Summarize cluster analysis, the different types of clusters and techniques.
' ' I '
__ ,_· .... ~::--
PANG-NING TAN Michigan State University
MICHAEL STEINBACH Un iversity of Minnesota
VIPIN KUMAR Univers i ty of Minnesota
and Army High Performanc e
Comput i ng Research Center
~ TT
• . Boston S;m Fr.mcisco New York Londo n Toronto Sydney Tokyo Singapore Madrid
Mexico Cicy Munich Paris Cape Town Hong Kong Montreal
Contents
Preface vii
1 Introduction 1 1.1 What Is Data Mining? . . . . . . . . . . . . . . . . . . . . . . . 2 1.2 Motivating Challenges . . . . . . . . . . . . . . . . . . . . . . . 4 1.3 The Origins of Data Mining . . . . . . . . . . . . . . . . . . . . 6 1.4 Data Mining Tasks . . . . . . . . . . . . . . . . . . . . . . . . . 7 1.5 Scope and Organization of the Book . . . . . . . . . . . . . . . 11 1.6 Bibliographic Notes . . . . . . . . . . . . . . . . . . . . . . . . . 13 1.7 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 16
2 Data 19 2.1 Types of Data . . . . . . . . . . . . . . . . . . . . . . . . . . . . 22
2.1.1 Attributes and Measurement . . . . . . . . . . . . . . . 23 2.1.2 Types of Data Sets . . . . . . . . . . . . . . . . . . . . . 29
2.2 Data Quality . . . . . . . . . . . . . . . . . . . . . . . . . . . . 36 2.2.1 Measurement and Data Collection Issues . . . . . . . . . 37 2.2.2 Issues Related to Applications . . . . . . . . . . . . . . 43
2.3 Data Preprocessing . . . . . . . . . . . . . . . . . . . . . . . . . 44 2.3.1 Aggregation . . . . . . . . . . . . . . . . . . . . . . . . . 45 2.3.2 Sampling . . . . . . . . . . . . . . . . . . . . . . . . . . 47 2.3.3 Dimensionality Reduction . . . . . . . . . . . . . . . . . 50 2.3.4 Feature Subset Selection . . . . . . . . . . . . . . . . . . 52 2.3.5 Feature Creation . . . . . . . . . . . . . . . . . . . . . . 55 2.3.6 Discretization and Binarization . . . . . . . . . . . . . . 57 2.3.7 Variable Transformation . . . . . . . . . . . . . . . . . . 63
2.4 Measures of Similarity and Dissimilarity . . . . . . . . . . . . . 65 2.4.1 Basics . . . . . . . . . . . . . . . . . . . . . . . . . . . . 66 2.4.2 Similarity and Dissimilarity between Simple Attributes . 67 2.4.3 Dissimilarities between Data Objects . . . . . . . . . . . 69 2.4.4 Similarities between Data Objects . . . . . . . . . . . . 72
xiv Contents
2.4.5 Examples of Proximity Measures . . . . . . . . . . . . . 73 2.4.6 Issues in Proximity Calculation . . . . . . . . . . . . . . 80 2.4.7 Selecting the Right Proximity Measure . . . . . . . . . . 83
2.5 Bibliographic Notes . . . . . . . . . . . . . . . . . . . . . . . . . 84 2.6 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 88
3 Exploring Data 97 3.1 The Iris Data Set . . . . . . . . . . . . . . . . . . . . . . . . . . 98 3.2 Summary Statistics . . . . . . . . . . . . . . . . . . . . . . . . . 98
3.2.1 Frequencies and the Mode . . . . . . . . . . . . . . . . . 99 3.2.2 Percentiles . . . . . . . . . . . . . . . . . . . . . . . . . 100 3.2.3 Measures of Location: Mean and Median . . . . . . . . 101 3.2.4 Measures of Spread: Range and Variance . . . . . . . . 102 3.2.5 Multivariate Summary Statistics . . . . . . . . . . . . . 104 3.2.6 Other Ways to Summarize the Data . . . . . . . . . . . 105
3.3 Visualization . . . . . . . . . . . . . . . . . . . . . . . . . . . . 105 3.3.1 Motivations for Visualization . . . . . . . . . . . . . . . 105 3.3.2 General Concepts . . . . . . . . . . . . . . . . . . . . . . 106 3.3.3 Techniques . . . . . . . . . . . . . . . . . . . . . . . . . 110 3.3.4 Visualizing Higher-Dimensional Data . . . . . . . . . . . 124 3.3.5 Do’s and Don’ts . . . . . . . . . . . . . . . . . . . . . . 130
3.4 OLAP and Multidimensional Data Analysis . . . . . . . . . . . 131 3.4.1 Representing Iris Data as a Multidimensional Array . . 131 3.4.2 Multidimensional Data: The General Case . . . . . . . . 133 3.4.3 Analyzing Multidimensional Data . . . . . . . . . . . . 135 3.4.4 Final Comments on Multidimensional Data Analysis . . 139
3.5 Bibliographic Notes . . . . . . . . . . . . . . . . . . . . . . . . . 139 3.6 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 141
4 Classification: Basic Concepts, Decision Trees, and Model Evaluation 145 4.1 Preliminaries . . . . . . . . . . . . . . . . . . . . . . . . . . . . 146 4.2 General Approach to Solving a Classification Problem . . . . . 148 4.3 Decision Tree Induction . . . . . . . . . . . . . . . . . . . . . . 150
4.3.1 How a Decision Tree Works . . . . . . . . . . . . . . . . 150 4.3.2 How to Build a Decision Tree . . . . . . . . . . . . . . . 151 4.3.3 Methods for Expressing Attribute Test Conditions . . . 155 4.3.4 Measures for Selecting the Best Split . . . . . . . . . . . 158 4.3.5 Algorithm for Decision Tree Induction . . . . . . . . . . 164 4.3.6 An Example: Web Robot Detection . . . . . . . . . . . 166
Contents xv
4.3.7 Characteristics of Decision Tree Induction . . . . . . . . 168 4.4 Model Overfitting . . . . . . . . . . . . . . . . . . . . . . . . . . 172
4.4.1 Overfitting Due to Presence of Noise . . . . . . . . . . . 175 4.4.2 Overfitting Due to Lack of Representative Samples . . . 177 4.4.3 Overfitting and the Multiple Comparison Procedure . . 178 4.4.4 Estimation of Generalization Errors . . . . . . . . . . . 179 4.4.5 Handling Overfitting in Decision Tree Induction . . . . 184
4.5 Evaluating the Performance of a Classifier . . . . . . . . . . . . 186 4.5.1 Holdout Method . . . . . . . . . . . . . . . . . . . . . . 186 4.5.2 Random Subsampling . . . . . . . . . . . . . . . . . . . 187 4.5.3 Cross-Validation . . . . . . . . . . . . . . . . . . . . . . 187 4.5.4 Bootstrap . . . . . . . . . . . . . . . . . . . . . . . . . . 188
4.6 Methods for Comparing Classifiers . . . . . . . . . . . . . . . . 188 4.6.1 Estimating a Confidence Interval for Accuracy . . . . . 189 4.6.2 Comparing the Performance of Two Models . . . . . . . 191 4.6.3 Comparing the Performance of Two Classifiers . . . . . 192
4.7 Bibliographic Notes . . . . . . . . . . . . . . . . . . . . . . . . . 193 4.8 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 198
5 Classification: Alternative Techniques 207 5.1 Rule-Based Classifier . . . . . . . . . . . . . . . . . . . . . . . . 207
5.1.1 How a Rule-Based Classifier Works . . . . . . . . . . . . 209 5.1.2 Rule-Ordering Schemes . . . . . . . . . . . . . . . . . . 211 5.1.3 How to Build a Rule-Based Classifier . . . . . . . . . . . 212 5.1.4 Direct Methods for Rule Extraction . . . . . . . . . . . 213 5.1.5 Indirect Methods for Rule Extraction . . . . . . . . . . 221 5.1.6 Characteristics of Rule-Based Classifiers . . . . . . . . . 223
5.2 Nearest-Neighbor classifiers . . . . . . . . . . . . . . . . . . . . 223 5.2.1 Algorithm . . . . . . . . . . . . . . . . . . . . . . . . . . 225 5.2.2 Characteristics of Nearest-Neighbor Classifiers . . . . . 226
5.3 Bayesian Classifiers . . . . . . . . . . . . . . . . . . . . . . . . . 227 5.3.1 Bayes Theorem . . . . . . . . . . . . . . . . . . . . . . . 228 5.3.2 Using the Bayes Theorem for Classification . . . . . . . 229 5.3.3 Näıve Bayes Classifier . . . . . . . . . . . . . . . . . . . 231 5.3.4 Bayes Error Rate . . . . . . . . . . . . . . . . . . . . . . 238 5.3.5 Bayesian Belief Networks . . . . . . . . . . . . . . . . . 240
5.4 Artificial Neural Network (ANN) . . . . . . . . . . . . . . . . . 246 5.4.1 Perceptron . . . . . . . . . . . . . . . . . . . . . . . . . 247 5.4.2 Multilayer Artificial Neural Network . . . . . . . . . . . 251 5.4.3 Characteristics of ANN . . . . . . . . . . . . . . . . . . 255
xvi Contents
5.5 Support Vector Machine (SVM) . . . . . . . . . . . . . . . . . . 256 5.5.1 Maximum Margin Hyperplanes . . . . . . . . . . . . . . 256 5.5.2 Linear SVM: Separable Case . . . . . . . . . . . . . . . 259 5.5.3 Linear SVM: Nonseparable Case . . . . . . . . . . . . . 266 5.5.4 Nonlinear SVM . . . . . . . . . . . . . . . . . . . . . . . 270 5.5.5 Characteristics of SVM . . . . . . . . . . . . . . . . . . 276
5.6 Ensemble Methods . . . . . . . . . . . . . . . . . . . . . . . . . 276 5.6.1 Rationale for Ensemble Method . . . . . . . . . . . . . . 277 5.6.2 Methods for Constructing an Ensemble Classifier . . . . 278 5.6.3 Bias-Variance Decomposition . . . . . . . . . . . . . . . 281 5.6.4 Bagging . . . . . . . . . . . . . . . . . . . . . . . . . . . 283 5.6.5 Boosting . . . . . . . . . . . . . . . . . . . . . . . . . . . 285 5.6.6 Random Forests . . . . . . . . . . . . . . . . . . . . . . 290 5.6.7 Empirical Comparison among Ensemble Methods . . . . 294
5.7 Class Imbalance Problem . . . . . . . . . . . . . . . . . . . . . 294 5.7.1 Alternative Metrics . . . . . . . . . . . . . . . . . . . . . 295 5.7.2 The Receiver Operating Characteristic Curve . . . . . . 298 5.7.3 Cost-Sensitive Learning . . . . . . . . . . . . . . . . . . 302 5.7.4 Sampling-Based Approaches . . . . . . . . . . . . . . . . 305
5.8 Multiclass Problem . . . . . . . . . . . . . . . . . . . . . . . . . 306 5.9 Bibliographic Notes . . . . . . . . . . . . . . . . . . . . . . . . . 309 5.10 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 315
6 Association Analysis: Basic Concepts and Algorithms 327 6.1 Problem Definition . . . . . . . . . . . . . . . . . . . . . . . . . 328 6.2 Frequent Itemset Generation . . . . . . . . . . . . . . . . . . . 332
6.2.1 The Apriori Principle . . . . . . . . . . . . . . . . . . . 333 6.2.2 Frequent Itemset Generation in the Apriori Algorithm . 335 6.2.3 Candidate Generation and Pruning . . . . . . . . . . . . 338 6.2.4 Support Counting . . . . . . . . . . . . . . . . . . . . . 342 6.2.5 Computational Complexity . . . . . . . . . . . . . . . . 345
6.3 Rule Generation . . . . . . . . . . . . . . . . . . . . . . . . . . 349 6.3.1 Confidence-Based Pruning . . . . . . . . . . . . . . . . . 350 6.3.2 Rule Generation in Apriori Algorithm . . . . . . . . . . 350 6.3.3 An Example: Congressional Voting Records . . . . . . . 352
6.4 Compact Representation of Frequent Itemsets . . . . . . . . . . 353 6.4.1 Maximal Frequent Itemsets . . . . . . . . . . . . . . . . 354 6.4.2 Closed Frequent Itemsets . . . . . . . . . . . . . . . . . 355
6.5 Alternative Methods for Generating Frequent Itemsets . . . . . 359 6.6 FP-Growth Algorithm . . . . . . . . . . . . . . . . . . . . . . . 363
Contents xvii
6.6.1 FP-Tree Representation . . . . . . . . . . . . . . . . . . 363 6.6.2 Frequent Itemset Generation in FP-Growth Algorithm . 366
6.7 Evaluation of Association Patterns . . . . . . . . . . . . . . . . 370 6.7.1 Objective Measures of Interestingness . . . . . . . . . . 371 6.7.2 Measures beyond Pairs of Binary Variables . . . . . . . 382 6.7.3 Simpson’s Paradox . . . . . . . . . . . . . . . . . . . . . 384
6.8 Effect of Skewed Support Distribution . . . . . . . . . . . . . . 386 6.9 Bibliographic Notes . . . . . . . . . . . . . . . . . . . . . . . . . 390 6.10 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 404
7 Association Analysis: Advanced Concepts 415 7.1 Handling Categorical Attributes . . . . . . . . . . . . . . . . . 415 7.2 Handling Continuous Attributes . . . . . . . . . . . . . . . . . 418
7.2.1 Discretization-Based Methods . . . . . . . . . . . . . . . 418 7.2.2 Statistics-Based Methods . . . . . . . . . . . . . . . . . 422 7.2.3 Non-discretization Methods . . . . . . . . . . . . . . . . 424
7.3 Handling a Concept Hierarchy . . . . . . . . . . . . . . . . . . 426 7.4 Sequential Patterns . . . . . . . . . . . . . . . . . . . . . . . . . 429
7.4.1 Problem Formulation . . . . . . . . . . . . . . . . . . . 429 7.4.2 Sequential Pattern Discovery . . . . . . . . . . . . . . . 431 7.4.3 Timing Constraints . . . . . . . . . . . . . . . . . . . . . 436 7.4.4 Alternative Counting Schemes . . . . . . . . . . . . . . 439
7.5 Subgraph Patterns . . . . . . . . . . . . . . . . . . . . . . . . . 442 7.5.1 Graphs and Subgraphs . . . . . . . . . . . . . . . . . . . 443 7.5.2 Frequent Subgraph Mining . . . . . . . . . . . . . . . . 444 7.5.3 Apriori-like Method . . . . . . . . . . . . . . . . . . . . 447 7.5.4 Candidate Generation . . . . . . . . . . . . . . . . . . . 448 7.5.5 Candidate Pruning . . . . . . . . . . . . . . . . . . . . . 453 7.5.6 Support Counting . . . . . . . . . . . . . . . . . . . . . 457
7.6 Infrequent Patterns . . . . . . . . . . . . . . . . . . . . . . . . . 457 7.6.1 Negative Patterns . . . . . . . . . . . . . . . . . . . . . 458 7.6.2 Negatively Correlated Patterns . . . . . . . . . . . . . . 458 7.6.3 Comparisons among Infrequent Patterns, Negative Pat-
terns, and Negatively Correlated Patterns . . . . . . . . 460 7.6.4 Techniques for Mining Interesting Infrequent Patterns . 461 7.6.5 Techniques Based on Mining Negative Patterns . . . . . 463 7.6.6 Techniques Based on Support Expectation . . . . . . . . 465
7.7 Bibliographic Notes . . . . . . . . . . . . . . . . . . . . . . . . . 469 7.8 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 473
xviii Contents
8 Cluster Analysis: Basic Concepts and Algorithms 487 8.1 Overview . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 490
8.1.1 What Is Cluster Analysis? . . . . . . . . . . . . . . . . . 490 8.1.2 Different Types of Clusterings . . . . . . . . . . . . . . . 491 8.1.3 Different Types of Clusters . . . . . . . . . . . . . . . . 493
8.2 K-means . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 496 8.2.1 The Basic K-means Algorithm . . . . . . . . . . . . . . 497 8.2.2 K-means: Additional Issues . . . . . . . . . . . . . . . . 506 8.2.3 Bisecting K-means . . . . . . . . . . . . . . . . . . . . . 508 8.2.4 K-means and Different Types of Clusters . . . . . . . . 510 8.2.5 Strengths and Weaknesses . . . . . . . . . . . . . . . . . 510 8.2.6 K-means as an Optimization Problem . . . . . . . . . . 513
8.3 Agglomerative Hierarchical Clustering . . . . . . . . . . . . . . 515 8.3.1 Basic Agglomerative Hierarchical Clustering Algorithm 516 8.3.2 Specific Techniques . . . . . . . . . . . . . . . . . . . . . 518 8.3.3 The Lance-Williams Formula for Cluster Proximity . . . 524 8.3.4 Key Issues in Hierarchical Clustering . . . . . . . . . . . 524 8.3.5 Strengths and Weaknesses . . . . . . . . . . . . . . . . . 526
8.4 DBSCAN . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 526 8.4.1 Traditional Density: Center-Based Approach . . . . . . 527 8.4.2 The DBSCAN Algorithm . . . . . . . . . . . . . . . . . 528 8.4.3 Strengths and Weaknesses . . . . . . . . . . . . . . . . . 530
8.5 Cluster Evaluation . . . . . . . . . . . . . . . . . . . . . . . . . 532 8.5.1 Overview . . . . . . . . . . . . . . . . . . . . . . . . . . 533 8.5.2 Unsupervised Cluster Evaluation Using Cohesion and
Separation . . . . . . . . . . . . . . . . . . . . . . . . . 536 8.5.3 Unsupervised Cluster Evaluation Using the Proximity
Matrix . . . . . . . . . . . . . . . . . . . . . . . . . . . . 542 8.5.4 Unsupervised Evaluation of Hierarchical Clustering . . . 544 8.5.5 Determining the Correct Number of Clusters . . . . . . 546 8.5.6 Clustering Tendency . . . . . . . . . . . . . . . . . . . . 547 8.5.7 Supervised Measures of Cluster Validity . . . . . . . . . 548 8.5.8 Assessing the Significance of Cluster Validity Measures . 553
8.6 Bibliographic Notes . . . . . . . . . . . . . . . . . . . . . . . . . 555 8.7 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 559
9 Cluster Analysis: Additional Issues and Algorithms 569 9.1 Characteristics of Data, Clusters, and Clustering Algorithms . 570
9.1.1 Example: Comparing K-means and DBSCAN . . . . . . 570 9.1.2 Data Characteristics . . . . . . . . . . . . . . . . . . . . 571
Contents xix
9.1.3 Cluster Characteristics . . . . . . . . . . . . . . . . . . . 573 9.1.4 General Characteristics of Clustering Algorithms . . . . 575
9.2 Prototype-Based Clustering . . . . . . . . . . . . . . . . . . . . 577 9.2.1 Fuzzy Clustering . . . . . . . . . . . . . . . . . . . . . . 577 9.2.2 Clustering Using Mixture Models . . . . . . . . . . . . . 583 9.2.3 Self-Organizing Maps (SOM) . . . . . . . . . . . . . . . 594
9.3 Density-Based Clustering . . . . . . . . . . . . . . . . . . . . . 600 9.3.1 Grid-Based Clustering . . . . . . . . . . . . . . . . . . . 601 9.3.2 Subspace Clustering . . . . . . . . . . . . . . . . . . . . 604 9.3.3 DENCLUE: A Kernel-Based Scheme for Density-Based
Clustering . . . . . . . . . . . . . . . . . . . . . . . . . . 608 9.4 Graph-Based Clustering . . . . . . . . . . . . . . . . . . . . . . 612
9.4.1 Sparsification . . . . . . . . . . . . . . . . . . . . . . . . 613 9.4.2 Minimum Spanning Tree (MST) Clustering . . . . . . . 614 9.4.3 OPOSSUM: Optimal Partitioning of Sparse Similarities
Using METIS . . . . . . . . . . . . . . . . . . . . . . . . 616 9.4.4 Chameleon: Hierarchical Clustering with Dynamic
Modeling . . . . . . . . . . . . . . . . . . . . . . . . . . 616 9.4.5 Shared Nearest Neighbor Similarity . . . . . . . . . . . 622 9.4.6 The Jarvis-Patrick Clustering Algorithm . . . . . . . . . 625 9.4.7 SNN Density . . . . . . . . . . . . . . . . . . . . . . . . 627 9.4.8 SNN Density-Based Clustering . . . . . . . . . . . . . . 629
9.5 Scalable Clustering Algorithms . . . . . . . . . . . . . . . . . . 630 9.5.1 Scalability: General Issues and Approaches . . . . . . . 630 9.5.2 BIRCH . . . . . . . . . . . . . . . . . . . . . . . . . . . 633 9.5.3 CURE . . . . . . . . . . . . . . . . . . . . . . . . . . . . 635
9.6 Which Clustering Algorithm? . . . . . . . . . . . . . . . . . . . 639 9.7 Bibliographic Notes . . . . . . . . . . . . . . . . . . . . . . . . . 643 9.8 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 647
10 Anomaly Detection 651 10.1 Preliminaries . . . . . . . . . . . . . . . . . . . . . . . . . . . . 653
10.1.1 Causes of Anomalies . . . . . . . . . . . . . . . . . . . . 653 10.1.2 Approaches to Anomaly Detection . . . . . . . . . . . . 654 10.1.3 The Use of Class Labels . . . . . . . . . . . . . . . . . . 655 10.1.4 Issues . . . . . . . . . . . . . . . . . . . . . . . . . . . . 656
10.2 Statistical Approaches . . . . . . . . . . . . . . . . . . . . . . . 658 10.2.1 Detecting Outliers in a Univariate Normal Distribution 659 10.2.2 Outliers in a Multivariate Normal Distribution . . . . . 661 10.2.3 A Mixture Model Approach for Anomaly Detection . . . 662
xx Contents
10.2.4 Strengths and Weaknesses . . . . . . . . . . . . . . . . . 665 10.3 Proximity-Based Outlier Detection . . . . . . . . . . . . . . . . 666
10.3.1 Strengths and Weaknesses . . . . . . . . . . . . . . . . . 666 10.4 Density-Based Outlier Detection . . . . . . . . . . . . . . . . . 668
10.4.1 Detection of Outliers Using Relative Density . . . . . . 669 10.4.2 Strengths and Weaknesses . . . . . . . . . . . . . . . . . 670
10.5 Clustering-Based Techniques . . . . . . . . . . . . . . . . . . . 671 10.5.1 Assessing the Extent to Which an Object Belongs to a
Cluster . . . . . . . . . . . . . . . . . . . . . . . . . . . 672 10.5.2 Impact of Outliers on the Initial Clustering . . . . . . . 674 10.5.3 The Number of Clusters to Use . . . . . . . . . . . . . . 674 10.5.4 Strengths and Weaknesses . . . . . . . . . . . . . . . . . 674
10.6 Bibliographic Notes . . . . . . . . . . . . . . . . . . . . . . . . . 675 10.7 Exercises . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 680
Appendix A Linear Algebra 685 A.1 Vectors . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 685
A.1.1 Definition . . . . . . . . . . . . . . . . . . . . . . . . . . 685 A.1.2 Vector Addition and Multiplication by a Scalar . . . . . 685 A.1.3 Vector Spaces . . . . . . . . . . . . . . . . . . . . . . . . 687 A.1.4 The Dot Product, Orthogonality, and Orthogonal
Projections . . . . . . . . . . . . . . . . . . . . . . . . . 688 A.1.5 Vectors and Data Analysis . . . . . . . . . . . . . . . . 690
A.2 Matrices . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 691 A.2.1 Matrices: Definitions . . . . . . . . . . . . . . . . . . . . 691 A.2.2 Matrices: Addition and Multiplication by a Scalar . . . 692 A.2.3 Matrices: Multiplication . . . . . . . . . . . . . . . . . . 693 A.2.4 Linear Transformations and Inverse Matrices . . . . . . 695 A.2.5 Eigenvalue and Singular Value Decomposition . . . . . . 697 A.2.6 Matrices and Data Analysis . . . . . . . . . . . . . . . . 699
A.3 Bibliographic Notes . . . . . . . . . . . . . . . . . . . . . . . . . 700
Appendix B Dimensionality Reduction 701 B.1 PCA and SVD . . . . . . . . . . . . . . . . . . . . . . . . . . . 701
B.1.1 Principal Components Analysis (PCA) . . . . . . . . . . 701 B.1.2 SVD . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 706
B.2 Other Dimensionality Reduction Techniques . . . . . . . . . . . 708 B.2.1 Factor Analysis . . . . . . . . . . . . . . . . . . . . . . . 708 B.2.2 Locally Linear Embedding (LLE) . . . . . . . . . . . . . 710 B.2.3 Multidimensional Scaling, FastMap, and ISOMAP . . . 712
Contents xxi
B.2.4 Common Issues . . . . . . . . . . . . . . . . . . . . . . . 715 B.3 Bibliographic Notes . . . . . . . . . . . . . . . . . . . . . . . . . 716
Appendix C Probability and Statistics 719 C.1 Probability . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 719
C.1.1 Expected Values . . . . . . . . . . . . . . . . . . . . . . 722 C.2 Statistics . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . 723
C.2.1 Point Estimation . . . . . . . . . . . . . . . . . . . . . . 724 C.2.2 Central Limit Theorem . . . . . . . . . . . . . . . . . . 724 C.2.3 Interval Estimation . . . . . . . . . . . . . . . . . . . . . 725
C.3 Hypothesis Testing . . . . . . . . . . . . . . . . . . . . . . . . . 726
Appendix D Regression 729 D.1 Preliminaries . . . . . . . . . . . . . . . . . . . . . . . . . . . . 729 D.2 Simple Linear Regression . . . . . . . . . . . . . . . . . . . . . 730
D.2.1 Least Square Method . . . . . . . . . . . . . . . . . . . 731 D.2.2 Analyzing Regression Errors . . . . . . . . . . . . . . . 733 D.2.3 Analyzing Goodness of Fit . . . . . . . . . . . . . . . . 735
D.3 Multivariate Linear Regression . . . . . . . . . . . . . . . . . . 736 D.4 Alternative Least-Square Regression Methods . . . . . . . . . . 737
Appendix E Optimization 739 E.1 Unconstrained Optimization . . . . . . . . . . . . . . . . . . . . 739
E.1.1 Numerical Methods . . . . . . . . . . . . . . . . . . . . 742 E.2 Constrained Optimization . . . . . . . . . . . . . . . . . . . . . 746
E.2.1 Equality Constraints . . . . . . . . . . . . . . . . . . . . 746 E.2.2 Inequality Constraints . . . . . . . . . . . . . . . . . . . 747
Author Index 750
Subject Index 758
Copyright Permissions 769
1
I htrod uctiori
Rapid advances in data collection and storage technology have enabled or- ganizations to accumulate vast amounts of data. However, extracting useful information has proven extremely challenging. Often, traditional data analy- sis tools and techniques cannot be used because of the massive size of a data set. Sometimes , t he non-traditional nature of the data means that tr aditional approaches cannot be applied even if the data set is rel a tive ly small. In other situations, the questions t hat need to be answered cannot be addressed using existing data anal ysis techniques, a nd thus, new me thods need to be devel- oped .
Data mining is a technology that blends traditional data analysis methods with sophisticated algor ith ms for processing large volumes of data. It has also opened up exciting opport unities for exploring and analyzing new types of data and for analyzing old types of data in new ways. In this introductory chapter, we present an overview of data mining and outline the key topics to be covered in this book. We start with a descript ion of some well-known app lications that requi re new techniques for data a nalys is.
Bus iness Point-of-sale data collection (bar code scanners, radio frequency identification (RFID), and smart card technology) have allowed retailers to collect up-to-the-minute data about customer purchases at the checkout coun- ters of their stores. Retailers can utilize this information, along with other business-critical data such as Web logs from e-commerce Web sites and cus- tomer service records from call centers, to help them better understand the needs of th eir cu stomers and make more in formed business decis ions.
Data mining tech niq ues can be used to support a wide range of business intelligence app lications such as customer profiling, targe ted marketing, work- flow management, store layou t , and fraud detection. It can also help retailers
..... -~-::....o:.·_-:---"
2 Chapter 1 Introduction
answer important busi ness questions such as "Who are the most profitable customers?" "What products can be cross-sold or up-sold?" and "What is the revenue outlook of the company for next year?" Some of these questions mo- tivated the creation of association a nalysis (Chapters 6 and 7) , a new data analysis technique.
Med icine, Science, and Eng ineering R esearchers in medicine, science, and engineering are rapidly accumulating data that is key to important new d iscoveries. For example, as an important step toward improving our under- standing of the Earth's climate system, NASA has dep loyed a series of Earth- orbiting satellites that con tinuously generate global observations of the land sur face, oceans, and atmosphere. However, because of the size and spatia- temporal nature of the data, tradit ional methods a re often not suitable for analyz ing these data sets. Techniques developed in data mining can aid Earth scientists in a nswering questions such as "What is the relationship between t he frequency and intensity of ecosystem distur bances such as drougllts and hurricanes to global warming?" "How is land surface precipit ation and temper- ature affected by ocean surface temperature?" and "How well can we predict the beginning and end of the growi ng season for a region?"
As another example, res earchers in molecular biology hope to use the large amounts of genomic data currently being gathered to better u nderstand the structure and function of genes. In the past, tradi tional methods in molecu- lar biology allowed scientists to stud y only a few genes at a time in a given experiment. Recent breakthroughs in microarray technology have enabled sci- entists to compare the behavior of thousands of genes under var ious situations. Such comparisons can help determine the function of each gene and perhaps isolate the genes responsible for certain diseases. However, the noisy a nd hi gh- dimensional natu re of data requires new types of data analysis. In ad dition to analyzing gene array data, data mining can also be used to address other im portan t biological challenges such as protein structu re prediction, multiple sequence alignm ent, the modeli ng of biochemical pathways, and phylogenetics.
1.1 What Is Data Mining?
Data mining is the process of automa tically discovering useful information in large data repositories. Data min ing techniques are deployed to scour large databases in order to find novel and useful patterns t h at might othe rwise re mai n unknow n . They also provide capabili ties to predict t.he outcome of a
1.1 What Is Data Min ing? 3
fut ure observation, such as predicting whether a newly arrived customer will spend more t han $100 at a department store.
Not all information d iscovery tasks are considered to be data mining . For example, looki ng u p ind ivid ual records using a database managemen t system or fi nding particul ar Web pages via a query to an Int ernet search engine are tasks related to the area of information r etr ieval. Although such tasks are im portant and may involve the use of the sophisticated algorithms and data st ruc t u res, t hey rely on traditio nal com puter science techni ques and obvious fe at ures of the data to create index structures for efficiently organizing and retrievi ng information. Nonetheless, d ata m ining tech niques have been used to enhance information retrieval systems.
Data M ining and Knowledge Discove ry
Data mi ning is an integral part of knowledge d iscovery in databases (KDD ), which is t he overall process of conve rt ing raw data into useful in- formati on, as show n in Figure 1.1. This process consists of a seri es of trans- formation steps, from data preprocessi ng to postprocessing of data mining results.
Input Data
Feature Selection Dimensionality Reduction Normalization Data Subse tting
Informat ion
Filtering Patterns V isualization Pattern Interpretati on
Figure 1.1. The process of knowledge discovery In databases (KDO).
The in put dat,a can be stored in a variety of formats (flat files, spread- sheets, or relational tab les) a nd may resid e in a ce ntrali zed data repository or be dist,r ibu ted ac ross multip le sites. The pu rpose of p r eprocessin g is to transform the raw in put data into an appropriate format for subsequent analys is. The steps involved in data preprocessing include fusing data from multip le sources, cleaning data to remove noise and d u plicate observations, a nd selecting records a nd features t hat are relevant to t he data mi ni ng task at ha nd. Because of the many ways data can be collected and stored, data
4 Chapter 1 Introduction
preprocessing is perhaps the most laborious and time-consuming step in the overall knowledge discovery process.
"Closing the loop" is the phrase often used to refer to t he process of in- tegrating data mining results into decision support systems. For example, in business applications, the insights offered by data mining results can be integrated with campaign management tools so that effective marketing pro- motions can be conducted a nd tested . Such integration requires a postpr o- cessing step that ensures that only valid and useful results are incorporated into the decision support system. An example of postprocessing is visualiza- tion (see Chapter 3), which allows analysts to explore the data a nd the d ata mining results from a variety of viewpoints. Statistical measures or hypoth- esis testing methods can also be applied during postprocessing to eliminate spurious data mining results.
1.2 Motiva ting C h a lle n ges
As mentioned earlier , traditional data analysis techniques have often encoun- tered practical difficult ies in meeting the challenges posed by new data sets. The following are some of the specifi c challenges that motivated the develop- ment of data mining.
Scalability Because of advances in data generation and collection, data sets with sizes of gigabytes, terabytes, or even petabytes are becoming common. lf data mining algorithms are to handle these massive data sets, then they must be scalable. Many data mining algorithms employ special search strate- gies to handle exponential search problems. Scalability may also require the implementation of novel data structures to access individual records in an ef- ficient manner. For instance, out-of-core algorithms may be necessary when processing data sets that cannot fit into main memory. Scalability can also be im proved by using sampling or developing parallel and distributed algorithms.
High D imensionality It is now common to encounter data sets with hun- dreds or thousands of attributes instead of the ha ndful common a few decades ago. In bioinformatics, progress in microarray technology has produced gene expression data involving thousands of featur es. Data sets with temporal or spatial components also tend to have hig h dimensionality. For example, consider a data set that contains measurements of temperature at various locations. If the temperature measurements are taken repeatedly for an ex- tended period, the number of dimensions (features) increases in proportion to
1 .2 Motivating Challenges 5
the number of measurements taken . Traditional data analysis techniques that were developed for low-dimensional data often do not work well for such high- dimensional data. Also, for some data analysis algorithms, the computational complexity increases rapidly as the dimensionality (the number of features) increases.
H eterogeneous and Complex Dat a Traditional data analysis methods often deal wit h data sets containing attribu tes of the same type, either contin- uous or categorical. As the ro le of data mini ng in business, science, medicine, and other fields has grown, so has the need fo r techniques that can handle heterogeneous attributes. Recent years h ave also seen the emergence of more complex data objects. Examples of such non-traditional types of data include collections of Web pages containing semi-structured text and hyperlinks; DNA data with sequential and three-dimensional structure; and climate data that consists of time series measurements {temperature, pressure, etc. ) at various locations on the Earth's surface. Techniques developed for mining such com- plex objects should take into consideration relationships in the data, such as tem poral and spatial autocorrelation, graph connecti vity, and parent-child re- lationships between the elements in semi-structured text and XML documenls.
Data Owner ship and Distribut ion Sometimes, the data needed for an analysis is not stored in one location or owned by one organization. Instead , the data is geographically distributed among resources belonging to multiple entities . This requi res the development of distributed data mining techniques. Among the key challenges faced by distributed data mining algorithms in- clude (1) how to reduce the amount of communication needed t o perform the distributed com putation, (2) how to effectively consolidate t he data minillg resu lts obtained from multiple sources, and (3) how to address data secur ity iss ues.
Non-trad itio n al Analysis The traditional statistical approach is based on a hypothesize-and-test paradigm . ln other words, a hypothesis is proposed , an experiment is designed to gather the data, and then the data is analyzed wit h respect to the hypothesis. Unfortunately, this process is extremely labor- intensive. Current data analysis tasks often require the generation and evalu- ation of thousands of hypotheses, and consequently, the development of some data mining techniques has been motivated by the desire to automate the process of hypothesis generation and evaluation. Furthermore, the data sets analyzed in data mining are typically not the result of a carefully designed
6 C hapter 1 Introduction
experiment and often represent opportunistic samples of the data, rat her than random samples. Also, t he data sets frequently involve non-traditional types of data and data distrib utions.
1.3 The Origins of Data Mining
Brought together by the goal of meeting the challenges of the previous sec- t ion, researchers from different disciplines began to focus on developing more efficient and scalable tools that could handle diverse types of data. This work, which culminated in the field of data mining, built upon the methodology and algorithms that researchers had previously used. In particular , data mining draws upon ideas, such as (1) sampling, estimation, and hypothesis testi ng from statistics and (2) search algorithms, modeling techniques, and learning theories from artificial intelligence, pattern recognition, and machine learning. Data mining has a lso been q uick to adopt ideas from other areas, including optimization, evolutionary computing, info rmat ion theory, signal processing, visualization, and info rmation retrieval.
A number of o ther areas also play key supporting roles. In particular , database systems are needed to provide support for efficient. storage, index- ing, and query processing. Techniques from high performance (parallel) com- puting are often important in add ressing the massive size of some data sets. Distributed techniques can also help address the issue of size and are essential when the data cannot be gathered in one location.
Figure 1.2 shows the relationship of data mining to other areas.
Figure 1.2. Data mining as a confluence of many discip li nes.
'*___.. _.
1.4 Data Mining Tasks 7
1.4 D ata Mining T as ks
Data mining tasks are generally divided into two major categories:
Pred ictive tasks. The objective of these tasks is to predict the val ue of a par- ticular attribute based on the values of other attributes. T he attribute to be predicted is commonly known as the target or depen dent vari- able, while the attributes used for making t he prediction are know n as the explanatory or independ ent variables .
Descr ipt ive tasks . Here, t he objective is t o derive pat terns (correlations, t rends, clusters, trajectories, and anomalies) that summarize the un- derlying relationshi ps in data. Descri ptive data mining tasks are often exploratory in nature a nd frequently require postprocessing techniques to validate and explain the results.
F igure 1.3 illustrates four of the core data mining tasks that are described in the remainder of t.his book.
• ••• • ••
••• •• • ••• •
• Dal a ltl 110 "'0 tl,\riUI Anrru..\1 DtiJ,.II('d
O..ntr!ir..IIIO ~Oomtfler
~- - 11101 ...
....... !20M ...
~ltSI( ..... ,......, lOOt "'-
~~x- ... ....... ... _ ,.. .. --
Q
Figure 1.3. Fou r of the core data mining tasks.
. .. 0
8 Chapter 1 Introduction
Predictive modeling refers to t he task of building a model for the target variable as a function of the explanatory variables. There are two types of predictive modeling tasks: classification , which is used for discrete target variables, a nd r egression, which is used for continuous target variables. For example, predicting whether a Web user will make a purchase at an online bookstore is a classification task because the target variable is binary-valued. On the other hand, forecasting the future price of a stock is a regression task because pr ice is a continuous-valued attribute. The goal of both tasks is to learn a model that minimizes the error between the predicted and true values of the target variable . Predictive modeling can be used to identify customers t hat will respond to a marketing campaign, pred ict disturbances in the Earth's ecosystem, or judge whether a patient has a particular disease based on the result s of medical tests.
Example 1.1 ( Predicting the Type of a Flower). Consider the task of predicting a species of flower based on the characteristics of the flower. In particular, consider classifying an Iris flower as to whether it belongs to one of the following three Iris species: Setosa, Versicolour, or Virginica. To per- form this task, we need a data set containing the characterist ics of various flowers of these three species. A data set with this type of information is t he well-known Iris data set from the UCI Machine Learning Reposi t ory at http://W\Iw. i cs.uci.edu/~m1earn. In addition to the species of a flower, this data set contains four other attributes: sepal width , sepal length, petal length, and petal width. (The Iris dat a set and its attributes are described further in Section 3.1.) Figure 1.4 shows a plot of petal width versus petal length for the 150 flowers in the Iris data set. P etal width is broken into the categories low, medium, and high, which correspond to the intervals [0 , 0.75) , [0.75, 1.75), [1. 75, oo), respectively. Also, petal length is broken into categories low, medium, and high, which correspond to the int ervals [0, 2.5), [2.5, 5), [5, oo), respectively. Based on these categories of petal width and length , the following rules can be derived:
Petal width low and petal length low implies Setosa. Petal width medium and petal length medium implies Versicolour. Petal width high and petal length high implies Virginica.
W hile these rules do not classify all the flowers, they do a good (but not perfect) job of classifying most of the flowers. Note that flowers from the Setosa species are well separated from the Versicolour and Virginica species with respect to petal widt h and length, but the latter two species overlap somewhat with respect to these attributes. •
2.5
2
e1.75 ~ .r::; 1.5 i5 ~ a; Qj 0..
0.75
0.5
-----==========~========
1.4 Data Mining Tasks 9
; -- - - -.--~.- .. - -- -: :. . • Setosa I ffff f f f
•• • Versicolour • Virginica ••••• . :
• . ' •t" . . ' ...
r - - - - - - - - - • - • • - - - - !~: ! - . -·~ . t _ _ +- -t_ - - -- J I f ' I • e t. f
• ••• • t• .... •...... .. . . . . . . .. ' ' ------- - - -- ---- - - - -:- ---- - -- ------- -- - - . ' '
2 ~5 3 4 5 Petal Length (em)
6
Figure 1.4. Petal width versus petal length tor 150 Iris flowers.
Association analysis is used to discover patterns that descri be strongly as- sociated features in t he data. The discovered patterns are typically represented in the form of implication rules or feature subsets. Because of the exponential size of its search space, the goal of association analysis is to extract the most interesting patterns in an efficient manner. Useful applications of association analysis include finding grou ps of genes that have related func tionality, identi- fying Web pages that are accessed together, or understandi ng the relationships between different elements of Earth's climate system.
Example 1. 2 (Market Basket Analysis) . The transactions shown in Ta- ble 1.1 illustrate point-of-sale data collected a t the checkout counters of a grocery store. Association a nalysis can be applied to find it ems that are fre- quently bought toge ther by customers. For example, we may discover t he rule {Di apers} --+ {Milk}, which suggests that customers who buy diapers also tend to buy milk. This type of rule can be used to identify potential cross-selling opportunities among related items. •
Cluster a nalysis seeks to find g roups of closely related observations so that observations that belong t o the same cluster a re more similar to each other
10 Chapter 1 Introduction
Table 1.1 . Market basket data.
Transaction ID Items 1 (Bread, Butter, Diapers, Milk} 2 {Coffee, Sugar, Cookies, Salmon} 3 {Bread, Butter, Coffee, Diapers, Milk, Eggs} 4 {Bread, Butter , Salmon, Chi cken} 5 {Eggs, Bread, Butter} 6 {Salmon, Diapers, Milk} 7 {Bread, Tea, Sugar, Eggs} 8 {Cof fee, Sugar, Chicken, Eggs} 9 {Bread, Diapers, Milk, Salt}
10 {Tea, Eggs , Cookies, Diapers, Milk}
than observations that belong to other clusters. Clustering has been used t o gro up sets of related customers, find areas of the ocean that have a significant impact on the Earth's climate, and compress data.
Example 1.3 ( D ocu ment C lustering). The collection of news a rticles shown in Table 1.2 can be grouped based on their respective topics. Each article is represented as a set of word-frequency pairs (w, c), where w is a word and c is the number of times the word appears in the article. There are two natural clusters in the data set. The first cluster consists of the first four ar- ticles, which correspond to news about t he economy, while the second cluster contains the last four articles, which correspond to news about health care. A good clustering algorithm should be able to identify these two clusters based on the similarity between words that appear in t he articles.
Table 1.2. Collection of news articles.
Article Words 1 dollar: 1, industry: 4, country: 2, loan: 3, deal: 2, government: 2 2 machinery: 2, labor: 3, market: 4, industry: 2, work: 3, country: 1 3 job: 5, inAat.ion: 3, rise: 2, jobless: 2, market: 3, country: 2, index: 3 4 domestic: 3, forecast: 2, gain: 1, market: 2, sale: 3, price: 2 5 patient: 4, symptom: 2, drug: 3, health: 2, clinic: 2, doctor: 2 6 pharmaceutical: 2, company: 3, drug: 2, vaccine: 1, flu: 3 7 death: 2, cancer: 4, drug: 3, public: 4, heal th: 3, director: 2 8 medical: 2, cost: 3, increase: 2, patient: 2, health: 3, care: 1
•
1.5 Scope and Organization of the Book 11
A nomaly detection is the task of identifying observati ons whose character- istics are significantly different from the rest of the data. Such observations are known as anomalies or outliers . The goal of an anomaly detection al- gorithm is to discover the real anomalies and avoid falsely labeling normal objects as anomalous. In other words, a good anomaly detector must have a high de tection ra te and a low false alarm rate. Applications of ano maly detection include the detection of fraud, network intrusions , unusual patterns of disease, and ecosystem disturbances.
Example 1.4 (Credit Car d Fraud Det ection). A credit card company records the transactions made by every credit card holder, along with personal information such as credit limit, age, annual income, and address. Since the number of fraudulent cases is relatively small compared to the number of legitimate transactions, anomaly detection techniques can be applied to build a profile of legitimate transactions for t he users . When a. new transaction arrives, it is compared against the profile of the user. If the characteristics of the transaction are very different from the previously created profile, t hen the transac tion is flagged as potentially fraudulent. •
1.5 Scope a n d Organization of the Book
This book introduces the maj or principles and techniq ues used in data mining from an algorithmic perspective. A study of these principles and techniques is essential for developing a better understanding of how data mining technology can be applied t o various kinds of data. This book also serves as a starting point for readers who are interested in doing research in th is fi eld.
We begin t he techn ical discussion of this book with a. chapter on data. {Chapter 2), which discusses the basic types of data, datil. quality, prepro- cessing techniques, and measures of simi larity and dissimilarity. AILhough t. his material can be covered quickly, it provides an essential foundation for data analysis. Chapter 3, on data ex ploration, discusses summary st.atist.ics, visualization tech niques, and On-Line Analytical Processing (OLAP) . These techniques provide the means for quickly gaining insight into a data set.
Chapters 4 and 5 cover classification. Chapter 4 provides a foundation by discussing decision t ree classifiers and several issues t.hat are important to all classification: overfitting, performance evaluatio n, and the comparison of different classification models. Using this foundation, Chapter 5 describes a number of other important classification tech niques: r ule-based systems, nearest-neighbor classifiers, Bayesian classifiers , a rti fic ial neural networks, sup- port vector machines, and ensemble classifiers, which are collections of classi-
12 Chapter 1 Introduc t ion
fiers. The multiclass and imbalanced class problems are also discussed. These topics can be covered independently.
