heat-shock protein 70 (Hsp70). We also sequenced a cloned Hsp70 gene from Spironucleus barkhanus, a very close relative of Giardia. Maximum likeli- hood analysis of Hsp70 proteins reveals a specific evolutionary relation between Car- pediemonas, Giardia and Spironucleus (Fig. 1b); three other molecular markers also support this relationship5.

The single intron found in a Giardia gene has a non-canonical CT dinucleotide at its 58 splicing boundary3, which could be interpreted as a ‘frozen’ primitive eukaryotic condition: canonical ‘GT…AG’

spliceosomal introns might then be a later innovation in more modern cells. Our results indicate that this is not the case, however, as canonical introns seem to be an ancestral feature of the larger evolutionary grouping that includes Giardia and Car- pediemonas. The aberrant Giardia intron probably represents a lineage-specific (or intron-specific) secondary alteration of the 58 splice boundary.

The extremely early divergence attrib- uted to Giardia is based on the absence or aberration of many typical eukaryotic features, such as mitochondria and introns, and on its arguably deep-branching posi- tion in many phylogenetic trees6–9. The grouping of Giardia with Carpediemonas (which, as well as canonical introns, has organelles that are probably derived from mitochondria4) weakens this argument for early divergence.

Irrespective of the true evolutionary position of Giardia, the only potentially ‘early’ eukaryotic group in which introns have not been found are the parabasalids, such as Trichomonas10,11. Trichomonas is already known to possess some of the cellu- lar machinery for intron splicing12, how- ever, and there is evidence to indicate that it is evolutionarily affiliated with Giardia and its relatives7,13 (and is slightly misplaced in many phylogenies, including that shown in Fig. 1b). An affiliation with Giardia implies a similar closeness to Carpediemonas, and it is likely that parabasalids have, or had, canonical introns. There is now every reason to assume that canonical introns were present in the most recent common ancestor of living eukaryotes. Alastair G. B. Simpson, Erin K. MacQuarrie, Andrew J. Roger Canadian Institute for Advanced Research, Program in Evolutionary Biology, Department of Biochemistry and Molecular Biology, Dalhousie University, Halifax, Nova Scotia B3H 4H7, Canada e-mail: [email protected]

1. Palmer, J. D. & Logsdon, J. M. Curr. Opin. Genet. Dev. 1,

470–477 (1991).

2. Logsdon, J. M. Curr. Opin. Genet. Dev. 8, 637–648 (1998).

3. Nixon, J. E. J. et al. Proc. Natl Acad. Sci. USA 99, 3701–3705

(2002).

4. Simpson, A. G. B. & Patterson, D. J. Eur. J. Protistol. 35, 353–370

(1999).

5. Simpson, A. G. B. et al. Mol. Biol. Evol. 19, 1782–1791 (2002).

6. Cavalier-Smith, T. Trends Genet. 7, 145–148 (1991).

7. Embley, T. M. & Hirt, R. P. Curr. Opin. Genet. Dev. 8, 624–629

(1998).

8. Roger, A. J. Am. Nat. 154 (suppl.), 146–163 (1999).

9. Sogin, M. L. Curr. Opin. Genet. Dev. 7, 792–799 (1997).

10. Johnson, P. J. Proc. Natl Acad. Sci. USA 99, 3359–3361 (2002).

11. Archibald, J. M., O’Kelly, C. J. & Doolittle, W. F. Mol. Biol. Evol.

19, 422–431 (2002).

12. Fast, N. M., Logsdon, J. M. & Doolittle, W. F. Mol. Biochem.

Parasitol. 99, 514–522 (1999).

13. Dacks, J. B. & Roger, A. J. J. Mol. Evol. 48, 779–783 (1999).

Competing financial interests: declared none.