Association analysis is explored in Chapters 6 and 7. Chapter 6 describes the basics of association analysis: frequent itemsets, association rules, and some of the algorithms used to generate them. Specific types of frequent itemsets-maximal, closed, and hyperclique-that are important for data min- ing are also discussed, and the chapter concludes with a d iscussion of eval ua- tion measures for association analysis. Chapter 7 considers a variety of more advanced topics, including how association analysis can be applied to categor- ical and continuous data or to data that has a concept hierarchy. (A concept hierarchy is a hierarchical categorization of obj ects, e.g., store items, clothing, shoes, sneakers.) This chapter also describes how assoc1at ion analysis can be extended to find sequential patterns (patterns involving order), patterns in graphs, and negative relationships (if one item is present, then t he other is no t ).
Cluster analysis is discussed in Chapters 8 and 9. Chapter 8 first describes the different types of clusters and then presents th ree specific clustering tech- niq ues: K-means, agglomerative hierarchical cluster ing, and DBSCAN. This is followed by a discussion of techniques for validating the results of a cluster- ing algorithm. Additional clustering concepts and techniques are explored in Chapter 9, incl uding fuzzy and probabi listic clustering, Self-Organizing Maps (SOM), graph-based clustering, and density-based clustering. There is also a discussion of scalability issues a nd factors to consider when selecting a clus- t ering algorithm.
The last chapter , Chapter 10, is on anomaly detection . After some basic definitions, several different types of anomaly detect ion are considered: st a- tistical , distance-based, density- based, and clustering-based . Appendices A through E give a brief review of important topics that are used in portions of t he book: li near algeb ra, di mensionality reduction, statistics, regression , and optimization.
The subject of data mining, while relatively young compared to stat istics or machine learning, is already too large to cover in a single book . Selected references to t opics that are o nl y briefl y covered, such as data quality, a re provided in the bibliographic notes of t he appropriate chapter. References to topics not covered in this book, s uch as data mining for streams and privacy- preserving data mining, are provided in the bibliographic notes of this chapter.
1.6 Bi bliographic Notes 13
1.6 Bibliographic Notes
The topic of data mining has inspired many textbooks. Introductory text- books include those by Dunham [10), Han and Kamber [21], Hand et al. [23], a nd Roiger and Geatz [36]. Data mining books with a stronger emphasis on business applications include t he works. by Berry and Linoff [2], P yle [34], and Parr Rud [33]. Books with an emphasis on statistical learning include those by Cherkassky and Mulier [6), and Has tie et al. [24]. Some books with an emphasis on machine learning or pattern recognition are those by Dud a et al. [9], Kantardzic [25], Mitchell [31], Webb [41], and Witten and Frank [42]. There are also some more specialized books: Chakrabarti [4] (web mining), Fayyad et al. [13] (collection of early articles on data mining), Fayyad et a!. [11] (visualization), Grossman et a!. [18] (science and engineeri ng), Kargupta and Chan [26} (distributed data mining), Wang et al. [40] (bioinformatics) , and Zaki and Ho [44] (para llel data mining).
There are several conferences related to data mining. Some of t he main conferences dedicated to this field include the ACM SIGKDD lnternaLional Conference on Knowledge Discovery and Data Mining (KDD), the IEEE In- ternational Conference on Data Mining (ICDM), the SIAM International Con- ference on Data Mining (SDM), the E uropean Conference on Principles and Practice of Knowledge Discovery in Databases (PKDD), and the Pacific-Asia Conference on Knowledge Discovery and Data Mining (PAKDD). Data min- ing papers can also be found in other major conferences such as the ACM SIGMOD/PODS conference, the International Conference on Very Large Data Bases (VLDB), the Conference on Information and Know ledge Management (CIKM ), the I nternational Conference on Data Engineering (ICDE), the In- ternational Conference on Machine Learning (ICML), a nd the National Con- ference on Artificial Intelligence (AAAI).
J ournal publications on data min ing include I EEE 7ra.nsactions on Knowl- edg e and Data Engineering, Data Mining and Knowledge Discovery , Knowl- edge and Information Systems, Intelligent Data Analysis, Information Sys- tems, a nd the J ournal of Intelligent Information Systems.
There have been a number of general articles on dat a mining that define the field or its relationship to other fields, particularly statistics. Fayyad eta!. [12] describe data mining and how it fits into the total knowledge d iscovery process. Chen et al. [5) give a database perspectiv.e on data mining. Ramakrishnan and Grama [35] provide a general discussion of data mining and present several view points. Hand [22) describes how da t a mining di ffers from statistics, as does Friedman [14). Lambert [29] explores t he use of statistics for large data sets and provides some comments on the respective roles of data mining and staListics.
14 Chapter 1 Introduction
Glymour et al. [16] consider the lessons that statistics may have for data mining. Smyth et al. [38] describe how the evolution of data mining is being driven by new types of data and applications, such as those involving streams, graphs, and text. Emerging applications in data mining are considered by Han et a!. [20] and Smyth [37] describes some research challenges in data mining. A discussion of how developments in data mining research can be turned into practical tools is given by Wu et al. [43] . Data mining standards are the subject of a paper by Grossman et al. [17]. Bradley [3] discusses how data mining algorithms can be scaled to large data sets.
With the emergence of new data mining appli cations have come new chal- lenges that need to be addressed. For instance, concerns about privacy breaches as a result of data mining have escalated in recent years, particularly in ap- plication domains such as Web commerce and health care. As a result, there is growing interest in developing data mining algorithms that maintain user privacy. Developing techniques for mining encrypted or randomized data is known as privacy- preserving data m in ing. Some general references in this area include papers by Agrawal and Srikant [1], Clifton et al. [7] and Kargupta et al. [27]. Vassilios et al. [39] provide a survey.
Recent years have witnessed a growing number of applications that rapidly generate cont inuous streams of data. Examples of stream data include network traffic, multimedia streams, and stock prices. Severa l issues must be considered when mining data streams, such as the limited amount of memory available, the need for online analysis , and the change of the data over time. Data mining for stream data has become an important area in data mining. Some selected publications are Domingos and Hulten [8] (classification), Giannella et al. [15) (association analysis), Guha et al. [19] (clustering), Kifer et al. [28] (change detection), Papadimitriou et al. [32] (time series), and Law eta!. [30] (dimensionality reduction).
B ibliogr aphy [lj R. Agrawal and R. Sri kant. Privacy-preserving data mining. In Proc. of 2000 A CM-
SIGMOD Inti. Conf. on Management of Data, pages 439- 450, Dallas, Texas, 2000. ACM Press.
[2) M. J . A. Berry and G. Linoff. Da ta Mining Techniques: For Marketing, Sales, and Customer Relationship Man agement . Wiley Computer Publishing, 2nd edition, 2004.
[3j P. S. Bradley, J . Gehrke, R. Ramakrishnan, and R. Srikant. Scaling mining algorithms to large databases. Communications of the ACM, 45(8):38-43, 2002.
[4] S. Chakrabarti. Mining the Web: Discovering Knowledge from Hypertext Data. Morgan Kaufmann, San Francisco, CA, 2003.
Bibliography 15
[5) M.-S. Chen, .J. Han, and P . S. Yu. Data. Mi ning: An Overview from a Database Perspective. IEEE Transactions on /(nowledge abd Data Engineering , 8(6):865-883, 1996.
[6) V. Cherkassky and F. Mulier. Learning from Data: Concepts, Theory, and Methods. Wiley lnterscience, 1998.
[7] C. Clifton , M. Kantarcioglu, and J. Vaidya. Defin ing p ri vacy for data mining. In National Science Foundation Workshop on Next Generation Data Mining, pages 125- 133, Baltimore, MD, November 2002.
[8) P. Domingos and G. Hulten. Mining high-speed data streams. In Proc. of the 6th Jntl. Conf. on Knowledge Discovery and Data Mining, pages 71-80, Boston, Massachusetts , 2000. ACM Press.
[9] R . 0. Duda, P . E. Har t, and D. G . Sto rk . Pattern Classification. John Wiley & Sons , Inc., New York, 2nd edition, 2001.
[10) M. H. Dunham. Data Mining: Introductory and Aduanced Topics. Prentice Hall, 2002. [11] U . M. Fayyad, G. G. Grinstein, and A. W ierse, edi tors. Information Visualizatton in
Data Mining and Knowledge DiscovenJ. Morgan Kau fma nn P u blishers, San Francisco, CA, September 2001.
[12) U . M. Fayyad, G. Piatetsky-Shapiro, and P. Smyth. From Data Mining to Knowledge Discovery: An Over view. In Aduances in Knowledge Discovery and Data Mining, pages 1- 34. AAAl Press, 1996.
[13) U. M. Fayyad, G. P iat etsky-Shapiro, P. Smyth, and R . Uth urusamy, editors. Advances in K nowledge Discovery and Data Mining. AAAI /MIT Press, 1996.
[14] J. H. Friedman. Data Mi ni ng and Statistics: What's the Connection? Unpublished. www-stat.stanford.ed u/ ~jhf/ftp/dm-stat. ps, 1997.
[15) C . Giannella, J. Han, J. Pe.i, X. Yan, and P. S. Yu. Mining Frequent Patterns in Data Streams at Multip le Time GranuJarities. In H. Kargupta, A. Joshi , K. Sivaknmar, and Y. Yesba, editors, Next Generation Data Mining, pages 191 -2 12. AAAI /MIT , 2003.
[1 6] C . Glymour, D. Madigan, D. P regib on, and P. Smyth. Statistical Themes and Lessons fo r Data Mining. Data Mining and Knowledge DiscovenJ, 1(1):11-28, 1997.
[17] R. L. Grossman, M. F. Hornick , and G. Meyer. Data m ining standards initiatives. Communications of the A CM, 45(8):59-61, 2002.
[18) R. L. Grossman , C. Kamatb , P. Kegelmeyer, V. Kumar, and R . Namburu, edi tors. Data Mining for Scientific and Engineering Applications. Kluwer Academic Publishers, 2001 .
[19] S. Cuba, A. Meyerson, N. Mishra, R. Motwani, and L. O'Callagban. Clustering Data Streams: Theory and Practice. IEEE 7ransactions on Knowledge and Data Engineering, 15(3):515-528, May/ June 2003.
[20] J. Han, R. B. Altman, V. Kumar, H . Mannila, and D. Pregibon. Emerging scientific applications in data mining. Communications of the ACM, 45(8):5~-58, 2002.
{21) J. Han and M. Kamber. Data Mining: Concepts and Techniques. Morgan Kaufmann Publishers, San Francisco, 2001.
[22] D. J. Hand. Data Mining: Statistics and More? The American Statistician , 52(2): 112-118, 1998.
[23) D. J. Hand , H. Mannila, and P. Smyth. Principles of Data Mining. MIT Press, 2001. [24] T. Hastie, R. Tibshirani, and J. H. Friedman. The Elements of Statistirol Learning:
Data Mining, Inference, Prediction. Springer, New York, 2001. [25) M. K antardzic. Data Minin g: Concepts, Models, Methods, and Algorithms. Wiley-IEEE
P ress , Piscataway, NJ, 2003.
... ...,.. .. .,-. ·~sz· ····;;;:=
16 C hapter 1 Introduction
)26) H. Kargupta and P. K. Chan, editors. Aduances in DistT'ibuted and Pam/lei Knowledge DisC01Jery. AAA I Press, September 2002.
)27) H. Kargupta, S. Datta, Q. Wang, and K. Sivakumar. On the Privacy Preserving Prop- erties of Random Data Perturbation Techniques. In Proc. of the 2003 IEEE Inti. Conf. on Data Mining, pages 99- 106, Melbourne, Florida, December 2003. IEEE Computer Society.
)28) D. Kifer, S. Ben-David, and J. Gehrke. Detecting Change in Data Streams. In Proc. of the 30th VLDB Con/-, pages 180-191, Toronto, Canada, 2004. Morgan Kaufmann.
[29) D. Lambert. What Use is Statistics for Massive Data? In ACM SIGMOD Workshop on Research Issues in Data Mining and Knowledge Discouery, pages 54-62, 2000.
[30] M. H. C. Law, N. Zhang, and A. K. Jain. Nonlinear Manifold Learning for Data Streams. In Proc. of the SIAM Intl. Conf. on Data Mining, Lake Buena Vista, Florida, April 2004. SIAM.
[31) T. Mitchel l. Machine Learning. McGraw-H ill, Boston, MA, 1997 . )32) S. Papadirnitriou, A. Brockwell, and C. Faloutsos. Adaptive, unsupervised stream min-
in g. VLDB Journal, 13(3):222-239, 2004. )33) 0. Parr Rud. Data Mining Cookbook: Modeling Data for Marketing, Risk and Customer
Relationship Management. John Wiley & Sons, New York , NY, 2001. )34) D. Pyle. Business Modeling and Data Mining. Morgan Kaufmann, San Francisco, CA,
2003. )35) N. Ramakrishnan and A. Grama. Data Mining: From Serendipity to Science-Guest
Editors' Introduction. IEEE Computer, 32(8):34-37, 1999. )36) R. Reiger and M. Geatz. Data Mining: A Thtorial Based PT'imer. Addison- Wesley,
2002. )37)
)38]
)39)
)40)
!41) )42)
)43)
)44)
P. Smyth. Breaking out of the Black-Box: Research Challenges in Data Mining. In Proc. of the 2001 ACM SIGMOD Workshop on Research Issues in Data Mining and Knowledge Discoue'1/, 2001. P. Smyth, D. Pregibon, and C. Faloutsos. Data-driven evolution of data mining algo- rithms. Communications of the ACM, 45(8):33- 37, 2002. V. S. Verykios, E. Bertino, I. N. Fovino, L. P. Provenza, Y. Saygin, andY. Theodorid is. State-of-the-art in privacy preserving data mining. SIGMOD Record, 33( 1):50-57, 2004. J . T. L. Wang, M. J . Zaki, H . Toivonen, and D . E. Shasha, editors. Data Mining in Bioinforrnatics. Springer, September 2004. A. R. Webb. Statistical Pattern Recognition. J ohn Wiley & Sons, 2nd edition, 2002. I. H. Witten and E. Frank. Data Mining: Practical Machine Learning Tools and Tech- niques with Java Implementations. Morgan Kaufmann, 1999. X. Wu, P. S. Yu, and G. Piat etsky-Shapiro. Data Mining: How Research Meets Pract ical Development? Knowledge and Information Systems, 5(2):248-261, 2003. M. J . Zaki and C.-T. Ho, editors. Large-Scale Parallel Data Mining. Springer, September 2002.
1-7 Exercises
L Discuss whether or not each of the following activities is a data mining task.
-- · 1. 7 Exercises 17
(a) Dividing the customers of a company according to their geuder.
(b) Dividing t he customers of a company according to their profitability.
(c) Computing the total sales of a company.
(d) Sorting a student database based on student identification numbers.
(e) Predicting the outcomes of tossing a (fair) pair of dice.
(f) Predicting the future stock price of a company using historical records.
(g) Monitoring the hear t rate of a patient for abnormali ties.
(h ) Mon itoring seismic waves for earthqu ake activit ies.
(i) Extr ac t ing the frequencies of a sound wave.
2. Suppose that you are employed as a data m ining consultant for an l nternel search engin e co m pany. D escri be how data mining can help the company by giving specific examples of how techniques, such as cluste ring, classification, association rule mining, and anomaly detection can be applied.
3. For each of the followin g data sets, explain wh ether o r not data privacy is an important issue.
(a ) Census data collected from 1900-1950.
(b) IP addresses and visit times of Web users who visit your Website.
(c) Images from Earth-orbiting satellites.
(d) Names and addresses of people from the telephone book .
(e) Names and email addresses collected from the Web.
2
Data
This chapter discusses several data-related issues t hat are important for suc- cessful data mining:
The Type of Data Data sets differ in a num ber of ways. For example , the attributes used to describe data objects can be of different types-quanti tat ive or qualitative--and data sets may have special characteristics; e.g., some data sets contain time series or objects with explicit relationships to one another. Not su rprisingly, t he type of data determines which tools and tech niq ues can be used to analyze the data. FUrthermore, new research in data mining is often driven by t he need to accommodate new application areas and their new types of data.
The Quality of the Data Data is often far from perfect. While most data mi ning t echniques can tolerate some level of imperfection in the data, a focus on understanding and improving data quality typically improves the quality of the result ing analysis. Data quality issues that often need to be addressed include the presence of noise and outliers; missing, inconsistent , or duplicate data; and data t hat is biased or , in some other way, unrepresentative of the phenomenon or population that the data is supposed t o describe.
Prep rocessing S t e ps to M ake t h e D ata More Suita b le for Data Min- ing Often, the raw data must be processed in order to make it suitable for analysis. While one objective may be to improve data qua lity, other goals focus on modifying the data so that it better fits a speci fied data mi ning tech- nique or tool. For example, a continuous attribute, e.g., lengt h, may need to be transformed into an attribute with discrete categories, e.g., short, medium, or long, in order to apply a pa rticular technique. As a nother example, the
-.
20 Chapter 2 Data
nu mber of att ributes in a data set is often reduced because many techniques are more effective when the data has a relatively small number of attributes.
Analyzing D a t a in Terms of Its Relationships O ne approach to data a nalysis is to find relationships among the data objects and then perform the remaining analysis using these relationships rather than the data objects themselves. For instance, we can compute the similarity o r distance between pairs of objects and then perform t he analysis- clustering, classificat ion, or anomaly detection-based on t hese similarities or distances. There are many such similarity or distance measures, and t he proper choice depends on the type of data and the part icular application.
Example 2.1 {An Illustration of Data-Re lated Issues). To further il- lustrate the importance of these issues, consider the following hypothetical sit- uation. You receive an email from a medical researcher concerning a project that you are eager to work on .
Hi ,
I've attached the data file that ] mentioned in my previous email. Each line contains the informa tion for a single palient and consists of five fields. We want to pred ict the last fie ld using the other fields. I don't have time to provide any more information about the data since I'm going out of town fo r a couple of days, but hopefully that won't slow you down too much. And if you don't mind, could we meet when ] get back to discuss your preliminary results? I might invite a few other members of my team.
Thanks and see you in a couple of days.
Despite some misgivings , yo u proceed to analyze the data. The first few rows of the file are as follows :
012 232 020 121 027 165
33.5 16.9 24.0
0 10.7 2 210.1 0 427.6
A brief look at the data reveals nothing strange. You put your doub ts aside and star t the analysis. There are only 1000 lines, a smaller data file t han you had hoped for , but two days later, you feel that you have made some progress. You arrive for the meeting, and while waiting for others to arrive, you strike
21
up a conversation with a statistician who is working on the project. When she learns that you have also been analyzing the data from the project, she asks if you would mind giving her a brief overview of your res ults.
Statistician: So, you got the data for a ll the patients? Data Miner: Yes. I haven't had much time for analysis , but l
do have a few interesting resul t s. Statistician : Amazing. There were so many data issues with
this set of patients that I cou ldn't do much . Data M iner : Oh? 1 didn't hear abou t any poss ible problems. Statistician: Well, first there is field 5, the variable we want to
predict. It's common knowledge among people who analyze this type of data that results are better if you work with the log of the values, but I didn 't discover this until later. Was it mentioned to you?
Data Miner: No. Statistician: But surely you heard about what ha ppened to field
4? It 's supposed to be measu red on a scale from 1 to 10, with 0 indicating a missing value, but because of a data entry error, all 10 's were changed into O's. Unfortunately, since some of the pa t ients have missing values for this fiel d, it's impossible to say whether a 0 in this field is a real 0 or a 10. Quite a few of the records have that problem.
Data Miner: I nteres ting. Were there any other problems? Statistician : Yes, fields 2 and 3 are basically the same, buL I
assume that you probably noticed that. D ata Miner: Yes, but these fiel ds we re only weak predictors of
field 5. Stat istician: Anyway, given all those problems, I' m surprised
you were able to accomplish anyt hing. Data Miner: True, but my resul ts are really quite good. Field 1
is a very strong predictor of field 5. I'm surprised i hat this wasn't noticed before.
Statistician: What? F ield 1 is j ust an ident ificat ion num ber. D ata Miner : Nonetheless, my resul ts speak for themselves. Statistician: Oh, no! I just remembered . We assigned lD
numbers after we sorted t he records based on field 5. There is a strong connection, but it's meaningless. Sorry.
•
22 Chapter 2 Data.
Although this scenario represents an extreme situation, it emphasizes t he importance of "knowing your data." To that end, this chapter will address each of the four issues mentioned above, outlining some of the basic challenges and standard approaches.
2.1 Ty p es of Data
A data set can often be viewed as a collection of data obj ects. Other names for a data object are record, point, vector, pattern, event, case, sample, observation, or entity. In turn, data objects are described by a number of attributes that capture the basic characteristics of an object, such as the mass of a. physical object or the time at which an event occurred. Other names for an attribute are variable, characteristic, field, feature, or dimension .
Example 2.2 (Student Information). Often, a d ata set is a file, in which the objects are records (or rows) in the file and each field (or column) corre- sponds to an attribute. For example, Table 2.1 shows a data set that consists of student information. Each row correspon ds to a student and each column is an attribute that describes some as pect of a student, such as grade point average (GPA) or identification number (ID).
Table 2.1. A sample data set containing student information.
Student ID Year Grade Point Average (GPA)
1034262 1052663 1082246
Senior Sophomore Freshman
3.24 3.51 3.62
• Although record-based data sets are common, either in flat files or rela-
tional database systems, there are other important types of data sets and systems for stor ing data. In Section 2.1. 2, we will discuss some of the types of data sets that are commonly encountered in data mining. However, we first consider attributes.
2.1 Types of Data 23
2.1.1 Attributes and Measure m ent
In this section we address the issue of describing data by considering what types of attributes are used to describe data objects. We first define an at- tribute, then consider what we mean by the type of an attribute, and finally describe the typ es of attributes that are commonly encountered.
What I s an attrib ute?
We start with a more detailed definition of an attribute.
D efinition 2.1. An attribute is a. property o r charac teris tic of an object that may vary, either from one object to another or from one time to anothe r.
For example, eye color varies from person to person, while the temperature of an object varies over time . Note that eye color is a symbolic attribute with a small num ber of possible values {brown, black, bl1le, green, hazel, etc.} , while temperature is a numerical attribute with a potentially unlimited number of values.
At the most basic level, attribut es are not about nu mbers or symbols. However, to discuss and more precisely analyze the characteristics of objects, we assign numbers or symbols to them. To do this in a well-defined way, we need a measurement scale.
Definition 2.2. A m easurement scale is a. ru le (function) that associates a numerical or symbolic value with an attribute o f an object.
Formally, the process of measurement is the application of a measure- ment scale to associate a value wit h a particular attribute of a specific object . While this may seem a bit abstract, we engage in the p rocess of measure me nt all the time. For instance, we step on a bathroom scale to determine our weight, we classify someone as male or female , or we count the number of chairs in a room to see if the re will be enough to seat all the people coming to a meetin g. In all these cases, the "physical value" of an attribu te of an object is mapped to a numerical or symbolic value.
With this background, we can now discuss the type of an attribute, a concept that is impor tant in determining if a part icular data analysis technique is consistent with a specific type of attribute.
The Type of an Attribute
It should be apparent from the previous discussion t hat. the p ro perties of an attribute need not be the same as the properties of t he values used to mea-
24 Chapter 2 Data
sure it . I n ot her words, the val ues used to represent an a t t ribute may have properties that are not properties of the attribute itself, and vice versa. This is illustrated with two examples.
Example 2.3 (Employee Age a n d ID Number). Two at tributes that might be associated with an employee are ID and age {in years). Both of these attributes can be represented as integers. However, while it is reasonable to talk about the average age of an employee, it makes no sense to talk about the average employee ID . Indeed, the only aspect of employees that we want to captu re with t he ID attribute is that they are distinct. Consequently, the only valid operation for employee IDs is t o te'st whether they are equal. There is no hint of this limitation, however, when integers are used to represent the employee ID attribu te. For the age att ribute, the properties of the integers used to represent age are very much the properties of the attribute. Even so, the correspondence is not complete since, for example , ages have a maximum, while integers do not . •
Example 2.4 (Length of Line Segments ). Consider Figure 2.1 , which shows some objects-line segments-and how the length attribute of t hese objects can be mapped to numbers in two different ways. Each successive line segment, going from the top to the bottom, is formed by appending t he topmost line segment to itself. Thus, the second line segment from the top is formed by ap pending the topmost line segment to itself twice, the third line segment from the top is formed by appending the topmost line segment to itself three t imes, and so fort h. In a very real {physical) sense, all the line segments are multiples of the first. This fact is captured by the measurements on the right-hand side of the figure, but not by those on the left hand-side. More specifically, the measurement scale on the left-hand side captures only t he ordering of the length a t t ribute, while the scale on t he right-hand side captures both the ordering and additivity properties. Thus, an att ribute can be measured in a way that does not capture all the properties of the attribute. •
The type of an attribute should tell us what properties of the attribute are refl ected in t he values used to measure it. Knowing the ty pe of an attribute is impo rtant because it tells us which prope rties of the measured values are consistent with the underl ying properties of the attribute, and therefore, it allows us to avoid fo olish actions, such as computing t he average employee ID. Note that it is common to refer to the type of an attribute as the type o f a m easureme nt scale .
'. .,.._ __ ______ _
3 - ---------
7 - ---- -----
8 --------- -
10 - - --------
A mapping of lengths to numbers that captures only the order prope rties of length.
2.1 TypesofData 25
-----------..
-------- - -+ 2
__ _ _ _____ ...., 3
--------- -+
--------- -+ 5
A mapping o f lengths to numbers th at captures both the order and additivity properties otlength.
Figure 2.1. The measurement of the length of line segments on two different scales of measurement.
The Different Typ es of Attributes
A useful (and simple) way to specify the type of an a t tribute is to identify the properties of numbers that correspond to underlying properties of the attribute. For example, an attribute such as length has ma ny of the properties of numbers. I t makes sense to compare and order objects by length , as well as to talk about the differences and ratios of length. The following properties (operations) of numbers are typically used to describe attrib utes.
1. Distinctness = and #
2. Orde r <, S, >, and 2:
3. Addition + and -
4. M u ltiplication * and / Given these properties, we can define four types of attributes: nominal,
ordinal , interval , and r atio . Table 2.2 gives t he defi nitions of these types, along with information about the statistical operations t hat are valid for each type. Each attribute type possesses all of tne properties and operations of t he attri bute types above it. Consequently, any property or o peration that is valid fo r nominal, ordinal , and interval attributes is also valid for ratio attributes. In other words, the definition of the attribute types is cumulative. However,
26 C hapter 2 Data
Table 2.2. OiHe rent attribute types.
Attribute Type Description Examples Operations
Nominal The values of a nominal zip codes, mode, entropy, attribute are just different employee ID numbers, contingency names; i.e., nominal values eye color, gender correlation, provide only enough x2 test
~~ information to distinguish u ·- one object from another. ·- ~ ... ro 0 ~ (=, #) hO ·- !{ Cd
Ordinal The values of an ordinal hardness of mi nerals, median, r-e ::l 0~ attribute provide enough {good, better, best}, percentiles,
information to order grades, rank correlation, objects. str eet numbers run tests, (<, >) sign tests
Interval For interval attributes, the calendar dates, mean, ..., differences between val ues temperature in Celsius standard deviation, .:: are meaningful, i.e., a un it or Fahrenheit Pearson's
u-:;; of measurement exists. correlation, ·c ·"'= "'~ (+ , -) t and F tests >== k - ro Ratio For ratio variables, both temperature in Kelvin, geometric mean, ::l ::l za
.:::.. differences and ratios are monetary quantities, harmonic mean , meaningful. counts, age, mass, percent (*, / ) length, variation
electrical current
this does not mean t ha t the operation s appropriate for one attr ibute type are a ppropriate for the attribute types above it.
Nominal a nd ordinal attributes a r e collectively referred to as categorical or qua litati ve attributes. As the name suggests, qualitative attributes, such as employee ID, lack most of t he properties of numbers. Even if t hey are rep- resented by numbers, i.e., integers, they s hould be treated more like symbols. The remaining two types of attributes , interval a nd ratio, are collectively re- ferred to as quantitative or nume ric attributes. Quantitative attributes are represented by numbers a nd have most of t he properties of numbers. Note that. quanti t ative att ributes can be integer-valued or cont.inuous.
The types of attributes can also be d escribed in terms of transformations that do not change the meaning of a n attribute. Indeed, S. Smith Stevens, the psychologist who originally defi ned t he t yp es of attr ibutes shown in Table 2.2, defined them in terms of t hese permissible t ran sforma tions . For exam ple,
2.1 Types of Data 27
Ta ble 2.3. Transformations tha t def ine attribute levels.
Attribu t e Type TI-ansformation Comment
Nomi nal Any one-to-one mappi ng, e.g., a If all employee JD numbers are
_..., permutation of val ues reassigned, it will not make any ro > difference. u ·- Ordinal An order-preserving change of An attri bu te encompassing the ·c ~ o.,
values, i.e., notion of good, better, best can bO ·- .£~ new. value = f(old.value), be represented eq ually well by "' ::l 0~ where f is a mon otonic function. the values {1, 2, 3} or by
{0.5 , 1, 10}. ..., Interval new. value - a* old.value + b, T he Fah renheit and Celsius ~ a and b constants. temperature scales differ in the
u "' location of thei r zero value and ·-.., ~~ the size of a degree (uni t). e <== ::> ro Rat io new. value - a* old_value Le ngth can be measu red in z~ meters or feet.
the meaning of a le ng th attri bute is unchanged if it is measured in meters instead of feet.
The statistical op erations that make sense for a par ticular type of attribute a re t hose that will yield the same results when the attribute is transformed us- ing a t r a nsform ation that preserves the attribute's meaning. To ill ustrate, the ave rage length of a set of objects is differen t whe n measured in meters rather than in feet, but both averages represent the same length. Table 2.3 shows the permissible (mean ing-preserving) t ransformations for the four attribute ty pes of Table 2.2.
Example 2.5 (Temperature Sca le s ) . Temperatu re provides a good illus- tration of some of the concepts that have been described. First, temperature can be either an interval or a ratio attribute, depending on its measurement scale. \'Vhen meas ured o n the Kelv in scale, a temperature of 2° is, in a physi- cally meaningfu l way, twice that o f a te m pera ture of 1 o . This is not true when temperature is measured on either t.he Celsius or Fahrenheit scales, because, physically, a temperature of 1° Fahrenheit (Celsius) is not much diffe rent t han a temperat ure of 2° Fahren heit (Celsius) . The problem is t hat the zero points of the Fahrenheit and Celsius scales are, in a physical sense, arbitrary, and therefore, the ratio of two Celsius o r Fahrenheit temperatures is not. physi- cally meaningfu l. •
28 Chapter 2 Data
Describing Attributes by the N umber of Va lues
An independent way of distinguishing between attributes is by t he number of values t hey can take.
Discrete A discrete attri bute has a finite or count abl y infinite set of values . Such attributes can be categorical, such as zip codes or ID numbers, or numeric, such as counts. Discrete attributes are often represented using integer variables. Binary attributes are a special case of dis- crete attributes and assume only two values, e.g., true/false , yes/no, male/female, or 0/1. Binary attributes are often represented as Boolean variables, or as integer va riables that only take t he values 0 or 1.
Continuous A continuous attribute is one whose values a re real numbers. Ex- amples include attribu tes such as t emperature, height, o r weight. Con- tinuous attributes are typically represented as floating-point variables. Practically, real va lues can only be measured and represented with lim- ited precision.
l n theory, any of the meas urement scale types- nominal, ordinal, interval , and ratio-could be combined with any of the types based on the number of at- tribute values-binary, discre te, and continuous. However , some combinations occur only infrequently or do not make much sense. For instance, it is difficult to think of a realistic dat a set that contains a continuous binary attribute. Typically, nominal and ordinal attributes are binary or discrete, wh ile interval a nd ratio attributes are continuous. However , cou nt a ttributes, which are discrete, are also ratio attributes.
A sy m metric Attributes
For asymmetric attributes, only presence--a non-zero att rib ute value--is re- garded as important. Consider a data set where each object is a student and each attribute records whether or not a student took a particular course at a university. Fo r a specific student, an attribu te has a value of 1 if the stu- dent took t he course associated with that attribu te and a value of 0 otherwise. Because students take only a small fraction of a ll available courses, most of the values in such a data set would be 0. Therefore , it is more meaningful and more efficient to focus on t he non-zero values. To illustrate, if students are compared on the basis of the courses t hey don 't take, t hen most students would seem very similar, at least if the number of courses is large. Binary attributes where only non-zero val ues are important are called asymmetric
·'
2.1 Types of Data 29
binary attributes . This type of attribute is particularly important for as- sociation analysis, which is discussed in Chapter 6. It is also possible to have discrete or continuous asymmetric features. For instance, if the number of credits associated with each course is recorded, then the result ing data set will consist of asymmetric d iscr ete or cont in u o u s attributes.
2.1.2 Types of Data Sets
There are many types of data sets, and as the field of data mining develops and mat ures, a greater variety of data sets become available for analysis. Jn t his sect ion, we describe some of the most common types. For convenience, we have grou ped the types of data sets into three groups: record data, graph- based data, and ordered dat a. These cat egories do not cover all possibilities and other groupings are certainly possible.
Gener a] C h aracteristics of D ata S e t s
Before providing details of specific kinds of data sets, we discuss three char- acterist ics t hat apply to many data sets and have a significant impact on the data mining techniques that are used : dimensionality, sparsity, and resolutio n.
Dim ensiona lit y T he dimensionality of a data set is the number of attributes that the objects in the data set possess. Data with a small number of dimen- sions tends to be qualit ati vely different t han moderate or high-dimensional data. Indeed, the difficulties associated with analy zi ng hig h-dimensional data are sometimes referred to as the curse of dimensionality. Because of this, an important mo t ivation in preprocessing the data is dimensionality reduc- t ion . T hese issues are discussed in more depth later in this chapter and in Appendix B.
Sparsit y For some data sets, such as those wi th asymmetric features, most attri butes of an object have values of 0; in many cases, fewer than 1% of the entries are non-zero. I n practical terms, sparsity is an advantage because usually only the non-zero values need to be stored and manipulated . This results in significant savings wi t h respect to computation time and storage. Furthermore, some data m ining algorithms ~ork well only for sparse data.
Resolutio n l t is frequently possible to obtain da ta at different levels of reso- lut ion, and often the properties of the data are different at different resolutions. For instance, the surface of the Earth seems very uneven at a resolution of a
30 Chapter 2 Data
few meters, but is relatively smooth at a resolution of tens of kilometers. The patterns in t he data. also depend on the level of resolution. If the resolution is too fine, a pattern may not be visible or may be buried in noise; if the resolution is too coarse, the pattern may disappear. For example, variations in atmospheric pressure on a scale of hours reflect the movement of storms and other weather systems. On a scale of months, such phenomena are not detectable.
Record Data
Much data mining work assumes that the data set is a collection of records (data objects), each of which consists of a fixed set of data fields (attributes). See Figure 2.2(a) . For the most basic form of record data, there is no explicit relationship among records or data fields, and every record (object) has the same set of attributes. Record data is usually stored either in flat files or in relational databases. Relational databases are certainly more than a collection of records, but data rruning often does not use any of the additional information available in a relational database. Rather, the database serves as a convenient place to find records. Different types of record data are described below and are illustrated in Figure 2.2.
Transaction or Market B asket D ata Transaction data is a special type of record data, where each record (transaction) involves a set of items. Con- sider a grocery store. The set of products purchased by a customer during one shopping trip constitutes a transaction, while t he individual products that were purchased are the items. This type of data is called marke t basket data because t he items in each record are the products in a person's "mar- ket basket." Transaction data is a collection of sets of items, but it can be viewed as a set of records whose fields are asymmetric attributes. Most often, the attributes a re binary, indicating whether or not an item was purchased, but more generally, the attributes can be discrete or continuous, such as the number of items purchased or the amount spent on those items. Figure 2.2(b) shows a sample transaction data set,. Each row represen ts the purchases of a particular customer at a particular time.
The Data Matrix If the data objects in a collection of da ta all have the same fixed set of numeric attributes, then the data objects can be thought of as points (vectors) in a multidimensional space, where each dimension represents a distinct attribute describing the object. A set of such data objects can be interpreted as an m by n matrix, where t here are m rows, one for each object,
2. 1 Types of Data. 31
Tid Refund Marital Taxable Defaulted Status Income Borrower
1 .. Yes Si~t ~: ·· 125K "Nd ·-: 2 No Mariiea l OOK No Bread, Soda, Milk
3 No s ;ri~t ~'' ·. 70K No · 4 . Yes M~rrled 120K No 2 Beer, Bread 5 No DivorCed 95K Yes
6 No Married 60K No 3 Beer, Soda. Oiaper. Milk
7 Yes Di~orced 220K No B. No Singl.e 85K Yes
Beer, Bread, Diaper, Milk
9 No ¥arri ed 75K No
10 No ~ingle · 90K Yes 5 Soda, Diaper, Milk
(a) Record data. (b) Transaction data.
Projection cl PrDICcllon Of D1stanco l oact ThlckMSS •Load v load
10.23 5.27 15.22 27 1.2
12.65 6.25 16.22 22 1.1
13.54 7.23 17.34 23 1.2
14.27 8 .43 18.45 25 0.9
(c) Data matrix. (d) Document-term matrix.
Figure 2.2. DiHerent variations of record data.
and n columns, one for each attribute. (A representation t hat has data objects as columns and attributes as rows is also fine.) This matrix is called a data matrix or a pattern matrix. A data matrix is a variation of record dat a, but because it consists of nu meric attributes, standard matrix operation can be applied to transform and manipulate t he data. Therefore, the data matrix is the standard data for mat for most statistical data. F igure 2.2(c) shows a sample data matrix.
The Sparse D ata Matrix A sparse data matrix is a special case of a data matrix in which the attributes are of the same type and are asymmetric; i.e., only non-zero values are important. 'fransaction dat a is an example of a sparse data matrix that has only 0-1 entries. Another common exam ple is document data. In particular, if the order of the terms (words) in a document is ignored ,
32 Chapter 2 Data
then a document can be represented as a term vector , where each term is a component (attribute) of the vector and the value of each component is the number of times the corresponding term occurs in t he document. This representation of a collection of documents is often called a document-te rm matrix. Figure 2.2(d) shows a sample document-term matrix. The documents are the rows of this matrix, while the terms are the columns. In practice, only the non-zero entries of sparse data matrices are stored.
Graph-Base d Data
A graph can sometimes be a convenient and powerful representation for dat a. We consider two specific cases: (1) t he graph captures relationships among dat a objects and (2) the data objects themselves are represented as graphs.
Data with Relationships among Objects The relationships among ob- jects freq uently convey important information. In such cases, the data is often represented as a graph . In particular, the data objects are mapped t o nodes of the graph , while the relationships among objects are captured by the links between objects and link properties, such as direction and weight . Consider Web pages on the World Wide Web, which contain both text and links to other pages. I n order to process search queries, Web search engines collect and process Web pages to extract their contents. It is well known, however, that the links to and from each page provide a great deal of information about the relevance of a Web page to a query, and thus, must also be taken into consideration. F igure 2.3(a) shows a set of linked Web pages.
Data with Objects That Are Graphs If objects have structure, that is, the objects contain subobjects that have relationships, then such obj ects are frequ ently represented as graphs. For example, the structure of chemical compounds can be represented by a graph, where the nodes are atoms and the links between nodes are chemical bonds. Figure 2.3(b) shows a ball-and-stick diagram of the chemical compound benzene, which contains atoms of carbon (black} and hydrogen (gray) . A graph representation makes it possible t o determine which substructures occur frequently in a set of compounds and to ascertain whether the presence of any of these substructures is associated with the presence or absence of certain chemical properties, such as melting point or heat of formation . Substructure mining, which is a branch of data mining that analyzes such data, is considered in Section 7.5.
Useful links:
- ----1+
u.- ,.,., .. Ori&O') l'i-.q..~ ..... as.,._.,.._,....._,. .,.,~-~JC~-0.. .._,.. .. MAJ~WITPftM. IM
' a-..Qo; ...... ·c•.);....,.,_,.w~ l&MIIAf", JroWffM it.f_..a~l"). IW~Ct~Mllctf)...., C'ioollllon U..O. ·o-. lrol ;.l"f lct~tF(.rMit\.etR.I. s.la.IOidc-t S~).JQtw!WIIIrJ A s-.t991.
Knowledge Discover y and Data Mining Bibliography
tGn.vpN!ff f.....-•IJ, .o ... itdlu'}
u-F-,JM."Iot~OII.-..uT...,. ~,.~~Dt.c·..,.·· · ..... ., flclEEEC_,_ Soc\aJT«.-:IIC..._.. OIIIOM~a . .-111,-.I, M..UIM
OwiMOpf!cf~ .... ,..; .. """-_,Cn:,.., rtMu'J·!Mf!(ro. ·s7 ... ,.. r. uo-~cVac DiK•"'"' ifl ...._.._ .. tru T,_lfOI\l . ~ ..... _, o.u EaaJ~ l(•tto!-tl), DlaftlbcflftJ.
(a) Linked Web pages.
2.1 Types of Data 33
(b) Benzene molecule.
Figure 2.3. DiHerenl variations of graph data.
Ordered Data
For some types of data, the attributes have relationships that involve order in time or space. Different types of ordered data are described next and are shown in Figure 2.4.
Sequential Data Sequential data, also referred to as temporal data, can be thought of as an extension of record data, where each record has a time associated with it. Consider a retail t ransaction data set that also stores the time at which the transaction took place. T his time information makes it possible to find patterns such as "candy sales peak before Halloween." A t ime can also be associated with each attribute. For example, each record could be the purchase history of a customer, with a listing of items purchased at different times. Using this information, it is possible to find patterns such as "people who buy DVD players tend to buy "DVDs in the period immediately following the purchase."
Figure 2.4(a) shows an example of sequential transaction data. There are five different times-tl, t2, t3, t4 , and tS ; three different customers-Cl
I
34 Chapter 2 Data
Time Customer Items Purchased t1 C1 A,B
t2 C3 A,C
t2 C1 C,D
t3 C2 A,D
14 C2 E 15 C1 A,E
Customer Time and Items Purchased
C1 (t1: A,B) (l2:C,D) (t5:A,E)
C2 (t3: A, D) (t4: E)
C3 (t2:A,C)
(a) Sequential transaction data.
- H) :
- I 5 ~ . . . ~~~ 1~ 1N4 ,. ,,_ 1Ml , ,;.. INf 1..0 1991 I~ ttrn ,.,. ·-
(c) Temperature time seri es.
GGTTCCGCCTTCAGCCCCGCGCC CGCAGGGCCCGCCCCGCGCCGTC GAGAAGGGCCCGCCTGGCGGGCG GGGGGAGGCGGGGCCGCCCGAGC CCAACCGAGTCCGACCAGGTGCC CCCTCTGCTCGGCCTAGACCTGA GCTCATTAGGCGGCAGCGGACAG GCCAAGTAGAACACGCGAAGCGC TGGGCTGCCTGCTGCGACCAGGG
(b) Genomic sequence data.
(d) Spatial temper ature data.
Figure 2.4. Different variations of ordered dala.
C2, and C3; and five different items- A, B, C, D, and E. In the top table, each row corresponds to the items purchased at a particular time by each customer. For instance, at time t3, customer C2 purchased items A a nd D. In the bottom table, the same information is displayed, but each row corresponds to a particular customer . Each row contains information on each transaction involving the customer, where a t ransaction is considered to be a set of items and the time at which t hose items were purchased. For example, customer C3 bought items A and C at time t2.
2.1 Types of Data 35
Sequence Data Sequence data consists of a data set that is a. sequence of individual entities, such as a sequence of words or letters. It is quite simi lar to sequential data, except that there are no time stamps; instead, there a re posi- tions in an ordered sequence. For example, the genetic information of plants and animals can be represented in the form of sequences of nucleotides tha t are known as genes. Ma ny of the problems associated with genetic sequence data involve pred icting similarit ies in the struct ure and function of genes from similarities in nucleotide sequences. F igure 2.4(b) shows a section of the hu- man genetic code expressed using the four nucleotides from which all DNA is constructed: A , T, G , and C.
Time Seri es Data Time series data is a special type of sequential data in which each record is a t ime series, i.e., a series of measurements taken over t ime. For example, a financial data set might contain objects that are time series of the dail y prices of various stocks. As another example, consider Figure 2.4(c), which shows a time series of the average monthly temperat ure for Minneapolis during the years 1982 to 1994. When working wit h temporal data, it is important to consider temporal autocorrelation ; i.e., if two measurements are close in t ime, then the values of those measurements are often very similar.
Spatial Data Some objects have s patial attributes, such as positions or ar- eas, as well as other types of attri butes. An example of spat ial data is weat her data (precipitation, temperature, pressure) that is collected for a variety of geographical locations. An important aspect of spatial data is spatial auto- corre lation; i.e., objects t hat are physicall y close tend to be simi lar in other ways as well. Thus, two points on !.he Earth that a re close to each other usually have similar values for temperature and rainfall.
Important examples of spatial data are the science and engineering data sets that are the result of measurements or model output taken at regularly or irregularly distributed points on a two- or three-dimensional grid or mesh. For instance, Earth science data sets record the temperature or pressure mea- sured at points (grid cells) on latitude-longitude spherical grids of various resolutions, e.g., 1° by 1°. (See Figure 2.4(d).) As another example, in the simu lation of the flow of a gas, the speed and direction of flow can be reco rded for each grid point in the simulation.
36 C hapter 2 Data
H an dling Non-Record D ata
Most data mining algorithms are designed for record data or its variations, such as transaction data and data matrices. Record-orient ed techniques can be applied to no n-record data by ext racting features from data objects and using these features to create a record corresponding to each object. Consider the chemical structure data that was described earlier. Given a set of common substructures, each compound can be represented as a record with binary attributes that indicate whether a com pound contains a specific substructure. Such a representation is actually a transaction data set, where the transactions are the compounds and the items are the substructmes.
I n some cases, it is easy to represent the data in a record format, but this type of representation does not capture all the information in the data. Consider spatia-temporal data consisting of a time series from each point on a spatial grid. T his data is often st ored in a data matrix, where each row represents a location and each column represents a particular point in time. However, such a re presentation does not explicit ly capture the time relation- ships that are present among attributes and the spatial relationships that exist among o bjects. This does not mean that such a representation is inap- propriate, but rather that these relationships mus t be taken into consideration during the analysis. For example, it would not be a good idea to use a dat a mining technique that assu mes the attributes are statistically independent of one another.
2.2 D ata Qua lity
Data mining a pplications a re often applied to data that was collected fo r an- other purpose, or for future, but unspecified applications,. For t hat reason , data mining cannot usually take ad vantage of the significant benefits of "ad- dressing quality issues at the source ." ln contrast, much of statistics deals with the design of experiments or surveys that achieve a prespecified level of data quality. Because preventing data quality problems is typically not an op- tion, data mining focuses on (1) the detection and correction of data quality problems and (2) the use of algorithms that can tolerate poor da ta quality. The first step, detectio n and correction, is often called data cleaning.
The following sections discuss specific aspects of data quality. The focus is on measurement and data collection issues, a lthough some appl ication-related issues are also discussed.
2.2 Data Quality 37
2.2.1 M easure ment and D a t a Collection Iss u es
It is unrealistic to expect that data will be perfect. There may be problems due to human error , limitations of measuring devices , or flaws in the data collection process. Values or even entire data objects may be missing. l n other cases, there may be spurious or duplicate objects; i.e., multiple data objects that all correspond to a single "real" object. For example, there might be two difl'erent records for a person who has recently Jived at two di fferent addresses. Even if all the data is present and "looks fine," there may be inconsistencies-a person has a height of 2 meters, but weighs only 2 kilograms .
In the next few sections, we focus on aspects of data quali ty that are related to data measurement and collection . We begin with a definition of measure- ment and data collection errors and then consider a variety of problems that involve measurement error: noise, artifacts, bias, precision , and accuracy. We conclude by discussing data quality issues that may involve both measurement and data collection problems: outliers, missing and inconsistent values, and duplicate data.
Measurem ent a nd D a t a C ollection Errors
The term meas ure m e nt e rror refers to any problem resulting from the mea- surement process . A common problem is that t he value recorded differs from the true value to some extent. For continuous attributes, the numerical di f~ ference of the measured and true value is called the error. The te rm data collect io n error refers to er rors such as omitti ng data o bjects or attri bute values, or inappropriately including a data object. For example, a study of animals of a certain species might include animals of a related species that are similar in appearance to the species of interest. Both measu rement errors and data collection errors can be either systematic or random.
We will only consider general types of errors. Within particular domains, there are certain types of data errors that are commonplace, and there often exist well-developed techniques for detecting and /o r correcting these errors. For example, keyboard errors are common when data is entered manuall y, and as a result , many data entry programs have techniques for detecting and, with huma n intervent ion, correcti ng such errors.
Noise a nd Artifacts
Noise is the random component of a measurement error. It may involve the distortion of a value or the addition of spurious objects. Figure 2.5 shows a t ime series before and after it has been disrupted by random noise. If a bit
38 Chapter 2 Data
(a) Time series. (b) Time series with noise.
Figure 2.5. Noise in a time series context.
. ·:. + + + ,: .
+
+ ... :..· .. ·
·. -: .. : . ··.· ....
+ +
+ +++
:i~<:.~: ~:::: >.:~:. -;.,. ; .. , ·:. ~- ··. · :J· .. . . . ': :~·. -· . . '• .. · .. : .. ;· (a) Three groups of points. (b) With noise points ( +) added.
Figure 2.6. Noise in a spatial co ntext.
more noise were added to the time series, its shape would be lost. Figure 2.6 shows a set of data points before and after some noise points (indicated by '+'s) have been added. Notice that some of the noise points are intermixed with the non-noise points.
The term noise is often used in connection with data that has a spatial or temporal component. In such cases, techniques from signal or image process- ing can freq uently be used to reduce noise and thus, help to discover patterns (signals) that might be "lost in the noise." Nonetheless, t he elimination of noise is frequently difficult, and much work in dat a mining focuses on devis- ing robust algorithms that produce acceptable results even when noise is present.
2.2 Data Quality 39
Data errors may be the result of a more deterministic ph enomenon, such as a streak in the same place on a set of photographs. Such deterministic distortions of the data are often referred to as artifacts.
Precision, Bias, and Accu racy
In statistics and ex perimental science, the quality of the measurement process and the resulting data are measured by precision and bias. We provide the standard definitions, followed by a brief discussion. For t.he following defini- tions, we assume that we make repeated measurements of the same under lying quantity and use this set of values to calculate a mean (average) value that serves as our estimate of the true value.
Definitio n 2.3 (P recision ) . The closeness of repeated measuremen ts (of the same quantity) to one another.
Definit ion 2 .4 (Bias). A systematic variation of measurements from the quantity being measured.
Precision is often measured by the standard deviation of a set of values, while bias is measured by taking the difference between the mean of the set of values and t he known value of the quantity being measured. Bias can only be determined for objects whose measured quantity is known by means external to the current situation. Suppose that we have a standard laboratory weight with a mass of 1g and want to assess t he precision and bias of ou r new laboratory scale . We weigh the mass five times, and obtain the following five values: {1.015, 0.990, 1.013, 1.001, 0.986}. The mean of these values is 1.001, and hence, the bias is 0.001. The precision, as measured by the standard deviation, is 0.013.
It is common to use the more general term, accuracy, to refer to the degree of measurement error in data.
Defini t ion 2. 5 (A ccuracy) . The closeness of measuremen ts to t.he true value of the quantity being measured.
Accuracy depends on precision and bias, but since it is a general concept, t here is no specific formula fo r accuracy in terms of these two quantities .
One important aspect of accuracy is the use of significant digits. The goal is to use only as many digits to repres~nt the result of a measurement or calculation as are justified by the precision of the data. For example, if the length of an object is measured with a meter stick whose smallest markings are millimeters, then we should only record the length of data to t he nearest mil- limeter. The precision of such a measurement would be ± 0.5mm. We do not
. - • .. !!§'; ·- ·-- · - ;:;::;;-----·-~ -....
40 C h apter 2 Data
review the details of working with significant digits, as most readers will have encountered them in previous courses, and they are covered in considerable depth in science, engineering, and statistics textbooks.
Issues such as significant digits, precision , bias, and accuracy are sometimes overlooked , bu t they are important for data mining as well as statistics and science. Many t imes, data sets do not come with information on the precision of t he data, and furthermore, t he programs used for analysis return results withou t a ny such information. Nonetheless, without some understanding of the accu racy of the data and the results, an analyst ru ns the risk of committing seri ous data analysis blunders.
Outlier s
Outliers are either (1) data objects that, in some sense, have characteristics t hat are different from most of the other data objects in the data set , or (2) values of an attribute that are unusual with respect to t he typical val ues for that attribute. Alternatively, we can speak of anomalous objects or values. There is considerable leeway in the definition of an outlier, and many difle rent definitions have been proposed by t he statistics and data mining commun it ies. Furthermore, it is important to distinguish between the notions of noise and outliers . Outliers can be legitimate data objects or values. Thus, unlike noise, outliers may sometimes be of interest. In fraud and network intr usion detection, for example, the goal is to find unusual objects or events fro m among a large number of normal ones. Chapter 10 discusses anomaly detection in more detail.
Missing Va lu es
It is not unusual for an object to be missing one or more attribute values. Jn some cases, the information was not collected; e.g., some people decline to give their age or weight . In other cases, some attributes are not applicable to a ll objects; e.g., often, forms have conditional parts that are filled out only when a person answers a previo us question in a certain way, but for simplicity, all fields are st ored. Regardless, missing values should be taken into account during the data analysis.
There are several strategies (and variations on these strategies) for dealing with missing data, each of which may be appropriate in certain cir cumstances. These strategies are list ed next, along with an indicat ion of their advantages and disadvantages.
2.2 Data Quality tJ l
Eliminate Data Objects or Attributes A simple and effective strateg,y is to eliminate objects with missing val ues. However, even a part ially speci- fied data object contains some information, a nd if many objects have missing values, then a reliable analysis can be difficult or impossible. Nonet heless, if a data set has o nly a few objects that have missing val ues , then it may be exped ient to omit them . A related stra t egy is t o eliminat e a ttribu tes that have missing values. T his should be done with caution , however, since the elimi nat ed attributes may be t he ones that are critical to the analysis .
Estimate M issin g Values Somet imes missing data can be reliably est.i- mated . For example, consider a ti me series that changes in a reasonably smooth fashion , but has a few, widely scattered missing values. In such cases, the missing values can be estimated (interpolated) by using the remaining values. As anothe r example , consider a data set that has many similar da ta points. In this situation, the attribute values of the points closest to t he point with the missing val ue are often used to estimate the missing value. If t he attribute is continuous, then the average attribute value of the nearest neigh- bors is used; if t he attrib ute is categorical, then the mos t commonly occurring at t ribute value can be taken. For a concrete illustration, consider precipitation measurements that are recorded by ground stations. For areas not cont aini ng a ground station, the precipitation can be estimated using values observed at nearby ground stat ions.
Ig n ore the M issing Value durin g Analysis Many data mining approaches can be modified to ignore missing values. For example, suppose t hat objects are bei ng clustered and the similarity between pairs of data objects needs to be calculated. lf one or both o bjects of a pai r have missing values for some att ributes, then the similari ty can be calculated by using only the attr ibutes that do not have missing values. It is true that the similarity will only be approximate, but unless t he t otal number of a t tributes is small or t he num- ber of missing values is high, t his degree of inaccuracy may not matt er much. Likewise, many classification schemes can be modified to work with missing values.
Inconsistent Values
Data can contain inconsistent values. Consider an address field , where both a zip code a nd city are listed , but the specified zip code area is not conta ined in that city. It may be that the individual entering this informat ion transposed two digits, or perhaps a digit was misread when the information was scanned
42 C hapter 2 Data
from a handwritten form. Regardless of the cause of t he inconsistent values, it is important to detect and , if possible, correct such problems.
Some types of inconsistences are easy to detect. For inst ance, a person's height should not be negative. In other cases, it can be necessar y to consult an external source of information. For example, when an insurance company processes claims for reimbursement, it checks the names and addresses on the reimbursement forms against a database of its customers.
Once an inconsistency has been detected, it is sometimes possible to correct the data. A product code may have "check" digits, o r it may be possible to double-check a prod uct code against a list of known product codes, and then correct the code if it is incorrect, but close to a known code. The correction of an inconsistency requires additional or redundant information .
Example 2.6 ( Incons istent S ea Surface Temp er at ure). This example illustrates an inconsistency in actual t ime series data that measures the sea surface temperature (SST) at various points on the ocean. SST data was origi- nally collected using ocean-based measurements from ships or buoys , but more recently, satellites have been used to gather the data. To create a long-term data set , both sources of data must be used. However, because the data comes from di fferent sources, the two parts of the data are sub tly different. This discrepancy is visually displayed in Figure 2.7, which shows t he correlation of SST values between pairs of years. If a pair of years has a positive correlation , t.hen the location corresponding to the pair of years is colored white; otherwise it is colored black. (Seasonal variations were removed from the data since, oth- erw ise, all the years would be highly correlated.) There is a distinct change in behavior where the data has been put together in 1983. Years wi thin each of the two groups, 1958- 1982 and 1983- 1999, tend to have a positive correlatio n with one another, but a negative correlation with years in the other group . This does not mean that this data should not be used, only that t.he analyst should consider the potential impact of such discrepancies on the data mining analysis. •
Duplicate D ata
A data set may include data objects that are duplicates, or almost duplicates, of one another. Many people receive duplicate mailings because they appear in a database multiple times under slightly different na mes. To detect and eliminate such duplicates, two main issues must be addressed . First, if there are two objects that actually represent a si ngle object, then the values of corresponding attributes may differ, and these inconsistent values must be
2.2 Data Quality 43
;;; ~
75
80
85
90
95
Year
Figure 2.7. Correlation of SST data between pairs of years. White areas indicate positive correlation. Black areas indicate negative correla tion.
resolved. Second , care needs to be taken to avoid accidentally combining data objects that are similar, but not duplicates, s uch as two distinct people with identical names. The term deduplication is often used to refer to the process of deali ng with these issues.
In some cases, two o r more obj ects are identical with res pect to the at- t ributes measured by the database, but t hey still represen t differen t objects. Here, the duplicates a re legitimate, but may still cause problems fo r some al- gorithms if t he possibili ty of identical objects is not specifically accounted for in thei r desig n. An example of t his is given in Exercise 13 on page 91.
2.2.2 Iss u es Rel ated to Application s
Data quality issues can also be considered from an application viewpoint as expressed by the statement "data is of high q uality if it is suitable for its intended use." This approach to data quality bas proven quite useful, particu- larly in business and industry. A similar viewpoint is a lso present in statist ics and t he experime ntal sciences, with t he ir emphasis on t he careful design of ex- periments to collect the data relevant to a specific hypot hesis . As wit h quality
44 Chapter 2 Data
issues at the measurement and data collection level , there are many issues that are specific to particular applications and fields . Again , we consider only a few of the general issues.
Timeliness Some data starts to age as soon as it has been collected. In particular, if the data provides a snapshot of some ongoing phenomenon or process, such as the purchasing behavior of customers or Web browsing pat- terns, then this snapshot represents reality for only a limited time. If the data is out of date, then so are the models and patterns that are based on it.
R e levance The available data must contain the information necessary for the application. Consider the t ask of building a model that predicts the acci- dent rate for drivers. If information abo ut the age and gender of the driver is omitted , then it is likely that the model will have limited accuracy unless this information is indirectly available thro ugh other attributes.
Making sure that the objects in a data set are relevant is also challenging. A common problem is sampling bias, which occurs when a sample does not contain different types of objects in proportion to their actual occurrence in the population. For example, survey data describes only those who respond to the survey. (Other aspects of sampling are discussed further in Section 2.3.2.) Because the results of a data analysis can reflect only the data that is present, sampling bias will ty pically result in an erroneous analysis.
l<n ow le dge about the D ata Ideally, data sets are accompanied by doc- umentat ion that describes different aspects of the data; the quali ty of this documentation can either aid or hinder the subsequent analysis. For example, if the documentation identifies several attrib utes as being strongly related, these attributes are likely to provide highly redundant information, and we may decide to keep j us t one. (Consider sales t ax and purchase price.) If the documen tation is poor, however, and fails to tell us, for example, that t he missing values for a particular field are indicated with a -9999, t hen our analy- sis of the data may be faulty. Other important characteristics are the precision of tlte data, the type of features (nominal, ordinal, interval, ratio), the scale of measurement (e.g., meters or feet for length), and the origin of the data.
2.3 Data Preprocessing
In this section, we address the issue of which preprocessing steps should be applied to make the data more suitable for data mining. Data preprocessing
2.3 Data Preprocessing 45
is a broad area and consists of a number of different strategies and techniques that are interrelated in complex ways. We will present some of the most important ideas and approaches, and try to point out the interrelationships among them. Specifically, we will discuss the following topics:
• Aggregation
• Sampling
• Dimensionality reductio n
• Feature subset selection
• Feature creation • Discretization and binarization
• Variable t ransformation
Roughly speaking, t hese items fall into two categories: selecting data ob- jects and attributes for the analysis or creating/changing the attributes. ln both cases the goal is to improve the data mining analysis with respect to time, cost, and quality. Details are provided in the following sections.
A quick note on terminology: In the following, we sometimes use synonyms for attribute, such as feature or variable, in order to follow common usage.
2.3.1 Aggr egation
Sometimes "less is more" and this is the case with a ggregation , the combining of two or mo re objects into a single object. Consider a data set consisting of transactions (data objects) recording t he daily sales of products in various store locations (M inneapolis, Chicago, Paris, ... ) for different days over the course of a year . See Table 2.4.. One way to aggregate t ransactions for this data set is to replace all the transactions of a single store with a single storewide transaction. This redu ces the hundreds or thousands of transactions that occur daily a t a specific store to a single daily transac tion, and the number of data objects is reduced to the number of stores.
An obvious issue is how an aggregate transaction is created ; i.e., how the values of each attribute are combined across all the records corresponding to a particular location to create the aggregate transaction that represents the sales of a single store or date. Quantitative attributes, such as price , are typically aggregated by taking a sum or an average, A qualitative attribute, such as item, can either be omitted or summarized as the set of all the items that were sold at that location.
The data in Table 2.4 can also be viewed as a multidimensional array, where each attribute is a dimension. From this viewpoint, aggregation is t he
46 Chapter 2 Data
Table 2.4. Data sel containing information about customer purchases.
Transaction ID
101123 101123 101124
Item
Watch Battery Shoes
S tore Location
Chicago Chicago
Minneapolis
Date
09/06/04 09/06/04 09/06/04
Price
$25.99 $5.99 $75.00
process of eliminating attributes, such as the type of item , or reducing the number of values for a particular attribute; e.g., reducing the possible values for date from 365 days to 12 months. This type of aggregation is commonly used in Online Analytical Processing (OLAP ), which is discussed further in Chapter 3.
T here are several motivations fo r aggregation. First, the smaller data sets resulting from data reduction require less memory and processing t ime, and hence, aggregation may permit the use of more expensive data mining algo- rithms. Second, aggregation can act as a change of scope or scale by providing a high-level view of the data instead of a low- level view. In the previous ex- ample, aggregating over store locations and months gives us a monthly, per store view of the data instead of a dail y, per item view. Finally, the behavior of groups of objects or attributes is often more stable t han that of individual objects or attri butes. This statement reflects the statistical fact that aggregate quantities, such as averages or totals, have less variability than the individ- ual objects being aggregated. For totals, the actual amount of variation is larger th an that of individual objects (on average), but the percentage of the variation is smaller, while for means, the actual amo unt of variation is less than t hat of individual objects (on average). A disadvantage of aggregation is the potential loss of interesting details. In the store example aggregating over months loses information about which day of the week has the highest sales.
Example 2.7 (Australian Precipitation) . This example is based on pre- cipi tation in Australia from t he period 1982 to 1993. Figure 2.8(a) shows a histogram for the standard deviation of average monthly precipitation for 3,030 0.5° by 0.5° grid cells in Australia, while Figure 2.8(b) shows a histogram for the standard deviation of the average yearly precipitation for the same lo- cations. T he average yearly precipitation has less variability than the average monthly precipitation. All precipitation measurements (and their standard deviations) are in centimeters.
•
(a) Histogram o f standard deviat ion of average monthly p recipitation
2.3 Data Preprocessing 47
(b) Histogram of standard deviation of average yearly precipitation
Figure 2.8. Histograms of standard deviation for monthly and yearly precipitation in Australia for the pe riod 1982 to 1993.
2.3.2 Sampling
Sampling is a commonly used ap proach for selecting a subset of the data objects to be analyzed. In statistics, it has long been used for both the pre- liminary investigation of the data and the final data analysis. Sampling can also be very useful in data mining. However, the motivations fo r sampling in statistics and data mining are often different. Statisticians use sampli ng because obtaining the entire set of data of interest is too expensive or time consuming, while data miners sample because it is too expensive or time con- suming to process all the data. In some cases, using a sampling algori t hm can reduce the data size to t he point where a better, but more expensive a lgorithm can b e used.
T he key principle fo r effective sampling is the following: Using a sample will work almost as well as using the entire data set if the sample is repre- sentative. In turn, a sample is representative if it has approximately the same property (of interest) as the original set of data. If the mean (average) of the data objects is the property of interest, then a sample is representative if it has a mean that is close to that of the original data. Because sampling is a statistical process, the representativeness ·of any particular sample will vary, and the best t hat we can do is choose a sampling scheme that guarantees a high probability of getting a representative sample. As discussed next, this involves choosing the appropriate sample size and sampling techniques .
48 Chap ter 2 Data
Sampling Approaches
There a re many sampling techniques, but only a fe w of the most basic ones and their variations will be covered here. The simplest type of sampling is simple random sampling. For t his type of sampling, there is an equal prob- ability of selecting any part icular item. There are two variations on random sampling (and other sampling techniques as well): (1) sampling without re- placement- as each item is selected, it is removed from the set of all objects that together constitute the population , and (2) sampling with replace- ment- objects a re not removed from the population as they are selected for the sample. l n sampling with replacement, the same object can be picked more t han once. The samples produced by the two met hods are not much d ifferent when samples are relatively small compared to the data set size, but sampling with replacement is simpler to analyze since the probability of selecting any object remains const ant during the sampling process.
When the population consists of different types of objects, with widely different numbers of obj ects, simple random sampling can fai l to adequately represent those ty pes of objects that are less frequent. This can cause prob- lems w hen t he analysis requires proper representation of all object types. For example, when building classification models for rare classes, it is critical that the rare classes be adequa tely represented in the sample. Hence, a sampling scheme that can accommodate differing frequencies for t he items of interest is needed. Stratified sampling, which starts with prespecified gro ups of ob- jects, is such an ap proach. In the simplest version , equal numbers of objects are drawn from each group even tho ugh the groups are of different sizes. In an- other variat ion, the number of objects drawn from each group is proportional to the size of that grou p.
Example 2.8 (Sampling and Loss of I nformation). Once a sampling technique has been selected, it is still necessary to choose the sample size. Larger sample sizes increase the pro bability that a sample will be representa- tive, bu t they also eliminate much of the advantage of sampling. Conversely, with smaller sample sizes, patterns may be missed or erroneous patterns can be detected. Figure 2.9(a) shows a data set that contains 8000 two-dime nsional points, while Figures 2.9 (b) and 2.9 (c) show samples fr om t his data set of size 2000 and 500, resp ectively. Although most of the structure of t his data set is present in the sample of 2000 points, much of the structure is missing in the sample of 500 points. •
2.3 Data P reprocessing 49
" j:·. :_:' : . ' . .' ' .. ~.-
- .:·-· ~· . :. ;. : -: -~:: . . = ' . ... . ':· . ·.· ..
(a) 8000 poi nt s (b) 2000 poin ts (c) soo poirit.s
Figure 2.9. Example of the loss of structure with sampling.
Example 2.9 ( D e termining the Proper Sample Size) . To ill ustrate that determining t he proper sample size requi res a methodical approach, consider the follow ing task .
Given a set of data that consists of a small number of alrr:ost equal- sized groups, find at least one representative point for each of the g roups. Assume that the objects in each group are highly similar to each other, but not very similar to objects in different groups. Also assu me that the re are a relatively small number of groups, e .g. , 10. F igure 2.10(a) shows a n idealized set of clusters (groups) from which these points might be drawn.
This problem can be efficiently solved using sampling. One approach is to t ake a small sample of data points, compute t he pairwise similari ties between points, and t hen form groups of points that a re hig hly si milar. The desired set of representative points is then obtained by taking one point from each of these grou ps . To fo llow this approach, however , we need to deter mine a sample size tha t would guarantee, with a high probability, the desired outcome; that is, that at least one poin t will be obtained from each cluster. Figure 2.10(b) shows t he proba bili ty of getting one object from each of t he 10 groups as the sample size runs from 10 to 60. Interestingly, with a sample size of 20, t here is little chance (20%) of getting a sample that .includes all 10 clusters. Even with a sample size of 30, t here is still a moderate chance (almost 40%) of get ti ng a sample that doesn't contain objects from all 10 cl usters. This issue is further explored in the context of clustering by Exercise 4 on page 559 .
•
50 Chapter 2 Data
• • • • • • • • • •
(a) Ten groups of points.
0.8 . ...................... ..
~ 0.6 '" .... , :0
~ Q, 0.4
0.2
Sample Size
(b) P robability a sample contains points from each of 10 groups.
Figure 2.1 0. Finding representative points from 10 groups.
Progressive Sampling
The proper sam ple size can be difficult to determine, so adaptive or progres- sive sam pling schemes are sometimes used. These approaches start with a small sam ple, and then increase the sample size until a sample of sufficient size has been obtained. \N'hile this technique eliminates the need to determine the correct sample size initially, it requires that there be a way to evaluate the sample to judge if it is large enough.
Suppose, for instance, that progressive sampling is used to learn a. pre- dictive modeL Although the accuracy of predictive models increases a.<> the sample size increases, at some point the increase in accuracy levels off. We want. to stop increasing the sample size at this leveling-off point. By keeping t.r ack of ~he change in accuracy of the model as we take progressively larger samples, and by taking other samples close to the size of the current one, we can get an estimate as to how close we are to this leveling-off point, and thus, stop sampling.
2.3.3 Dimensionality R ed u ction
Data sets can have a large number of features. Consider a set of documents, where each document is represented by a vector whose components are the frequencies with which each word qccurs in the document. In such cases,
2.3 Data Preprocessing 51
there are typically thousands or tens of thousands of attributes (components), one for each word in t he vocabulary. As another example, consider a set of time series consisting of the daily closing price of various stocks over a period of 30 years. In this case, the attributes, which are t he prices on specific days, again number in the tho usands.
There are a variety of benefits to dimensionality reduction . A key benefit is that many data mining algorithms work better if the dimensionality-the number of attributes in the data-is lower. This is partly because dimens ion- ality reduction can eliminate irrelevant features and reduce noise and partly because of the curse of dimensionality, which is explained below. Another ben- efit is that a reduction of dimensionality can lead to a more understandable model because the model may involve fewer attributes. Also, dimensionality reduction may allow the data to be more easily visualized. Even if dimen- sionality reduction doesn't red uce the data to two or three dimensions, data is often visualized by looking at pairs or triplets of attributes, and t he num- ber of such combinations is greatly reduced. Finally, the amount of time and memory required by the data mining algorit hm is reduced with a reduction in dimensionality.
The term dimensionality reduction is often reserved for those techniq ues that reduce the dimensionali ty of a data set by creating new attributes that are a combination of the old att ributes. The reduction of dimensionali ty by selecting new attributes that are a subset of the old is known as feature subset selection or fe ature selection. It will be discussed in Section 2.3.4 .
In the remainder of this section, we briefly introduce two import ant topics: the curse of dimensionality and dimensionality reduction techniques based on linear algebra approaches such as principal components analysis (P CA ). More details on dimensionality reduction ca.n be found in Appendix B.
The Curse of Dimens ionality
The curse of dimensiona lity refers to the phenomenon that many types of data analysis become significantly harder as the dimensionality of the data increases. Specifically, as dimensionality increases, the data becomes increas- ingly sparse in the space that it occupies. For classification, this can mean t hat there are not enough data objects to allow the creation of a model that reliably assigns a class to all possible objects. For clustering, th e definitions of density and the distance between points, which are critical for clustering, become less meaningful. (This is discussed further in Sections 9.1 .2, 9.4.5, and 9.4.7.) As a result, many cl ustering and classification algorithms (and other
• 52 C h a pte r· 2 Data
data analysis algo rithms) have t rouble with high-dimensional data- reduced classification accuracy and poor quality clusters.
Linear Alge bra Techniques for Dimensionality R eduction
Some of the most common approaches for dimensionality reduction, part ic- ularly for continuous data, use techniques from linear algebra to project the data from a high-dimensional space into a lower-dimensional space. Principal Components Analys is (PCA) is a linear a lgebra technique for continuous at tribu t es that finds new attributes (principal components) t hat (1) are linear combinations of the original attributes, ( 2) are orthogonal (perpendicular) to each other, and (3) capture t he maximum amount of variation in the data. For example, the first two principal components capture as much of the variation in the dat a as is possible with two orthogonal attributes that are linear combi- nations of the original attributes. Singular Value D ecomposition (SVD) is a linear algebra technique that is related to PCA and is also commonly used for dimensionality reduction . For addi tional details, see Appendices A and B.
2.3.4 Fea ture Subset Selection
Another way to reduce the dimensionality is to use only a subset of t he fea- tu res. Wh ile it might seem that such an approach would lose information, t his is not t he case if redundant and irrelevant features are present. Redunda nt features duplicate much or all of the information contained in one or more other attributes. For example, the purchase price of a product and t he amount of sales tax paid contain much of the same information . Irre levant features contain almost no useful information for the data mining task at hand. For instance, students ' ID numbers are irrelevant to t he task of predicting stu- dents' grade point averages. Redundant and irrelevant features can reduce classification accuracy and the quality of the clusters t hat are found .
While some irrelevant and redundant attributes can be eliminated imme- diately by using common sense or domain knowledge, selecting the best subset of features frequently requires a systematic approach. The ideal approach to fea ture selection is to t ry all possible subsets of features as input to t he data mining algorithm of interest , and then take the subset that produces the best results. This method has the advantage of reflecting the objective and bias of the data mining algori thm that will eventually be used. Unfortunately, since the number of subsets involving n attributes is 2n, such an approach is imprac- tical in most situations and alternative strategies are needed. There are three standard approaches to feature selection: embedded , filter, and wrapper.
2.3 Da t a P reprocessing 53
Embedde d approaches Feature selection occurs naturally as part of the data mining algorithm. Specifically, during the operation of the data mining algorithm, the algorithm itself decides which attributes to use and which to ignore. Algorithms for building decision tree classifiers, which are discussed in Chapter 4, often operate in this manner.
Filter approaches Features are selected before t he data mining algorithm is run , using some approach that is independent of the data mining task. For example, we might select sets of attributes whose pair wise correlation is as low as possible.
W rapper approaches These methods use the target data mi ning algo rithm as a black box to find the best subset of attri butes, in a way similar to that of the ideal algorithm described above, but typically without enumerating all possible subsets.
Since the embedded app roaches are algorithm-specific, only the filter and wrapper approaches will be discussed further here.
An Architecture for Feature Subset Selection
It is possible to encompass both the filter and wrapper approaches within a common architecture. The featu re selection process is viewed as consisting of four parts: a measure for evaluating a subset , a search strategy that controls the generation of a new s ubset of features, a stopping criterion , and a valida- tio n procedure. F ilte r methods and wrapper methods differ only in the way iu which they evaluate a subset of features. For a wrapper method , subset evaluat ion uses the targe t data mining algorithm, while for a fi lter approac h, the evaluation technique is distinct from the t a rget data mi ning algorithm . T he following discussion provides some details of this approach, which is sum- marized in Figure 2.11.
Conceptuall y, feature subset select ion is a search over all possible subsets of feat ures. Many different types of search strategies can be used, but the search strategy should be computationally inexpensive and should fi nd optimal or near optimal sets of features . lt is usually not possible to satisfy both requirements, and thus, tradeoffs are neces:;;ary.
An integral part of the search is an evaluatio n st ep to judge how the current subset of feat ures compares to others that have been considered . This requires an evaluation measure t hat a ttempts to de termine the goodness of a subset of attribu tes with respect to a particular data mining task, such as classification
54 C hap t e r 2 Data
Selected
Validation Procedure
Not Done
Search Strategy
Evaluation
Figure 2.11. Flowchart of a feature subset selection process.
or clustering. For the filter approach, such measures attempt to predict how well the actual data mining algo rithm will perform on a given set of attributes. For the wrapper approach, where evaluation consists of actually running the target data mining applicat ion, the subset evaluatio n function is simply t he criterion normally used to measure t he resul t of the data mining.
Because t he number of subsets can be enormous and it is impractical to examine them all, some sort of stopping criterion is necessary. This strategy is usually based on one or more conditions involving the following: the number of iterations, whether t he value of t he subset evaluation measure is optimal or exceeds a certain th reshol d, whether a subset of a. certain size has been ob- tained, whether simultaneous size and evaluation criteria. have been achieved, and whether any improvement can be achieved by the options available to the search strategy.
Finally, once a subset of features has been selected, the results of the target data mining algorithm on the selected subset should be validated. A straightforward evaluation approach is to r un the algorithm wit h the full set of features and compare t he full results to results obtained using the subset of features. Hopefully, the subset of features will produce results that are better than or almost as good as those produced when using all features. Another validation approach is to use a number of different feature selection algorithms to obtain subsets of featu res and t hen compare the results of running t he da ta mining a lgorithm on each subset.
2 .3 Data Preprocessing 55
Feature Weighting
Feature weighting is an alternative to keeping or eliminating features. More importan t features are assigned a higher weight, while less important features are given a lower weight . These weights are sometimes assigned based on do- main knowledge about the rela ti ve importa nce of features. Alternatively, they may be determined automaticaUy. For example, some classification schemes, such as s upport vector machines (Chapter 5), produce classification models in which each feature is given a weight. Features with larger weights play a more important role in the mode l. The normalization of objects that takes place when computing the cosine similarity (Sect ion 2.4 .5) can also be regarded as a. type of feature weighting.
2.3 .5 Feature C reation
It is frequent ly possible to create, from the original attributes , a new set of attri butes that captures the important information in a dat a. set much more effectively. Furthermore, the number of new attributes can be smaller than the number of original attributes, allowing us to reap all the previously described benefits of dimensionality reduction. Three related methodologies for creat ing new att ributes are described next: feature extraction, mapping the data to a new space, and feature construction.
Feature Extractio n
The creation of a new set of features from t he original raw data is known as feature extr actio n . Consider a set of photographs, where each photograph is to be classified acco rding to whether or not it contains a. human face. The raw data is a set of pixels, and as such, is not suitable for many types of classification algorithms. However, if the data is processed to provide higher- level features, such as the presence or absence of certain types of edges and areas that are highly correlated with the presence of huma n faces, then a much broader set of classification techniques can be applied to this problem .
Unfortunately, in the sense in which it is most commonly used , feature extraction is highly domain-specific. For a particular field, such as image processing, various features and the techniques to extract them have been developed over a period of time, and often_ these techniques have limited ap- plicability to other fields. Consequently, whenever data mining is applied to a relatively new area., a key task is t he development of new features and feature extraction methods.
r-=------
56 C hapter 2 Data
(a) Two tim e se ries . (b) Noisy time series. (c) P ower spect rum
Figure 2.12. Application of the Fourier transform to identify the underlying frequencies in time series data.
Mapping the Data to a New Space
A totally different view of t he data can reveal import ant and interesting fea- tures. Consider, for example, time series data, which often contains periodic patterns. If there is only a single periodic pattern and not much noise, then the pattern is easily detected. If, on the o ther hand, there are a number of periodic patterns and a significant amount of noise is present, then these pat- terns are hard to detect. Such patterns can, nonetheless , often be detect ed by applyi ng a Fourier t ransform to the time series in order to change to a representation in which freq ue ncy informa tion is explicit. In the example that foll ows, it will not be necessary to know the details of the Fourier transfor m. It is eno ugh LO know that, for each time series, the Fourier transform produces a new data obj ect whose attributes are related to frequencies.
Example 2 .10 (Fourier Analysis) . The time series presented in Figure 2.12(b) is the sum of three other time series, two of which are shown in Figure 2. 12(a) and have frequencies of 7 and 17 cycles per second , respectively. T he third time series is random noise. Figure 2. 12(c) shows t he power spectrum that can be computed after applying a Fourier transform to the original time series. (Informally, the power spectrum is proportional to t he square of each frequency attribute.) In spite of the noise, there are two peaks that correspond to the periods of the two original, non-noisy time series. Again, the main point is t ha t better feat ures can reveal important aspects of the data. •
"!.'"" . l ·:·'
' . '
2.3 Data Preprocessing 57
Many o ther sorts of transformations are also possible . Besides the Fourier t ra nsfor m, the wavelet t r a ns form has also proven very usefu l for time series and other types of data.
Feature Construction
Sometimes the features in the origina l data sets have the necessary information , but it is not in a fo rm suitable for t he dat a m ining algorithm. In this situation, one or more new features constructed out of the original features can be more useful t han the original features .
Example 2.11 (Density). To illustrate this, consider a data set consisting of information about historical artifacts , which, along with other information, contai ns the volume and mass of each artifact. For simplicity, assume that t hese artifacts are made of a small number of materials (wood, clay, bronze, gold) and that we want to classify the artifacts with respect to t he material of which t hey are made. In this case, a density feature constructed from t he mass and volume feat ures, i.e. , density == mass/volume, would most direc tly yield an accu ra te classification. Although there have been some attempts to automatically p erform feature const ruction by exploring simple mathematical combinations of existing attributes , the most commo n ap proach is to construct features using domain expertise. •
2.3.6 Discret ization a nd B in a rization
Some data mining algorithms, especially certain classification algorithms, re- quire t hat the data be in the form of categorical attributes. Algorithms that find association patterns require that the data be in the form of binary at- t ributes. T hus, it is oft en necessary to transform a conti nuous attribute into a categorical attribute (d iscretization), and both continuous and discrete attributes may need to be transformed into one or more binary attributes (b inarizat ion). Additionall y, if a categorical attribute has a large number of val ues (categories), or some values occur infrequently, then it may be beneficial for certain data mining tasks to red uce the nu mber of categories by combining some of t he val ues.
As with feature selection, the best discretization and binarization approach is the one that "produces t he best result for the data mining algorithm t hat will be used to a nalyze the data'' It is typically not practical to apply such a criterion directly. Consequent ly, discretizat ion or binarization is performed in
58 C h apter 2 Data
Table 2.5. Conversion of a categorical allribu te to three binary attributes.
Categorical Value Integer Value XJ X2 XJ awful 0 0 0 0 pour 1 0 0 1 OK 2 0 1 0 good 3 0 1 1 great 4 1 0 0
Table 2.6. Conversion of a categorical attribute to five asymmetric binary attributes.
Categorical Value Integer Value XJ X2 X3 x4 Xs awful 0 1 0 0 0 0 poor 1 0 1 0 0 0 OK 2 0 0 1 0 0 good 3 0 0 0 1 0 great 4 0 0 0 0 1
a way t ha t satisfies a criterion that is tho ught to have a relationship to good performance for the data mining task being considered .
Binarizatio n
A sim ple technique to binarize a categorical attri bute is the following: If there are m categorical values, then uniquely assign each original value to an integer in the interval [0, m - 1 ]. If t he attribute is ordinal, then order must be maintained by the assignment. (Note that even if the attribute is originally represented using integers, this process is necessary if the integers are not in the interval [0 , m - 1].) Next, convert each of these m integers to a binary number. Since n = Pog2(m)l binary digits are requi red to represent t hese integers, represent these binary numbers using n binary attributes. To illustrate, a categorical variable with 5 values {awful, poor, OK, good, great} would req uire three binary variables X J , x2, and X3. The conversion is shown in Table 2.5.
Such a transformation can cause complications, such as creating unin- tended relationsh ips among the transformed attributes. For example, in Table 2.5, attributes x2 and X3 are correlated because information about t he good value is encoded using both attributes. Furthermore, associa tion analysis re- qu ires asymmetric binary attribu tes, where only the presence of the attribu te (value = 1) is important. For association problems, it is t herefore necessary to introduce one binary attribute for each cat egorical value, as in Table 2.6. If the
2. 3 Data Preprocessing 59
num ber of resulting attri butes is too large, then the techn iques described below can be used to reduce the number of categorical values before binarization.
Likewise, for association problems, it may be necessary to replace a single binary attribute with two asymmetric binary attributes. Consider a binary attribute that records a person's gender, male or female. For t radi tional as- sociation rule algorithms, this information needs to be transformed into two asymmetric binary attributes, one that is a 1 only when the person is male and one t hat is a 1 only when t he person is female. (For asymmetric binary attributes, the information representation is somewhat inefficient in that two bits of storage a re requi red to represent each bit of information.)
Discr etization of Continuous Attributes
Discretization is typically appUed to attributes that are used in classification or association analysis. In general, the best discretization depends on the algo- rithm being used, as well as the other attributes being considered. Typically, howeve r, t he discretization of an attribute is considered in isolation.
Transformation of a continuous attribute to a categorical attribute involves two su btasks: deciding how many categories to have and determi ning how to map t he values of the continuous a ttribute to these categories . In the first step, after the values of t he continuous attribute are sorted, t hey are then divided into n intervals by specifying n- 1 split points. In the second , rather t rivial st.ep, all the values in one interval are mapped to the same categorical value. Therefore, the problem of discretization is one of deciding how many split points to choose and whe re to place them . T he result can be represented either as a set of intervals {(xa,x !] , (x1.x2J, .. . ,(xn-J ,Xn)}, where x 0 and Xn may be +oo or -oo, respectively, or equivalently, as a series of inequalities XQ < ."l: :5 X], . . . 1 Xn-1 <X< Xn.
Unsupervised Discretization A basic distinction between discretization methods for classification is whether class information is used (supervised) or not (unsupervised). If class info rmat ion is not used, then relatively simple approac hes are common. For ins tance, the equ a l width approach divides the range of the attribute into a user-specified numbe r of intervals each having the same width . S uch an app roach can be badly affected by out liers, and for that reason , an e qual frequ e n cy (equa l depth) approach, which tries to put the same number of objects into each inter~al , is often preferred . As another example of unsupervised discretization, a clustering method, such as K-mea.ns (see Chapter 8), can also be used. Finally, visually inspecting the data can sometimes be an effect ive approach.
6 0 Chap ter 2 Data
Exam ple 2.12 (Discretizat io n Techniques) . This example demonstrates how these approaches wor k on an actual data set . Figure 2.13(a) shows data points belonging to four diffe rent groups, along with two outliers-the large dots on either end. The techniques of the previous paragraph were applied to discretize the x values of t hese d ata p oints into four categor ical values. (Points in the d ata set have a random y component to make it easy to see how many points are in each group.) Visually inspecting t he data works quite • we ll , but is not aut omatic, and thus, we focus on t he other three approaches. The sp lit points produced by the techniques equal widt h, equal frequency, and K-rneans are shown in Figures 2.13(b), 2.13(c), and 2.13(d) , respectively. The split points are re presented as dashed lines. If we measure the per formance of a discretization technique by the extent to which different objects in different groups are assigned t he same categor ical val ue, t hen K-means performs best , followed by equal fr equency, and fi n ally, eq ual wid th. •
S u p ervised D iscr etization T he disc retization method s described above are usually better t han no d iscretization, b ut keeping the end purpose in mind and using additional information (class labels) often produces better results. T his s hould not be surprising, since an interval constructed with no knowledge of class labels often contains a mixture of class labels. A conceptually simple approach is to p lace the splits in a way t hat maximizes th e pur ity of the interva ls. In practice, however, such a n approach requires potentially arbitrary decisions about the purity of an interval and the minimum size of an interval. To overcome such concerns, some statistically based approaches start with each attribute value as a separate interval and create larger intervals by m erging adjacent intervals that are similar according to a statistical test. Entropy- based ap proaches a re one of the most promising approac hes to discret ization, and a s imple approach based on entropy will be presented.
First, it is n ecessary to define e ntJ·opy. Let k be t h e number of different class labels , m; be the number o f values in the i th interval of a partition, and m ; j be the number of values of class j in interval i. Then the entropy e; of the ith interval is given by the equation
k
e; = L Pij log2 Pii, 1=1
where Pii = ffiij/m ; is the probability (fraction of values) of class j in the i th interval. The total entropy, e, of t he partition is the weighted average of the individual interval entropies, i.e.,
•
0
•
,·~: .. ,,
::~ ·· . .. .''· . . .... . . ... : · .. '· •.. 5
· .. .. .. . -.. . ... . :
.. ...
10
. ·, .•. ... · . .. . '· : .... .. •
. •·· ·'
15
(a ) Original data.
... .... , I ~~ " ' 4'
" ... : - ... . :-.;~
"• I ., . . ... . ... , .. .......
··,.~ ' \ ~ r ,
··:·
! ! : I ..J . . .. ,
I I: .... 0 I
I • • ~
. -.. : .. I 0
~" ::: ' I • • I ,
I
,, .. : . I • I I
.... • I
·'i'. ... \ .. I • . ' .. ~· · \ .• I .
1'; . : .... ,, .. I ' •
, I
I• '· .. 1,.• •
" . }'
• •
20 0
• •
2. 3 D ata P reprocessing 61
.. .. ..... I ~. .,,, ... :'{ ., .
·1, ••
.. ::r·;. . .. . .,. ,. 'l 't
1·.· . i· · 5
I
1 ~
•, , I
1( -1. I ... ~ .-.. · ~
.. ~ . ~ ·: • r ~. 'I
' .. , ,. . ., ·' • I'
10
. '\ .. ~ 1, ...
'4 • •
I '
' '· I, . .. 'I •"' .. ~i . :, .. ' ' ·· '":
, I ~ ...
... :• . , .. -:1 .,
:~ ·.' 15
(b) Equal width discreti zat ion.
" I '• I '.• ' I
J J , I ...• '
• I . : ~ • I .J
· .. : · .. • r: ::~·· . : ...
• f I I ' o ~
., ! .- .. : .. -~·. ·: .::"' :. ! . .. :' : ~ . :· ' , ' 1 I ' I"' I , I
": : ,, . ~ , 'I I ~
",• I I I I
. .... \ ~· ·. •' .. ... .•
~·~ · ,:_..· . ..
•
20
•
0 5 10 15 20 0 5 10 15 20
(c) Equal freque ncy discretizatio n. (d) !<-means discretization.
Figure 2.13. Different discretization techniques.
11
e = l: wiei , i=l
where m is t he number o f values, w; = m;fm is the fr act ion of values in the i th interval , a nd n is the numbe r of intervals. Intuitively, the entr opy of an interval is a m easure o f t he pur ity of an interval. If an inter val contains only values of one class (is perfect ly pure) , then the entropy is 0 and it contri b utes
62 Chapter 2 Data
nothing to the overall entropy. If the classes of values in an interval occur equally often (the interval is as impure as possible), then the entropy is a maximum.
A simple approach for partitioning a continuous attribute starts by bisect- ing the initial values so that the resulting two intervals give minimum entropy. T his technique only needs to consider each value as a possible split point, b e- cause it is assumed that intervals contain ordered sets of values. The split ting process is then repeated with another interval, typically choosing the interval with the worst (highest) entropy, until a user-specified numbe r of intervals is reached, or a stopping criterion is satisfied .
Exam ple 2.13 (Discr et izatio n o f Two A ttributes) . This method was used to independently discretize both the x and y attributes of t he two- dimensional data shown in Figure 2.14. In the first discretization, shown in Figure 2.14(a), the x andy attributes were both split into three intervals. (The dashed lines indicate the split points.) In the second discretization, s hown in Figu re 2.14(b) , t he x and y attributes were both split into five intervals. •
This simple example illustrates two aspects of discretization. First, in two dimensions, the classes of points are well separated, but in one dimension, this is not so. In general, disc retizing each attribute separately often guarantees suboptimal results. Second, five intervals work better than three, but six intervals do not improve the discretization much, at least in terms of entropy. (Entropy values and results for six intervals are not shown.) Consequently, it is desirable to have a stopping criterion that automatically finds the right number of partitions.