270 NATURE | VOL 419 | 19 SEPTEMBER 2002 | www.nature.com/nature

Eukaryotic evolution

Early origin of canonical introns

S pliceosomal introns, one of the hall- marks of eukaryotic genomes, were thought to have originated late in evo-

lution1,2 and were assumed not to exist in eukaryotes that diverged early — until the discovery of a single intron with an aberrant splice boundary in the primitive ‘protozoan’ Giardia3. Here we describe introns from a close relative of Giardia,

brief communications

Giardia Spironucleus

Alveolates

Stramenopiles

Plants + green algae

Nucleomorphs Kinetoplastids Entamoeba

Animals

Fungi Cryptomonad

Slime mould

Trichomonas

61/71

Carpediemonas 2

BiP (outgroup)

CT...AG

GT...AG

Origin of canonical

introns

???? 49/87

Carpediemonas 1

TAT A TCGTGAAAACGGCATTGCCCTTCTTATCT TC GGA

TTC A ACGTACCAACACTATT--CTTCCTTATCC TC GGC

G

G

F

Y I

I

AG

AG

GT

GT

a

b

Figure 1 Introns and evolutionary affinities of Carpediemonas. a,

Portions of two Carpediemonas carbamate kinase genes, showing

intron sequences (red) interrupting the protein-coding sequence

(in blue). The introns have canonical splice boundaries (GT…AG;

large red type). b, Maximum-likelihood evolutionary tree of

eukaryotic cytosolic Hsp70 proteins (‘G&invariable sites’ model).

Endoplasmic-reticulum Hsp70 (‘BiP’) is used as an outgroup. The

grouping of Carpediemonas with Giardia and Spironucleus is

shown in the blue box; statistical support (bootstrap percentages)

for this grouping is assessed using likelihood (upper left of box),

and likelihood distance (lower left). The higher percentages (right

in each pair) apply when the outgroup is omitted. The basal place-

ment of Trichomonas is weakly supported with likelihood (21%);

green arrow shows a more plausible position on the basis of other

evidence7,13. The intron splice boundaries for the relevant groups

and the origin of canonical introns are shown in red. New

sequences have been deposited at GenBank under accession

numbers AY131204–AY131209.

brief communications is intended to provide a forum for both brief, topical reports of general scientific interest and technical discussion of recently published material of particular interest to non-specialist readers. Priority will be given to contributions that have fewer than 500 words, 10 references and only one figure. Detailed guidelines are available on Nature’s website (www.nature.com) or on request from [email protected]

1. Brugger, P., Regard, M. & Landis, T. Cogn. Neuropsychiatr. 2,

19–38 (1997).

2. Grüsser, O. J. & Landis, T. Visual Agnosias and Other

Disturbances of Visual Perception and Cognition 297–303

(Macmillan, Amsterdam, 1991).

3. Hécaen, H. & Ajuriaguerra, J. Méconnaissances et Hallucinations

Corporelles 310–343 (Masson, Paris, 1952).

4. Blanke, O., Perrig, S., Thut, G., Landis, T. & Seeck, M. J. Neurol.

Neurosurg. Psychiatr. 69, 553–556 (2000).

5. Penfield, W. & Perot, P. Brain 86, 595–696 (1963).

6. Damasio, A. The Feeling of What Happens: Body, Emotions and

the Making of Consciousness 213–215 (Vintage, London, 2000).

7. Worthington, A. & Beevers, L. Neurocase 2, 135–140 (1996).

8. Halligan, P. W., Marshall, J. C. & Wade, D. T. Cortex 31, 173–182

(1995).

9. Nathan, S. S., Sinha, S. R., Gordon, B., Lesser, R. P. & Thakor,

N. V. Electroencephalogr. Clin. Neurophysiol. 86, 183–192 (1993).

10. Lobel, E., Kleine, J., Leroy-Wilig, A., Le Bihan, D. & Berthoz, A.

J. Neurophysiol. 80, 2699–2709 (1998).

Competing financial interests: declared none.

© 2002 Nature Publishing Group

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.