Categorical A t t r ibut es wi t h Too Many Va l ues
Categorical attributes can sometimes have too many values. If the categorical attribute is an ordinal attribute, then techniques similar to those for con- tinuous attributes can be used to reduce the number of categories. If the categorical attribute is nominal, however, then other approaches are needed. Consider a university that has a large number of departments. Consequently, a department name att ribute might have dozens of different values. In this situation, we could use our knowledge of the relationships among different departments to combine departments into larger groups, such as engineering, social sciences, or biological sciences. If do main knowledge does not serve as a useful guide or such an approach results in poor classification performance, then it is necessary to use a mo re empirical approach, such as grouping values
2.3 Data Preprocessing 63
(a) Three inte rvals (b) Five intervals
Figure 2.14. Discretizing x andy attributes for fou r groups (classes) of points.
together only if such a grouping results in improved classification accuracy or achieves some other data mining objective.
2.3.7 Var iable Tran sformation
A variable transformatio n refers to a transformation t hat is applied to all the values of a variable. (We use the term variable instead of attri bute to ad- here to common usage, although we will also refer to attribute transformation on occasion.) In other words, for each object , t he transformation is applied to the value of the variable fo r that object. For example, if only the magnitude of a variable is important, then the values of the variable can be transform ed by t aking the absolute value. In the following section, we discuss two impor- tant types of variable transformations: simple functional transform ations and normalization .
S imple Functions
For this type of variable transformation, a simple mathematical function is applied to each value individuall y. If x is a variable, then examples of such t ransformations include xk, log x, e"', ../X, 1/ x, sin x, or lxl. In statistics, vari- able transformations, especiall y sqrt, log, and 1/x, are often used t o transform data that does not have a Gaussian (normal) distribution into data t hat does. While this can be important, other reasons often take precedence in data min-
----~
~--- -·- ·-· - ==·==-=---==--=-===================~iiiiii~~=~~====.==========
64 Chapter 2 Data
ing. Suppose the variable of interest is the number of data bytes in a session, and the number of bytes ranges from 1 to 1 billion. This is a huge range, and it may be advantageous to compress it by using a log 10 transformation . In this case, sessions that t ransferred 108 and 109 bytes would be more similar to each other than sessions that transferred 10 and 1000 bytes (9 - 8 = 1 versus 3 - 1 = 2). For some applications, such as network intrusion detection, this may be what is desired, since the first two sessions most likely represent transfers of large files, while the latter two sessions could be two quite distinct types of sessions.
Variable transformations should be applied with caution since they change the nature of the data. While this is what is desired, there can be problems if the nature of the transformation is not fully appreciated. For instance, the transformation 1/x reduces the magnitude of values t hat are 1 or larger, but increases t he magnitude of values between 0 and 1. To illustrate, the values {1,2,3} go t o {1,!,n, but the values {1,! . ~} go to {1,2,3}. Thus, for all sets of values, the transformat ion 1/x reverses the order. To help clarify the effect of a transformation, it is important to ask questions such as the following: Does the order need to be maintained? Does the t ransformation apply to all values, especially negative values and 0? What is the effect of the transformation on the values between 0 and 1? Exercise 17 on page 92 explores other aspects of variable transformation.
Normalization or Sta ndardizatio n
Another common type of variable transformation is the s tandardization or normalization of a varia ble. (In the data mining community the terms are often used interchangeably. In statistics, however, the term normalization can be confused with the transformations used for making a variable normal, i.e., Gaussian. ) The goal of standardization or normalization is to make an en- tire set of values have a particular property. A traditional example is that of "standardizing a variable" in statistics. If x is the mean (average) of the attribute values and s:r is their standard deviation, then t he transformation x' = (x - x)/ Sx creates a new variable that has a mean of 0 and a standard deviation of 1. lf different variables are to be combined in some way, then such a transformation is often necessary to avoid having a variable with large values dominate the results of the calculation. To illustrate, consider compar- ing people based on two variables : age and income. For any two people, the difference in income will likely be much higher in absolute terms (hundreds or thousands of dollars) than the difference in age (less than 150). If the differ- ences in the range of values of age and income are not taken into account, t hen
2.4 Measu res of Similarity and Dissimilarity 65
the comparison between people will be dominated by differences in income. In particular, if the similarity or dissimilarity of two people is calculated using the sim ilarity or dissimilarity measures defined later in this chapter, then in many cases, such as that of Euclidean distance, the income values will dominate the calculation .
The mean a nd standard deviation are strongly affected by outliers, so the above transformation is often modified. First, the mean is replaced by the median , i.e., the middle value. Second , the st andard deviation is replaced by the absolute stan dard d eviation. Specifically, if x is a variable, then the absol ute standard deviation of x is given by a A = 2..::~ 1 lx; - I-l l. where x; is the i 1h value of the variable, m is the number of objects, and 1-l is either the mean or median. Other approaches for computing estimates of the location (center) and spread of a set of values in the presence of outliers are described in Sections 3.2.3 and 3.2.4, respectively. These measures can also be used to define a standardization t ransform ation.
2.4 Measures of Similarity and Dissimilarity
Similarity and dissimilarity are important because they are used by a number of data m ining techniques, such as clustering, nearest neighbor classification, and anomaly detection. In many cases, the init ial data set is not needed once these similarities or dissimilar ities have been computed. Such approaches can be viewed as transforming the data to a similarity (dissimilarity) space and then performing t he analysis.
We begin with a discussion of the basics: high-level definitions of similarity and dissimilarity, and a discussion of how they are related. For convenience, the term proximity is used to refer to ei t her similarity o r dissimilarity. Since the proximity between two objects is a function of the proximity between the corresponding attributes of tbe t wo objects, we first describe how to measure the proximity between objects having only one simple attribute, and t he n consider proximity measures for objects with mult iple attributes . This in- cludes measures such as correlation and Euclidean distance, which are useful for dense data such as time series or two-dimensional points, as well as the Jaccard and cosine similar ity measu res, which a re useful for sparse data like documents. Next, we consider several important issues concerning proximity measures. The section concludes with a brief discussion of how to select the right proximity measure.
66 C h a p ter 2 Data
2.4.1 Basics
Defini t ions
Informally, the si m ila ri ty between two objects is a numerical measure of the degree to which the two objects are alike. Consequently, similarities are higher for pairs of objects that are more alike. Similarities are usually non-negative and are often between 0 (no similarity) and 1 (complete similarity).
The dissimilar it y between two objects is a numerical measure of the de- gree to which t he two objects are different . Dissimilarities are lower for more similar pairs of objects. Frequently, the term dist a nce is used as a synonym for dissimilarity, a lthough , as we shall see, distance is often used to refer to a special class of dissimilarities. Dissimilarities sometimes fall in the interval [0, I], but it is also common for them to range from 0 to oo.
Tra n s fo r mations
Transforma tions are often applied to convert a similarity to a dissimilarity, or vice versa, or to t ransform a proxim ity measure to fall within a particular range, such as [0,1]. For instance, we may have similarities that range from 1 to 10, but the particu lar algorithm or software package that we want to use may be designed to only work with dissimilarities, or it may only work with similarities in the interval [0,1]. We discuss these issues here because we will employ such transformations later in our discussion of proximity. In addi- tion, these issues are relatively independent of the details of specific proximity measures.
Frequently, proximit.y measures, especially similarities, are defined or trans- for med to have values in t he interval [0, 1] . In formally, the motivation for t his is to use a scale in which a proxim ity value indicates the fraction of similarity (or dissimilarity) between two objects. Such a transform ation is often rela- tively straightforward. For example , if the similarities between objects range from 1 (not at all similar) to 10 (completely similar), we can make them fall wit hin the range [0, I] by using the transformations'= (s - 1)/9, where sand s' are the original and new similarity values, respectively. In the more general case, t he transformation of similarities to the interval [0, 1] is given by the expressions' = (s - min_s)/(max_s - min_s), where max_s and min_s are the maximum and minimum similarity values, respectively. Likewise, dissimilarity measures with a finite range can be mapped to the interval [0, 1] by using the formula d' = (d- min_d)/(max_d- min_d).
There can be various complications in mapping proximity measures to the interval [0, I ], however. If, for example, the proximity measure originally takes
2. 4 Measures of Similarity and Dissimilarity 67
values in the interval [O,oo], then a non-linear transformation is needed and values will not have the same relationship to one another on the new scale. Consider the t ransformation d' = d/(1 + d) for a dissimilarity measure that ranges from 0 to oo. The dissimilarities 0, 0.5, 2, 10, 100, and 1000 will be transformed into the new dissimilarities 0, 0.33, 0.67, 0.90, 0.99, and 0.999, respectively. Larger values on the original dissimilarity scale are compressed into the range of values near 1, but whether or not this is desirable depends on the application. Another complication is that the meaning of the proximity measure may be changed . For example, correlation, which is discussed later, is a measure of similari ty that takes values in the interval [-1, 1]. Mapping these values to the interval [0, 1] by taking the absolute value loses information about the sign, which can be important in some applications. See Exercise 22 on page 94.
Transforming similarities to dissimilarities and vice versa is also relati vely straightforward, al t hough we again face the issues of preserving meaning and changing a linear scale into a non- linear scale. If the s imi larity (or dissimilar- ity) fall s in the interval [0 ,1], then the dissimilarity can be defined as d = 1- s (s = 1 - d). Ano ther simple approach is to define similarity as t he nega- tive of the dissimilarity (or vice versa). To illustrate, t he dissimilarities 0, 1, 10, and 100 can be t ransformed into the similarities 0, -1, - 10, and -100, respectively.
The similarities resulting from the negation transformation are not re- stricted to the range [0, 1], but if that is desired, then transformations such as s = <t±r, s = e- d, or s = 1- ,!~t;;;;~_d can be used . For t he transformation s = d!J , the dissimilarities 0, 1, 10, 100 are t ransformed into 1, 0.5, 0.09, 0.01, respectively. For s = e-d, they become 1.00, 0.37, 0.00, 0.00, respectively, while for s = 1 - ma~~;;'i;;;f,_d they become 1.00, 0.99, 0.00, 0.00, respectively. In this discussion, we have focused on converting dissimilarities to similarities. Conversion in t he opposite direction is considered in Exercise 23 on page 94.
In general, any monotonic decreasing function can be used to convert dis- similari ties to similarities, or vice versa. Of course, other factors also must be considered when transfo rming similarities to dissimilarit ies, or vice versa, or when transforming the values of a proximity measure to a new scale. We have men t ioned issues related to preserving meaning, distortion of scale, and requirements of data analysis tools, but this list is certainly not exhaust ive.
2.4 .2 Simil arity and Dissimila r ity b etween S im ple A t tributes
The proximity of objects with a number of attributes is typically defined by combining t he proximities of individual attri butes, and t hus, we firs t discuss
68 Chapter 2 Data
proximity between objects having a single attribute. Consider objects de- scrib ed by one nominal attribute. What would it mean for two such o bjects to be similar? Since nominal attributes only convey information about the distinctness of objects, all we can say is that two objects either have t he same val ue or t hey do not. Hence, in t his case similarity is traditionally defined as 1 if attribute values match, and as 0 otherwise. A dissimilarity would be defined in the opposite way: 0 if the attribute values match, and 1 if they do not.
For objects with a single ordinal attribute, the situation is more compli- cated because information about o rder should be taken into account. Consider an attribute that measures the quality of a product, e.g., a candy bar, on t he scale {poor, fair, OK, good, wonderful} . It would seem reasonable that a prod- uct, P1, which is rated wonderful, would be closer to a product P2, which is rated good, than it would be to a product P3, which is rated OK. To make t his observation quantitative, the values of t he ordinal attribute are often mapped to successive integers, beginning at 0 or 1, e.g., {poor=O, fair =1 , OK =2, good=3, wonderful=4}. Then, d(P1,P2) = 3-2 = 1 or, if we want the dis- similarity to fall between 0 and 1, d(Pl, P2) = 3~2 = 0.25. A similarity for ordinal attributes can then be defined as s = 1 -d.
T his definition of similarity (dissimilarity) for an ordinal attribute should make the reader a bit uneasy since this assumes equal intervals, and this is not so. Otherwise, we would have an interval o r ratio attribute. Is the difference between t he values fair and good really t he same as that between the values OK and wonderful? Probably not , but in practice, our options are limited, and in the absence of more information, this is the standard approach for defining proximity between ordinal attributes.
For interval or ratio attributes, the natural measure of dissimilarity be- tween two objects is th e absolu te difference of their values. For example, we might compare our cur rent weig ht and our weight a year ago by saying "I am ten pounds heavier." ln cases s uch as t hese, the dissimilarities typically range from 0 to co, rather than from 0 to 1. T he similarity of interval o r rat io at- tributes is typically expressed by t ransforming a similarity into a dissimilarity, as previously described.
Table 2.7 s ummarizes this discussion. In this table, x andy are two objects that have one att ribute of the indi cated type. Also, d(x,y) and s(x,y) are t he dissimilari ty and similarity between x and y, respectively. Other app roaches are possible; t hese are the most common ones.
The following two sections consider more complicated measures of prox- imi ty between objects that involve mul t iple attributes: (1) dissimilarities be- tween data objects and {2) similarities between data objects. This division
2.4 Measures of Similarity and Dissimilarity 69
Table 2.7. Similarity and dissimilarity for simple attributes
Attribut e Dissimilar ity Similarity Type
Nominal d = { ~ if X- y s = { ~ ifx = y if X f' y if X f' y d- !x - y!/(n- 1)
Ordinal (values mapped to integers 0 to n-1, s=l-d where n is the number of values)
Interval or Ratio d = !x- Y! s=-d,s= i+d's=e-a, s=l- d-min.d max d-m i n d
allows us to more naturally display the underlying motivations for employing various proximity measures. We emphasize, however, that similarities can be transformed into dissimilarities and vice versa using the approaches described earlier.
2.4.3 Dissimilari ties between Data Objects
In t his section, we discuss various kinds of dissimilarities. We begin with a discussion of dis tances , which are dissimilarities with certain properties, and then provide examples of more general kinds of dissimilarities.
Distances
We first present some examples, and t hen offer a more formal description of distances in terms of the properties common t o all distances. The Euclidean dis tance, d, between two points, x and y, in one-, two-, three-, or higher- dimensional space, is given by the following familiar fo rmula:
n
d(x, y) = ,L)xk - Yk)2, {2.1 ) k=l
where n is the number of dimensions and Xk and Yk are, respect ively, the kth attri butes (components) of x and y . We illustrate t his formula with Figure 2.15 and Tables 2.8 and 2.9, which show a se~ of points, t he x andy coordinates of t hese points, and the di stance matrix containing the pairwise distances of these points.
70 C h ap t er 2 Data
T he Euclidean dist a nce measure given in Eq uat ion 2.1 is generalized by t he Minkowski distance met ric shown in Equation 2.2,
(2.2)
where r is a parameter. The following are the three most common examples of Minkowski distances.
• r = l. City block (Ma nhatt an, taxicab, L1 norm) distance. A common example is the Hamming distan ce, which is the number of bits that are different between two objects that have only binary attributes, i.e., between two binary vectors.
• r = 2. Euclidean distance (L2 norm).
• r = oo. Supremum (Lma:r or L00 norm) distance. This is the maximu m difference between any attribu te of the objects . More formall y, t he L00 dist ance is defi ned by Equation 2.3
(
n ) 1/r
d(x,y) = r~~ L lxk - Ykir k=l
(2.3)
The r parameter should no t be confused with the number of dimensions (at- tribu tes) n. The Euclidean, Manhattan, and supremum distances are defined for all values of n: 1, 2, 3, .. . , and speci fy different ways of combining the differences in each dimension (a.tt ribute) into a n overall distance.
Tables 2.10 and 2.11, respectively, give the proximity matrices for the L1 and Loo distances using data from Table 2.8. Notice that all these distance matrices are sy mmetric; i.e., the ijlh entry is the same as t he jith entry. In Table 2.9, for instance, the fourth row of the first column and t he fourth column of the first row both contain the value 5.1.
Distances, such as the Euclidean distance, have some we ll-known proper- ties. If d(x, y) is the dist ance between two points, x and y, then the following properties hold.
1. Pos it ivity
(a) d(x,x) ~ 0 for all x andy,
(b) d(x,y) = 0 only if x = y.
2.4 Measures of Similarity a nd Dissimilarity 71
y
3
2 p1
p2
2
p3
•
3 X
4
p4
•
5
Figure 2.1 5. Four two-dimensional points.
6
Table 2.8. x andy coordinates of four points. Table 2.9. Euclidean distance matrix for Table 2.8.
point x coordinate y coordinate pl p2 p3 p4 p l 0 2 pl 0.0 2.8 3.2 5.1 p2 2 0 p2 2.8 0.0 1.4 3.2 p3 3 1 p3 3.2 1.4 0.0 2.0 p4 5 1 p4 5.1 3.2 2.0 0.0
Table 2.10. L1 distance matrix for Table 2.8. Table 2.11. L00 distance matrix for Table 2.8.
L1 pl p2 p3 p4 Loo pl p2 p3 p4 pl 0.0 4.0 4.0 6.0 pl 0.0 2.0 3.0 5.0 p2 4.0 0.0 2.0 4.0 p2 2.0 0.0 1.0 3.0 p3 4.0 2.0 0.0 2.0 p3 3.0 1.0 0.0 2.0 p4 6.0 4.0 2.0 00 p4 5.0 3.0 2.0 0.0
2. Symm etr y d(x,y) = d(y,x) for all x andy.
3. Triangle Inequ al ity d(x, z) ::; d{x, y) + d(y , z) for all points x, y, and z.
Measures that satisfy all t hree properties are known as metr ics . Some people only use t he term distance for dissimilarity measures that satisfy these proper ties, bu t that practice is often violated . The t hree properties described here are useful, as well as mathematically pleasing. A lso, if the t riangle in- equality holds, then this property can be used to increase the efficiency of tech- niques (including clustering) that depend on distances possessing this property. (See Exercise 25.) Nonetheless, many dissimilarities do not satisfy one or more of the metric properties. We give two examples of such measures.
72 C h apter 2 Da.ta
E xample 2 .14 (No n- met r ic D issi milarities: Set Difl"eren ces) . This ex- ample is based on the notion or the difference of two set s, as defined in set theory. Given two sets A and B, A- B is the set of elements of A that are not in B. For example, if A = {1,2,3,4} and B = {2,3,4}, then A - B = {l} and B - A = 0, the ernpty set. We can define the dis t ance d between two sets A and n as d(A, B) = size( A - B), where size is a functio n retur ning the number of elements in a set. T his distance measure, which is an integer value greater than or equal to 0, does not satisfy the second part of the pos- itivity property, the symmetry property, or the triangle inequality. However, these prope rties can be made to hold if t he dissimilarity measure is modified as follows: d(A, B) = size( A- B) + s·ize(B - A). See Exercise 21 on page 94. •
Examp le 2. 1 5 (No n- metr ic D issim ilariti es: Time). This example gives a more everyday example of a dissimilarity measure that is not a metric, but t hat is still useful. Defi ne a measure of the distance between t imes of the day as follows:
{ t2 - tl if tl :s t2 }
d(tl , t2) = 24 + (t2 - tl) if tl ~ t2 . (2.4)
To illustrate, d(1PM, 2PM) = 1 hour, while d(2PM, lPM) = 23 hours. Such a definition would make sense, for example, when answering t he question: "If an event occurs at 1P M every day, and it is now 2PM, how long do I have to wait for that event to occur again?" •
2.4.4 S im ila r iti es between D ata O b j ects
For similarities, the triangle inequa lity (or the a nalogous property) typically does no t hold, but symmetry and positivity typically do. To be explicit , if s(x, y) is the s imilarity between points x and y , t hen t he typical properties of similarities are the following:
1. s(x,y) = 1 only if x = y. (0 :S s :S 1)
2. s(x,y) = s(y,x) for all x and y. (Symmetry)
T here is no general a nalog of the triangle inequality for sim ilarity mea- sures. It is sometimes possible, however, to show that a similarity measure can easily be converted to a metric distance. The cosine and Jaccard similarity measures, which are discussed shortly, are two examples. Also, for specific sim- ilarity measures, it is possible to derive mathematical bounds on the similarity between two objects t hat are similar in spirit to the triangle inequality.
2 .4 Measures of Sim il arity a nd Dissimilarity 73
Example 2 .1 6 (A Non-sy m metric Simila r ity Measure). Consider an experiment in which people are asked to classify a small set of characters as they flash on a screen. The confusion mat r ix for this experiment records how often each character is classified as itself, and how often each is classified as another character. For instance, suppose tha t "0" appeared 200 times and was classified as a "0" 160 times, but as an "o" 40 t imes. Likewise, suppose that 'o ' appeared 200 t imes and was classified as an "o" 170 times, but as "0" only 30 t imes. If we take these counts as a measure of the similarity between two characters, then we have a similarity measu re, but one that is not symmetric. In such sit uations, the similarity meas ure is often made symmetric by setting s'(x, y) = s'(y, x) = (s(x, y) + s(y , x))/2, where s' indicates the new similari ty measure. •
2.4.5 Exam p les of P roximity Measures
This section provides specific examples of some similarity and dissim ilarity measures.
Similarity M easu res for B in ary Data
Similarity measures between objects that contain only binary a ttributes are called s im ilarity coefficien t s , and typically have values between 0 and 1. A value of 1 indicates that t he two objects are completely similar, while a value of 0 indicates that the objects are not a t all similar. There are many rationales for why one coefficient is better than another in specific instances.
Let x and y be two objects that consist of n binary attri butes. The com- parison of two such object s, i.e. , two binary vectors, leads to the following fou r quantit ies (frequencies):
f oo = the number of attributes where x is 0 and y is 0 J01 = the number of attributes where x is 0 and y is 1 JJO = the number of attributes where x is 1 and y is 0 f 11 = the number of attribut es where x is 1 and y is 1
Si m p le Matching Coefficient One commonly used similarity coefficient is the s imple match in g coefficient (SMC) , which is defined as
number of matching attribute values !11 + foo ( 2 . 5 )
S M C = = -,----:..c..;;--=:::"'--:- number of attributes /o1 + !10 + /u + foo
74 Chapter 2 Data
Th is measure counts both presences and absences equally. Consequently, the SMC could be used to find students who had answered questions similarly on a test that consisted only of true/false questions.
J accard Coefficien t Suppose that x andy are data objects that represent two rows (two transactions) of a transaction matrix (see Sect ion 2.1.2) . If each asymmetric binary attribute corresponds to an item in a store, then a 1 indi- cates that t he item was purchased , while a 0 indicates that the product was not purchased . Since the number of products not purchased by any customer far outnumbers t he number of products t hat were purchased, a similarity measure such as SMC would say that all transactions are very similar. As a result, the Jaccard coefficient is frequently used to handle objects consisting of asymmet- ric binary attributes. The Jaccard coefficient, which is often symbolized by J, is given by the following equation:
J = number of matching presences _ f 11 numbe r of attributes not involved in 00 matches - fo 1 + f 10 + f 11 •
(2.6)
Example 2 .17 (The SMC and J accard Similarity Coefficients) . To illustrate the difference between t hese two similarity measures, we calculate SMC and J for the following two binary vectors.
X= (J,0,0,0,0,0,0,0,0,0) y = (0,0,0,0,0,0,1,0,0, 1)
fm = 2
ho = 1 foo = 7 fn = 0
the number of at tri butes where x wa.s 0 a.nd y was 1 the number of attributes where x was 1 and y was 0 the number of attributes where x was 0 a.nd y was 0 the number of attributes where x was 1 and y was 1
SMC = ln+!oo - ___9±Z_ - 0 7 fo>+l>o+!n+foo- 2 + 1+0+7 - ·
J = '" __ o _ _ o lot+ J,o+ I n - 2+1+0 -
Cosine S imilarity
•
Documents are often represented as vectors, where each attribute represents the frequency with which a particular term (word) occurs in the document. It is more complicated than this, of course, since certain common words are ig-
2.4 Measures of Similarity and Dissimilarity 75
nored and various processing techniques a re used to account for d ifferent fo rms of the same word, differing documen t lengt hs , and d ifferen t wo rd frequencies.
Even though documents have thousands or tens of thousands of attributes (terms), each document is sparse since it has relatively few non-zero attributes. (The normalizations used for documents do not create a non-ze ro entry where there was a zero entry; i.e., t hey preserve sparsity.) Thus, as with transaction data, similarity should not depend on the number of shared 0 val ues since any two documents are likely to "not contain" many of the same words, and t herefore, if Q-0 matches a re counted, most documents will be highly similar to most other doc uments. Therefore, a similarity measure for documents needs to ignores 0-0 matches like the Jaccard measure, but also must be able to handle non-binary vectors. The cosine similarity, defined next, is one of the most common measure of document similarity. If x and y are two document vectors, then
x·y cos(x,y) = ll xllllyiJ' (2.7)
where · indicates the vector dot product, x · y = L:;~= l XkYk, and ll x ll is the
length of vector x , llxll = /L:::~=l x~ = ,;x-:x. Exam pl e 2 .18 ( Cosine S imi lari ty o f Two Document Vectors) . This exam ple calculates the cosine similarity for the following two data objects, which might. represent document vectors:
X= (3,2,0,5, 0,0,0,2,0, 0) y = (1,0,0,0,0,0,0, 1,0,2)
X·y = 3• 1 +2•0+0•0+5•0+0•0+0•0+0•0+2• ] +0•0+0•2 = 5
IJxll = J3 • 3 + 2 • 2 + 0 • 0 + 5 • 5 + 0 • 0 + 0 • 0 + 0 • 0 + 2 • 2 + 0 • 0 + 0 • 0 = 6.48 IJyiJ = J1 • 1 + 0 • 0 + 0 * 0 + 0 • 0 + 0 • 0 + 0 • 0 + 0 • 0 + 1 * 1 + 0 * 0 + Z. 2 = 2.24 cos(x,y) = 0.31
• As indicated by Figure 2.16, cosine similarity really is a measure of the
(cosine of the) angle between x andy. Thus, if t he cosine similari ty is 1, the angle between x and y is 0°, and x and y are the same except for magnitude (length). If the cosine similarity is 0, then the angle between x andy is 90°, and they do not share any terms (words).
76 Chapter 2 Data
A y Figure 2.16. Geometric illustration of the cosine measure.
Equation 2. 7 can be written as Equation 2.8.
X Y 1 I cos(x , y) = W · M = x · Y , (2.8)
where X 1 = x/Jixll and y 1 = y /JIYII· Dividing x andy by their lengths normal- izes them to have a length of 1. This means that cosine similarity does not take the magnitude of the two data objects into account when computing similarity. (Euclidean distance might be a better choice when magnitude is important.) For vectors with a length of 1 , the cosine measure can be calculated by taking a simple dot product. Consequently, when many cosine similarities between objects are being computed, normalizing the obj ects to have unit length can reduce t he time required.
Extended J accard Coefficient (Tanimoto Coefficient)
The extended Jaccard coefficient can be used for docu ment data and that re- duces to the Jaccard coefficient in the case of binary attributes. The extended Jaccard coefficient is also known as the Tanimoto coefficient. (However , there is anot her coefficient that is also known as the Tanimoto coefficient. ) This co- efficient, which we shall represent as EJ , is defined by the following equation:
Corr elation
X·y EJ(x,y) = Jlxii 2 +11YJI 2 -x·y · (2.9)
The correlation between two data objects that have binary or continuous vari- ables is a measure of the linear relationship between the attributes of the objects. (The calcu lation of correlation between attributes, which is more common, can be defined similarly.) More precisely, Pearson's correlation
2.4 Measures of Sim ilari ty and Dissimilarity 77
coefficient between two data obj ects, x and y, is defined by the following equation:
covariance( x , y ) Sxy corr(x,y) = d d d · · ( ) d d d · · ( ) = -, stan ar _ ev1at1on x * stan a r _ ev1at10n y S:z: sy (2.10)
where we are using the following standard st atis tical notation and definitions:
1 n covariance(x,y) = Sxy = - - '"'(xk- x)(yk- y)
n -1 L..,
standard _d eviation (x)
standard_deviation (y)
k=l
I n - ""'(Yk - Y)2 n -lL..,
k=l
1 n ;:; L:xk is the mean of x k=l
1 n - L Yk is the mean of y n
k=l
(2.11)
Example 2.19 (Perfect Corr e lation) . Correlat ion is always in the range - 1 to 1. A correlation of 1 ( -1) means that x and y have a perfect positive (negative) linear relationship; that is, Xk = ayk + b, where a and b are con- stants. The following two sets of values for x and y indicate cases where the correlation is -1 and + 1, respectively. In the fi rst case, the means of x and y were chosen to be 0, for simplicity.
X= (-3, 6, 0, 3, -6) y=( 1, -2, 0,-1, 2)
X = (3,6,0,3,6) y = (1,2,0, 1,2)
•
78 C hap ter 2 Data
- 1.00 -0.90 -0.80 -0.70 -0.60 0.50 -0.40
~~~~~~ -0.30 -0.20 -0. 10 0.00 0.10 0.20 0.30
0
~~ o"o~~ 0.40 0.50 0.60 0.70 0.80 0.90 1.00
Figure 2.17. Sca"er plols illuslrating correlalions from -1 lo 1.
Example 2.20 (Non-linear R e la tio ns hips). If the cor relation is 0, then there is no linear relationship between the attributes of the two data objects. However, non-linear relationships may still exist. In the following example, Xk = y~, but their correlation is 0.
x= (-3,-2, - 1, 0, 1, 2, 3) y = ( 9, 4, l' 0, 1, 4, 9)
• Example 2.21 (Vis u a lizin g Cor rela tion). 1t is also easy to judge the cor- relation between two data objects x and y by plotting pairs of corresponding attribut e values. Figure 2. 17 shows a number of these plots when x and y have 30 attributes and the values of t hese attributes are randomly generated (with a normal distribution) so that the correlation ofx andy ranges from - 1 to 1. Each circle in a plot represents one of the 30 attributes; its x coordinate is the value of one of the attributes for x, while its y coordinate is the value of the same attribute for y. •
If we transform x and y by subtracting off their means and then normaliz- ing them so that their lengths are 1, then their correlation can be calculated by
2.4 Measures of Similarity and Dissimilarity 79
taking the do t product. Notice that this is not the same as the standardization used in other contexts, where we make the transformations, x~ = (xk - x)/ s:r. and Yk = (Yk - Y)/ Sy·
Bregman D ive r gen ce• This section provides a brief desc ri ption of Breg- man divergences, which are a family of proximity functions that share some common properties. As a result, it is possible to construct general data min- ing algorithms, such as clusteri ng algorithms, that work with any Bregman divergence. A concrete example is the K-means clustering algori thm (Section 8.2). Note that this section requires kn owledge of vector calculus.
Bregman divergences are loss or distortion functions . To understand the idea of a !oss function, consider the following. Let x and y be two points, where y is regarded as the original point and x is some distortion or approximation of it. For example, x may be a point that was generated, fo r example, by adding random noise to y . The goal is to measu re the resu lting distortion or loss t hat results if y is approximated by x. Of course, the more similar x and y are, the smaller the loss or distortion . Thus, Bregman d ivergences can be used as dissimilarity functions.
More fo rmally, we have the following defin ition.
D e fini t ion 2.6 (Bregm an Divergence). Given a strictly convex function ¢ (with a few modest restrictions that are generally satisfied), the Bregman divergence (Joss function) D(x,y) generated by that function is given by the following equation:
D (x,y) = ¢(x ) - ¢(y)- ('i7¢(y) , (x - y)) (2.12)
where 'i7¢(y) is the gradient of¢ evaluated at y, x - y , is the vector difference between x andy, and (\7</>(y),(x- y) ) is the inner product between \l<f>(x) and (x- y). For points in Euclidean space, the inner product is just the dot product.
D(x,y) can be written as D(x,y) = ¢(x)- L(x), where L(x) = ¢(y) + (\7</>(y), {x- y)) and represents t he equation of a plane that is tangent to the function </> at y. Using calculus terminology, L(x) is the linearizat ion of¢ around the point y and the Bregman divergence is just the difference between a funct ion and a linear approximation to that function. Different Bregman divergences are obtained by using different choices for ¢.
Example 2.22 . We provide a concrete exam ple using squared Euclidean dis- tance, but restrict ourselves to one dimension to simpli fy the mathematics . Let
80 Chapter 2 Da t a
x and y be real num bers and ¢(t) be the real valued function, ¢(t) = t 2 In that case, the gradient reduces to th e derivative and the dot product reduces to multiplication. Specifically, Equa ti on 2.12 becomes Eq ua t ion 2.13.
D(x, y) = x 2 - y2 - 2y(x - y) = (x- y) 2 (2.13) The graph for this example, with y = 1, is shown in F igure 2.18. The
Bregman divergence is shown for two val ues of x: x = 2 and x = 3. •
Figure 2.1 B. Illustration of Bregman divergence.
2.4 .6 Issu es in Proximity Calculation
This section discusses several important issues related to proximi ty measu res : (1) how to handle t he case in whkh attri butes have different scales and / or are correlated, (2) how to calculate proximity between objects that are composed of different types of attributes, e .g., quantitative and qualitative, (3) and how to handle proximity calculation when attributes have different weights; i.e. , when no t a ll attributes contribute equally to t he proximity of o bjects.
2.4 Measures of Similarity and Dissimilarity 81
Standardization and Corre lation for D istan ce Measures
An import ant issue with distance measures is how to handle the si t uation when att ributes do no t have the same range of values. (This situation is often described by saying that "the variables have different scales.") Earlier, Euclidean dist ance was used to measure the distance between people based on two attributes: age and income. Unless these t wo attrib utes are standardized, the distance between two people will be dominated by income.
A related issue is how to compute distance when there is correlation be- tween some of the a t t ri butes, perhaps in additio n to difrerences in the ranges of values. A generalization of Euclidean dis tance , the Mahalan obis distance , is useful when att ributes are correlated, have different ranges of values (dif- ferent variances), and the distribution of the data is app roximately Gaussian (normal). Specifically, the Mahalanobis distance between two objects (vectors) x and y is defined as
mahalanobis(x,y) = (x- y) :E- 1 (x- y)T, {2.14)
where :E - 1 is the inverse of the covariance matrix of the data. Note that the covariance matrix L: is the matrix whose ij'h entry is the covariance of the ith and j'h attributes as defined by Equation 2.11.
Example 2.23. In Figure 2. 19, there are 1000 points, whose x and y at- tri butes have a correlation of 0.6. The distance between t he two large points at the opposit e ends of the long axis of the ellipse is 14.7 in terms of Euclidean distance, but only 6 with respect to Mahalanobis distance. In practice, com- put ing the Mahalanobis distance is expensive, but can be wor t hwhile for data whose attributes are correlated. If the attributes are relatively uncorrelated, but have different ranges, then standardizing t he variables is sufficient.
•
Combining Similarities for H e terogeneous Attributes
The previous definitions of similarity were based on app roaches that assumed all the attributes were of the same type. A general approach is needed when the a ttri butes are of different t ypes. One st raightforward app roach is to compute t he similarity between each attribute separately using Table 2.7, and then combine t hese similarities using a method tliat results in a similarity between 0 and l. Typically, the overall similarity is defined as the average of all the individual attribute similarities.
82 Chapter 2 Data
5 . ··· ··· . .... .
4
3 ... . . ... · .... ..... ' .. . ' ... : -:· ... · ... : ... : ." ,. ;· .·: ·' .. . ..... ::· - ~ .....
2
1 · ·· · ··- -:·-·· · ··
>- 0 .... .... -;.
-1
-2 .... .. . ~ . '. . ~ . ·.. : . . : .....
-3 . ... ~ .. . :· ... . : .... : ;: .. ,:--: .: :
-4 ........ :. ........ : ••..•... : . . . ··· ··· ····· -·· · ··················· .. . .
-~~----~6-----~~----~2~--~0----~2~---i-----6~--~8
Figure 2.19. Set of two-dimensional points. The Mahalanobis distance between the two points rep re- sented by large dots is 6; their Euclidean distance is 14.7.
Un fortunately, this approach does not work well if some of the attributes are asymmetric attributes. For example, if all the attributes are asy mmetric binary attributes, then the similar ity measure suggested previously reduces to the s imple matching coefficient, a measure that is not appropriate for asym- metric binary attri butes. T h e easiest way to fix this probl em is to omit asym- metric attributes from the similarity calculation when their values are 0 for both of the objects whose similarity is being computed . A similar approach also works well for handling missing values.
In summary, Algorithm 2.1 is effective fo r computing an overall similar- ity between two obj ects, x and y, with different types of attributes. This procedure can be easily modified to work with dissimilarities.
Using W eig hts
In much of the previous discussion, a ll attributes were treated equally when computing proximity. This is not desirable when some attributes are more im- portant to the d efinjtjon of proximity than others. To address these situations,
2.4 Measures of Similarity and Dissimilarity 83
Algorithm 2.1 Similarities o f he terogeneous objects. J: For the k 'h attribute, compute a similarity, sk(x , y), in the range 10, 1]. 2: Defi ne an indicator variable, ch, for the k'h attribute as follows:
1 0 if the k'h attribute is an asymmetric attribute and
6 = both objects have a value of 0, or if one of the objects
k has a missing value for the k'h attribute otherwise
3: Compute the overall similarity between the two objects using the following for- mula:
. . 1
. ( ) I:~- 1 6ksk(x,y) s1m1 an ty x, y = "" 6 L. k=l k
(2.15)
the formulas for p roximi ty can be modified by weighting the contribution of each attribute.
If the weights wk sum to 1, then (2.15) becomes
. . 1 .t( )- L~=1 wkOkSk (x,y) SliD! an y x, y - '\' n 0 Lk=1 k
(2.16)
The definition of the Min.kowski d istance can also be modified as follows :
(2. 17)
2.4.7 Selecting t he Ri ght Prox imity Measure
The following are a few general obser vations that may be helpfu l. F irst, the ty pe of proximity measure should fit t he type of data. For many types of dense, continuous data, metric distance measures such as Euclidean distance are of- ten used. Proximity between continuous attributes is most often expressed in te rms of d ifferences, and distance measures provide a well-defined way of combining these differences into an over all proxi mity meas ure. Although at- tribu tes can have d ifferent scales and be of differing importance, these issues can often be dealt with as aescribed earlier .
For sparse d ata, which o ften consists o~ asymmetric attri b utes, we typi- cally employ similarity measures that ignore 0- 0 matches. Conceptually, this reflects the fact that, for a pair of complex objects, similarity depends on the number of characteristics they both share, rather than the number of charac- teristics they both lack. More specificall y, for sparse, asym metric data, most
84 C hapter 2 Data
objects have only a few of t he characterist ics described by the attributes, and thus, are hig hly similar in terms of the characteristics t hey do no t have. The cosine, Jaccard , and extended Jaccard measu res are appropriate for such data.
There are other characteristics of da t a vectors that may need to be consid- ered. Suppose, for example , that we are interested in comparing t ime series. If the magnitude of the time series is important (for example, each time series represent total sales of the same organization for a different year), then we could use Euclidean distance. If the time series represent different quantities (for example, blood press ure and oxygen consumption), then we usually want to determine if the t ime series have the same shape, not the same magnitude . Correlation, which uses a buil t-in normalization that accounts for differences in magnitude and level, would be more ap propriate.
l n some cases, transformation or normalization of t he data is im portant for o btaining a proper similarity measure since such transformations are not always present in proximity measures. For instance , time series may have trends or periodic patterns t hat sign ificant ly impact similarity. Also, a proper computation of similarity may require t hat t ime lags be taken into account. Finally, two t ime series may only be similar over specific periods of time. For example, there is a st rong relationship between tempera ture and t he use of natural gas, but only d uring the heating season.
P ractical consideration can also be important. Sometimes, a one or more proximity measures are already in use in a particular field, and thus, others will have answered the question of which proximit y measures should be used. Other times, t he software package or clustering a lgorithm being used may dras tically limit t he choices. lf efficiency is a concern , then we may want to choose a proximity measure that has a property, such as t he t riangle ineq uality, that can be used to reduce t he number of proximity calculations. (See Exercise 25.)
However, if common practice o r practical res trictions do not dictate a choice, then the proper choice of a proximity measure can be a t ime-consuming task that requires careful consideration of both domain knowledge and the purpose for which the measure is being used. A number of diffe rent similarity measures may need to be evaluated to see which o nes produce results that make the most sense.
2.5 Bibliographic N otes
It is essential to unders tand the nature of t he data that is being analyzed, and at a fundamental level, t his is the subject of measurement theory. ln
2 .5 Bibliographic Notes 85
particular, one of t he initial motivations for defining types of attributes was to be precise about which statistical operations were valid for what sorts of data. We have presented the view of measurement theory that was initially described in a classic paper by S. S. Stevens [79). (Tables 2.2 and 2.3 are derived from those presented by Stevens [80).) While this is t he most common view and is reasonably easy to understand and apply, t here is, of course, much more to measurement theory. An authoritative disc ussion can be found in a t hree-volume series on the foundations of measurement theory [63, 69 , 81). Also of interest is a wide-ranging article by Hand [55), which discusses measurement theor y and statistics, and is accompanied by comments from ot her researchers in t he fi eld. Finally, there are many books and articles that describe measurement issues for particular areas of science and engineering.
Data quality is a broad subject t hat spans every discipline that uses data. Discussions of precision, bias, accu racy, and signifi cant figures can be found in many int roducto ry science, enginee ring, and statistics text books. The view of data quality as "fitness for use" is explained in mo re detail in the book by Redman [76). Those inte rested in data quality may also be interested in MIT's Total Data Quality Management program [70, 84). However, the knowledge needed t o deal with specific data quality issues in a particular domain is often best obtained by investigating the data quality practices of researchers in that field.
Aggregation is a less well-defined subject than many o ther preprocessing t asks. However, aggregat ion is one of the main techniques used by the database area of Online Analytical Processing (OLAP), which is discussed in Chapter 3. There has also been relevant work in the area of symbolic data analysis (Bock and Diday [47)). One of the goals in this area is to summarize t raditional record data in terms of symbolic data objects whose attribut es are more complex than t raditional attributes. Specifically , these attri butes can have values that o.re sets of values (categories), intervals, or sets of values with weights (histograms). Another goal of symbolic data analysis is to be able to perform clustering, classification, and other kinds of data analysis on data t hat consists of symbolic data objects.
Sampli ng is a subject t hat has been well studied in statistics and related fie lds. Many introductory statistics books, such as t he one by Lindgren [65], have some discussion on samp)j ng, and there are entire books devoted to the subject, such as the classic text by Cochran [49) . A survey of sampling for data mining is provided by Gu and Liu [54], while a survey of sampling for databases is provided by Olken and Rotem [72]. There a re a number of other data mi ni ng and database-related sampling references that may be of interest,
86 Chapt er 2 Data
including papers by Palmer and Faloutsos [74], Provost et al. [75], Toivonen [82], and Zaki et al. [85].
In statistics, the traditional techniques that have been used for dimension- ality reduc t ion are multidimensional scaling (MDS) (Borg and Groenen [48], Kruskal and Uslaner [64]) and p r incipal component analysis (PCA) (Jolliffe [58]), which is s imilar to s ingular value decomposition (SVD) (Demmel [50]) . Dimensionality reduction is discussed in more detail in Append ix B.
Discretization is a topic that has been extensively investigated in data mini ng. Some classificat ion algorithms only work with categorical data, and association analysis requires binary data, and thus, there is a significant moti- vation to investigate how t o best binarize or discretize continuous attributes. For association analysis, we refer the reader to work by Srikant and Agrawal [78], while some useful r eferences for discretization in the area of classification include work by Dougherty et al. [51], Elomaa and Rousu [52], Fayyad and Irani [53], and Hussain et al. [56).
Feature selection is another topic well investigated in data mining. A broad coverage of this topic is pr ovided in a survey by Molina et al. [71] and two books by Liu and Motada [66, 67]. Other useful papers include those by Blum an d Langley [46], Ko havi an d John [62], and Liu et al. [68].
It is difficult to provide r eferences for the subject of feature transformations because practices vary from one discipline to another. Many statistics books have a discussion of transfor mations, but typically the discussion is restricted to a particular p urpose, such as ensuring the normality of a variable or making sure t hat variables have equal var iance. We offer two references: Osborne [73] and Tukey [83].
While we have covered some of the most commonly used distance and similarity measu r es, there are hund reds of such measures and more are being created all the time. As with so many other topics in this chapte r, many of these measures a re specific to particular fields; e.g., in the area of time series see papers by Kalpakis et al. [59] and Keogh and Pazza.ni [61]. Clustering books provide t he best general d iscussions. In particular, see the books by Anderberg [45], J ai n and Dubes [57], K aufman and R.ousseeuw [60], and Sneath and Sakal [77].
Bibliography [45) M. R. Anderberg. Cluster Analysis for Applications. Academic Press, New York, De-
cember 1973. [46) A. Blum and P. Langley. Selection of Relevant Features and Examp les in Machine
Learning . Artificial Intelligence, 97( 1- 2):245--271, 1997.
Bibliography 87
[47) H. H. Bock and E. Diday. Analysis of Symbolic Data: Exploratory Methods for Extract- ing Statistical I nformation from Complex Data (Studies in Classification, Data Analysis, and Knowledge Organization}. Springer-Verlag Telos, January 2000.
[48) I. Borg and P. Groenen. Modern Multidimensional Scaling-Theory and Applications. Springer-Verlag, February 1997.
[49) W . G. Cochran. Sampling Techniques. John W iley & Sons, 3rd ed ition, Jul y 1977. [501 J . W . Demmel. Applied Numerical Linear Algebra. Society for Industria l & App lied
Mathematics, September 1997. [511 J. Dougherty, R . Kohavi, and M. Sahami. Supervised and Unsupervised Discretization
of Continuous Features. In Proc . of the 12th Inti. Conf. on Machine Learning, pages 194-202, 1995.
[52] T. E lomaa and J . Rousu. General and Effici ent Multisplitt.ing of Numerical Attributes. Machine Learning, 36(3}:201-244 , 1999.
[53) U. M. Fayyad and K. B. Irani. Multi-interval discretization of continuousvalued at- tributes for classification learning. In Proc . 13th Int. Joint Conf. on Artificial Intelli- gence, pages 1022-1027. Morgan Kaufman, 1993.
[541 F . H. Gaohua Gu and H . Liu. Sampli ng and Its Application in Data Mining: A Survey. Techn.ical Report TRA6/00, Natio nal Un iversity of Sin gapore, Singapore, 2000.
[55) D. J. Hand . Statistics a nd the T heory of Meas ureme nt . Journal of the Royal Statistical Society: Series A (Statistic., in Society), 159(3}:445-492, 1996.
[56) F. Hussai n, H. Liu, C. L. Tan, and M. Dash. TRC6/99: Discretization: an enabling techn ique. Technical report, National University of Singapore, Singapo re, 1999.
[57) A. K. Jain and R. C. Dubes. A lgorithms fo r Clustering Data. Prentice Hall Advanced Reference Series. Prentice Hall, March 1988. Book available online at http:/ fwww.cse.msu.edu/~jain/Clusteri ng_Jai n..Dubes.pdf.
[58) I. T . Jolliffe. Principal Component Analysis. Springer Verlag, 2nd edition, October 2002.
[59) K. Kalpakis, D. Gada, and V. Puttagunta. Distance Measures for Effective Clustering of ARlMA Time-Series. In Proc. of the 2001 IEEE InU. Conf. on Data Mining , pages 273-280. IEEE Computer Society, 2001.
[60) L. Kaufman and P . J. Ro usseeuw. Finding Groups in Data: An Introduction to Cluster Analysis. Wi ley Series in Probability and Statistics. John Wi ley an d Sons, New York , November 1990.
[61) E . J . Keogh and M. J. Pazzani. Scaling up dynamic time warping for datam ining applications. In KDD, pages 285- 289, 2000.
[62) R. l<ohavi and G. H . John. Wrappers for Feature Subset Selection. Artificial Intelligence, 97( 1-2):273-324, 1997.
[63) D. K rantz, R . D. Luce, P. Suppes, and A. Tve rsky. Foundations of Measurements: Volume 1: Additive and polynomial representations. Academic P ress , New York , 197 1.
[64) J. B. Kruskal an d E. M. Us la ner. Multidimensional Scaling. Sage Pub lications, August 1978.
[65) B. W . Lindgren. Statistical Theory. CRC Press, January 1993. [66) H. Liu and H. Motoda, editors. Feature Extraction, Construction and Selection: A Data
Mining Perspective. Kluwer International SerieS in Enginee ring and Computer Science, 453. Kluwer Academic Pu blishers, July 1998.
[67] H. Liu and H. Motoda. Feature Selection for Knowledg e Discovery and Data Min - ing. Kluwer Internation a l Series in E ngi neering and Computer Scie nce, 454. K luwer Academic Publishers, July 1998.
88 C h apter 2 Data
j68]
j69j
170]
1711
172]
j7 3]
174]
175]
176] 177] 178]
179]
lBO!
j81]
j82}
183]
184}
185]
H. Liu, H. Motoda, and L. Yu. P~ature Extrac tion, Selection, Rnd Const ru ction. In N Ye, editor, The Handbook of Data Mining, pages 22- 41. Lawrence Erlbaurn Asso- ciates, Inc., Mahwah, NJ, 2003. It 0. Luce, D. Krantz, P. Suppes, and A. Tversky. Foundattous of Measurements: Volume 3: Representation, Axiomutization, and /nvariance. Academic Press, New York, 1990. MIT Thtal Data Quality Management Program. web.mit.edu/tdqmfwwwfindex.shtml, 2003. L. C. Molina, L. Belanche, and A. Nebot. Peat ure Selection Algorithms: A Survey and Experimenta l Eval uation. In Proc . of the 2002 IEEE Inti. Conf. on Dat a Mining, 2002. F. Ol ken and D. Rotem. Random Sampling from Databases-A Su rvey. Statisttcs & Computing, 5(1):25-42, March 1995. J. Osborne. Notes on the Use of Data Transform ations. Prac tical Assessment, Resear·ch fj Evaluation, 28(6), 2002. C. R. Palmer and C. Faloutsos. Density biased sampl ing: An improved method fo r data mining and clusteri ng. ACM SIGMOD Record, 29(2):82-92, 2000. F . J . Provost, D. Jensen, nod T . Oates. Efficient Progressive Sam pling. lo ?T'Oc. of the 5th Inti. Conf. on Knowledge Discove"J and Data Mining , pages 23-32, 1999. T . C. Redman. Data Quality: The Field Guide. Digital Press, January 2001. P. H . A. Sneath and R. R. Sokal. Numerical Taxonomy. Freeman, San Francisco, 1971. R. Srikant and R. Agrawal. Mining Quantitative Associat ion Rules in Large Relational Tables. In ?T'Oc. of 1996 ACM-SIGMOD Inti. Conf. on Management of Data, pages 1- 12, Montreal, Quebec, Canada, August 1996. S. S. Stevens. On th e Theory of Scales of Measurement. Science, 103(2684):677-680, June 1946. S. S. Stevens. Measurement. In G. M. Maranell, editor, Scaling: A Sourcebook for BehaVtoral Scientist..s, pages 22--41. Aldjne Publish.ing Co., Chicago, 1974. P. Suppes, D. Krantz, R. D. Luce, an d A. Tversky. Foundations of Measurements : Volume 2: Geometrica l, Threshold, an d ?T'Obabilistic Representations. Academic Press, New York , 1989. H . Toivonen. Sampling Large Databases fo r Association R.ules. In VLDB96, pages 134-145. Morgan Kaufman, Sept ember 1996. J. W. Thkey. On the Comparative Anatomy of Transformations. Annals of Math ematical Statistics, 28(3):602-632, September 1957. R. . Y. Wang, M. Ziad, Y. W. Lee, and Y. R. Wang. Data Quality. The Kluwer In- ternational Series on Advances in Dat abase Systems, Volume 23. Kluwer Academic Publishers, January 2001. M. J . Zaki, S. Parthasarathy, W. Li, and M. Ogihara. Evaluation of Sam pling for Data Mining of Associa tion Rules. Technical Report TR617, Rensselaer Polytechnic Institu t e, 1996.
2.6 Exercises
1. l n the initial example of Chapter 2, the statis t ician says, "Yes, fields 2 and 3 are basically the same." Can you tell from the three lines of sample data that arc sh own why she says that ?
2.6 Exercises 89
2. C lassify th e following anributes as bi nary, disc rete, or co nt inuous. Also cla~>Sify them as qualita t ive (nominal or ordinal ) or quan t itative (in terval or ratio). Some cases may have more t han one interpretation, so briefl y indicate your reasoning if you think t here may be some a mbiguity.
E x ample: Age in years. Answe r: Discrete, quantitative, ratio
(a) Time in terms of AM or PM.
(b) Brightness as measured by a light meter.
(c) Brightness as measu red by people's judgments.
(d) Angles as measu red in d egrees betwee n 0 a nd 360.
(e) B ronze , Sil ve r , and Gold m edals as awarded at the Oly mpics.
(f) Height a bove sea level.
(g) Number of pa tients in a hospital.
(h) ISBN numbers for books. (Look up the format on the Web.)
(i) Ability to pass light in t er ms of the following values: opaque, t ranslucent, transparent.
U) Military rank.
(k) Distance from the center of campus.
(I) Densi ty of a substance in grams per cubic centi meter.
(m) Coat check number. (When you attend an event, you can often give your coat to so meone who, in turn, gives you a number that you can use to claim your coat when you leave .)
3. You are approached by the marketing director of a local company, who b elieves that he has devised a foolproof way to measure customer satisfaction . He explains h.is scheme as follows: "It's so simple that I can 't b elieve th a t no one has thought of it before. 1 just kee p track of the number of customer complai nts for each product. I read in a data mining book that counts are ratio attributes, and so, my measure of p roduct satisfaction must be a ratio attri bute. But when 1 rated t he p roducts based on my new customer satisfaction measure and showed t hem t o my boss, b e told me that 1 had overl ooked t he obvious, and that my measure was worth less. I think that he was just mad because our best- selling product had the wo rst satis fac tion s ince it had the most complaint s. Could you he lp me set hi m straight?"
(a) Who is right, the marketing d irect or or hi s boss? If you answered, his boss, what would you do to fix the meas ure of satisfaction?
(b) What can you say about the attribute type of the origi nal producl satis- faction att ribute?
90 C h apter 2 Data
4. A few mont hs later , you are again approached by the same marketi ng director as in Exercise 3. T his t ime, he has devised a b etter app roach to measure the extent t o which a customer prefers one product over other, similar p roducts. He explains, "When we develop new products, we typically create seve ral variations and evaluat e which one customers prefer. Our standard procedure is to give our test subjects all of the product variations at one time and then ask them to rank the product variations in order of preference. However, our test subjects are very indecisive, especially when there are more than two products. As a result, testing takes forever. J suggested t hat we perform the compar isons in pairs and t hen use t hese comparisons to get the rankings. T hus, if we have three prod uct variations, we have the customers compare variations 1 and 2 , then 2 and 3, and finally 3 and 1. Our testing time wi t h my new procedure is a t hird of what it was for the old procedure, but the employees conductin g the tests complain that they cannot come up with a consistent ranking from the resu lts. And my boss wan ts the latest product evaluations, yesterday. I should also mention th at he was t he person who came up with the old product evaluati on approach. Can you help me?"
(a) Is the marketing director in trouble? Will his a pproach work for gener- a ting an ordinal r anking of t h e prod uc t variations in t.erm s of custom er preference? Explain.
(b) Is there a way to fix the marketi ng director 's a pproach ? More generally, what can you say a bout trying to create a n ordinal measurement scale based on pairwise com parison s?
(c) For the original produ ct evaluation scheme, the overall rankings of each product variation are found by computing its average over all test subjects. Commen t on whethe r you think that this is a reasonable approach. What ot her approaches might you take?
5. Can you think of a situation in wh ich ident ification numbers would be useful for prediction?
6. An educational psychologist wants to use association analysis to analyze test results. The test consists of 100 questions with four possible answers each.
(a) How would you convert th is data into a form sui table for associ at ion analysis?
(b) In particular, wha t type of attr ibutes would you have and how many of t.hem are there?
7. Wh ich of the following quantities is likely to show more temporal autocorrela- t ion: dail y rainfall or daily temperatu re? Why?
8. Discuss why a documen t- term matrix is an example of a data set that has asymmetric discrete or asymmetric continuous features.
2 .6 Exercises 91
9. Many sciences rely on observation instead of (or in a ddition to ) designed ex- periments. Compare the data qual ity issues involved in observational science with t hose of experimental science and data mining.
10. Discuss the difference between the precision of a measurement and th e terms single and double precision, as they are used in compute r science, typically to represent floating-point numbers that require 32 and 64 bits, respectively.
11. Give at least two advantages to working wi th data sto red in text files instead of in a bin ary format.
12. Distinguish between noise and outliers. Be sure to consider t he foll owing ques- t ions.
(a) Is noise ever in t eresting or desirable? Outliers?
(b) Can noise objects be outliers?
(c) Are noise objects always outliers?
(d) Are outliers a lways noise objects?
(e) Can noise make a typical value into an unus ual one, or vice versa?
13. Co nsider the problem of fi nding t he K nearest neighbors of a data object. A programmer designs Algorithm 2.2 for t his task.
Algorithm 2.2 Algorithm for finding K nearest neighbors. 1: for i- 1 to number of data objects d o 2: F'ind the distances of the i 1h object to all other objects. 3: Sort t hese distances in decreasing order.
(Keep track of which object is associated with each distance.) 4 : return t he objects assoc iated with t he first K distances of t he sorted list 5: end for
(a) Describe the potential problems with this algorithm if th ere are duplicate obj ects in t he d a t a set. Assume the dist ance fu n cti on will only return a distance of 0 for obj ects t hat are the same.
(b) How would you fix t his problem?
14. The fo ll owing at t ributes are measured for members of a herd of Asian ele- phants: weight, height, tusk length, trunk .length, a nd ear area. Based on these measurements, what sort o f similarity measure from Secti on 2.4 would you use to compare or group t hese elephants? Justify you r answer and explain any special circumstances.
92 Chapter 2 Data
15. You are given a set of m objects that is divided into K groups, where the i'h group is of size m;. If the goal is to obtain a sample of size n < m, what is the difference between the following two sampling schemes? (Assume sampling with replacement.)
(a) We randomly select n • m;fm elements from each group.
(b) We randomly select n elements from the data set, without regard for the group to which an object belongs.
16. Consider a docwnent-term matrix, where t/;; is the frequency of the i'h word (term) in the j'h document and m is the number of documents. Consider the variable transformation that is defined by
, m tf;; = tf;; • log df;, (2.18)
where df; is the number of documents in which the i'h t erm appears, which is known as t he document frequency of the term. This transformation is known as the inverse document fr equency transformation.
(a) What is the effect of this t ran sformat ion if a term occurs in one document? In every document?
(b) What might be t he purpose of this transfor mation?
17. Assume that we apply a square root transformation to a ratio attribute x to obtain the new attribute x • . As part of your analysis, you identify an interval (a, b) in which x' has a linear relationship to another attribute y .
(a) What is the correspond ing interval (a, b) in terms of x?
(b) Give an eq uation that relates y to x.
18. This exercise compares and contrasts some similarity and distance measures.
(a) For binary data, the 11 distance corresponds to t he Hamming distance; that is, the number of bits that are d ifferent between two bi nary vectors. T he Jaccard similarity is a measure of t h e similarity between two binary vectors. Compute the Hamm ing distance and the J accard si mi larity be- tween the following two binary vectors.
X = 0101010001 y = 0100011000
(b) Which approach, J accard or Hamming distance, is more similar to the Simple Matching Coefficient, and which approach is more similar to the cosine measure? Explain . (Note: The Hamming measure is a distance, while the other three measures are similarities, but don't let this confuse you.)
2.6 Exercises 93
(c) Suppose that you are comparing how similar two organisms of different species are in terms of the number of genes they share. Describ e wh ich measure, Hamming or Jaccard, you thin k would be more appropriate for comparing t he genetic makeup of two organisms. Ex plain. (Assu m e that each animal is represented as a binary vector, where each attribu t e is 1 if a particular gene is present in the organism and 0 otherwise.)
(d) If you wanted to compare t he genetic makeup of two organisms of t he same species, e.g., two human beings, would you use the Hamming dis t ance, the Jaccard coefficient, or a different meas ure of similari ty or dis t ance? Explain. (Note that t wo human beings share > 99.9% of the same genes.)
19. For t he follow ing vectors, x andy, calculate the indicated similarity or d istance measur es.
(a) x = (1, 1, 1, 1), y = (2, 2, 2, 2) cosine, correl ation, Euclidean
(b) x = (0, 1, 0, 1), y = (1, 0, 1, 0) cosine, correlation, Euclidean, Jaccard
(c) x = (0,- 1,0, 1), y = {1,0,-1,0) cosi ne, correlat ion , Euclidean (d) x = (1, 1,0,1,0, 1), y = (1,1, 1, 0,0,1) cosi ne, correlation , Jaccard
(e) x = (2,- 1,0,2,0,-3), y = {-1, 1,-1 , 0 , 0, -1) cosine, correlat ion
20. Here, we further explore the cosine and correlat ion measures.
(a) What is the range of values that are possible for the cosi ne measure?
(b) If two objects have a cosine measure of 1, a re they ident ical? Explain.
(c) What is the relationship of the cosine measure to correlation , if any? (Hint: Look at statistical measures such as mean and standard d eviati on in cases where cosine and correlation are the same and different. )
(d) Figure 2.20(a) shows the relations hip of the cosine measu re to E uclidean distance for 100,000 randomly generated points t hat have been normalized to have an 12 length of 1. What ge nera l observation can you make about the relationship between Euclidean distance and cosine similari ty when vectors have an 12 norm of 1?
(e) Figure 2.20(b) shows t he relat ions hip of cor relation t o Euclidean d is tance for 100,000 randomly ge nerated points t hat have been s tandard ized to have a mean of 0 and a standard deviation of l . Wha t general observa- t ion can you make abou t t he re lationship b etween Euclidean dis tance and correlation when the vec tors have been standardized to ha ve a mean of 0 and a standard deviation of l ?
(f) Derive the mathematical relationshi p b etween cosine sim ilarity and E u- clidean distance when each data object has an 1 2 length of I.
(g) Derive t he mathematical relationship between correlation and Euclidean distance when each data point has been been standard ized by subt racting its mean and dividing by its standard deviation.
94 Chapter 2 Data
1.4c=--~---,--..,......-~----,
1.2 1.2 Q) " g 1 g 1 "' "' ~0.8 ~ 0.8 :g 0 .6 ~ 0.6 u u goA w
g 0 .4 w
0.2 0.2
~~~o~.2~~0~.4~~o~.6~-.o~.a.-~ ~~-0~.~2-~0~.4~~0~.6----0~.8--~ Cos ine Similarity
(a) Relationship between Euclidean distance and t he cosine measure.
(b) Relationship between Euclidean distance and correlation.
Figure 2.20. Graphs for Exercise 20.
21. Show that the set difference metric given by
d(A, B) = size(A -B )+ size(B- A) (2.19)
satisfies the metric axioms given on page 70. A and B are sets and A - B is the set difference.
22. Discuss how you might map correlation values from the interval [-1,1] to the interval [0,1]. Note that the type of transformation that you use might depen d on t he application that you have in mind. Thus, consider two applications: clustering time series and predicting the behavior of one time series given an- other.
23. Given a similarity measure with values in the interval [0,1] describe two ways to transform this similarity value into a dissimilarity value in the interval [O,oo].
24. Proximity is typically defined between a pair of objects.
(a) Define two ways in which you might define the proximity among a group of objects.
(b) How might you define t he distance between two sets of points in Euclidean space?
(c) How might you d efine the proximit y between two sets of data objects? (Make no assumption about the data objects, except that a proximity measure is defined between any pair of objects.)
25. You are given a set of points S in Euclidean space, as well as the distance of each point in S to a point x. (It does not matter if x E S.)
2 .6 Exercises 95
(a) lf the goal is to find al l points within a specified distance c of po in t. y , y # x, explain how you could use t he triang le inequality and t he a lready calculated distances to x to potentially reduce t he number of distance calculations necessary? Hint: The triangle inequality, d(x, z) ~ d(x , y ) + d(y,x), can be rewritten as d(x,y) ~ d(x,z)- d(y, z ).
{b) In general, how would the distance between x andy affect the number of distance calculations?
(c) Suppose that you can find a small subset of points S', from t he origi nal data set, such that every point in t he dat a set is within a specified distance o of at least one of t he poi nts in S', and that. you also have the pairwise distance m atrix for S'. Describe a techn ique that uses t his informat ion to compute, with a minimum of distance calcul a.Lio ns, the set of all p oints within a distance of /3 of a specified poin t from the data set.
26. Show that 1 minus the Jaccard similarity is a dist ance measure between two data objects, x and y , t hat satisfies t he metric axioms given on page 70. Specifically, d {x,y) = 1- J (x,y).
27. Show that t he distance measure defined as the angle between two dat a vectors, x and y, satisfies t he m etr ic axioms give n on page 70. Specifically, d{x, y) = arccos(cos(x , y)).
28. Explain why computing the proximity between two a t.tributes is often simpler t han computing the similarity between two objects.
3
Exploring Data
The previous chapter addressed high-level data issues that are important in the know ledge discove ry process. This chapter provides an introd uction to data exp loration, which is a preliminar y investigation of the data in order to better understand its specific characterist ics . Data exploration can a id in selecting the appropriate preprocessing and data analysis techniques. ll can even address some of the questions typically answered by dat a mining. For example, patterns can sometimes be found by visually ins pecting t he data. Also, some of t he techniques used in data exploration, such as visualizat ion , can be used to understand and interpret data mining results.
T his chapter covers three major to pics: summary statistics, visualizat ion, and On-Line Analytical Processing (OLAP). Summary statistics, such as the mean and standard deviation of a set of values, and visualizat ion techniq ues, such as histograms and scatter plots, are standard methods that are widely employed for data exploration. OLAP, which is a more recent development, consists of a set of techniques for exploring multidimensional arrays of val ues. OLAP-related analysis functions focus on various ways to create summary data tables from a multidimensional data array. These techn iq ues include aggregating data either across various dimensions or across various attribute values. For instance, if we are given sales information reported accordi ng to product, location , and da te, OLAP techniques can be used to crea te a summary that describes the sales activity at a particular locat ion by month and product category.
The topics covered in this chapter have considerable overlap wi th the area known as Exploratory D ata Analysis (EDA), which was created in t he 1970s by the prominent statistician , John Thkey. This chapter , li ke EDA, places a heavy emphasis on visualization . Unlike EDA, t his chapter does no t include topics such as cluster analysis or anomaly detec t ion. There are two
98 Chapter 3 Exploring Data
reaso ns for this. First, data mining views descriptive data analysis techniques as an end in t hemselves, whereas st atist ics, from which EDA originated, tends to view hypothesis-based testi ng as the final goal. Second , cluster analysis and anomaly detection a re large areas and require full chapters for an in- dept h discussion. Hence, cluster analysis is covered in C hapters 8 and 9, while anomaly de tection is discussed in Chapter 10.
3 .1 The Iris Data S et
In the following discussion, we will often refer to the Iris data set that is available from the University of California a t Irvine (UCI) Machine Learn- ing Repository. It consists of information on 150 Iris fl owers, 50 each from one of three Iris species: Setosa, Versicolour, and Virginica. Each flower is characterized by five attributes:
1. sepal length in centimeters
2. sepal width in centimeters
3. petal length in centimeters
4. petal width in centimeters
5. class (Setosa, Versicolour, Virginica)
The sepals of a flowe r are the outer structures t hat protect the more fragile parts of the flower, such as the petals. In many flowers, the sepals are green, and only the petals are colorful. For Irises, however, the sepals are also colorfu l. As illustrated by the pict ure of a Virginica Iris in Figure 3.1, the sepals of an Iris a.re larger than the petals and are drooping, while the petals are up right.
3 .2 Summary Sta tistics
S umma ry statistics are quantities, such as the mean and standard deviation, that capture various characteristics of a potentially large set of values with a single number or a small set of numbers. Everyday examples of summary statistics are the average household income or the fraction of college students who complete an undergraduate degree in four years. Indeed, for many people, summary statistics are the most visible manifestation of statistics. We will concentrate on s ummary statistics for the values of a single at tribute, but will provide a brief descript ion of some multivariate summary stat istics .
3.2 Summary Statistics 99
Figure 3.1. Picture of Iris Virginica. Robert H. Mohlenbrock @ USDA·NACS PLANTS Database/ USDA NAGS. 1995. Northeast wetland llora: Field office guide lo plant species. Northeast National Technical Center, Chester, PA. Background removed.
T his section considers only t he descri ptive nature of summary statistics. However, as described in Appendix C, statistics views data as arising from an underlying statistica l process that is characterized by various pa ra meters, and some of the summary statis t ics discussed here can be viewed as estimates of statistical parameters of the underlying d istribution that generated the data.
3.2 .1 Frequencies and t h e Mod e
Given a set of unordered categorical values, there is not much that can be done to further characterize t he values except to compute the frequency wi th which each value occurs for a particular set of data. Given a categorical attribute x, which can take values {v1 , •.. , v;, ... Vk} and a set of m objects, the frequency of a value v; is defined as
fr ( ) number of objects with attribute val ue v;
equency v; = . m
(3.1)
The mode of a categorical attribute is t he value that has t he highest frequency.
100 Chapter 3 Explo ring Data
Exam ple 3.1. Consider a set of students who have an aLt ri bu te, class, which can take values from the set {freshman, sophomore, junior, senior}. Table 3.1 shows the number of students for each value of the class attribute. The mode of the class attribute is freshman, with a frequency of 0.33. This may indicate dropouts due to attrition or a larger than usual fres hman class.
Table 3.1. Class size for students in a hypothetical college.
Class Size Frequency freshman 140 0.33 sophomore 160 0.27 junior 130 0 .22 senior 170 0.18
• Categorical attributes often, but not a lways, have a small number of values,
and consequently, the mode and frequencies o f these values can be interesting and useful. Notice, t hough, t hat for th e lris data set and the class attribute, the three types of flower all have the same frequency, and therefore, the notion of a mode is not interesting.
For continuous data, the mode, as currently defined, is often no t useful because a single value may not occur more th an once. Nonetheless, in some cases, the mode may indicate important information about t he natu re of the values or the presence o f missing values. For example, Lhe heights of 2 0 people measured to the nearest millimeter will typically not repeat, but if the heights are measured to the nearest tenth of a meter, then some people may have the same height. Also, if a unique val ue is used to indicate a missing value, then this value will often show up as the mode.
3.2.2 P ercen t iles
For ordered data, it is more useful to consider the pe1·centiles of a set o f values . ln par ticular, g iven an ordinal or continuous auribute x and a num ber p between 0 and 100, the p' 11 percentile Xp is a value o f x such that p% of the observed values of x are less t han Xp· For ins t ance, the 50'11 percentile is the value x 50% such that 50% of a ll val ues of x are less than x 5o%· Table 3.2 shows the percentiles for the four quantitat ive attributes of the Iris data set .
3 .2 Summary Statistics 101
Table 3.2. Percentiles lor sepal length, sepal width, petal length, and petal width. (All values are in centimeters.)
Percentile Sepal Length Sepal Width Petal Length Petal Width 0 4.3 2 .0 1.0 0.1.
10 4.8 2.5 1.4 0.2 20 5.0 2.7 1.5 0.2 30 5.2 2.8 1.7 0.4 40 5.6 3.0 3.9 1.2 50 5.8 3.0 4.4 1.3 60 6.1 3.1 ~.6 1.5 70 6.3 3.2 5.0 1.8 80 6.6 3.4 5.4 1.9 90 6.9 3.6 5.8 2.2 100 7.9 4 .4 6.9 2.5
Example 3.2 . The percentiles, x 0%, x 10%, .. . , x 9o%, x 100% of the integers from 1 to 10 are, in order , the following: 1.0, 1.5, 2.5 , 3.5, 4.5, 5.5 , 6.5, 7.5, 8.5, 9.5, 10.0. By t radi tion, min(x) = xo% and max(x) = XJOO%· •
3 .2 .3 Measu res of Location: Mean and M edian
For cont inuous data, two of the most widely used summary stat istics are the m ean and median , which are measures of the location of a set of values. Consider a set of m objects and an a t tribu te x. Let {x1 , ... , Xm} be lhe attribute val ues of x for these m objects. As a concrete example, these values might be the heigh ts of m children. Let {X( ! ), .. . , X(m)} represent the values of x after they have been sorted in non-decreasing order. Thus, X(!) = min (x ) and x(m) = max(x). T he n, the mean and median are defined as fol lows:
1 m mean(x) = x = - 'L: x;
m i=l
. { x(,·+l) if m is o d d , i.e., m = 2r + 1 med1an x = 1 · · ·
( ) 2 (x(r) + X(r+l)) 1f m IS even , I.e., m = 2r
(3.2 )
(3.3)
To s ummarize, the median is the middle value if there are an odd number of valu es , and the average of the two middle val ues if the number of val ue~ is even. T hus, for seven val ues, the med ian is x(4 ), while for ten values, the
median is ~ (x(s) + X(6)) ·
102 Chapter 3 Exploring Data
Although the mean is sometimes interpreted as the middle of a set of values, this is only correct if t he values are distributed in a symmetric manner. If the distribution of values is skewed, then the median is a better indicator of the middle. Also, the mean is sensitive to the presence of outliers. For data with outliers , the median again provides a more robust estimate of the middle of a set of values.
To overcome problems with the t raditional definition of a mean, the notion of a trimmed mean is sometimes used. A percentage p between 0 and 100 is specified, the top and bottom (p/2)% of the data is thrown out, and the mean is then calculated in the normal way. The median is a trimmed mean with p = 100%, while the standard mean corresponds to p = 0%.
Example 3.3. Consider the set of values {1 , 2, 3, 4, 5, 90} . The mean of these values is 17.5, while the median is 3.5. The trimmed mean with p = 40% is also 3.5. •
Example 3.4. The means, medians, and trimmed means (p = 20%) of the four quantitative attributes of the Iris data are given in Table 3.3. The three measures of location have similar values except for the attribute petal length.
Table 3.3. Means and medians for sepal length, sepal width, petal length, and pelal width. (All values are in centimelers.)
Measure Sepal Length Sepal Width Petal Length Petal Width mean 5.84 3.05 3.76 1.20
median 5.80 3.00 4.35 1.30 trimmed mean (20%} 5.79 3.02 3.72 1.12
•
3.2.4 Measu res of Spread: R a n ge a n d Variance
Another set of commonly used summary statistics for continuous data are those that measure the dispersion or spread of a set of values. Such measures indicate if the attribute values are widely spread out or if they are relatively concent rated around a single point such as the mean.
The simplest measure of spread is the range, which, given an attribute x with a set of m values {x1, . .. , Xm}, is defined as
range(x) = max(x)- min(x) = X(m)- X(l)· (3.4)
3.2 Summary Statist ics 103
Table 3.4. Range, standard deviation (std), absolute average difference (AAD), median absolute differ·
ence (MAD), and interquartile range (lOR) for sepal length, sepal width, petal length, and petal width. (All values are in centimeters.)
Measure Sepal Length Sepal Width Petal Length Petal Width range 3.6 2.4 5.9 2.4 std 0.8 0.4 1.8 0.8
AAD 0.7 0.3 1.6 0.6 MAD 0.7 0.3 1.2 0.7 IQR 1.3 0.5 3.5 1.5
Although the range identifies the maximum spread , it can be misleadi ng if most of the values are concentrated in a nar row ba nd of values, but t here are also a relatively small number of more extreme values. Hence, t he variance is preferred as a measure of spread. The variance of the (o bserved) val ues of an attribute xis typically written as si and is defined below. The standard deviation, which is t he square root of the variance, is wri t ten as S::: and has the same units as x .
1 m variance(x) = si =-- "' (xi- xi
m-1~ i = l
(3.5)
The mean can be distorted by outliers , and since the vari ance is computed using the mean, it is also sensitive to outliers. Indeed, the variance is particu- larly sensitive to outliers since it uses t he squared difference between t he mean and other values. As a resul t, more robust estimates of the spread of a set of values are often used . Following are the definitions of three such measures: the absolute average d e viation (AAD), the median absolute dev iation (MAD), and the interquartile range(IQR). Table 3.4 shows these measures for the Iris data set.
1 m AAD (x) = - Llxi - xl
m i=l
MAD (x) =median ( {Jx1 - xJ , ... , Jxm - xi} )
interquartile range(x) ~ x 15<r. - x2s %
(3.6)
(3. 7)
(3.8)
104 Cha pter 3 Exploring Data
3.2 .5 M u ltivariate S ummary S tatistics
Measures of location for data that consists of several attributes (multivariate data) can be obtained by computing t he mean or median separately for each attri bute. Thus, given a data set the mean of the data objects, x, is given by
X = (X I,·· · ,Xn), (3.9)
where X; is the mean of the i 1h attribute x;. For multivariate data, the spread of each attribute can be computed in-
dependently of t he o ther attributes using any of t he approaches described in Section 3.2.4. However, for dat a with continuous variables, the spread of the data is most commonly captured by t he covaria n ce m atrix S , whose i/h entry s;; is the covariance of the i 1h and jlh attributes of the data. Thus, if x; and x; a re the i 1h and j 1" a t t ributes, then
s;; = covariance( X;, x;).
In t urn , covariance(x;,x; ) is given by
1 m covariance( X;, x;) = - - " (xki- X;)(xki- x;),
m-1 L... k= l
(3. 10)
(3.11)
where Xki and Xkj a re t he values of the i 1" and/" attributes for t he kth object. Notice that covariance( X;, x;) = variance(x;). Thus, t he covariance matrix has the variances of t he attributes along the diagonal.
T he covariance of two at tributes is a measure of the degree to which t wo at tributes vary together and depends o n t he magnitudes of the variables. A val ue near 0 indicates t ha t two attributes do not have a (linear) relationship, but it is not possible to judge the degree of relationship between two variables by looking only at the value of the covaria nce. Because t he correla tion of two attri butes immediately gives an indication of how st rongly two at tributes are {linead y) related, correlation is preferred to covariance for data exploration. {Also see the discussion of correlation in Section 2.4.5.) The ij1h entry of the corr elat ion m a trix R, is t he correlation between t he i 1h and /h a t tributes of t he data. 1f x; and x; are t he ith and /" attributes, then
. covariance( x;, x ·) r;; = correlatwn (x; , x;) = 1 ,
S;Sj (3. 12)
3. 3 Visualizatio n 105
where s; and s; are the variances of x; and x ;, respectively. The diagonal entr ies of R are correlation{x;,x;) = 1 , whi le the other entries are between - 1 and 1. It is a lso useful to consider correlation matrices that contain the pairwise correlations of objects instead of attributes.
3.2. 6 Ot h e r W ays to Summarize t h e D ata
There are, of course, other types of summary statistics. For instance, the skew n ess of a set of values measures the degree to which the values are sym- metrically distributed around the mean. There are also other characteris tics of the data t hat are not easy to measure quant itatively, such as whether the distribu tion of values is multimodal; i.e., the dat a has multiple "bumps" where most of the values are concentrated. In many cases, however, the most effec- tive approach to unders t anding the more complicated or subtle aspects of how the val ues of an attri bute are distrib uted, is to view t he values graphically in the form of a histogram . (Histograms are discussed in the next section .)
3.3 V isu a lizatio n
Data visualizat ion is t he disp lay of information in a graphic or tabular format. Successful visualization requi res that the data (information) be converted into a visual format so that the characteristics of the data and the relationships among data items or at tributes can be analyzed or reported. The goal of visualization is the interpretation of the visualized information by a person and the formation of a mental model of t he information.
In everyday life, visual techniques such as graphs and tables are often the preferred ap proach used t o explain the weather , t he economy, and the results of political elections. Likewise, while algorit hmic or mathematical approaches are often emphasized in most technical disciplines-data mining included- visual techniques can play a key role in data analysis. In fact , sometimes t he use of visualization tech niques in data mining is referred to as visual data minin g.
3.3. 1 M o t ivat ion s for Vis u a lizatio n
The overriding motivation for using visualization is that people can quickl y absorb large amounts of visual information· and find patterns in it. Consider F igure 3.2, which shows the Sea Surface Temperature (SST) in degrees Celsius for July, 1982. This picture summarizes the information from approximately 250,000 num bers and is readily interpreted in a few seconds . For example, it
106 Chapter 3 Exploring Data
15
10
Longi11Jde
Figure 3.2. Sea Surtace Temperature (SST) for July, 1982.
is easy to see that the ocean temperature is highest at the equator and lowest at. the poles.
Another general motivation for visualization is to make use of t he domain knowledge that is "locked up in people's heads." While the use of domain knowledge is an important task in data mining, it is often difficult or impossible to fully utilize such knowledge in statistical or algorithmic tools . In some cases, an analysis can be performed using no n-visual tools, and t hen the results presented visuall y for evaluation by t he domain expert . In other cases, having a domain specialist examine visualizations of the data may be the best way of finding patterns of interest since, by using domain knowledge, a person can often quickly eliminate many uninteresting patterns and direct the focus to the patterns that are important.
3 .3.2 Gene ral Concepts
T his section explores some of the general concepts related to visualization, in particular, general approaches for visualizing the data and its attributes. A number of visualization techniques are mentioned briefly and will be described in more detail when we discuss specific approaches later on . We assume that the reader is familiar with line graphs, bar charts, and scatter plots .
3.3 Vis ua lization 107
Representation: Mapping Data to Graphical E lements
The first step in visualization is the mapping of. information to a visual format; i.e., ma pping the objects, att ri butes, and relationships in a set of information to visual objects, at tributes, and relationships. That is, data objects, their at- tributes, and the relat ionships amo ng data objects are translated into graphical elements such as points, lines, shapes, and colors.
Objects are usually represented in o ne of three ways. First, if only a single categorical att ribute of the ob j ect is being considered, t hen objects are often lumped into categories based on the value of tha t a t tribu te, and these categories are displayed as an entry in a table or an a rea o n a screen . (Exam ples shown later in t his chap ter are a cross-tabu lation table and a bar chart .) Second, if an object has multiple att ributes, then t he object can be displayed as a row (or column) of a table or as a line on a graph. F inally, an object is often interpreted as a point in two- or th ree-di mensional space, where g raphically, t he point might be represented by a. geometric figure , such as a. circle, cross, or box.
For attri butes, the representation depends o n t.he type of a tt ribute, i.e., nomina l, ordinal, or continuous (int erval or rat io). O rdinal and contin uous att ri butes can be mapped to continuous, orde red graphica.l features such as location alo ng the x, y , or z axes; intensity ; color; or size (diameter, width, height, etc.). For categorical attributes, each category can be mapped to a distinct position, color, shape, orientation, embellishment, or column in a table. However, for nomjnal attributes, whose values are uno rdered, care should be taken when using graphical feat ures, such as color and posit ion that have an inherent ordering associated with their val ues. In o ther words , the graphical elements used to represent t he ordin al values often have an order , but ordin al values do not.
The represent ation of relationships via gr aphical elements occurs either explicitly o r implicit ly. For grap h data, t he standard graph representation- a set of nodes with links between the nodes-is normally used . If the nodes (data obj ects) or links (relationships) have attributes or characteristics of their own, then t his is represented grap hically. To illustrate, if the nodes are cities and the links are highways, t hen the diameter of the nodes might rep resent population, while the width of t he links might represent the volume of traffic.
In most cases , though, mapping ob jects and attributes to graphical el- emen ts implicitly maps the relat ionships in t he data to relatio nships among graphical elements . To illustrate, if t he data object represents a physical object t hat has a location, such as a city, the n the relative posit ions of t he graphical objects corresponding to the data obj ects tend to naturally preserve the actual
108 Chapt er 3 Exploring Data
relative positions of the objects. Likewise, if there are two or three continuous attributes that are taken as the coordinates of the data points, then the result- ing plot often gives considerable insight int o the relationships of the attribu tes and the data points because data points that are visually close to each other have similar values for their attrib utes.
In general, it is difficult to ensure that a mapping of objects and attribu tes will result in the relat ionships being mapped to easily observed relationships among graphical elements. Indeed, this is one of the most challenging aspects of visualization. In any given set of data, there are many implicit relationships, and hence, a key challenge of visualization is to choose a technique that makes the relationships of interest easily observable.
Arrangement
As discussed earlier, the proper choice of visual representation of objects and attributes is essential for good visualization. The arrangement of items within the visual display is also crucial. We illustrate this with two examples.
Example 3 .5 . This example illustrates the importance of rearran ging a table of data. In Table 3 .5, which shows ni ne o bjects with six binary attributes, there is no clear relationship between objects and attributes, at least at first glance. 1f the rows and columns of this table are permuted, howeve r, as shown in Table 3.6, then it is clear that there a re really only two types of objects in the table-one that has all ones for the first three attributes and one that has only ones for the last three attributes. •
Tabl e 3.5. A table ol nine objects (rows) with Table 3.6. A table of nine objects (rows) with six six binary attributes (columns). binary attributes (columns) permuted so that the
relationships of the rows and columns are clear.
1 2 3 4 5 6 1010110 2101001 3010110 4 I 0 1 0 0 1 5010110 6 1 0 0 0 1 70 1 0110 8101001 9 0 1 0 0
4 2
6
6 1 8 1 1 5 0 0 3 0 0 9 0 0 1 0 0 7 0 0
3 2 5 4 0 0 0 0 0 0
1 0 0 0 1 0 0 0 0 0 0 0 0
3.3 Visualization 109
Example 3 . 6 . Consider Figure 3.3(a), which shows a visu alizat ion of a graph. lf the connected components of the graph are separated , as in Figure 3.3 (b) , then the relationships between nodes and graphs become much s impler to understand. •
(a) Original view of a graph. (b) Uncoupled view of connected components of the graph.
Figure 3.3. Two visualizations of a graph.
Selection
Another key concept in visualization is selection , which is the elimination or the de-emphasis of certain objects and attributes. Specifically, while data objects that only have a few dimensions can often be mapped to a two- or three-dimensional graphical representation in a straightforward way, there is no completely satisfactory and general approach to represent d ata wi th many attributes. Likewise, if the re are many data objects, then visualizing all the obj ects can result in a display that is too crowded. If there are many atlri bu tes and many objects, t hen the situation is even more challenging.
The most common approach to handli ng many attribu tes is to choose a subset of attributes-usually two-for display. lf the dimensionality is not too high, a matrix of bivariate (two-attri bute) plots can be constructed for simul- taneous viewing. (Figure 3.16 shows a matrix of scatter plots for the pairs o f a ttribu tes of the Iris data set.) Alternatively, a visualizat ion p rogram can automatically show a series of two-dimensional plots, in which the sequence is user directed or based on some predefined strategy. The hope is that visual iz- ing a collection of two-dimensional plots wili provide a more complete view of the data.
llO Chapter 3 Exploring Data
The technique of selecting a pair (or small number) of attributes is a type of dime nsionality reduction, and there are many more sophisticated dimension- ality reduction techniques that can be employed, e.g., principal components analysis (PCA). Consult Appendices A (Linear Algebra) and B (Dimension- ality Reduction) fo r more information.
When the number of data points is high, e.g., more than a few hundred, or if the range of the data is large, it is difficult to display enough information about each object. Some data points can obscure other data points, or a data object may not occupy enough pixels to allow its features t.o be clearly d isplayed. For example, the shape of an object cannot be used to encode a characteristic o f t hat object if there is only one pixel available to display it. In these situations, it is useful to be able to eliminate some of the objects, either by zooming in on a particular region of the data or by taking a sample of the data points.
3.3.3 T ech niques
Visualization techniques are often specialized to the type of data being ana- lyzed. I ndeed , new visualization techniques and approaches, as well as special- ized variations of existing approaches, are being continuously created, typically in response to new kinds of data and visualization tasks.
Despite this specialization and the ad hoc nature of visualization, there are some generic ways to classify visualization techniques. One such classification is based on the number of attributes involved (1, 2, 3, or many) or whether the data has some sp ecial characteristic, such as a hierarchical or graph structure. Visualization methods can also be classified according t o the type of attributes involved. Yet anot her classification is based on the type of application: scien- tific, statistical, or information vis ualization. The following discussion will use three categories: visualization of a small number o f attributes, visualization of data with spatial and / or temporal attri butes, and visualization of data with many attributes.
Most of the visualization techniques discussed here can be found in a wide variety of mathematical and statistical packages, some of which are fre ely available. There are also a number of data sets that are freely available on the World Wide Web. Readers are encouraged to try these visualization techniques as they proceed through the following sections.
3 . 3 Visualizatio n 111
Visualizing Small Numbers of Attr ibutes
This section examines techniques for visualizing data with respect to a small number of attributes. Some of these techniques, such as histograms, give insight into the distribution of the observed values for a single att ribu te. Other techniques, s uch as scatter plots, are intended to display the relationships between the values of two attributes.
Stem and Leaf Plots Stem and leaf plots can be used to provide insight into the dis tribu tion of one-dimensional integer or continuous data . (We will assume integer data init ia lly, and t hen explain how stern and leaf plots can be applied to continuous data.) For t he simplest type of stem and leaf plot, we split the values into groups, where each group contains those values t hat are the same except for the last digit. Each group becomes a stem, while the last digits of a group are the leaves. Hence, if the values are two-digit integers, e.g ., 35, 36, 42, and 51, then the s tems will be the high-order d igits , e.g., 3, 4, and 5, while the leaves are the low-order digits, e.g., 1, 2, 5, and 6. By plotting the stems vertically and leaves horizontally, vye can provide a visual representation of the distribution of the data.
Example 3. 7. The set of integers shown in Figure 3.4 is the sepal length in centimeters (multiplied by 10 to make the values integers) t aken from the Iris dat a set. For convenience, the values have also been sorted.
The stem and leaf plot for this data is shown in F igure 3.5. Each number in Figure 3.4 is first put into one of the vertical groups-4, 5, 6, or 7- according to its ten's digit. Its last digit is t hen placed to the righ t of the colon. Often, especially if the amount o f data is larger, it is desirable to split the s t,ems. For example, instead o f placing all values whose ten's digit is 4 in the same "bucket," the stem 4 is repeated twice; all values 40-44 are put in the bucket corresponding to the first stem and all values 45-49 a re put in the bucket correspond ing to the second stem . This a pproach is shown in the stem and leaf plot of Figure 3.6. Other variations are also possible. •
H istograms Stem and leaf plots are a type of h istogram, a plot that dis- plays the distribution of val ues for attributes by dividing the possible values into bins and showing the nu mber of objects that fall into each bin. For cate- gorical data, each value is a bin. If this results in too many values, t hen values are combined in some way. For continuous attributes, the range of values is di- vided into bins-typically, bu t not necessarily, of equal width-and t he values in each bin are counted.
112 C ha pt er 3 Exploring Data
43 44 44 44 45 46 46 46 46 47 47 48 48 48 48 48 49 49 49 49 49 49 50 50 50 50 50 50 50 50 50 50 51 51 51 51 51 51 51 51 51 52 52 52 52 53 54 54 54 54 54 54 55 55 55 55 55 55 55 56 56 56 56 56 56 57 57 57 57 57 57 57 57 58 58 58 58 58 58 58 59 59 59 60 60 60 60 60 60 61 61 61 61 61 61 62 62 62 62 63 63 63 63 63 63 63 63 63 64 64 64 64 64 64 64 65 65 65 65 65 66 66 67 67 67 67 67 67 67 67 68 68 68 69 69 69 69 70 71 72 72 72 73 74 76 77 77 77 77 79
4
5
Figure 3.4. Sepal length data from the Iris data set.
34444566667788888999999 000000000011 1111 111 222234444445555555666666777777778888888999
6 000000 11 1111222233333333344444445555566777777778889999 7 0122234677779
Figure 3.5. Stem and leaf plot for the sepal length from the Iris data set.
4 3444 4 566667788888999999 5 00000000001 11111 11122223444444 5 5555555666666777777778888888999 6 00000011111122223333333334444444 6 5555566777777778889999 7 0122234 7 677779
Figure 3.6. Stem and leaf plot for the sepal length from the Iris data set when buckets corresponding to digits are split.
Once the counts are available for each bin, a bar plo t is constructed such t hat each bin is represented by one bar a nd the a rea of each bar is proportional to the number of values (objects) t hat fall into the corresponding range. If all intervals are of equal width, then all bars a re the same width and the height of a bar is proportional to the num ber of values in the corresponding bin.
Examp le 3. 8. F igure 3.7 shows hist ograms (wi t h 10 bins) for sepal length, sepal widt h, petal length, and petal width. Since the shape of a histogram can depend on the number of bins, his tograms for the same data, but with 20 bins , are shown in F igure 3.8. •
There are variations of the hist ogr am plot. A r elative ( fr eque n cy) his- tog ra m replaces t he count by the relative frequency. However , t his is just a
3 .3 Vis ualization 113
(a) Sepal len gLh. (b) Sepal width. (c) Petal length. (d) Petal width.
Figure 3.7. Histograms of four Iris attributes (10 bins).
(a) Sepal length. (b) Sepal width. (c) Petal length. (d) Petal wid th.
Figure 3.8. Histogra ms of four Iris attributes (20 bins).
change in scale of the y axis, and the shape of the histogram does not change. Another common variation, especially for unordered categorical data, is the P aret o histogr am , which is the same as a normal histog ram except that the categories are sorted by count so that the count is decreasing from left to right.
T wo-Dimen sio n a l Histog r ams Two-dimensional histograms are also pos- sible. Each attribute is divided into intervals and the two sets of intervals define two-dimensional rectangles of values.
E xam p le 3.9 . F igure 3.9 shows a two-dimensional histogram of petal length and pet al width. Because each a t tribute is split into th ree bins, there are nine rectangular two-dimensional bins. The height of each rectangular bar indicates the number of objects (flowers in this case) t hat fall into each bin. Most of the flowers fall into only three of the bins-those along the diagonal. It is not possible to see this by looking at the one-dimensional distributions. •
114 Chapter 3 Exploring Data
c " 8
Figure 3.9. Two-dimensional histogram of petal length and width in the Iris data set.
Whi le two-dimensional histograms can be used to discover interesting facts about how the values of two attributes co-occur, t hey are visually more com- plicated. For instance, it is easy to imagine a situation in which some of the columns are hidden by others.
Box Plots Box plots are a nother method for showing the dis tri bution of t he values of a single numerical attribute. Figure 3.10 shows a labeled box plot fo r sepal length. T he lower and upper ends of t he box indicate t.he 25th and 75th percentiles, respectively, whi le t he line inside the box indicates the value of the 501h percentile. The top and bottom li nes of the tai ls indicate the 10th and goth percentiles. Outliers are shown by "+" ma rks. Box plots a re relatively compact, a nd thus, many of them can be shown on t he same plot. Sim plified versions of the box plot, which take less space, can a lso be used.
Example 3.10. The box plots for the first fou r attributes of the Iris data set are shown in Figure 3.11. Box plots can also be used to compare how attributes vary between different classes of objects, as shown in Figure 3.12.
•
Pie Chart A pie chart is similar to a histogram, but is typically used wi th categorical attributes that have a relatively small number of values. Instead of showing the relative frequency of different values with the area or height of a bar, as in a histogram, a pie chart uses t he relative area of a circle to indicate relative frequency. Although pie charts are common in popular articles, they
~ ' ! !
_j_
-Outlier
- 90"' percentile
+--- 75tt1 percen1ite
+--- soth percentile
+---- 25th percentlle
+---- , 01h percenlilo
Figure 3.1 0. Descripti on of
box plot for sepal length.
I: ~
$ l· +
c;!;. ..... ~s-c.o- ...... ~~"""-'
3.3 Visuali zation 115
-,..
6
~ I. 0 ! . + j 3 ~ ~ e
Sepal Length SOQIIWktlh Petal Leng4h Petal Width
Figure 3.11. Box plot for Iris aMributes.
,: $ ·~ T $ f:
j_ 8 "
j_
J $ J: $ ~
..L $ ~l~ ..... - ...... """""",.,.... ....... S..l ...... s-.-"-> -'--CIII' ,..,.._
(a.) Sctosa.. (b) Versico lour. (c) Vi rginica..
Figure 3.12. Box plots of attributes by Iris species.
are used less freq uently in t echn ical publications because the size of relative areas can be hard to judge. Histograms are preferred for technical work.
Example 3 .11. Figure 3.13 displays a pie chart t hat shows the distribu tion of Iris species in t he I ris data set. In this case, all t hree Hower types have the same frequency. •
P ercentile Plots and Empirical Cumulative Distrib ut ion Functions A type of diagram that shows the distributiqn of the data more quantitatively is the plot of an empirical cumulative d istribution function. While this type of plot may sound complicated, the concept is straightforward. For each value of a statistical distribution, a cumulative distribution function (CDF) shows
116 Chapter 3 Exploring Data
Versicolour
Figure 3.13. Distribution of the types of Iris llowers.
the probability that a point is less than that value. For each observed value, an em pirical cumulat ive distrib utio n function (ECDF) shows the fraction of points that are less t han this value. Since the number of points is finite, the empirical cumulative distribution function is a step function.
Example 3.12. Figure 3.14 shows the ECDFs of the Iris attributes. The percentiles of an attribute provide similar information. Figure 3.15 shows the p ercentile p lots of the four continuous attributes of the Iris data set from Table 3.2. The reader should compare these figures with the histograms given in Figures 3.7 and 3.8. •
Scatter Plots Most people are familiar with scatter plots to some extent, and they were used in Section 2.4.5 to illustrate linear correlation. Each data object is plotted as a point in t he plane using t he values of the two attributes as x and y coordinates. It is assumed that the attributes are either integer- or real-valued.
Example 3.13. Figure 3.16 shows a scatter plot for each pair of at tributes of the Iris data set. The different species of Iris are indicated by different markers. The arrangement of the scatter plots of pairs of attribu tes in this typ e of tabular format, which is known as a scatte r p lot matrix , provides an organized way to examine a number of scatter plots simultaneously. •
3. 3 Visualization 117
(a) Sepal Length. (b) Sepal Widt h.
~0.5
'·'
(c) Petal Length. (d) Petal Width.
Figure 3.14. Empirical CDFs of four Iris attributes.
·- Figure 3.15. Percentile plots for sepal length, sepal width, petal length, and petal width.
118 C h apter 3 Exploring Data.
8 Cllfo soo 5 oorf'
\ 0 "' ~0 "' 0 u <II u ·c: <B"tj. 0 '§ 'e> '.P m o; CfJ ~ > )( )()(' ..,. . ·~-- + t .. 0 -~ .... .. + ol 0 ij: X )C)(X'f' )( co " "' "' Ill V U1 M ll') C\1 "' " C\1 " (') N t.n6uat tedas 41P!M tedas 416ua1 telad
~ o ~<eo afl t ~~ ~
+ i 0 + "':!: Ill C\1 Ill - Ill 0 C\1 0
41P!M 1e1ad
N
co
1'-.t:: 0, c Q)
"'= co a. Q)
"'"'
3 .3 Visualization 119
There are two main uses for scatter plots. First , they graphically show t he relationsh ip between two attribu tes. In Section 2.4.5, we saw how scatter plots could be used t o judge t he degree of linear correlation. (See Figure 2 .17.) Scatter plots can also be used to detect non-linear relationships, either direct ly or by using a scatter plot of the t ransformed a t tri butes.
Second , when class labels are ava ila ble, they can be used to investigat e the degree to which two attri butes separate the classes. If is possible to draw a line (or a more complicated curve) t hat divides the plane defined by the two attributes into separate regions that contain mostly objects of one class, then it is possible to construct a n acc urate classifier based on the specified pair of attributes. If not , then more at tri butes or more sophisticated methods are needed to build a classifier. In F igure 3.16, many of the pairs of attributes (for example, pet a l width and petal length) provide a moderate separation of the Iris species.
Example 3.14. There are two separate approaches for displaying three at- tributes of a data set with a scatter plot. First, each object can be displayed according to the values of t hree, instead of two a t tribu tes. Figure 3.17 shows a th ree-dimensional scatter plot for three attribu tes in t he Iris data set. Second , one of the attributes can be associated with som e cha racteristic of the marker, such as its size, color, or shape. F igure 3.18 shows a plot of three attributes of the Iris data set, where one of t he attributes, sepal wid th , is mapped to the size of t he marker. •
Exten ding Two- and T hre e-Dimension a l P lots As illustrated by Fig- ure 3 .18 , two- or three-dimension al plots can be extended to represent a few add it ional attributes . For example, scatter plots can displ ay up to three ad- di tional attrib utes using color or shading, size, and shape, allowi ng five or six dimensions to be represented. There is a need for caution, however. As the complexity of a visual representat ion of the data increases, it becomes harder fo r the intended audience to interpret the information. T here is no benefit in packing six di mensions ' worth of informat ion into a two- or three-dimensional plot, if doing so makes it impossible to understand.
V isua l iz in g Sp a t io- t e mporal D ata
Data often has spatial or temporal attributes. For instance, the data may consist of a set of observations on a spatial grid , such as observations of pres- sure on the surface of the Earth or t he modeled temperature a t various grid points in the simulat ion of a physical object. T hese observations can also be
120 Chapter 3 Exploring Data
2
"' 1.5 g. " .J
"iii c.
" (/) 0.5
0 5
. . ··-..
. ·~ .. ' ...
--~ • !C ::. • •
+ Setosa • Versicolou r
., Virginica
,_ .. ~~ ..... , ..... .. ,.. .. . . x ... ";·r .. ·.,'-..••·r• ·-. +"""·J· : .
. ,,{ · • ,. ·. ... · • -!< T "· . . " ,l; • ~ ..• , • . • .. t-:ta ... ..; .. . . •. ~ ·:: .. ~:=- · ~: + +il+,
Sepal Width 3
Figure 3.17. Three-dimensional scatter plot of sepal width, sepal length, and petal width.
2.5
2
~ 1,5 s: "iii ;;; 0..
0.5
• Setosa • Vers ico lour "' Virginlca
o,~----~2------~3~-----L------L5------~6------~
Petal Length
Figure 3.1 B. Scatter plot of petal length versus petal width, with the size of the marker indicating sepal width.
3.3 Visualization 121
Figure 3.19. Contour plot of SST for December 1998.
made at various points in time. In addition, data may have only a temporal component , such as time series data th at gives the daily prices of stocks.
Contour Plots For some three-dimensional data, two attributes specify a position in a plane, while the third has a continuous value, s uch as temper- ature or elevation . A useful visualization for such data is a contour plot , which breaks the pl ane into separate regions where the values of the t hird at t ribute (temperat u re, elevation) are roughly the same. A common example of a contour plot is a contour map that shows the elevation of land locations.
Example 3.15. F igure 3.19 shows a contour plot of the ave rage sea surface temperature (SST) for December 1998. The land is ar bitrari ly set to have a tempera t ure of 0°C. In many contour m a ps, such as that of F igure 3 .19, the contour lines that separate two regions are labeled w ith the val ue used to separ ate the regions. For clarity, some of these lab els have b een deleted. •
Surface Plots Li ke contour plots, s u rface p lots use two attributes for the :r and y coordinates. The third a t tribute is used to indicate the h eight above
122 Chapter 3 Exploring Data
(a) Set of 12 points. {b) Overall density fun ctio n-surface plot.
Figure 3.20. Density of a set of 12 points.
the plane defined by the first two attribu tes. While such graphs can be useful, they require that a value of the third attrib ute be defined for all combinations of values for the first two attributes, at least over some range. Also, if the su rface is too irregu lar, then it can be difficult to see all the information , unless the plot is viewed interactively. T hus, surface plots are often used to desc ribe mathema tical functions or physical sur faces that vary in a relatively smooth manner.
Example 3 .16. Figure 3.20 shows a surface plot of t he density around a set of 12 points. This example is furt her discussed in Section 9.3.3. •
Vector Field P lots In some data, a characteristic may have both a mag- nit ude and a direction associated with it. For example, consider the flow of a su bstance or the change of density with location. In these situations, it can be useful to have a plot that displays both direction and magnitude. This type of plot is known as a vector p lot.
Example 3 .17. Figure 3.21 shows a contour plot of the density of the two smaller density peaks from Figure 3.20(b), an notated with the density gradient vect ors. •
Lower-Dimensiona l Slices Consider a spatio-temporal data set that records some quantity, such as temperature or pressure, at various locations over time. Such a data set has four dimensions and cannot be easily displayed by t he types
3.3 Visualization 123
\ \_..,\· ··\ "''l · · ·l . . . l. I \ \ .. \ .. , ."I . I . '
I 1 -- 1 ... ). I I '
I I
Figure 3.21. Vector plot of the gradient (change) in density for the bottom two density peaks of Figure
3.20.
of plots that we have described so fa r. However, separate "slices" of the data can be displayed by showing a set of plots, one for each month . By examining the change in a particular area from one month to another, it is possible to notice changes that occur, including those that may be due to seasonal factors .
Example 3.1 8. The underlying data set for this example consists of the av- erage mont hly sea level pressure (SLP) from 1982 to 1999 on a 2.5° by 2.5° latitude-longitude grid. T he twelve monthly plots of pressu re for one year are shown in F igu re 3.22. In this example, we are interested in slices for a par- ticular month in the year 1982. More generally, we can consider slices of t he data along any arbitrary dimension. •
Animat ion Another a pproach to dealing with s lices of da ta., whet her or not t ime is involved, is to employ animation. The idea is to display successive two-dimensional slices of the data. The human visual system is well suited to detecting visual changes and can often notice changes t hat might be difficult to detect in anot her manner. Despite the visual appeal of animation, a set of still plots, such as those of Figure 3.22, can be more useful since this type of visualizat ion allows the information t o be stud ied in arbitrary ord er and for a rbitrary amou nts of time.
124 Cha pter 3 Exploring Data
January February March
April May June
July August September
October N ovember December
Figure 3.22. Monthly plots of sea level pressure over the 12 months of 1982.
3. 3.4 Visualizing Higher-Dime ns ional D a ta
This section considers vis ua lization techniques that can display more than the handful of dimensions that can be observed with the techniques just discussed. However, even these t echniques are somewhat limited in t hat they only show some aspects of the dat a.
Matrices An image can be regarded as a rectangular array of pixels, where each p ixel is characterized by its color and br ig htness. A data matrix is a rec t angular array of val ues. Thus, a data matrix can be visualized as an image by associating each entry of t he data matrix wi t h a pixel in t he image. The brightness or color of the pixel is de ter mi ned by the value of the corresponding entry of the matrix .
Figure 3.23. Plot of the Iris data matrix where columns have been standardized to have a mean of 0 and standard deviation ol 1.
3. 3 Visualization 125
Figure 3.24. Plot of the Iris correlation matrix.
There are some important practical considerations when visualizing a data matrix. If class labels are known , t hen it is useful to reorder the data matrix so that all objects of a class are together. This makes it easier, for example, to detect if all objects in a class have similar attribute values for some attributes. If differe nt attribut es have different ranges , then t he attri butes are often stan· dardized to have a mea n of zero and a standard deviation of 1. This preveuts the attribute with the largest magnitude values from visually dominating tlte plot.
Example 3 .19 . F igure 3.23 shows t he standardized data mat rix for the lris data set. The first 50 rows represent lris flowers of the species Setosa, the next 50 Versicolour, a nd the last 50 Virginica. The Setosa flowers have petal width and length well below the average, while the Versicolour flowers have petal width and length around average. The Virginica flowers have petal width and length above average. •
It can also be useful to look for structure in the plot of a proximity matrix for a set of data o bjects. Again , it is useful to sort t he rows and columns of the similarity matrix (when class labels are known) so that all the objects of a class a re together. This allows a visual evaluation of the cohesiveness of eaclt class and its separation from o ther classes.
Example 3 .20 . Figure 3.24 shows the correlation matrix for the Iris data set. Again , the rows and columns are organized so t ha t a ll the flowers of a. particular species are together. The flowers in each group are most simi lar
126 C ha p ter 3 Exploring Data
to each other, but Versicolour and Virginica are more similar to one another t han to Setosa. •
If class labels are not known, various techniques (matrix reordering and seriation) can be used to rearrange t he rows and columns of the similarity matrix so that groups of highly similar objects and attributes a re together and can be visually identified. Effectively, t his is a simple kind of clustering. See Section 8.5.3 for a discussion of how a proximity matrix can be used to investigate the cluster structure of data.
Para lle l C oord ina t es Parallel coordinates have one coordinate axis for each attribute, but t he different axes a re pa rallel to one other instead of per- pendicular, as is trad itional. Furthermore, an object is represented as a line instead of as a point. Specifi~:ally, the value of each attribute of an object is map ped to a point on the coordinate axis associated with that att ri bute, and these points are then connected to for m the line that represents t he object.
It, might be feared t hat t his would yield quite a mess. However, in many cases, objects tend to fall into a small number of groups , where the points in each group have si mi lar values for their at t ri b utes . If so , and if t he number of data objects is not too large, then the resul ti ng parallel coordinat es plot can reveal interesting patterns.
E x am p le 3.21. Figure 3.25 shows a parallel coordinates plot of t he four nu- merical attrib utes of the Iris data set. T he lines representing objects of differ- ent classes are distinguished by t heir shadjng and the use of t hree different line styles-solid , do t ted , and dashed. T he parallel coordinates plot shows t hat t he classes are reasonably well separated for petal width and petal length, but less well separated for sepal lengt h and sepa l width . F igure 3.25 is another parallel coordinates plot of t he same data, but with a different ordering of the axes . •
One of the drawbacks of parallel coordinates is that the detection of pat- terns in such a plot may depend on the order. For instance, if Ji nes cross a lot, the picture can become confusing, and thus, it can be desirable to order the coordinate axes to o btain sequences of axes with less crossover. Compare Figure 3.26, where sepal width (the at tribute t hat is most mixed) is at t he left of the fig ure, to Figure 3.25, where this attribute is in the middle.
Sta r Coor dina t es a nd C h e rnoff Faces
Another approach to displaying multidimensional data is to encode objects as g lyp hs or icon s- symbols that impart information non-verbally. More
~ 2 "' E ·~ 4
"' .!?. "' " 'iii >
Sepal Lenglh Sepal Widlh
3.3 Visualization 127
- - -Sel osa - - - Verslcolour ...... · Virginica
Pel al Lenglh
Figure 3.25. A parallel coordinates plot ol the four Iris attributes.
- - - Selosa - - - Verslcolour . ... . .. -Virglnica
6
Sepal Widlh Sepal Lenglh Pelal Lenglh Pela l Widlh
Figure 3.26. A parallel coordinates plot of the four Iris at1ributes with the at1 ributes reordered to emphasize similarities and dissimilarities of groups. '
128 Chapter 3 Exploring Data
specifically, each atlribu t e o f an o bjecl is mapp ed to a particular feature of a g, lyph, so that t he value o f t he a ttribute determines t he exact n ature of the feature . Thus, at a glance, we can distinguish how t wo objects differ.
S t ar coo rdinates are one example of this approach. This technique uses o ne axis for each attribute . T hese axes a ll radiate from a center p oint, like t he spokes of a wheel , and are evenly spaced. Typically, all the attribute values are mapped to the range [0, 1) .
An object is ma pped onto t h is star-shaped set of axes using the following process: Each attribute value of the o bject is converted to a fraction t hat represents its distance between the minimum and maximum values of the attribute. T his fraction is m ap ped t o a point on the axis correspond ing to this att ri b ute. Each p oi nt is connected with a line segment to the point on the axis preceding or following its own axis; this forms a polygon. The size and shape o f this polygon gives a visual description of the attribute values of the object. For ease of interpretation, a separate set of axes is used for each object. l n other words, each object is mapped to a polygon. An example of a star coordinates plot of flower 150 is given in Figure 3.27(a) .
It is also possible to map t he values of featur es to those of more familiar objects, such as faces. Thjs technique is named Che r noff faces for its creator, Herman Chernoff. ln this technique, each a ttribu te is associated with a specific feature of a face , and the attribute value is used to determine the way that the facial fea t ure is expressed . Thus, the shape of the face may b ecome more elongat ed as the value of the corresponding data feature increases. An example o f a Chernoff face for flower 150 is given in Figure 3.27(b) .
The program that we used to make this face mapped the features to the four featur es listed below . Other features of the face, such as wid th between the eyes and length of the mouth, are given default values.
Data Feature sepal length sepal width petal le ngth pet al width
Facial Feature size of face forehead/jaw re lative arc length shape of forehead shape of jaw
Examp le 3.22. A more extensive illus tration of these two ap proaches to view- ing mult idimensional d ata is provided by Figures 3 .28 and 3.29, which shows the star and face plots, respectively, of 15 flowers from t he Iris data set. The first 5 flowers are of species Setosa, the second 5 ar e Versicolour , and the last 5 a re V irgin ica. •
3.3 Visualization 129
(a) Star graph of Iris 150. (b) Chernoff face of Iris 150.
Figure 3.27. Star coordinates graph and Chernoff face of the 150'h flower of the Iris data set.
$$47~$ M ~ ~ ~ ~
~~$¢¢ 101 102 103 t Q-4 tOS
Figure 3.28. Plot of 15 Iris flowe rs using star coordinates.
(Y) 0 ""' 0 <D
e e e eJ e 51 52 53 54 55
e e e e e 101 102 103 104 105
Figure 3.29. A plot of 15 Iris flowers using Chernoff faces.
130 Chapter 3 Exploring Data
Despite the visual appeal of these sorts of diagrams, they do not scale well, and thus, they are of limited use for many data mining problems. Nonetheless, they may still be of use as a means to quickly compare small sets of objects that have been selected by other techniques.
3 .3 .5 Do's and Don'ts
To conclude this section on visualization, we provide a short list of visualiza- tion do's and don'ts. While these guidelines incorporate a Jot of visualizat ion wisdom, they should not be followed blindly. As always, guidelines are no substitute for thoughtful consideration of the problem at hand.
ACCE NT Principles The following are the ACCENT principles for ef- fective graphical display put forth by D . A. Burn (as adapted by Michael Friendly):
Apprehension Ability to correctly perceive relations among variables. Does the graph maximize apprehension of the relations among variables?
Clarity Ability to visually distinguish all the elements of a graph. Are t he most important elements or relations visually most prominent?
Consistency Ability to interpret a graph based on similarity to previous graphs. Are the elements, symbol shapes, and colors consistent with their use in previous graphs?
Efficien cy Ability to portray a possibly complex relation in as simple a way as possible. Are the elements of the graph economically used? Is the graph easy to interpret?
Necessity The need for the graph, and the graphical elements. Is the graph a more useful way to represent the data than alternatives (table, text)? Are all the graph elements necessary to convey the relations?
Truthfulness Ability to det ermine the true value represented by any graph- ical element by its magnitude relative to the implicit or explicit scale. Are the graph elements accurately positioned and scaled?
Tufte's Guidelines Edward R. Tufte has also enumerated the following principles for graphical excellence:
3.4 OLAP and Multidimensional Data Analysi s 131
• Gra phical excellence is the well-designed presentation of int erest ing data- a matter of substance, of statistics, and of design.
• Graphical excellence consists of complex ideas communicated with clar- ity, precision, and efficiency.
• Graphical excellence is that which gives to the viewer the greatest num- ber of ideas in the shortes t time with the least ink in the smallest space .
• Graphical excellence is nearly always multivariate .
• And graphical excellence requires telling t he t ru t h abo ut the dat a ..
3 .4 OLAP and M ult idimensio n a l Data Analysis
In this section, we investigate the t echniques and insights that come from viewing data sets as multidimensional arrays. A number of database sys- tems support such a viewpoint, most notably, On-Line Anal ytical Processing ( OLAP) systems. Indeed, some of the terminology and capabilities of OLAP systems have made their way into spreadsheet programs that are used by mil- lions of people. OLAP systems also have a strong focus on the interactive analysis of data and typically provide extensive capabilities for visualizing the data and generating summary statistics . For these reasons, our approach to multidimensional data analysis will be based on the term inology and concepts common to OLAP systems.
3. 4.1 Representing Iris Data as a Mul t id imensional Array
Most data sets can be represented as a table, where each row is an object and each column is an attribute. In many cases, it is also possible to view t he data as a multidimensional array. We illustrate this approach by re presenting the Iris data set as a multidimensional ar ray.
Table 3.7 was created by discretizing the petal length and petal width attributes to have values of low, medium, and high and then counting the number of flowers from the Iris data set that have parti cular combina.tions of petal width, petal length, and species type. (For petal width, the cat- egories low, medium, and high correspond ·to the int ervals [0 , 0.75), [0.75, 1. 75), [1. 75 , oo), respectively. For petal length, the categories low, medium, and high correspond to the intervals [0, 2.5) , [2 .5, 5) , [5, oo), respectively.)
132 C h a pte r 3 Exploring Data
Table 3.7. type.
Numbe r of flowers hav ing a particular combination of petal width, petal leng th, and species
Petal Length Petal Width Species Type Count low low Setosa 46 low medium Setosa 2
medium low Setosa 2 medium medium Versicolour 43 medium high Versicolour 3 medium high Virginica 3
high medium Versicolour 2 high medium Virginica 3 high high Versicolour 2 high high Virginica 44
Petal Width
Vi rginica/ / / / sicolour/ / / / Ve r
Se tosa / .. ...... ~- '- .. ---/---- · ···- v high
mediu m
low
Petal Width
0
0
' 0
..c.
.Ql
..c.
0
·o -
·' 2
E ::J
'6 Ql
E
, • / .0 · / .. ··,· v . /L 2
// ~ •.;1. ·lli
. - : / v" 46 . / Re
/ q
Fig ure 3.30. A multidimensional data representation for the Iri s data set.
3.4 OLAP and Multidimensional Data Analysis 133
Table 3.8. Cross-tabulation of flowers accord· ing to petal length and width for flowers of the Setosa species.
Width low medium high
..c low 46 2 0 .. ~ med ium 2 0 0 s: Cl) high 0 0 0
....:l
Table 3.1 0. Cross-tabulation of flowers ac- cording to petal lengt h and width for fl owers of the Virgin ica species.
Wi d th low medium high
..c ... low 0 0 0 bl) medium 0 0 3 s:: Cl) high 0 3 44 ....:l
Table 3.9. Cross-tabulation of flowers accord· ing to petal length and width for flowers of th e Versicolour species.
Width low medium hi gh
..c low 0 0 0 bD medium 0 43 3 s:: Cl) high 0 2 2 ....:l
Empty combinations-those combinations that do not correspond to at least one flower-are not shown.
The data can be organized as a multidimensional array with th ree dimen- sions corresponding to petal width, petal length, and species type, as ill us- trated in Figure 3.30. For clarity, slices of this array are shown as a set of three two-dimensional tables, one for each species-see Tables 3.8, 3.9, and 3.10. The information contained in both Table 3.7 and Figure 3.30 is the same. However , in t he multid imensional representation s hown in Figure 3.30 (and Tables 3.8, 3.9, and 3. 10), the val ues of the attributes- petal width, petal length, and species type--are a rray indices.
What is important are the insights can be gained by looking at data from a multidimensional viewpoint. Tables 3.8, 3.9, and 3.10 show that each species of lris is characterized by a different combination of values of petal length and width. Setosa Bowers have low width and length, Yersicolour flowers have medium width and length, and V irginica flowers have high width and length.
3.4. 2 M ult id im e n s ional D ata: The .Gen e r a l Case
The previous sect ion gave a specific example of using a multidimensional ap- proach to represent and analyze a familiar data set. Here we describe the general approach in more d etail.
134 Chapter 3 Exploring Data
The starting point is usually a tabular representa tion of the data, such as that of Table 3.7, which is called a fact table. Two steps are necessary in order to represent data as a mult idimensional array: identification of t he dimensions and identification of an attribute that is the focus of the analy- sis. The dimensions are categorical attribu tes or, as in the previous example, continuous attributes that have been convert ed to categorical attribu tes. The values of an attri bute serve as indices into t he array for t he di mension corre- sponding to the attribute, and the number of attribute values is the size of that dimension . In the previous example, each attribute had three possible values, and thus, each dimension was of size three and could be indexed by three values. This produced a 3 x 3 x 3 multidimensional array.
Each combination of attribute values (one value for each different attribute) defines a cell of the multidimensional array. To illustrate using the previous example, if petal lengt h = low, petal width = medium, and s pecies = Setosa, a specific cell containing the value 2 is identified. That is, the re are only two flowers in t he data set that have the specified attribute val ues. Notice that each row (object) of the data set in Table 3.7 corresponds to a cell in the multidimens ional array.
The contents of each cell represents t he value of a target quantity (target variable or attribute) that we are interested in analyzing. In the Iris example, the target quantity is the number of flowers whose petal width and length fall within certain limits. T he target at tribute is quanti tati ve because a key goal of multidimensional data analysis is to look aggregate quant ities, such as totals or averages.
The fo llowi ng summarizes the procedure for creating a multidimensional data representatio n from a data set represented in t abular form. First, identify t.he categorical attributes to be used as the dimensions and a quantitative attribute to be used as the target of the analysis. Each row (object) in the table is mapped to a cell of the multidimensional array. The indices of the cell are specified by the values of the attributes that were selected as dimensions, wh ile the value of the cell is the value of the target attribute. Cells not defined by t.he data are assumed to have a val ue of 0.
Example 3.23. To further illustra te the ideas just discussed, we present a more traditional example involving the sale of prod ucts.The fact t able fo r t his example is given by Table 3.11. The dimensions of t he multidimensional rep- resentation are the product ID, location, and date attributes, while the target at t ribute is the revenue. Figure 3.31 shows the multidimensional representa- tion of this data set. This larger and more complicated data set will be used to illustrate additional concepts of multidimensional data analysis. •
3.4 OLAP and M ult id imensional Data Analysis 135
3.4.3 Analyzi ng Mul t idimensional Data
In th is section, we desc ribe different multidimensional analysis techni ques. Jn particular, we discuss the creation of data cubes, and related operations, such as slicing, dicing, dimensionality reduction, roll-up, and drill down .
Data Cubes: Computing Aggregate Quantities
A key motivation for taking a mult idimensional viewpoint of data is the im- po rt ance of aggregati ng data in various ways. I n the sales exam ple, we might wish to fin d t. he total sales reve nue for a specific year and a s p ecific product. Or we might wis h to see the yearl y sales revenue for each location across all products. Computing aggregate totals involves fixing specifi c val ues for some of the attributes that are being used as dimensions and t hen summi ng over all possible val ues for the attributes that make up the remaining dimensions. There are other ty pes of aggregate q uantities that are also of interest, but for simplicit y, this discussion will use totals (sums).
Table 3.12 shows the resul t of summi ng over all locations for various com- binations of date and product. For simplicity, assume that all the dates are within one year. If there a re 365 days in a year and 1000 products , then Table 3.12 has 365,000 entri es (totals) , one for each product-data pair. We could also specify the store location and date and sum over products, or specify the location a.nd product and sum over all dates.
Table 3.13 shows the marg inal totals of Table 3.12 . These totals are t he result of further summing over either dates or products. In Table 3.13, the total sales revenue due to product 1, which is obtained by summing across row 1 (over all dates), is $370,000. T he tot al sales revenue on J anuary 1, 2004, which is obtained by summing down column 1 (over all products), is $527,362. The total sales revenue , which is obtained by summing over all rows and columns (all t imes and products) is $227,352,1 27. All of t hese totals are for all locations because the entries of Table 3. 13 include all locations.
A key point of this example is that t here are a number of different totals (aggregates) that can be computed for a mul tidimensional array, depending on how many attri butes we sum over. Assume that t here are n dimensions and that t he ith dimension (attribute) has si possible values . There are n different ways t o sum only over a single attri bute. If we sum over dimension j, then we obtain s 1 * · · · * Sj-1 * Sj+J * · · · * sn to tals, 9ne for each possible combination of attribute values of then - 1 other attributes (dimensions). The totals that result from summing over one attri bute form a multidimensional array of n -1 dimensions and there are n such arrays of totals. In t he sales example, there
136 Chapte r 3 Exploring Data
Table 3.11. Sales revenue of products (in dollars) for various locations and lim es.
Product lD Location Date Revenue
Minneapolis Oct. 18, 2004 $250 Chicago Oct. 18, 2004 $79
Paris Oct. 18, 2004 301
27 Mi nneapolis Oct. 18, 2004 $2,321 27 Chicago Oct. 18, 2004 $3,278
27 Paris Oct. 18, 2004 $1,325
Date
Product ID
Figure 3.31. Munidimensional data representation for sales data.
3.4 OLAP and M ul ti d im ensional Data Analysis 137
Table 3.12. Totals that result from summing over all locations lor a fixed lime and product.
date Jan 1, 2004 Jan 2, 2004 Dec 31, 2004
Q 1,001 $987 $891
....
.... u ;::l
"0 27 $10,265 $10,225 $9,325 0 ... 0.
Ta ble 3.13. Table 3.12 wil h marginal lotals.
d a te Jan 1, 2004 Jan 2 , 2004 Dec 31, 2004 total
Q $1,001 $987 $891 $370,000
.... ... u ;::l
"0 27 $10,265 $10,225 $9,325 $3,800,020 0 ... 0.
total $527,362 $532,953 $631,221 $227,352,127
are th ree sets of totals that r esult from s um m ing over only one dimension and ea ch set of to tals can be disp layed as a two-dimensional table.
If we sum over two dimensions ( perhaps star t ing wit h one of the arrays of totals obtained by s u mming over one dimension), then we will obtain a multidimensional a rray of totals with n - 2 dimensions. T here wi ll b e (~)
distinc t a rrays of such to ta ls. For t he sales examples, there will be (~) = 3 arrays of totals t hat result from s um m ing over location and product, location and time, or product and time. In general, summing over k dimensions yields G) arrays o f totals, each with d imensio n n- k .
A multidimensional representati on o f the d ata, together with all possible to ta ls (aggregates), is k nown as a data cube. D espi te the name, the size of each dime nsion- the number of a ttr ib ute values-does not need to be equal. Also, a data cube may have either more or fewer than three dimen~ions. More importantly, a data cube is a ge neralization of what is known i n statistical termi nology as a cross-tabulation . If marginal totals were added, Tables 3.8, 3.9, or 3.10 would be typical examples of cross tabulations .
138 C ha pter 3 Exploring Data
Dim e n s ion a lity Reduction and Pivoting
The aggregation descri bed in t he last section can be viewed as a form of dime n sionality reduction . Specifically, the jth dimension is eliminated by summing over it. Conceptually, this collapses each "column" of cells in t he lh dimension into a s ingle cell. For both the sales and Iris examples, aggregating over one dimension red uces the dimensionali ty of t he data from 3 to 2. If Sj is the nu mber of possible val ues of the j th dimension, th e number of cells is reduced by a factor of Sj . Exercise 17 on page 143 asks the reader to explore t.h e difference between t his type of dime nsionali ty reduction and that of P CA.
Pivot ing refers to aggregating over all dimensions except two. The result is a two-d ime nsional cross t abulation with t he two specified dimensions as the only remain ing dimensions. Table 3.13 is an example of pivoting on date and product.
Slicing a nd Dicing
These two colorful names refer to rathe r straight forward operations. Slicing is selecting a group of cells from the entire multidimensional array by specifying a speci fi c value for one or more dimensions. Tables 3.8, 3.9, a nd 3.10 are three slices from the Iris set that were obtained by specifyi ng three separate values for the species dimension . Dicing involves selecting a subset of cells by specifying a range of attri bute values. This is equivalent to defi ning a subarray from the complete array. In practice, both operations can also be accompanied by aggregation ove r some dimensions.
R o ll-Up and D rill-Dow n
I n Chapter 2, attr ibute values were regarded as being "atomic" in some sense. However , th is is not always the case. In particular , each date has a number of pro pert ies associated with it such as the year , month, and week. The data can also be identified as belonging to a particular business quarter, or if the app lication relates to educat ion , a school quarter or semester . A location also has various properties: continent, country, state (province, etc.), and city. P roducts can also be divided into various categories, such as clothing, electronics, and furniture.
Often these categories can be organized as a hierarchical tree or lattice. For instance, years consist of months or weeks, both of which consist of days. Locations can be divided into nations, which contain states {or other units of local government), which in turn contain cities. Likewise, any category
3.5 Bibliograp hic Not es 139
of products can be further subdivided. For example, t he product category, furniture, can be subdivided into the subcategories, chairs, tables, sofas, etc.
This hjerarchical struc ture gives rise to the roll-up and drill-down opera- tions. To illustrate, starting with the original sales data, which is a multidi- mensional array with entries for each date, we can aggregate {r oll up) the sales across all the dates in a month. Conve rsely, given a representation of t he data where the t ime dimension is broken into months, we might want to split t he monthly sales totals {drill dow n ) into daily sales t ot als. Of course, this requi res t hat the underlying sales data be ava.il able at a daily granularity.
Thus, ro ll-up and drill-down operations are related to agg regation . No- tice, however, that they differ from the aggregation operations discussed until now in that they aggregate cel ls within a dimension, not across the entire dimension.
3.4.4 Final Comments on M ul t idime nsiona l Data Analysis
Multidimensional data a nal ysis, in t he sense implied by OLAP and related sys- tems, consists of viewing the data as a multidimensional ar ray and aggregating data in order to better analyze the structure of the data. For t he Iris data, the differences in petal width and length are clearly shown by such an anal- ysis. The analysis of busi ness data, such as sales data, can also reveal many interesting patterns, such as profitable {or unprofitable) stores or products.
As mentioned, there are various types of database systems that support the analysis of multidimensional data. Some of these systems are based on relational databases and a re known as ROLAP systems. More specialized database systems t hat specifically employ a mul tidimensional data represen- tation as their fundamental data model have a lso been designed. Such systems are known as MOLAP systems. In addition to these types of systems, statisti- cal databases (SDBs) have been developed to store and analyze various ty pes of statistical data, e.g., census a nd public health data, that are collected by governments or other large organizations. References to OLAP and SDBs are provided in the bibliographic notes.
3.5 Bibliographic Notes
Summary stat istics are discussed in detail in most introductory statistics books, such as [92]. References for exploratory data analysis are the classic text by Thkey [104] and the book by Velleman and Hoaglin [105].
The basic visualization t echniques are read ily available, being an integral part of most spreadsheets {Microsoft EXCEL [95]) , statistics programs (SAS
140 Chapter 3 Exploring Data
[99], SPSS 1102], R [96], and S-PLUS [98)), and mathematics software (MAT- LAB [94] and Mathematica [93)) . Most of the graphics in this chapter were generated using MATLAB . The statistics package R is freely available as an open source software package from the R project.
The literature on visualization is extensive, covering many fields and many decades. One of the classics of the field is the book by Thfte [103]. The book by Spence [101], which strongly influenced the visualization portion o f t his chapter, is a useful reference for information visualization-both principles and techniques. This book also provides a thorough discussion of many dynamic visualization techniques that were not covered in this chapter. T wo other books on visualization that may also be of interest are those by Card et al. [87] and Fayyad et al. [89].
Finally, there is a great deal of information available about data visualiza- tion on the World Wide Web. Since Web sites come and go frequently, the best strategy is a search using "information visualization," "data visualization," or "statistical graphics." However, we do want to single out for attention "The Gallery of Data Visualization," by Friendly [90] . The ACCENT Principles for effective graphical display as stated in this chapter can be found there, or as originally presented in the article by Burn [86] .
There are a variety of graphical techniques that can be used to explore whether the distribution of the data is Gaussian or some other specified dis- tribution. Also, there are plots that display whether the observed values are statistically significant in some sense. We have not covered any of these tech- niques here and refer the reader to the previously mentioned statist ical and mathematical packages.
Multidimensional analysis has been around in a variety of forms for some time. One of the original papers was a white paper by Codd [88], the father of relational databases. The data cube was introduced by Gray et al . [91], who described various operations for creating and manipulating data cubes within a relational database framework . A comparison of stat ist ical databases and OLAP is given by Shoshani [100]. Specific information on OLAP can be found in documentation from database vendors and many popular books. Many database textbooks also have general discussions of OLAP, often in the context of data warehousing. For example, see the text by Ramakrishnan and Gehrke [97].
B ib liography 1861 D. A. Burn. Designing Effective Statistical Graphs. In C . R. Rao, editor, Handbook of
Statistics 9. E lsevier/Nor th-Holland, Amsterdam, The Netherlands, September 1993.
3.6 Exercises 141
1871 S. K. Card, J. D. MacK inlay, and B. Shneiderman, edi tors . Readings in Information Visualization: Using Vision to T hink. Morgan Kaufmann P ublishers, San Francisco, CA, January 1999.
j88j E. F. Codd , S. B . Codd, and C . T. Smalley. Provid ing OLAP (On-line Analytical Process ing) to User- A n alysts: An IT Mandate. Wh ite Paper, E .F. Codd and A ssociates, 1993.
J89j U. M. Fayyad, G . G . Grinstein, and A. Wierse, editors. Information Visualization in Data Mining and Knowledge Discovery. Morgan Kaufmann Publishers, San Francisco, CA, September 2001.
J90j M . Friendly. Gallery of Data Visualizat ion. http:/ f www.mat h .york u .caj SCSJ Gallery/, 2005.
[91 ) J. Gray, S. Chaudhuri, A. B osworth , A. Layman, D. Reichart, M. Venkatrao , F . Pellow, and H. Pirahesh. Data Cube: A Relational Aggregation Operator Generalizing Group- By, C ross-Tab , and Sub-Totals. Journal Data M in ing and Knowledge Discovery, 1( 1): 29-53, 1997.
[92) B. W. Lindgren. Statistical Theory. CRC Press, Jan uary 1993. [93) Mathematica 5.1. Wolfram R esearch, I nc . http:/ fwww .wolfram.com /, 2005. l94j MATLAB 7.0. The Math Works, I nc. h ttp: / /www .mathworks.com, 2005. J95) Microsoft Excel 2003. Micr osoft, Inc. h ttp: / fwww.microsoft.co m/ , 2003. l96j R : A language and environment for statistical computing and graphics. T h e R Project
for Statistical Computing. http:/ jwww.r-projec t.org/ , 2005. j97) R. Ramakrishnan and J. Gehrke. Database Management Systems. McGraw-Hi ll, 3rd
edition, A ugust 2002. l98j S-PLUS. Insightful Corporation. http:/ fww w.insightfu l.com , 2005. j99) SAS : Statistical Anal ysis System. SAS Institu te Inc. http:/ jwww .sas.com/ , 2005. [l OOj A. Shoshan i. OLAP and statis tical databases: similarities and differences . In ?roc.
of the Sixteenth ACM SJGACT·SIGMOD-SIGART Symp . on Principles of Database Systems, pages 185- 196. ACM Press, 1997 .
1101) R. Spence. Information Visualization. ACM P ress, New York, December 2000. J102) SPSS: Statistical Package fo r the Social Sciences. SPSS, Inc. http :/ jwww.spss.com/ ,
2005. 1103) E . R . Thfte. The Visual Display of Quantitative Information. Graphics Press, Cheshire ,
CT, March 1986 . J104) J. W . Thkey. Exp loratory dat a analysis. Addison-Wesley, 1977. [105) P. Velleman and D . Hoaglin . The ABC's of EDA: Applications, Ba sics, and Computing
of Exploratory Da ta Analysis. D uxbury, 198 1.
3 .6 E x ercises
1. Obtain one of the data set s available at the UCI Machine Learning Repository and apply as many of the different visualization techniques described in the chapt er as possible. The bibliographic notes and book Web site provide pointers to visualization software.
142 C hapter 3 Ex ploring Data
2. Identify at least two advantages and two disadvantages of using color to visually represent information.
3. What are the arrangement issues that arise wit h respect to three-dimensional plots?
4. Discuss the advantages and disadvantages of using sampling to reduce the num- ber of data objects that need to be displayed. Would simple random sampling (wi thou t replacement ) be a good approach to sampling? Why or why not?
5. Describe how you would create visualizatio ns to display information that de- scribes th e following types of systems.
(a) Computer networks. Be su re to incl ude both the static aspects of t he network, such as connectivity, and the dynamic aspects, such as traffic.
(b) The distribution of specific plant and animal species around the world for a specific moment in time.
(c) The use of computer resources, such as processor time, main memory, and d isk, for a set of benchmark database programs.
(d) The change in occupation of workers in a particular country over the last thirty years. Assume that you have yearly information about each person that also incl udes gender and level of education .
Be su re to add ress the following issues:
• Representation. How wi ll you map objects, attributes, and relation- shi ps to visual elements?
• Arra n geme nt. Are there any special considerat.ions that need to be taken into account with respect. to how visual elements are displayed? Spe- cific exam ples might be tbe choice of viewpoint, the use of transparency, or the separation of certain groups of object.s.
• Select ion. How will you handle a large number of att ri but.es and data objects?
6. Describe one advantage and one disadvantage of a stern and leaf plot with respect to a standard histogra m.
7. How might yo u address the problem that a histogram depends on the num ber and location of the bins?
8. Describe how a box plot can give information about whether the value of an attribute is symmetrically distributed. What can you say about the symmetry of the distributions of the attributes shown in Figure 3.11?
9. Compare sepal length, sepal width, petal length, and petal width, using Figure 3.12.
3.6 E xercises 143
10. Commen t on the use of a box plot to explo re a data set with four attributes: age, weight, height , and income.
11. G ive a possible explanation as to why most o f t he values of pe tal length and width fall in the b uckets along the d iagonal in Figure 3.9.
12. Use Figures 3.14 and 3.1 5 to identify a characteristic shared by the petal width and petal length attrib utes.
13. Simple line plots, such as that displayed in Figure 2.12 on page 56, which shows two time series, can be used to effectively display high-dimensional data. For exam ple, in Figure 2.12 it is easy to tell t hat the frequencies of the two t ime series are d iffere nt. What characteristic of time series allows the effective visualization of high-d imensional data?
14. Describe t he types of situations that produce sparse or dense data cubes. Illus- trate with examples other than those used in the book.
15. How might you extend the notion of multidimensional data analysis so that the target variable is a qu a litative variable? In other wo rds, what sorts of summary statistics or data visualizations would be of interest?
16. Constr uct a data cube from Table 3.14. Is t his a dense or sparse data cube? If it is sparse, identify th e cells t hat empty.
Table 3.14. Fact table for Exercise 16.
Product ID Locat ion ID Number Sold 1 1 10
2 2
3 6 1 2
5 22
17. Discuss the differences between dimensionality reduction based on aggregation and dimensionality reduction based on techniques such as PCA and SVD .
I
Classification: Basic Concepts, Decision Trees, and Model Evaluation
4
ClliMificatioo, wbich ;.. the tllllk of MOigning obj ccl8 to one of O<M:rt>l pr<:<ldincd ca.tego:riee1 is a pcrvnalve problem that enc:ompaaaoo many diverae o.pplicBtioDB. Ex.amp].., include detecting apam email m'""'ll.S"" baaed upon the measage header and content, categorizing cells as malignant or benign based upon the resul18 of MRI scans, lllld clBBBifying galaxies based upon their shapes (see Figure 4.1).
(a) A spU:el seloxy. (b) AD olliptical gala>cy.
FlgLn 4.1. Classificaion ol galuies. The images 818 from tha NASA web&te.
146 Chapter 4 Classification
Input
Attribute set c:==:::) (x)
Classification model
Output
Class label (y)
Figure 4.2. Classification as the task of mapping an input attribute set x into its class label y.
This chapter introduces the basic concepts of classification, describes some of the key issues such as model overfitting, and presents methods for evaluating and comparing the performance of a classification technique. While it focuses mainly on a technique known a.s decision tree inductio~ most of the discussion in this chapter is also applicable to other dassi£cation techniques, many of which are covered in Chapte r 5.
4.1 Preliminaries
The input data for a classification task is a collection of records. Each r ecord, also known as an instance or example, is characterized by a tnple (x, y), where xis the attribute set andy is a special attribute, designated as the class label (also known as category or target a ttribute). Table 4.1 shows a sample data set used for classifying vertebrates into one of the following categories: mammaL bird, fish, reptile, or amphibian. The attribute set includes properties of a vertebrate such as its body temperature, skin cover, method of reproduction, ability to fly, and ability to live in water. Although the attributes presented in Table 4.1 are mostly discrete, t he attribute set can also contain continuous features. The cl~ label, on the other hand, must be a discrete attribute. This is a key characteristic that distinguishes classification from regression, a predictive modeling task in which y is a continuous attribute. Regression techniques are covered in Appendix D .
Definition 4.1 ( Classification). Classification is the task of learning a tar- get function f that maps each att ribute set x to one o f the predefined class labels y.
The target function is also known informally as a classification model. A classification model is useful for the following purposes.
Descriptive Modeling A classification model can serve as an explanatory tool to distinguish between objects of different classes. For example, it would be useful- for both biologists and others- to have a descriptive model that
4.1 Preliminaries 147
Table 4.1. The vertebrate data set.
Name llody ~kin Uives Aquatic Aeria Ha> Hiber- <Jia<ti Temperature Cover Birth CreaturE> Creature Legs nates Label
human warm-blooded hair yes yes mammal python cold-blooded scales ye• reptile s a lmon C'old-blooded scales yes fish whale warm-blooded hair yes yes mammal frog cold-blooded semi Y"S yes amphibian komodo cold-blooded scales yes reptile dragon bat warm-blooded hair yes yes yes yes mammal pigeon warm-blooded feathers yes yes bird cat warm-b!OCtded fu• yes yes mammal leopard cold-blooded scales yes yes no fish shark turtle cold-blooded scales semi yes r eptile penguin warm-blooded feathers semi yes bird porcupine warm-blooded quills yes yes yes mammal eel cold-blooded scales ye> fish 6a.lamander cold-blooded semi yes yo. amphibian
summarizes the data shown in Table 4.1 and explains what features define a vertebrate as a mammal. reptile. bird. fish. or amphibian.
Predictive Modeling A classification model can also be used to predict t he class label of unknown records. As shown in Figure 4.2. a classification model cao he treated as a black box that automatically assigns a class la bel when presented with the attribute set of an unknown record. Suppose we are given the following characteristics of a creature known as a gila monster:
We can use a classification model built from the data set shown in Table 4.1 to determine the class to which the creature belongs.
Classification t echniques are m ost s uited for pred icting or describing data sets with binary or nominal categories. They axe less effective for ordinal categories (e.g ., to classify a person as a member of high-. medium-, or low- income group) becau se they do not consider the implicit order among the categories. Other forms of relationships, s uch as the s ubclas!HSuperclass re- lationships an1ong categories (e.g. , humans and apes are primates , which in
148 Chapter 4 Classification
turn, is a subclass of mammals) are also ignored. The remainder of this chapter focuses only on binary or nominal class labels.
4.2 G e neral Approach to Solving a Classification Problem
A classification technique (or classifier) is a systematic approach to building classification models from an input data set. Examples include decision tree classifiers , rule-based classifiers, neural networks, support vector n1a.chlnes, and na·ive B ayes classifiers. E ach technique employs a learning algorithm to identify a model that best fits the relationship between the attribute set and class label of the input data. The model generated by a learning algorithm should both fit the input data well and correctly predict the class labels of records it has never seen before. Therefore, a key objective of the learning algorithm is to build models with good generalization capability; i.e. , models that accurately predict the class labels of previously unknown r ecords.
Figure 4.3 shows a general approach for solving classification problems. F irst, a training set consisting of records whose class labels are known must
Training Set .,
1 Yes Large 125K No 2 No Medium 100K No 3 No Small 70K No 4 Yes Medium 120K No 5 No Large 95K Yes 6 No Medium 60K No 7 Yes Large 220K No 8 No Small 85K Yes 9 No Medium 75K No 10 No Small 90K Yes
Test Set .. 11 No Small 55K ? 12 Yes Medium BOK ? 13 Yes Large 110K ? 14 No Small 95K ? 15 No Large 67K ?
Figure 4.3. General approach for building a classification model.
4.2 Gene r a l Approach to Solving a Classification Problem 149
Table 4.2. Confusion matrix for a 2-class problem.
Predicted Class Class= 1 I Class= 0
Actual I Class = 1 111 I ItO Class Class~ 0 01 00
be provided. The training set is used to build a classification model , which is subsequently applied to the test set, which consists of records with unknown dass labels.
Evaluation of the performance of a classification model is based on the counts of test records correctly and incorrectly predicted by the model. These counts are tabulated in a table known as a confusion mat rix. Table 4.2 depicts the confusion matrix for a binary classification problem. Eacl1 entry hJ in this table d enotes the numbe r of records from class i predicted to be of class j. For instance, /01 is the number of records from class 0 incorrectly predicted as class 1. Based on the entries in the confusion matrix, the total number of correct predictions made by the model is (/11 + loo) and the total numbe r of incorrect predictions is Uto +Jot).
Although a confusion matrix provides the information needed to determine how well a classification model performs) sunrmarizing this inforn1ation with a single nutnber would tnake it more convenient to cotnpare the perforn1ance of different models. Tllis can be done using a performance metric such as accuracy , which is defined as follows:
A Number of correct predictions ccuracy = Total number of predictions
lu + loo (4.1)
fu + Ito +lot + /oo ·
Equivalently, the performance of a model can be expressed in terms of its error rate, which is given by t-he following equation:
Error rate = Number of wrong predictions = 110 + j 01 Total number of predictions fu + ho + fot + loo ·
(4.2)
Most classification algorithms seek models that attain the highest accuracy, or equivalently, the lowest error rate when applied to the t.est set. We will revisit the topic of model evn.luation in Section 4.5 .
150 Chapter 4 Classification
4.3 Decision Tree Induction
This section introduces a decision tree classifier, which is a simple yet widely used classification technique.
4.3.1 How a Decision Tree Works
To illustrate how classification with a decision tree works, consider a simpler version of the vertebrate classification problem described in the previons sec- tion. Instead of classifying the vertebrates into five distinct gro ups of species, \'ole assign them to two categ ories: mammals and non-mammah~.
Suppose a new species is discovered by scientists. How can we tell whether it is a mammal or a non-mammal? One approach is to pose a series of questions ahout the characteristics of the species. The first question we may ask is whether the species is cold- or warm-blooded. If it is cold-blooded, then it is definitely not a mammal. Otherwise, it is either a bird o r a mammal. In the latter case, we need to ask a follow-up question: Do the femalt"s of the species give birth to their young? Those that do give birth are definitely mammals, while those that do not are likely to be non-mammals (with the exception of egg-laying mammals s uch as the platypus and spiny anteater).
The previous example illustrates how we can solve a classification problem by asking a series of carefully crafted questions abont the attributes of the test record. Each time we r eceive an answer, a follow-up question is asked nntil we reach a conclnsion about the class label of the record. The series of questions and t heir possible answers can be organized in the form of a decision tree, which is a hierarchical structure consisting of nodes a nd directed edges. Figure 4.4 shows the decision tree for the mammal classification problem. The tree has three types of nodes:
• A root node that has no incoming edges and zero or more outgoing edges.
• Internal nodes, each of which has exactly one incoming edge and two or more outgoing edges.
• Leaf or terminal nodes, each of which has exactly one incoming edge and no outgoing edges.
In a decision tree, each leaf node is assigned a class label. The non- terminal node s 1 which indude the root and other intemal nodes, contain attribute test conditions to separate records that have different characteris- tics. For example, the root node shown in Figure 4.4 uses the attribute Body
4.3 Decision Tree Induction 151
Internal node
___ _ .- -·.\ ,'
' Leal
Root ···- nOOe
nodes
Figure 4.4. A decision tllle for the mammal classification problem.
Temperature to separate warm-blooded from cold-blooded vertebrates . Since all cold-blooded vertebrates ace non-mammals, a leaf node labeled Non-mammals is created as the right child of the root node. If the vertebrate is warm-blooded, a subsequent attribute, Gives Birth, is used to distinguish mammals from other warm-blooded creatures, which are most ly birds .
Classifying a test record is straightforwa rd once a decision tree has been constructed. Starting from the root node, we apply the test condition to the record and foUow the appropriate branch based on the outcome of the t est. This will lead us either to another internal node, for which a new test condit ion is applied, or to a leaf node. The class label associated with the leaf node is then assigned to the record . As an illustration, Figure 4.5 trace s the path in the decision tree that is used to predict the class label of a flamingo. The path terminates at a leaf node labeled Non-mammals.
4.3.2 How to Build a Decision Tree
In principle, there are exponentially many decision trees that can be con- structed from a given set of attributes. While some of the t rees are more accu- rate than others , finding the optimal tree is computationally infeasible because of the expone ntial size of the search s pace. Neverthelessf efficient algorithms have been developed to induce a reasonably accurate, albeit suboptimal, de- cision tree in a reasona ble amount of time. These algorithms nsnally employ a greedy strategy that grows a decision tree by making a series of locally op-
152 Chapter 4 C lassification
--""'"'
I
: Non- pnammals I I I I I I I I I I I
I
.,./"//
Figure 4.5. Classifying an unlabeled vertebrate. The dashed lines represent the outcomes of applying various attribute test conditions on the unlabeled vertebrate. The vertebrate is eventually assigned to the Non-mammal class.
timum decisions about which attribute to use for partitioning the data. One sucl1 algorithm is H u nt's alg orithm, which is the basis of many existing de- cision tree induction algorithms, including ID3, C4.5, and CART. This section presents a high-level discussion of Hw1t's algorithm and illustrates some of its design issues.
Hunt 's Algorit hm
In Hunt's algorithm, a decision tree is grown in a recursive fashion by parti- tioning the training records into successively purer subsets. Let D, be the set of training records that are associated with node t and y = {YI, !J2, .. . , Yc} be the class labels. The following is a recursive definition of Hunt's algorithm.
Step 1: If all the records in Dt belong to the same class y, , then t is a leaf node labeled as Yt·
Step 2 : If D, contains records that. belong to more than one class, an a t - tribute test cond ition is selected t o partition the records into smaller s ubse ts. A child node is created for each outcome of t.be test condi- tion and the records in D, are distributed to the children based on the outcomes. The algorithm is then recnrsively applied to each cliild node.
4.3 Decision Tree Induction 153
T1d Home Manta I Annual Defaulted Owner Status Income Borrower
1 Yes Single 125K No 2 No Married 100K No 3 No Single ?OK No 4 Yes Married 120K No 5 No Divorced 95K Yes 6 No Married 60K No 7 Yes Divorced 220K No 8 No Single 85K Yes 9 No Married 75K No 10 No Single 90K Yes
Figure 4.6. Training set for predicting borrowers who will default on loan payments.
To illustrate how t he a lgorithm works, consider the problem of pre dicting whether a loan applicant will repay her loan obligations or become delinquent, subsequently defaulting on her loan. A training set for this problem can be constructed by examining the records of previous borrowers. In the example shown in Fignre 4.6, each record contains the personal information of a bor- rower a long with a class label indicating w hctber the borrower has defaulted on loan payments.
The initial tree for the classification problem contains a single node with class label Defaulted = No (see Figure 4.7(a)), which means that most of the borrowers s uccessfully repaid their loans. The tree, however, needs to be refined since the root node contains records from both classes . The records are subsequently divided into smaller subsets based on the outcomes of the Home Owner test condition, as shown in Figure 4.7(b). The justification for choosing this attribute test condition will be discussed later. For now, we will assume that this is the best criterion for splitting the data at this point. Hunt's algorithm is then applied recursively to each child of the root node. From the training set given in Fignre 4.6, not ice that all borrowers who are home owners successfully repaid their loans. The left child of the root is t herefore a leaf node la heled Defaulted = No (see Fignre 4.7(b)). For the right child , we need to continue applying the recursive step of Hunt's algorithm until all the records belong to the same class. The trees resnlting from each recursive step are shown in Figures 4. 7 (c) and (d).
154 Chapter 4 Classification
Defaulted = No I
(a) (b)
(c) (d)
Figure 4.7. Hunt's algorithm for inducing decision trees.
Hunt's algorithm will work if every combination of attribute values is present in the training data and each combination has a unique class label. These assumptions are too stringent for use in most practical situations. Ad- ditional conditions are needed to handle the following cases:
1. It is possible for some of the child nodes created in Step 2 to be empty: i.e., there are no records associated with these nodes. This can happen if none of the training records h ave the combination of attribute values associated with such nodes. In this case the node is declared a leaf node with the same class label as the majority class of training records associated with its parent node.
2. In Step 2, if a ll the records associated with D, have identical attribute values (except for the class label), then it is not possible to split these reoords any further. In this case, the node is declared a leaf node with the same class label as the majority class of training records associated with this node.
4.3 Decision Tree Induction 155
Design Issues of Decision Tree Induction
A learning algorithm for inducing decision trees must address the following two issues.
1. How should the training records be split? Each recursive atep of the tree-growing process must s elect an attribute test condition to divide the records into smaller subsets. To implement this step, the algorithm must provide a method for specifying the test condition for different attribute types as well as an objective measure for evaluating the goodness of each test condition.
2. How should the splitting procedure stop? A stopping condition is needed to terminate the tree-growing process. A possible strategy is to continue expanding a node until either all the records belong to the same clas.s or all the records have identical attribute values. Although both conditions are sufficient to stop any decision tree induction algorithm, other criteria can be imposed to allow the tree-growing procedure to terminate earlier. The advantages of early termination will be discussed
later in Section 4.4.5.
4.3.3 M et hods for Expressing Attribute T est Conditions
Decision tree induction algorithms must provide a method for expressing an attribute test condition and its corresponding outcomes for different attribute types.
Binary Attributes The test condition for a binary attribute generates two potential outcomes, as shown in Figure 4.8.
Warm- blooded
Cold- blooded
Figure 4.8. Test condnion for binary attributes.
156 Chapter 4 Classification
Single Divorced
(a) Mu~iway spiK
OR
{Married} {Single, {Single} {Married, Divorced} Divorced}
Married
OR
{Single, Married}
(b) Binary split {by grouping attribute values}
Figure 4.9. Test conditions for nominal atlributes.
{Divorced}
Nominal Attributes Since a nominal attribute can have many values. its test condition can be expressed in two ways, as shown in Figure 4.9. For a multiway split (Figure 4.9(a)), the number of outcomes depends on the number of distinct values for the corresponding attribute. For example, if an a ttribute such as marital status has three dis tinct values-£ingle, married, or divorced-its test condition will produce a three-way split. On the other hand, some decision tree algorithms, such as CART, produce only binary splits by considering all 2k-l - 1 ways of creating a binary partition of/,; attribute values. Figure 4.9(b) illustrates three different ways of grouping the attribute values for marital status into two subsets.
Ordinal Attributes Ordinal attributes can also produce binary or multi way splits. Ordinal attribute values can be grouped as loug as the grouping does not violate the order property of the attribute values. Figure 4.10 illustrates various ways of splitting training records based on the Shirt Size attribute. The groupings shown in Figures 4 .10(a) and (b) preserve the order among the attribute values, whereas the grouping shown in Figure 4 .10(c) violates th.is property because it combines the attribnte valnes Small and Large into
{Small, Medium)
4.3 Decision Tree Induction 157
{Large, Extra Large)
(a)
{Small) {Medium, Large, Extra Large)
(b)
{Small, Large}
Figu;e 4.10. Dille rent ways of grouping ordinal attribute values.
{Medium. Extra Large}
(c)
the same partition wh.ile Medium and Extra Large are combined into another partition.
Continuous Attributes For continuous attributes, the test condition can be expressed as a comparison test (A< v) or (A~ v) with binary outcomes, or a range query with outcomes of the form Vi ::; A < Vi+1
1 for i = 1 , ... . k. The
difference between these approaches is shown in Figure 4.11. For the binary case, the decisiou tree algorithm must consider all possible split positjons v, and it selects the one that produces the best partition. For the rnultiway split, the algorithm must consider all possible ranges of continuous values. One approach is to apply t he discretization strategies described in Section 2.3.6 on page 57. After discretization, a uew ordinal value will be assigned to each discretized interval. Adjacent intervals can also be aggregated into wider ranges as long as the order property is preserved.
(a)
(10K, 25K} {25K, 50K} {50K, BOK)
(b)
Figure 4.11. Test condition for continuous aHributes.
158 Chapter 4 Classification
(a) (b) (c)
Figure 4.12. Multiway 110rsus binary splits.
4.3.4 Measures for Selecting the Best Split
There are many measures that can be used to determine the best way to split the records. These measures are defined in terms of the class distribution of the records before and after splitting.
Let p(i It) denote the fraction of records belonging to class i at a given node t. We sometiines omit the reference to node t and express the fraction as Pi· In a two-class problem, the class distribution at any node can be written as (Po, pi), where Pl = 1 -Po· To illust rate, consider the test conditions shown in Figure 4.12. The class distribution before splitting is (0.5, 0.5) because there are an equal number of records from each class. If we split the data using the Gender attribute, then the class distributions of the child nodes are (0.6, 0.4) and (0.4, 0.6) , respectively. Although the classes are no longer evenly distributed, the child nodes still contain records from both classes. Splitting ou the second attribute, Car Type, will remit in purer partitions.
The measures developed for selecting the hest split are often based on the degree of impurity of the child nodes. The smnller the degree of impurity, the more skewed the class distribution. For example, a node with class distribu- tion (0, 1) has zero impurity, whereas a node with uniform class distribution (0.5, 0.5) has the highest impurity. Examples of impurity measures include
Entropy(t)
Gini(t)
Classificatiou error( t)
c-1
- l::p(ilt) log2 p(i lt), i=O
c-1
1- 2:lP(ilt)] 2
,
l- ml"'[p(i lt)],
where c is the number of classes and 0 log2 0 = 0 in entropy calculations.
(4.3)
(4.4)
{4.5)
4.3 Decision Tree Induction 159
0.9 Entropy
0.8
0.7
Figure 4.13. Comparison among the mpurity measures for binary classification problems.
Figure 4.13 compares the values of the impurity measures for binary classi- fication problems. p refers to the fraction of rec.ords that belong to one of the t wo classes. Observe that all three measures a ttain their maximum value when the class distribution is uniform (i.e., when p = 0.5). The minimum values for the measures are attained when all the records belong to the same class (i.e. , when p equals 0 or 1). We next provide several examples of computing the diffe rent impurity measures.
Gini = 1 - (0/6) 2 - (6/6) 2 = o Entropy = -(0/6) log2 (0/6) - (6/6) log 2 (6/6) = 0 Error = 1- max[0/6, 6/6] = 0
Gini = I - (1/6) 2 - (5/6) 2 = 0.278 Entropy= -(l/6)log2 (1/6) - (5/6)log2 (5/6) = 0.650 Error= 1- max[1/6, 5/6] = 0.167
Gini = I - (3/6) 2 - (3/6) 2 = 0.5 Entropy= - (3/6) log2 (3/6) - (3/6) log2 (3/6) = 1 Error = I- max[3/6, 3/6] = 0.5
160 Chapter 4 Classification
The preceding examples, along with Figure 4.13, illustrate the consistency among different impurity measures. Based on these calculations, node N 1 has the lowest impurity value, followed by N2 and N3. Despite their consistency, the attribute chosen as the test condition may vary depending on the choice of impurity measure, as will be shown in Exercise 3 on page 198.
To determine how well a test condition performs, we need to compare the degree of impurity of the parent node (before splitting) with the degree of impurity of the child nodes (after splitting). The larger their difference, the better the test condition. The gain, C., is a criterion that can be used to determine the goodness of a split:
~N(v) C.= /(parent)- L.. ---Jf-I(vj),
J~l
(4.6)
where I( ·) is the impurity measure of a given node, N is the total number of records at the parent node, k is the number of attribute values, and N ( Vj) is the number of records associated with the child node, Vj· Decision tree induction algorithms often choose a test condition that maximizes the gain C.. Since /{parent) is the same for all test conditions, maximizing the gain is eqni valent to minimizing the weighted average impurity measures of the child nodes. Finally, when entropy is used as the impurity measure in Equation 4.6, the difference in entropy is known as the info r mation gain, Cl;nfo·
Splitting of Binary Attr ibutes
Consider the diagram shown in Figure 4.14. Suppose there are two ways to split the data into smaller subsets. Before splitting, the Gini index is 0.5 since there are an equal number of records from both classes . If attribute A is chosen to split the data, the Gini index for node N1 is 0.4898, and for node N2, it is 0.480. The weighted average of the Gini index for the descendent nodes is (7 /12) x 0.4898 + (5/12) x 0.480 = 0.486. Similarly, we can show that the weighted average of the Gini index for attribute B is 0.375. Since the subsets for attribute B have a smaller Cirri index, it is preferred over attribnte A.
Splitting of Nominal Attributes
As pr eviously noted, a nominal attribute can produce either binary or multi- way splits, as shown in Figure 4.15. The computa tion of the Gini index for a binary split is similar to that shown for determining binary attributes. For the first binary grouping of the Car Type attribute, the Gini index of {Sports,
{Sporls, Luxury)
{Sports, luxury}
1 co 9 I C1 7
4.3 Decision Tree Induction 161
Parent
co 6 C1 6
Gini = 0.500
A
Yes
~ ~
I N1 II N2 co 1 4 11 2 C1 I 3 II 3 Gini = 0 .486
B
I N1 ll N2 co 1 q s C1 I 4 II 2 Gini = 0.375
Figure 4.14. Splitting binary attributes.
(Family, Family Luxury}
" , .
{Family} {Sports} {Family, Luxury}
Family
1 I co 8 2 1 co 1 3 I C1 0 10 l C1 3
"
Sports Luxury
8 1 0 7
I Ginl 0.468 I Glni 0.167 I Glni 0.163
(a) Binary spl~ (b) Muniway spl~
Figure 4.15. Splitting nominal attributes.
Luxury} is 0.4922 and the Gini index of {Family} is 0.3750. The weighted average Gini index for the grouping is equal to
16/20 X 0.4922 + 4/20 X 0.3750 = 0.468.
Similarly, for the second binary grouping of {Sports} and {Family, Luxury} , the weig hted average Gini index is 0.167. The second grouping has a lower Gini index because its corresponding subsets are much purer.
162 Chapter 4 Classification
Figure 4.16. Splitting continuous attributes.
For the multi way split , the Gini index is computed for every attribute value. Since Gini({Family}) = 0.375. Gini({Sports}) = 0, and Gini({Luxury}) 0.219, the overall Gini index for the multiway split is equal to
4/20 X 0.375 + 8/20 X 0 + 8/20 X 0.219 = 0.163.
The mnltiway split has a smaller Gini index compaxed to both two-way splits. This resn.lt is not surprising because the two-way split actually merges some of the outcomes of a multiway split, and thus, results in less pure subsets.
Splitting of Continuous Attributes
Consider the example s hown in Figure 4.16, in which the test condition Annual
Income ~ v is used t.o split the training records for the loan default classifica- tion problem. A brute-force method for finding v is to consider every value of the attribute in theN records as a candidate split position . For eacl1 candidate v, the data set is scanned once to count the number of records with annual income less thru1 or greater than v. Vie then compute the Gini index for each candidate and choree the one that gives the lowest value. This approach is computationally expensive because it requires O(N) operations to compute the Gini index at each candidate split position. Since there arc N candidates, the overall complexity of this task is O(N2 ). To reduce the complexity, the training records are sorted based on their annual inco me, a computation that requires O(N log N) time. Candidate split p05itions are identified by taking the midpoints between two adjocent sorted values: 55, 65, 72, and so on. How- ever, unlike the brute-force approach, we do not have to examine all N records when evaluat ing the Gini index of a candidate split position.
For the first candidate, v = 55, none of the records has annual income less than $55K. As a result , the Gini index for the descendent node with Annual
4 .3 Decision Tree Induction 16 3
Income < $55K is zero. On the other hand, the number of records with annual income greater than or equal to $55K is 3 (for class Yes) and 7 (for class No), respectively. Thus, the Gini index for this node is 0.420 . The overall Gini index for tlus candidate split position is equal to 0 x 0 + 1 x 0.420 = 0.420.
For the second candidate, v = 65, we can determine its class distribution by updating the distribution of the previous candidate. More specifically, the new distribution is obtained by exanlining the class label of the record with the lowest annua.l income (i.e., $60K). Since the class label for this record is No, the count for class No is increased from 0 to 1 (for Annual Income :o; $65K) and is decreased from 7 to 6 {for Annual Income > $65K). The distribution for class Yes remains unchanged. The new weighted-average Gini index for this candidate split position is 0.400.
This procedure is repeated until the Gini index values for all candidates are computed, as shown in Figure 4.16. The best split position corresponds to the one that produces the smallest Gini index, i.e., v = 97. This procedure is less expensive because it requires a constant amount of tiine to update the class distribution at eoch candidate split position. It can be further optinuzed by considering on.ly caudidate split positions located between two adjacent records with different class labels. For example, because the first three sorted records (with annual incomes $60K, $70K , and $75K) have identical class labels, the best split position shon.ld not reside between $60K and $75K. Therefore, the candidate split positions at v = $55K, $65K, $72K, $87K, $92K, $110K, $122K, $172K, and $230K are ignored because they are located between two adjocent records with the same class labels. This approach allows us to reduce the number of candidate split positions from 11 to 2.
Gain Ratio
Impurity measures such as entropy and Gi1u index tend to favor attributes that have a !urge number of distinct values. Figure 4.12 shows three alternative test conditions for partitioning the data set given in Exercise 2 on page 198. Comparing the first test condition, Gender, with the second , Car Type, it is easy to see that Car Type seems to provide a better way of splitting the data since it produces purer descendent nodes. However, if we compare both conditions with Customer ID, the latter appears to produce purer partitions. Yet Customer ID is not a predictive attribute because its value is unique for each record. Even in a less extren1e s ituation, a test condition that .results in a large number of outcomes may not be desirable because the number of records associated with eoch paxtition is too small to enable us to make any reliable predictions.
164 Chapter 4 Classification
There are two strategies for overcoming this problem. The first strategy is to restrict the test conditions to binary splits only. This strategy is employed by decision tree algorithms such as CART. Another strategy is to modify the splitting criterion to take into account the number of outcomes produced by the attribute test condition. For example, in the C4.5 decision tree algorithm, a splitting criterion known as gain ratio is used to determine the goodness of a split. This criterion is defined as follows:
Gain ratio ~info
Split Info. (4.7)
Here, Split Info= -2:7= 1 P(v;)log2 P(v;) and k is the total number of splits. For example, if each attribute value has the same number of records, tben Vi : P(v;) = l/k and the split information would be equal to log2 k. Tbis example suggests that if an attribute produces a large number of splits, its split information will also be large, which in turn reduces its gain ratio.
4.3.5 Algorithm for Decision Tree Induction
A skeleton decision tree induction algorithm called TreeGrowtb is shown in Algorithm 4.1. The input to this algorithm consists of tbe training records E and the attribute set F . The algorithm works by recursively selecting the best attribute to split tbe data (Step 7) and expanding the leaf nodes of the
Algorithm 4.1 A skeleton decision tree induction algorithm. TreeGrowth (E, F)
1: if stopping_cond(E,F) = tru.e then 2: leaf= createNode{). 3: leaf.label = Classify(E). 4: return lea f . 5: el8e G: root= createNode(). 7: root.test_cond = tin<Lbest_split(E, F ). 8: let V = { vlt' is a possible outcome of root.test..cond } . 9: for each v E V do
10: E, = {e I root.test_cond(e) = t' and e E E). 11: child= TreeGrovth(E,., F). 12: add child as descendent of root and label the edge (root~ child) as t•. 13: end for 14: end if 15: return root.
4.3 Decision Tree Induction 165
tree (Steps 11 and 12) until the stopping criterion is met (Step 1). The details of this algorithm are explained below:
1. The createNode() function extends the decision tree by creating a new node. A node in the decision tree has either a test condition, denoted as node.tesLcond, or a class label, denoted as node.! abel.
2. The find_best_spli t() function determines which attribute should be selected as the test condition for splitting the training records. As pre- viously noted, the choice of test condition depends on which impurity measure is nsed to determine tbe goodness of a split. Some widely nsed measures include entropy, the Gini index. and the ;~:2 statistic.
3. The Classify() function determines the cla.ss label to be assigned to a leaf node. For each leaf node t, let p(ilt) denote t he fraction of training records from class i associated with the node t. In most cases, the leaf node is assigned to the class that has the majority number of training records:
leaf.! abel= argmax p(ilt) , i
(4.8)
where the argmax operator returns the argument i that maximizes the expression p(i lt). Besides providing the information needed to determine the class label of a lea f node, the fraction p(ilt) can also be used toes- timate the probability that a record assigned to the leaf node t belongs t o class i. Sections 5. 7.2 and 5. 7.3 describe how such probability esti- mates can be used to determine the performance of a decision tree under different cost functions.
4. The stopping_cond() function is used to terminate the tree-growing pro- cess by testing whether all the records have either the same cla.ss label or the same attribute values. Another way to terminate the r ecursive function is to test whether the number of records have fallen below some minimum threshold.
After building the d ecision tree, a tree-pruning step can be performed to reduce the size of the decision tree. Decision tr~s that are too large are susceptible to a phenomenon known as overfitting. Pruning helps by trim- ming the branches of the initia l tree in a way that improves the generalization capability of the decision tree. The issues of overfitting and tree pruning are discussed in more detail in Section 4.4.
166 Chapter 4 Classification
s.. .. IP-ts n- r:::· _ .... _ .... """"" so. ... - A- """"""' of &,<eo 60.1\.11 .11 OOIAIJg/2004 GET htlp:ltwww.cs.tmt.EWI HTTPIU 200 .. ,. Moz.ilaJ4.0
10:15:21 _...,., ("""" ... ; MSIE6.0;
Windows NT 5.0) 60.11.11.11 OOIAIJg/2004 GET httpJ/www.cs.urm.edul HTIP/1.1 200 41378 httpJiwww.cs.umn.tdJI Modla/4.0
10:15:34 -llumar/MINDS _...,., (00f1'1l01ble; MSIE6.0;
WinOOws NT 5.0 60.11 .11.11 OOIAIJg/2004 GET hftp:l/www.cs.orm.edul HT1P11.1 200 1018516 htlp:II'Nww.cs.urm.edul Moz~la/<4.0
10;15:41 -lcl.lmaf/MINOS-MINDS -kumariMINOS (OOI'Ill8tble; MSIE6.0;
-""""•·""' WinclowsNTS.O 160.11.11.11 00/AIJg/2004 GET http:// WWW.C!LUIM..edul HTWIU 200 7<63 htlp'JJwww.CS-t.IIM.edul Moz.ila/4.0
10:16:11 -kuman'papers/pape!S. -- =.''M:i~·~ """ 35.9.2.2 OOIAIJg/2004 GET tilp:J/ V.WW.CS.t.W'!Vtedul H'T1Pf1.0 200 ""' =-~~-=; 10:16:15 - stalrmac rv:1.7)Ged:ofl0040616 (a) Example of a Web server log.
A~eN5Y18 De- :::A'"m• g papers/pa~rs.html
IOtaiPages Total niJI'Ibet of pages retrievt~d in a WrJJ session mag.., ages Total mmber ol image pages rwteved ~ a Web seSSi~ T~Mmme Total arrollll of tine spent b ¥kb site .,.sior AepeatedA.ooess The same page requested rrol& than once in a Wfb session EnorRequest Errors In reQ.Jestilg lor Wfi:J pages GET Petter&age d ~eq.~ests made usirg GET metlod POST Petter*aoe cl rewests mede usino POST me !hod HEAD Pe~tt~riage d req;ests made usirg HEAD method Breadlh Bfead:h ol Wfb traversal Deplh Depth of Web tra\IE!r&al M~UP Sessicn wiltl m.Jiiple IP addresses M~Mgert SessiM with rrultiple user agents
M!NDSIMINDS_papers.htm
(b) Graph of a Web session. (c) Derived attributes for Web robot detection.
Figure 4. 17. Input data lor Web robot detection.
4.3.6 A n Example: Web Robot Detection
Web usage mining is the task of applying data mining techniques to extract useful patterns from Web access logs. These patterns can reveal interesting characteristics of site visitors; e .g., people who repeatedly visit a \Veb site and view the same product description page a re more likely to buy the product if certain incentives s uch as rebates or free shipping are offered.
In Web usage mining, it is important to distinguish accesses made by hu- man users from those due to Web robots. A \Veb robot (also known as a Web crawler) is a software program that automatically locates and retrieves infor- mation from the Internet by following the hyperlinks embedded in \\'eb pages. These p rograms are deployed by search engine portals to gather the documents necessary for indexing the Web. \Veb robot accesses must be discarded before applying Web mining techniques to analyze human browsing behavior.
4 .3 Decision Tree Induction 167
This section describes how a decision tree classifier can be used to distin- guish between accesses by human users and those by Web robots. The input data was obtained from a Web server log, a sample of which is shown in Figure 4.17(a). Each line corresponds to a single page request made by a Web client (a user or a Web robot). The fields recorded in the Web log include t he IP address of the client, timestamp of the request, Web address of the requested document, size of the document, and the client's identity (via the user agent field). A \Veb session is a sequence of requests made by a client during a single visit to a Web site. Each 'Neb session can b e modeled as a directed graph, in which the nodes correspond to Web pages and the edges correspond to hyper- links connecting one Web page to another. Figure 4.17(b) shows a graphical r<>presentation of the first \Veb session given in the Web server log.
To classify the Web sessions, features are constructed to describe the char- acteristics of each session. Figure 4.17(c) shows some of the features used for the Web robot detection task. Among tbe notable features include the depth and breadth of the traversaL Depth det .,.nnines the ma..umum dis- tance of a requested page, where d istance is measured in terms of the num- ber of hyperlinks away from the entry point of the Web s ite. For exan1ple, the home page http://www.cs.umn.edu/~kumar is asswued to be at depth 0, whereas http : I /www. cs. umn. edu/kumar/MINDS/HINDS_papers .htm is lo- cated at depth 2. Based on the Web graph shown in Figure 4.17(b), the depth attribute for the first session is equal to two. The breadth attribute measures the width of the corresponding \Veb graph. For example, the breadth of the Web session shown in Figure 4.17(b) is equal to two.
The data set for classification contains 2916 records, with equal numbers of sessions due to Weh robots (class 1) and human users (class 0). 10% of the data were reserved for t raining while the remaining 90% were used for testing. The induced decision tree model is shown in Figure 4.18. The tree has an error rate equal to 3.8% on the training set and 5.3% on the test set.
The model suggests that 'Neb robots can be distinguished from hwnan users in the following way:
1. Accesses by Web robots tend to be broad but shallow, whereas accesses by humau users t end to be more fo cused (narrow but deep).
2. Unlike human users, Web robots seldom retrieve the image pages asso- ciated with a Weh document.
3. Sessions due to Web robots tend to be long and contain a large number of requested pages.
168 Chapter 4 Classification
Decision Tree: depth ;1:
breadth> 7: class 1 breadth<:= 7:
breadth<= 3: 1 lmagePageS> 0.375: class o I lmagePageS<• 0.375: I I totaiPagesc:= 6: claaa 1 I I totaiPageS> 6: I I I breadth <= 1: class 1 I I I breadth > 1: class 0 widlh>3: I MultiiP=O: I I lmagePages<= 0.1333: claas1 I I lmagePages> 0.1333: I I breadth c 6: cla88 0 I I breadth> 6: class 1 I MultiiP= 1: I I TotarTime <= 361 : class 0 I I TotarTime>361: class1
depth>1 : Multi Agent= 0: I depth> 2: claaa 0 I depth< 2: I I MultiiP = 1: class 0 I I MultiiP = 0: I I I breadth<== 6: class 0 1 r 1 breadth>6: I I I I RepeatedAccess <= 0.322: class 0 I I I I RepeatedAccess > 0.322: claaa 1 Multi Agent= 1: I total Pages<= 81: eta as 0 I tota1Pages>81: class 1
Figure 4.18. Decision t~ee model for Web robot detection.
4. Web robots are more likely to make repeated requests for the same doc- ument since the Web pages retrieved by human users are often cached by the browser.
4.3.7 Characteristics of Decision Tree Induction
The foUowing is a summary of the important characteristics of decision tree induction algorithms.
I. Decision tree induction is a nonparametric approach for huilding classifi- cation models. In other words, it does not require any prior assumptions regard ing the type of probability distributions satisfied by the class and other attributes (unlike some of the techniques described in Chapter 5).
4.3 Decision Tree Induction 169
2. Finding an optimal decision tree is an NP-complete problem. Many de- cision tree algorithms employ a heuristic-based approach to guide their search in the vast hypothesis space. For example, the algorithm pre- sented in Section 4.3.5 uses a greedy, top-down, recursive partitioning strategy for growing a decision tree.
3. Techniques developed for constrncting decision trees are computationally inexpensive, making it possible to quickly construct models even when the training set size is very large. Furthermore. once a decision tree has been built, classifying a test record is extreme! y fast, with a worst-case complexity of 0( w ), where w is the maximum depth of the tree.
4. Decision trees, especially smaller-sized trees:, are relatively easy to inter- pret. The accuracies of the trees are also comparable to other classifica- tion techniques for many simple data sets.
5. Decision trees provide an expressive representation for learning discrete- valued functions. However, they do not generalize well to certain types of Boolean problems. One notable example is the parity function, whose value is 0 (I) when there is an odd (even) number of Boolean attributes with the value True. Accurate modeling of such a function requires: a full decision tree with ~ nodes, where d is the number of Boolean attributes (see Exercise 1 on page 198}.
6. Decision tree algorithms axe quite robust to the presence of noise, espe- cially when methods for avoiding overfitting, as described in Section 4.4, are employed.
7. The presence of redundant attributes does not adversely affect the ac- curacy of decision trees. An attribute is redundant if it is strongly cor- related with another attrihnte in the data. One of the two redundant attributes will not be used for splitting once tbe other attribute bas been chosen. However, if the data set contains many irrelevant attributes, i.e. , attributes that are not useful for t he classification task, then some of the irrelevant attributes may he accidently chosen during the tree-growing process, which results in a decision tree that is larger than necessary. Feature selection techniques can help to improve the accuracy of deci- sion trees by eliminating the irre1evant attributes dnring preprocess-ing. \Ve will inve stigate the issue of too many irrelevant attributes in Section 4.4.3.
170 Chapter 4 C lassification
8. Since n1ost decision tree algorithtns etnploy a top-down, recursive parti- tioning approach, the number of r ecords becomes smaller as we t raverse down the t ree. At the leaf nodes, th e number of records may be too small to make a statistically significant decision about the class rep- resentation of the nodes. This is known as the data fragmentation problem. One possible solution is to disallow further splitting when the number of records falls below a certain threshold.
9. A subtree can be replicated multiple times in a decision tree, ns illus- trated in Figure 4.19 . This makes the decision tree more complex than necessary and perhaps mo re d ifficult to interpret. Such a situation can arise frotn decision tree implen1entations that rely on a single attribute test condition at each internal node. Since most of the decision tree al- gorithms use a divide-and-conquer partitioning strategy, the same test condition can be applied to different parts of t he attribute space, t hus leading to the subtree replication problem.
Figure 4.19. Tree replication problem. The same subtree can appear at diflerent branches.
10. The test conditions described so far in this chapter involve using only a single attribute at a time. As a consequence , t he tree-growing procedure can be viewed as the process of partitioning the attribute space into disjo int regions until each region contains records of the same dass (see Figure 4.20). The border between two neighboring regions of different classes is known as a decision boundary. Since t he test condition in- volves only a single attribute, the dec ision boundaries are rectilinear; i.e., parallel to the ''coordinate axes." T his limits t he expressiveness of tbe
0.9
0.8
0.7
0.6
v
4.3 Decision Tree Induction 171
v >- 0.5 --------·--·------------
0.4
0.3
0.2
0.1 v v
v
r---~-----··:··------;;--
lo ' 0o~~o~.1~0~.2~~0~.3~0~.4~0~.~5~0~ .• ~0~.7~0~.~8~0~.9~
X
Figure 4.20. Example of a decision tree and its decision boundaries for a two-dimensional data set.
0.2 .... +
0.1 ,..
.. . . .: ... ~ .':: . . .. . . . .. .,.! • .. 'r. •• • • .' ..... . .. . · .. .
-·.
. . I •
. . ..
. . , . ' ... .. .
• . ..
0.3 0.4 0.5 0.6 0. 7 0.8 0.9
Figure 4.21 . Example of data set that cannot be partitioned optimally using test cond~ions involving single attributes.
decision tree representat.ion for modeling complex relations hips among continuous attributes. Figure 4.21 illustrates a data set that cannot be classified effectively by a decision tree algorithm that uses test conditions involving only a single attribute at a time.
172 Chapter 4 Classification
An oblique d e cision tree can b e used to overcome this limitation because it allows test conditions that involve more than one a ttribute. The data set given in Figure 4.21 can be easily represented by an oblique decision tree containing a single node with test condition
£ +y < 1.
Although such techniques are more expressive and can produce more compact trees, finding the optimal test condition for a given node can be computationally expensive.
Constructive induction provides another way to partition tbe data into homogeneous, nonrectangular regions (see Section 2.3.5 on page 57). This approach creates composite attributes representing an arithmetic or logical combination of the existing attributes. The new attributes provide a better discrimination of the classes and are augmented to the data set prior to decision tree induction. Unlike the oblique decision tree approach, constructive induction is less expensive because it identifies all the relevant combinations of at t ributes once, prior to constructing the decision tree. In contrast, an oblique decision tree must determine the right attribute combination dynamically, every time an internal node is expanded. However, constructive induction can introduce attribute re- dundancy in the data since the new attribute is a combination o f several existing attributes.
11. Studies have shown that the choice of impurity measure has little effect on the performance of decision tree indnction algorithms. This is because many impurity measures are quite consistent with each other, as shown in Figure 4.13 on page 159. Indeed, the strat egy used to prune the tree has a greater impact on t he final tree than the choice of impurity measure.
4.4 Model Overfitting
The errors committed by a classification model are generally divided into two types: training errors and generalization errors. Training error, also known as resubstit ution e rror or apparent error, is the numbe.r of misclas- sifi.cation errors committed on t raining records, whereas generalization error is the expecte d error of the model on previously unseen records.
Recall from Section 4.2 that a good classification model must not only fit the training data well, it 1nust also accurately classify records it has never
4.4 Model Overfitting 173
Figure 4.22. Example of a data set with binary dasses.
seen before . In other words, a good model must have low training error as well as low generalization error. This is important because a model that fits t he training data too well can have a poorer generalization error than a model with a higher training error. Such a situation is known as model overfitting.
Overfitting Example in Two-Dimensional Data For a more concrete example of the overfitting problem, consider the two-dimensional dat a set shown in Figure 4.22. The data set contains data points that belong to two diffe rent cla.sses1 denoted as class o and class + 1 respectively. The data points for tbe o class are generated from a mixture of three Gaussian distributions, while a uniform dis tribution is used to generate t he data points for the + class. There are altogether 1200 points belonging to the o class and 1800 points be- longing to the + class. 30% of tbe points are chosen for training, while t h e remaining 70% are used for t esting. A decision tree classifier that uses the Gini index as its irnpnrity measure is t hen applied to the training set. To investigate the effect of overfitting, different levels of pruning are applied to the initial, fully-grown tree. Figure 4.23(h) shows the training and test error rates of the dec ision tree.
17 4 Chapter 4 Classification
Number of Nod9s
Figure 4.23. Training and test error rates.
Notice that the training and te5t error rates of the model are large when the size of the tree is very small. This situation is known as model underfitting. Underfitting occurs because the model has yet to learn the true structure of the data. As a result, it performs poorly on hath the training and the t est sets. As the number of nodes in the decision tree increases, the tree will have fewer training and test errors. However, once the tree becomes too large, its test error rate begins to increase even though its training error rate continues to decrease. This phenomenon is known as model overfitting.
To understand the overfitting phenomenon, note that the training error of a model can b e reduced by increasing the model complexity. For example, the leaf nodes of the tree can be expanded until it perfectly fits the training data . Although the training error for s uch a complex tree is zero, the test error can he large because the tree may contain nodes that accidently fit some of the noise points in the training data. Such nodes can degrade the p e rformance of the tree because they do not generalize well to the t est exaruples. Figure 4.24 shows the structure of two decision trees with different number of nodes. The tree that contains the smaller number of nodes has a higher training error rate, but a lower test error rate compared to the more complex tree.
Overfitting and underfitting are two pathologies that are related t.o the model complexity. The remainde r of this section examines some of the poten- tial causes of model overfitting.
1!1"1Uil,:.:"
,;~_.., .. 7,'lA
'£•1•12.11
(a) Decision tree v.'ith 11 leaf nodes.
4.4 Model Overfitting 175
-- c • .,. -- -~~ .
"''"-"A--
.. ~~·- ,; ·." ... ~;L
. !~"- :;.~~11-
·"'·.""'"" ""••n .t; b ... n.•·.~·
-o' .A..·· ''"~
.\ ""''""'
......... .z..
(b) Decision tree with 24 leaf nodes.
Figure 4.24. Decision trees w~h different model complexities.
4.4.1 Overfitting Due to Presence of Noise
Consider the training and test sets shown in Tables 4.3 and 4.4 for the mammal classification problem. Two of the ten training records are mislabeled: hats and whales are classified as non-mammals instead of mammals.
A decision tree that perfectly fits the training data is shown in Figure 4.25(a). Although the training error for the bee is zem, its error rate on
Table 4.3. An example training set for classifying mammals. Class labels with asterisk symbols repre- sent mislabeled records.
Name Body Gives F'our- Hibernates Class Temperature Birth legged L•bel
porcupine warm-blooded y es ye,; yes yes cat w a rm-blooded yes yes no yes bot warm-blooded yes no yes no' whale warm-blooded yes no no no' salamander cold-blooded no yes yes n o komodo dragon cold-blooded no ye,; no no python cold-blooded no no yes no s almon cold-blooded no no no no eagle warm-blooded no no no no guppy cold-blooded yes no no no
176 Chapter 4 Classification
Table 4.4. An example test set for classifying mammals. Name Body Gives Four- Hibernates Class
Temperature Birth legged Label human warm-blooded yes no no yes pigeon warm-b looded no no no no elephant warm-blooded yes yes no yes leopard shark cold- blooded yes no no no turtle cold- blooded no yes no no penguin oold- blooded no no no no ool oold- blooded no no no no dolphin warm-b looded yes no no yes spiny anteater warm-blooded no yes yeo; yes gila monster oold- blooded no yes yeo; no
(a) Model M1 (t>) Mode1M2
Figure 4.25. Decision tree induced from the data set shown in Table 4.3.
the test set is 30%. Both humans and dolphins were m.isclassified as non- mammals b ecause their attribute values for Body Temperature , Gives Birth, and Four-legged are identical to the mislabeled records in the training set. Spiny anteaters, on the other hand, represent an exceptional case in which the class label of a test record contradicts the class labels of other similar records in the training set. Errors due to exceptional cases are often unavoidable and establish the minimum error rate achievable by any classifier.
4.4 Model Overfitting 177
In contrast, the decision tree M2 shown in Figure 4.25(b) has a lower test error r ate (10%) even though its training error rate is somewhat higher (20%). It is evident that the first decision tree, Ml. has overfitted t he training data because there is a simpler model with lower error rate on the test set. The Four-legged attribute test condition in model Ml is spurious because it fits the mislabeled training records, which leads to the m.isclassification of records in the test set.
4.4.2 Over fitting Due to Lac k of Representative Samples
Models that make their classification decisions based on a small number of training records are also susceptible to overfitting. Such models can be gener-
ated b ecause of lack of representative samples in the training data and learning algorithms that continue to refine their models even when few t raining records are available. We illustrate these effects in the example below.
Consider the five training records shown in Table 4.5. All of these training records are labeled correctly and the corresponding d ecision tree is d epicted in Figure 4.26. Although its training error is zero, its error rate on the test set is 30%.
Table 4.5. An example training set for classifying mammals.
Name Body Gives Four- Hibernates Class Temperature Birth legged Labet
salamander cold-blooded no yes yes no guppy cold-blooded yes no no no eagle warm-blooded no no no no poorv:iU warm-b1ooded no no yes no platypus warm-blooded no yes yes yes
Hwnans, elephants, and dolphins are m.isclassified because the decision tree classifies all warm-blooded vertebrates that do not hibernate as non-mammals. The tree arrives at this classification decision b ecause there is only one training record, which is an eagle, with s uch characteristics. This example clearly demonstrates the danger of making wrong predictions when there are not enough representative examples at the leaf nodes of a decision tree.
178 Chapter 4 Classification
Rgure 4.26. Decision tree induced from the data set shown in Table 4.5.
4.4.3 Overfitting and the Multiple Comparison Procedure
Model overfitting may arise in learning algorithms that employ a methodology known as multiple comparison procedure. To understand multiple comparison procedure, consider the task of predicting whether the s tock market will rise or fall in the next ten trading days. If a stock analyst simply makes random gnesses, the probability that her prediction is correct on any trading day is 0.5. However, the probability that she will predict correctly at least eight out of the ten times is
('") + ('0) ('") 8 g + 10 = 0 054 7 210 . )
which seems quite unlikely. Suppose we are interested in choosing an investment advisor from a pool of
fifty stock analysts. Our strategy is to select the analyst who makes the most correct predictions in the next ten trading days. The flaw in this strategy is that even if all the analysts had made their predictions in a random fashion. the probability that at least one of them makes at least eight correct predictions is
1- (1 - 0.0547) 50 = 0.9399,
which is very high. Although each analyst bas a low probability of predicting at least eight times correctly, putting them together, we have a high probability of finding an analyst who can do so. Furthermore, there is no guarantee in the
4.4 Model Overfitting 179
future that such an analyst will continue to make accurate predictions through random guessing.
How does the multiple comparison procedure r elate to model overfitting? Many learning algorithms explore a set of independent alternatives, { "Yi}, and then choose an alternative, "'(max, that maximizes a given criterion function.
The algorithm will add "Ymax to the current mode.! in order to improve its overall performance. This procedure is repeated until no further improvement is observed. AB an example, during decision tree growing, multiple tests are performed to determine which attribute can best split the training data. The attribute that leads to the best split is chosen to extend the tree as long as the observed improvement is statistically significant.
Let To be the initial decision tree and Tx be the new tree after inserting an internal node for attribute .£. In principle, x can be added to the tree if the observed gain, ~(To,T,), is greater than some predefined threshold a. If there iB only one attribute teBt condition to be evaluated, then we can avoid inserting spurious nodes by choosing a large enough value of a. However. in practice, more than one test condition is available and the decision tree algorithm must choose the best attribute X max from a set of candidates, {x1, x 2, . ... Xk}, to partition the data. In this situation, the algorithm is actually using a multiple comparison procedure to decide whether a decision tree should be extended. More specifically, it is testing for ~(To. Txm~l >a instead of ~(To. T,) > o. As the number of alterna tives, k, increases, so does our chance of finding ~(To.Tx~~l > o. Unless the gain function~ or threshold a is modified to account for k, t he algorithru may ina dvertently add spurious nodes to the model, which leads to model overfltting.
This effect becomes more pronounced when the number of training records
from which :L'm"" is chosen is small, because the variance of ~(To. Tx~~l is high when fewer examples are available for training. AB a result, the probability of finding d(To, Trma.J > o increases when t here are very few training records. This often happens when the decision tree grows deeper, which in turn reduces the number of records covered by the nodes and increases the likelihood of adding unnecessary nodes into the tree. Failure to compensate for the large number of alternatives or the small number of training records will t herefore lead to model overfitting.
4.4.4 Estimation of Generalization Errors
Although the primary reason for overfitting is still a s ubject of debate, it is generally agreed that the complexity of a model has an impact on model overfitting, as was illustrated in Figure 4.23. The question is, how do we
180 Chapter 4 Classification
determine the right model complexity? The ideal complexity is that of a model that produces the lowest generalization error. The prohlem is that the learning algorithm has access only to the training set during model building (see Figure 4.3). It has no knowledge of the test set, and thus, does not know how well the tree will perform on records it has never seen before. The best it can do is to estimate the generalization error of the induced tree. This section presents several methods for doing the estimation.
Using Resubstitution Estimate
The resubstitution estimate approach assumes that the training set is a good representation of the overall data. Consequently, tbe training error, otherwise known as resubstitution error, can be used to provide an optimistic estimate for the generalization error. Under this assumption, a decision tree induction algorithm simply selects the model that produces the lowest training error rate as its final model. However, the training error is usually a poor estimate of gene ralization error.
Example 4.1. Consider the binary decision trees shown in Figure 4.27. As- sume that both trees are generated from the same training data and both make their classification d ecisions at each leaf node according to the majority class. Note that the left tree, TL, is more complex because it expands some of the leaf nodes in the right tree, T R· The training error rate for the left tree is e(h) = 4/24 = 0.167, while the training error rate for the right tree is
Decision Tree, T L Decision Tree, T R
Figure 4.27. Example of two decision trees generated from the same training data.
4.4 Model Overfitting 181
e(TR) = 6/24 = 0.25. Based on their resuhstitution estimate, the left tree is considered better than the right tree. •
Incorporating Model Complexity
As previously noted, the chance for model overfitting increases as the model becomes more complex. For this reason, we should prefer simpler models, a strategy that agrees with a well-known principle known as Occam's razor or the principle of parsimony:
Definition 4 . 2. Occam's Razor: Given two models with the same general- ization errors, the simpler model is preferred. over the more complex model.
Occam's razor is intuitive hecause the additional components in a complex model stand a greater chance of being fitted purely by chance. In the words of Einstein, "Everything should be made as simple as possible, but not simpler." Next, "" present two methods for incorporating model complexity into the evaluation of classification models.
Pessimistic Error Estimate The first approach explicitly computes ge ner- alization error as the sum of training error and a penalty term for model com- plexity. The resulting generalization error can be considered its pessimistic error estimate. For instance, let n( t) be the number of training records classi- fied by node t and e(t) be the number of misclassi6ed records. The pessimistic error estimate of a decision tree T , e9 (T), can be computed as follows:
e(T) +fl(T)
N,
where k is the number of leaf nodes, e(T) is the overall training error of the decision tree, Nt is the number of training records, and fl(t;) is the penalty term associated with each no de ti.
Example 4 . 2. Consider the binary decision trees shown in Figure 4.27. If t he penalty term is equal to 0.5. then the pessimistic error estimate for the left tree is
4 + 7 X 0.5 7.5 e9 (TL) = 24
= Z4 = 0 .3125
and the pessimistic error estimate for the right tree is
6 + 4 X 0.5 8 e9 (TR) = 24
= 2.1 = 0.3333.
182 Chapter 4 Classification
A B
Figure 4.28. The minimum description length (MDL) principle.
Thus, the left tree has a better pessimistic error rate than the right tree. For binary trees, a penalty term of 0.5 means a node should always he expanded into its two child nodes as long as it improves the classification of at least one training record because expanding a node, which is equivalent to adding 0.5 to the overall error, is less costly than committing one training error.
If !1(t) = 1 for all the nodes t, the pessimistic error estimate for the left tree is e9 (TL) = 11/24 = 0.458, while the pessimistic error estimate for the right tree is eg(TR) = 10/24 = 0 .417. The right tree therefor e has a better pessimistic error rate than the left tree. Thus, a node should not be expanded into its child nodes unless it reduces the misclassification error for more than one training record. • Minimum Description Length Principle Another way to incorporate model complexity is based on an information-theoretic approach known as the minimnrn description length or MDL principle. To illustrate this principle, consider the example shown in Figure 4.28. In this example, both A and B are given a set of records with known attribute values x. In addition, person A knows the exact class label for each record, while person B knows none of this infoTmation. B can obtain the classification of eacb record by requesting that A transmits the class labels sequentially. Such a message would require 8(n) bits of information, where n is the total number of records.
Alternatively, A may decide to build a classification model that summarizes the relationship between x and y. The model can be encoded in a compact
4.4 Model Overfilling 183
form before being transmitted to B. If the model is 100% accurate, then the cost of transmission is equivalent to the cost of encoding the model. Otherwise, A must also transmit information about which record is classified incorrectly by the model. Thus, the overall cost of transmission is
Cost( model, data) = Cost(mode/) + Cost(datajmodel), (4.9)
where the first term on the right-hand side is the cost of encoding the model, while the second term represents the cost of encoding the mislabeled records. According to the MDL principle, we shonld seek a model that minimizes the overall cost function. An example showing how to compute the total descrip- tion length of a decision tree is given by Exercise g on page 202.
Estimating Statistical Bounds
The g eneralization error can also be estimated as a statistical correction to the training error. Since generalization error tends to be larger than training error, the Btatistical correction is usually computed as an upper bound to the training error, taking into account the number of training records that reach a particular leaf node. For instance, in the C4.5 decision tree algorithm, the number of errors committed by each leaf node is assumed to follow a binomial distribution. To compute its generalization error, we mnst determine the upper bound limit to the observed training error, as illustrated in the next example.
Example 4.3. Consider the left-most branch of the binary d ecision trees shown in Figure 4.27. Observe that the left.most leaf node of TR has been expanded into two child nodes in TL . Before splitting, the error rate of the node is 2/7 = 0.286. By approximating a binomial distribution with a normal distribution, the following upper bound of the error rate e can be derived:
•' J •' e + ¥ + Za j2 e(~e) + ~ Eupper(N, e, a)= ,
1 + z~, (4.10)
where a is the confidence level, z0 ; 2 is the s t andardized value from a standard normal distribution, and N is the total number of training records used to compute e. By replacing a= 25%, N = 7, and e = 2/7, the upper bound for the error rate is eupper(7, 2/7, 0.25) = 0.503, which corresponds to 7 X 0.503 = 3. 521 errors. If we expand the node into its child nodes as s hown in TL, the training error rates for the child nodes are 1/4 = 0.250 and 1/3 = 0. 333,
184 Chapter 4 Classification
respectively. Using Equation 4.10, the upper bounds of these error rates are eupp€r(4, 1/4, 0.25) = 0.537 and eupper(3 , 1/3,0.25) = 0.650, respectively. The overall training error of the child nodes is 4 x 0.537 + 3 x 0.650 = 4.098, which is larger than the estimated error for the corresponding node in T R. •
Using a Validation Set
In this approach, instead of using the training set to estimate the generalization error. the original training data is divided int.o two smaller subsets. One of the subsets is used for training, while the other, known as the validation set, is used for estimating the generalization error. Typically, two-thirds of the training set is reserved for model building, while the remaining one-third is used for error estimation.
This approach is typically used with classification techniques tbat can be parameterized to obtain models with different levels of complexity. The com- plexity of the best model can he estimated by adjusting the parameter of the learning algorithm (e.g., the pruning level of a d ecision tree) until the empir- ical model produced by the learning algorithm attains the lowest error rate on the validation set. Although this approach provides a better way for esti- mating how well the model performs on previously unseen r ecords, less data is available for training.
4.4.5 Handling Overfitting in Decision Tree Induction
In the previous section, we described several methods for estimating the gen- eralization error of a classification model. Having a reliable estimate of gener- alization error allows the learning algorithm to search for an accurate model without overfitting the training data. This section presents two strategies for avoiding model overfitting in the context of decision tree induction.
Prepruning (Early Stopping Rule) In this approach, the tree-growing algorithm is halted before generating a fully grown tree that perfectly fits the entire training data. To do this , a more restrictive stopping condition must be used; e.g., stop expanding a leaf node when the observed gain in impurity measur e (or improvement in the estimated generalization error) falls below a certain threshold. The advantage of this approach is that it avoids generating overly complex subtrees tbat overfit the training data. Nevertheless, it is difficult to choose the right threshold for early termination. Too high of a threshold will result in underfitted models, while a threshold that is set too low may n ot be sufficient to overcome the model overfilling problem. Furthermore,
Decision Tree: de~h= 1:
breedth> 7 : class 1 breadth<"' 7:
breadth<= 3: I lmagePages:> 0.375· class (I I lmagePages<= 0 .375: I I DtaiPages<~ 6: class 1 I I DtaiPages:> 6: 1 1 1 breadth<= 1: class 1 I I I breadth > 1: cl.ass 0 width> 3: Subtree I MultiiP=O: 1 t i~QeP~es<,.,O-:-t3:fa:-cTDS.S1-t I II lnagePages> 0.1333: I I 1l breadth<=6: classO I ILPL.~Jtl~~=-£l!~ ... L ______ J I MultiiP= 1: I I TolaiTime <= 361: class 0 I I TotaiTime ~ 361 : c.lau1
deptl't> 1:
: ~~~~~i'~cla-un------------1 I l~deplhc::=2 : I I Ill MultiiP .. l: classO I II• MuttiiP= 0: I l1l I breadth"'"' 6 : class 0 I Ill I breadth~6: I 1 1 I 1 1 1 RepeatedAccess <= 0.322: class 0 1 I I I_! _!_J __ ~~~9!!~~1!.~~Q_~_;__c.!_a.!!_!._l I MuttiAgenl = 1: I I btaiPages <=81: class 0 I I btaiPages >81: clillss1
4.4 Model Overfitting 185
Simplified Decision Tree:
depth;, , 1 r iiTiagerages <;0.1333:- c.ass-1- - , lllmagePages >0.1333: I
I breadth<:•6: classO I ·~.!'~~1'!.~1!=_~!~..:! ________ : ~su~~~r.t-;-o:-dasso------- 1 1-MUffiA~~~,;------------
1 I bta1Pages<=81: clillssO I I btaiPages > 81: Cia ISS 1
Figure 4.20. Post·pruning of the decision tl9e for Web robot detection.
even if no significant gain is obtained using one of the existing attribute test conditions, subsequent splitting may result in better subtrees.
Post-pruning In this approach, the decision tree is initially grown to its maximum size. This is followe d by a tree-pruning step) which proceeds to trim the fully grown tree in a bottom-up fashion . Trimming can b e done by replacing a subtree with (1) a new leaf node whose class label is determined from the majority class of r ecords afliliated with the subtree, or (2) the most frequently used branch of the subtree. The tree-pruning step terminates when no further improvement is observed. Post-pruning tends to give better results than prepruning because it 10akes pruning decisions based on a fully grown t ree, unlike prepruning, which can suffer from premature termination of the t ree-growing process. However, for post-pruning, the additional computations needed to grow the full tree may be wasted when the subtree is pruned.
Figure 4.29 illustrates the simplified decision tree model for the Web robot detection example given in Section 4.3.6. No tice that the subtrees rooted at
186 Chapter 4 Classification
depth = 1 have been replaced by one of the branches involving the attribute ImagePages. Tbis approach is also known as subtree raising. The depth > 1 and Mul tiAgent = 0 subtree has been replaced by a leaf node assigned to class 0. This approach is known as subtree replacement. The subtree for depth > 1 and MultiAgent = 1 remains intact.
4.5 Evaluating the Performance of a Classifier
Section 4.4.4 described several methods for estimating the generalization error of a model during training. The estimated error helps the learning algorithm to do model selection; i.e., to find a model of the right complexity that is not susceptible to over fitting. Once the model bas been constructed, it can be applied to the test set to predict the class labels of previously unseen records.
It is often useful to measure the performance of the model on the test set because such a measure provides an unbiased estimate of its generalization error. The accuracy or error rate computed from the test set can also be used to compare the relative performance of different classifiers on the same domain. However, iu order to do tbis, the class labels of the test records must be knowu. This sectiou reviews some of the methods collliilonly used to evaluate the performance of a classifier.
4 .5.1 Holdout Method
In the holdout method, the original data with labeled examples is p artitioned into two disjoint sets, called the training and the test sets, respectively. A clasBi£cation model is then indnced from the training set and its performance is evaluated on the test set. The proportion of data reserved for training and for testiug is typically at the discretion of the aualysts (e.g., 50-50 or two- thirds for training and one-third for testing}. The accuracy of the classifier can be estimated based on the accuracy of the induced model on the test set.
The holdout method has several well-known limitations. First, fewer la- beled examples are available for training because some of the records are with- held for testing. As a result, the induced model may not be as good as when all the labeled examples are used for training. Second, the model may be bighly dependent on the composition of the training and test sets. The smaller the training set size, the larger the variance of the model. On the other hand, if the training set is too large, the n the estimated accuracy computed from the smaller test set is less reliable. Such an estimate is said to have a wide con- fidence iuterval. Finally, the training and test sets are no longer independent
4.5 Evaluating the Performance of a Classifier 187
of each other. Because the training and test set.. are subset.. of the original data, a class that is overrepresented in one subset will be underrepresented in the other, and vice versa.
4.5.2 Random Subsampling
The holdout method can be repeated several times to improve the estimation of a classifier's performance. Tbis approach is known as random subsampling. Let ace; be the model accuracy during the ;th iteration. The overall accuracy is given by acc,ub =I:~=! acc.,jk. Random subsampling still encounters some of the problems associated with the holdout method because it does not utilize as much data as possible for training. It a1so has no cout.rol over the number of times each record is used for testing ru1d traiuing. Consequently, some records might be used for training more often than others.
4.5.3 Cross-Validation
An alternative to random subsampling is cross-validation. In tbis approach, each record is used_ the s ame nwnber of times for training and exactly once for testing. To illustrate this method, suppose we partition the data into two equal-sized subsets. First, we choose one of the s ubsets for training and the other for testing. We then swap the roles of the subsets so that the previous training set becomes the test set and vice versa. This approach is called a two- fold cross-validation. The total error is obtained by summing up the errors for both runs. In tbis example, ea ch record is used exactly once for tra.irring and once for testing. The k-fold cross-validation method generalizes tbis approacl> by segn1enting the data into /.:equal-sized partitions. During e.ach run, one of the partitions is choseu for testing, while t he rest of them are used for trainiug. This procedure is repeated k times so t hat each partition is used for test ing exactly once. Again, the total error is found by summing up the errors for all k runs. A special case of the /.:-fold cross-validation method sets k = N , the size of the data set. In tbis so-called leave-one-out approach, each test set contains only one record. This approach has the advantage of utilizing as much data as possible for training. In addition, the test sets are mutually exclusive and they effectively cover the entire data set. The drawback of this approach is that it is computationally expensive to repeat the procedure N time.s. Furthermore, since each test set contains only one record, the variance of the estimated performance metric tends to be high.
188 Chapter 4 Classification
4.5.4 Bootstrap
The methods presented so far assume that the training records are sampled without replacement. As a result, there are no duplicate records in the training and test sets. In the bootstrap approach, the training records are sampled with replacement: i.e., a record already chosen for training is put back into the original pool of records so that it is equally likely to be redrawn. If the original data has N records, it can be shown that, on average~ a bootstrap sample of size N contains about 63.2% of the records in the original data. This approximation follows from the fact that the pmbability a record is chosen by a bootstrap sample is 1 - (1 - 1/N)N. When N is sufficiently large, the probability asymptotically approaches 1- e-1 = 0.632. Records that are not included in the bootstrap sample become part of the test set. The model induced from the training set is then applied to the test set to obtain an estimate of the accuracy of the bootstrap sample,<;. The sampling procedure is then repeated b times to generate b bootstrap samples.
There are several variations to the bootstrap sampling approach in terms of how tbe overall accuracy of the classifier is computed. One of the more widely used approaches is the .632 bootstrap, which computes the overall accuracy by combining the accuracies o f e.ach bootstrap sample ( <i) with the accuracy computed from a training set that contains all the labeled examples in the original data (ace,):
1 b Accuracy, accboot = b I)0.632 x <; + 0.368 x ace,).
i = l
4.6 Methods for Comparing Classifiers
(4.11)
It is often useful to compare the performance of different classifiers to deter- mine which classifier works better on a given data set. However, depending on the size of the data, the observed difference in accuracy between two clas- sifiers may not be statisticaUy significant. This section examines some of the statistical tests available to compare the performance of different models and classifiers.
For illustrative purposes, consider a pair of classification models, MA and MB. Suppose MA achieves 85% accuracy when evaluated on a test set con- taining 30 records, while }.[B achieves 75% accuracy on a different test set containing 5000 records. Based on this information, is J..fA a better model than ME?
4.6 Methods for Comparing Classifiers 189
The preceding example raises two key questions regarding the statistical significance of the per formance metrics:
1. Although MA has a higher accuracy than MB, it was tested on a smaller test set. How mucb confidence can we place on the accuracy for AIA?
2 . Is it possible to explain the difference in accuracy as a result of variations in the composition of the test sets?
The first question relates to the issue of estimating the confidence interval of a given model accuracy. The second question relates to the issue of testing the statistical significance of the observed deviation. These issues are investigated in the remainder of this section.
4.6.1 Estimating a Confidence Interval for Accuracy
To determine the confidence interval, we need to establish the probability distribution that governs the accuracy measure. This section describes an ap- proach for deriving the confidence interval by modeling the classification task as a binomial experiment. Following is a list of characteristics of a binomial experiment:
1. The experiment consists of N independent trials, where each trial has two possible outcomes: success or failure.
2. The probability of success, p, in each trial is constant.
An example of a binomial experiment is counting the number of heads that turn up when a coin is flipped N times. If X is the number of successes observed in N trials, then the probability tbat X takes a particular value is given by a binomial distribution with mean Np and variance Np(1- p):
For example, if the coin i.'3 fair (p = 0.5) and is flipped fifty times, then the probability that the head shows up 20 times is
P(X = 2o) = G~)o.520(1 - o.5)30 = o.0419.
If the experiment is repeated many times, then the average number of heads expected to s how up is 50 x 0.5 = 25, while its variance is 50 x 0.5 x 0.5 = 12.5.
190 Chapter 4 Classification
The task of predicting the class labels of test records can also be consid- ered as a binomial experiment. Given a t est set that contains N records, let X be the number of records correctly predicted by a model and p be the true accuracy of the model. By modeling the prediction task as a binomial experi- ment, X has a binomial distribution with mean Np and variance Np(1 - p). It cruJ be shown that the empirical accuracy, ace= XjN, also has a binomial distribution with mean p and variance p(1-p)/N (see Exercise 12). Although the binomial distribution can be used to estimate the confidence interval for ace, it is often approximated by a normal distribution when N is sufficiently large. Based on the normal distribution, the following confidence interval for a.cc can be derived:
( acc-p )
P - Zo/2 :0: :0: Zl-o/2 = I - "• y'p(l - p)jN
(4.12)
where Za;z and Z 1 _ 012 are the upper and lower bounds obtained from a stan- dard normal distribution at confidence level (1- o). Since a standard normal distribution is symmetric around z = 0, it follows that z o/2 = zl-o/2• Rear- ranging this inequality leads to the following confidence interval for p:
2 X N X ace+ z~/2 ± Zo;2J z~/2 + 4N ace- 4N acc2 2(N + Z~12)
(4.13)
The following table shows the values of Zo;2 at different confidence levels:
Example 4.4. Consider a model that has an accuracy of 80% when evaluated on 100 test records. What is the confidence interval for its true accuracy at a 95% confidence level? The confidence level of 95% corresponds to zo/2 = 1.96 according to the table given above. Inserting this term into Equation 4.13 yields a confidence interval between 71.1% and 86. 7%. The following table shows the confidence interval when the number of records, N, increases:
Note that the confidence interval becomes tighter when N increases. •
4.6 Methods for Comparing Classifiers 191
4.6.2 Comparing the Performance of Two Models
Consider a pair of models, lvft and .M2 , that are evaluated on two independent test sets, D 1 and D2. Let n1 denote the number of records in D1 and n2 denote the number of records in D 2 . In addition, suppose the error rate for .M, on D1 is e1 and the error rate for Af2 on Dz is e2. Our goal is to test whether the observed difference between e1 and e2 is statistically significant.
Assuming that n1 and n2 are sufficiently large, the error rates e, and e2 can be approximated using normal distributions. If the observed difference in the error rate is denoted as d = e1 - e2, then d is also normally distributed with mean dt, its true difference, and variance, cr3. The variance of d can be computed as follows:
(4.14)
where. e 1 (1- e 1 )jn1 and e2 (1- e2 )/nz are the variances of the error rates. Finally, at the (1 - a)% confidence level, it can be shown that the confidence interval for the true difference dt is given by the following equation:
(4.15)
Example 4.5 . Consider the problem d escribed at the beginning of this sec- tion. Model AfA has an error rate of e1 = 0.15 when applied to N, = 30 test records, while model MB has an error rate of e2 = 0.25 when applied to N 2 = 5000 test records. The observed difference in their error rates is d = 10.15 - 0.251 = 0.1. In this example, we are performing a two-sided test to check whether d1 = 0 or d, # 0. The estimated variance of the observed difference in error rates can be compu ted as follows:
~2 = 0.15(1 - 0.15) 0.25(1 - 0.25) = 0.0043 (Jd 30 + 5000
or &d = 0.0655. Inserting this value into Equation 4.15 , we obtain the following confidence interval for d, at 95% confidence level:
dt = 0.1 ± 1.96 X 0.0655 = 0.1 ± 0.128.
As the interva l spans t he value zero, we can conclude that the observed differ- ence is not statistically significant at a 95% confidence level. •
192 Chapter 4 Classification
At what confidence level can we reject the hypothesis that d, = 0? To do this, we need to determine the value of z.,/2 such that the confidence interval fo r d1 does not span the value zero. We can reverse the preceding computation and look for the value z.,12 such that d > Z0 ; 2Cid. Replacing the values of d and (id gives Za;2 < 1.527. This value first occurs when (1 - <>) ;$ 0.936 (for a two-sided test). The result suggests that the null hypothesis can be rejected at confidence level of 93.6% or lower.
4.6.3 Comparing the Performance of Two Classifiers
Suppose we want to compare the performance of two classifiers using the k-fold cross-validation approach. Initially, the data set D is divided into k equal-sized partitions. We then apply each dassifier to construct a model from k - 1 of the partitions and test it on the remaining partition. This step is repeated k t imes, each t ime using a different partition as the test set.
Let llfij denote the model induced by claESification technique Li during the j'h iteration. Note that each pair of models M 1j and M2j are tested on the same partition j. Let e1j and e 2j be their respective error rates. The difference between t heir error rates during the j'h fold can he written as d; = e1; - e2;. If k is sufficiently large, then d; is normally distributed with mean d,"", which is the true difference in their error rates, and variance uc'·. Unlike the previous approach. the overall variance in the observed differences is estimated using the following formula:
(4. 16)
where d is the average difference. For this approach, we need to use a ! - distribution to compute the confidence interval for d,"':
The coefficient 1(1- Q),k- 1 is obtained from a probability table with two input parameters , its confidence level (1- <>)and the number of degrees of freedom, /.: - 1. The probability table for the !-distribution is shown in Table 4.6.
Example 4.6. Suppose the estimated difference in the accuracy of models generated by two classification t echniques has a mean equal to 0.05 and a standard deviation equal to 0.002. If the accuracy is estimated using a 30-fold cross-validation approach, then at a 95% confidence level, the true accuracy difference is
df'' = 0.05 ± 2.04 X 0.002. (4.17)
4.7 Bibliographic Notes 193
Table 4.6. Probability tabla for !-distribution.
(1- a) k - 1 0.99 0.98 0.95 0.9 0.8
1 3.08 6.31 12.7 31.8 63.7 2 1.89 2.92 4.30 6.96 9.92 4 1.53 2.13 2.78 3.75 4.60 9 1.38 1.83 2.26 2.82 3.25
14 1.34 1.76 2.14 2.62 2.98 19 1.33 1.73 2.09 2.54 2.86 24 1.32 1.71 2.06 2.49 2.80 29 1.31 1.70 2.04 2.46 2.76
Since t he confidence interval does not span the value zero, the observed dif- ference between the techniques is statistically significant. •
4. 7 Bibliographic Notes
Early classification systems were developed to organize a large collection of objects. For example. the Dewey Decimal and Library of Congress classifica- t ion systems were designed to catalog and index the vast nwnber of library books. The categories are typically identified in a manual fashion, with the help of domain experts.
Automated classification has been a subject of intensive research for many yean~. The study o f classification in classical statistics is sometimes known as discriminant analysis, where the objective is to predict the group member- ship of an object based on a se t of predictor variables. A well-known classical method is Fisher's linear discriminant analysis [117], which seeks to find a lin- ear projection of the data that produces the greatest discrimination between objects that belong to different classes.
Many pattern recognition problems also require the discrimination of ob- jects from different classes. Examples include speech recognit ion, handwritten character identification, and image classification. Readers who are interested in t he application of classification techniques for pattern recognition can r efer to the survey articles by Jain et al. [122] and Kulkarni et al. [128] or classic pattern recognition books by Bishop [107], Duda et al. [114]. and Fukunaga [118]. The subject of classification is also a major research topic in the fields of neural networks, statistical learning, and machine learning. An in-depth treat-
194 Chapter 4 Classification
ment of various classification techniques is given in the books by Cherkassky and Mulier [112], Hastie et al. [120], Michie et al. [133], and Mitchell [136].
An overview of decision tree inductio n algorithms can be foWld in the survey artides by Buntine [110], Moret [137], Murthy [138], and Safavian et al. [147]. Examples of some well-known decision tree algorithms include CART [108], ID3 [143], C4.5 [1 45 ], and CHAID [125]. Both ID3 and C4.5 employ the entropy measure as their splitting function. An in-depth discussion of the C4.5 decision tree algorithm is given by Quinlan [145]. Besides explaining the methodology for decision tree growing and tree pruning, Quinlan [145] also described how the algorithm can be modified to handle data sets with missing values. The CART algorithm was developed by Breiman et al. [108] and uses the Gini index as its splitting function. CHAID [125] uses the statistical x2 test to determine the best split dUJing the tree-growing process.
The decision tree algorit hm presented in t his chapter assumes that the splitting condition is specifie d one attribute at a time. An oblique decision tree can use multiple attributes to form the attribute test condition in the internal
nodes [121, 152]. Breiman et al. [108] provide an option for using linear combinations of attributes in their CART implementation. Other approaches for inducing oblique decision trees were proposed by Heath et al. [121], Murthy et a!. [139]. Cantu-Paz and Kamath [111], and Utgoff and Bradley [152]. Although oblique decision trees help to improve the expressiveness of a d ecision tree representatiou 1 leanring the appropriate test condition at each node is computationally cballenging. Another way to improve the expressiveness of a decision tree without using oblique decision trees is to apply a method known as constructive induction [132]. T his method simplifies t he task of learning complex splitting functions by creating compound features from the original attributes.
Besides the top-down approach, other strategies for growing a decision tree include t he bottom-up approach by Landeweerd et al. [130] and Pattipati and Alexandridis [142], as well as the bidirectional approach by Kim and Landgrebe [126]. Schuermann and Doster [150] and Wang and Suen [154] proposed using a soft splitting criterion to address the data fragmentation problem. In this approach, each record is assigned to different branches of the decision tree with different probabilities .
Model ove rfitting is an important issne that ruust be addressed to ensure that a decision tree clru;sifier performs equally well on previously unknown records. The model overfitting problem ha. been investigated by many authors including Breiman et al. [108], Schaffe r [148]. Mingers [135], and J ensen and Cohen [123]. While the presence of noise is often regarded as one of the
Bibliography 195
primary reasons for overfitting [135. 140], Jensen and Cohen [123] argued that overfitting is the result of using incorrect hypothesis tests in a multiple comparison procedure.
Schapire [149] defined generalization error as "the probability of rnisclas- sifying a new example" and test error as •tthe fraction of mistakes on a newly sampled test set." Generalization error can therefore be considered as the ex- pected test error of a classifier. G eneralization error may sometimes refer to the true error [136] of a modeL i.e .. its expected error for randomly drawn data points from the same population distribution where the training set is sampled. These definitions are in fact equivalent if both the training and test sets are gathered from the same population distrihutiou, which is often the case in many data mining and machine learning applications.
The Occam's razor principle is often attributed to the phil060pher William of Occam. Domingos [113] cautioned against the pitfall of misinterpreting Occam ~B razor as comparing models with similar training enors, instead of generalization errors. A survey on d ecision tree-pruning methods to avoid
overfitting is given by Breslow and Aha [109] and Esposito et al. [116] . Some of the typical pruning methods include reduced error pruning [144], pessimistic error pruning [144], minimum error pruning [141] , critical value pruning [134], cost-complexity pruning [108], and error- based pruning [145]. Quinlan and Rivest proposed using the minimum description length principle for decision tree pruning in [146] .
Kohavi [127] had performed an extensive empirical study to compare the performance metrics obtained using different estimation methods such as ran- dom subsampling, bootstrapping, and k-fold cross-validation. T heir results suggest that the best estimation m ethod is based on the ten-fold stratified cross-validation. Efron and Tibshirani [115] provided a theoretical and empir- ical comparison between eros&-validat ion and a bootstrap method known as t he 632+ rnle.
Current t echniques such as C4.5 require that the entire training data set fit into main memory. There has been considerable effort to develop parallel and scalable versious of decision tree induction algorithms. Some of the proposed algorithms include SLlQ by Mehta et al. [131], SPRINT by Shafer et al. [151], CMP by Wang and Zaniolo [153], CLOUDS by Alsabti eta!. [106], RainForest by Gehrke et a!. [119], and Sca!ParC by Jos hi et al. [124]. A general survey of parallel algorithms for data mining is available in [129].
196 Chapter 4 Classification
Bibliography fl06) K. Alsabti, S. R.anka, and V. Singh . CLOUDS: A Decision Thee Classifier for Large
Dntasets. lu Proc. of the 4th lntL Con/. on Kno.,lroge Discovery and Data Mining. pages 2-s. New Yock. NY. August 1998.
[107J C . M. Bishop. Neural Network.t for Pattern RewgniltmL Oxro rd University Press, O xfo rd, U. K .. 1005.
[108) L. Breimnn. J. H . .FriedmllD, R. Ols he n, ond C'. J. Stone. Classification and Regresst-o n '1h>!s. Chapman & Ha ll. New York, 1984 .
11001 L. A. Breslow a nd D. W . Aha. Simplifying Decisiou Trees: A S urvey. Knowledge Enganeertng Re~oew, 12(1): 1 40, 1097.
[110J W . Bunt ine. learning classification trees. In Artifictal l ntelltgence Fhmtters in Statis- tic., pages 182- 201. C hapman & Hall, London. 1003.
[111) E. CantU-Paz and C'. Ka.rnat.b . Using 6\'0lutionary algori th1ns to induce oblique decision trees . In Proc. of the Genetic and Et10lutionary Computation Con/ .. pages 1053-tOOO. San Francisco. C A. 2000.
11121 V . Cherkassky and F. Mulier. Leeming from Data: Conceyt.. Theory. and Methods. \Viley Intencience, 1098.
[113] P. Domingos. The- Role o f Oa:am's Razor in Knowledge D iscove-ry. Dato Mi ning and Knowledge Ducot'e17/. 3(4):409-425. 1099.
11141 R. 0. Duda, P. E. Hart. and D. G. S to rk. Pattern Cfas•ificution. J o hn Wiley & Sons. Inc .. New York. 2nd edition. 2001.
[11 5J B . Efron and R . Tibsbir8ni. Cros.s-vatidat ion and tbe Boot strap: EstimRtiog tbe E rro r Rate of a P rediction Rule. Technical report . Stanford University, 1995.
ru6J F. &posito. D. Malerb8, and G. Sememro. A Comparative Analysis o f f\le thods for Pruning Decision Trees. IEEE 1hms. Patte m Analysis and M achine lntelltge nce , 19 (5) :476-491. May 1007.
[117] R. A. Fis he r. T he use o f mult iple measureme nts in taxonomic problems. Annals of Eugenics, 7:179 188, ID30.
[118] K. Puknnnga Introductirm t"o Statistical Pattern Recognition. Academic Press, New York. 1900.
IUDJ J. Gehrke. R. R.amakrishnan, and V. Ganti. RainForest A Framework for Fast 0... cision Ttee Construc tio n o f Large Datnscts. Data Mini ng and Kno-w ledge DisrotJery, 4 (2/3):127- 162. 2000.
1120) T. Hastie , R. Tihshirani , and J . H. Friedman. The Element. of Staluticol Leamsng: Data Mtntng. Inference, Prediction. Springer, New York. 2001.
l12lJ D. Heath, S. Kasif. BJJd S. Salzberg. Induct ion of Obl iqne Decision 'frees. In Proc. of the 13th /niL Joint Conf. on Arlo/ic1allntelltgence. pages 1002- 1007, Chambery. France, August 1993.
11221 A . K. Jain. R. P. W . Duin, and J . Mao. Sta\isticnl Pattern Recognition: A Review. IEEE Thin. Pat-t. Anal. and Mach . lntellig .. 22(1) :·1 37. 2000.
[123] D . Jensen a nd P. R. Cohen. Multiple Comparisons in Induction Algorithms. Machme Leamtng, 38(3) :309-338. March 2000.
ll24J M. V. J oshi, G. Ka.rypis, a nd V. Kumar. ScalParC: A New Scalable and Efficient Paralle l C lassification Algorithm for Mining Large Dlltasets. In Proc. of JQth Inti. Parollel Processing Symp. (IPPS/SPDP). pages 573-679, Orlando. FL, April 1008.
11251 G. V. Kass. An Exploratory Tochnique f<>< Investigating L.~rge Quantities o f Categor- ical Data. A pplied Statistics, 29:1 19- 127, 1080.
Bi bliography 197
I12GJ B. Kim and D. Landgrebe. Hierarchical d ecision classifiers in high·dimensional and large class data. IEEE Thins. on Grosci<nce and Remote Sensmg, 29(4):518- 528. 1091.
[127) R Kobavi. A Study on Cross-Validation and Bootsl.ra.p for :\ccuracy Estimation and f\lodc l Selectio n. In Proc. of the 15th lntL Joint Conf. o n Artificial Intelligence, pages 1137- 1145. Montreal. Canada. August 1005.
[128] S. R. Kulkarni, G. Lngosi, and S. S. Vcnk.•llesb. Learning Pattern C lassification A S urve,v. IEEE Thin. Tnf. Them-y, 44(6):2178- 2206, 1098.
1129] V. Kumar, M. V. Joshi. E.-H. Han, P. N. Tan. and M. Steinbach. High Performance Data Mining. In High Perforntance Compu ting for Computational Science ( VECPA R QOOQ), pages 111- 125. Springer. 2002.
[130] G. Landeweerd , T. Timmers. E . Ce rsema. M . Bins, and M . Halic. Binlll"y t.ree versus single level tree classitlcat.ion o r wbite blood eells. Pattem Recogm tiont 16:&71- 571, 1983.
1131] ~1. Me bta. R. Agnwal. and J . Rissonen . SL!Q: A Fast Scolable Classifier for Datn Mining. In Proc. of tht 5th Inti. Con/. on &tending Databa.s• T.chnology, pages 18 32. Avignon , Franoe, March 1900.
1132] R. S. Michalski. A theory and methodology of inductive lenrning. A rl•ficiallnlcl/ogtnct. 20: 111- 116, 1983.
1133] D. l\.licrue. D. J . Spiege lhalter . and C. C . Taylor. Ma chine Ltaming. Neurnl and StaWhro.l Class,ficolton. Ellis Ho rv.·ood. Uppe-r Saddle River. NJ , 1004.
1134) J . Mingers. Expert Syste111s R ule Induction with St atistical Data. J Opemfoorl<Ji Research Societv. 38:39-47. 1987.
[135] J. Mingers. An empirical oompBrison of pruning me thod s for decision tree induction. Machme Leornmg. 4 :227- 243 . 1989.
1136] T. Mitche U. Ma chine Le .. ming. McGraw. HiU , Boston. MA, 1997. li37J B. ~1. E. ~foret. Decision '!toes and Diogrnms. Computing Surv<vs. 14(4) :503- 023,
1982. [138] S. K. Murth.v. Automatic Const ruc tion of Decisicm Trees from Data: A Multi-
Disciplinary Survey. Data Mi ning afltl Kn ()IJ) Iedge Diseot•ery, 2(4):34f>-389. 1998. 1130] S. K. Murthy, S. K asif, ond S. Salzberg. A S)'!item for ind uct ion of oblique decision
trees. J of Artificial I ntelligence Research , 2: 1-33, 1994. [140] T . N iblett. Constrnct.iog decision trees in noisy domains. In Proc. of the Qnd European
Wo-r.l:ing Se.uwn em Ltnrni"g, pages 67- '18, Bled , Yugoslavia, May 1987. [141] T. Nibleu and I. Bratko. Lesmi ng Decision Rules in Noisy Domains. In Re•earc.h and
D e uelopment in Expert Svstems Ill. Cambridge. 1986. Cambridge University Press. [142] K. R. Pattipati and f\f. G. Ale-xandridis. Application o f heuristic search and informat~on
theory to sequential fa ult diagnosis. IEEE Trans. on Systerru. Man. and Cubemehcs, 20(4):872-887. 1000.
[143] J. R. Quinlan. Oisoovering rules by indLJCt ion from large collection of examples. In D. Michie, editor. Expert Systems u 1 U1e }.hero Electronic Age. Edinhurgb Universicy Press. Edinburgh , UK, 1079.
1144) J. R. Quinlan. Sin1plifying Decision 'frees. In ti. J. Man· Machine S tudie.. 27:221 234. 1087.
[145] J. R. Quinlan. C,J .S: Programs for Mac hine Learni ng. Morgan-Kaufmann Publishers. San Mateo, C A, 1093.
[146] J. R . Quin la n and R. L. Rivest . In ferring Decis ion Trees Using the Minimum Descri~ tion Le ngth Principle. l nfom,ation and Computation, 80(3}:227- 248
1 1989 .
198 Chapter 4 Classification
[147] S. R. Safavian and D. Landgrebe. A Survey of Decision Trre Classifier Methodology. IEEE 1\uns. Systems, Man and Cybernetics, 22:060-074, May/June 1008.
[148] C. Schaffer. Overfitting avoidence as bias. Machine Learning. 10:153-178, 1993. [149] R. E. Schopire. The Boooting Approoch to Machine Learning: An Overview. In MSRJ
Worhhop Ofl Nonlinear Estimation and Cla.ssification, 2002. [150] J. Schuermann and \V. Doster. A decision-theoretic approach in hierarchical classifier
design. Pattern Recognitwn, 17:35!1--369, 1984. [151] J. C. Shofer, R. Agrawal. and M. Mehto. SPRINT: A Scalable Porallel Classifier
for Dato ]\fining. In Proc. of the QQnd VL DB Con/ .. pages 544 555, Bombay, India, September 1996.
[152] P. E. Utgoff and C. E. Brodley. An incremental method for finding multivariate splits for decision trees. In Proc. of the 7th Inti. Conf. on Machine Len.ming, pages 58--65. Austin, TX, June 1990.
[153] H. Wang and C. Zaniolo. CMP: A F ... t Decision Thee Cl ... sifier Using Multivariate Predictions. In Proc. of the 16th Inti. Conf. on Data Engineering, pages 449 460. San Diego, CA. March 2000.
[154] Q. R. \Vang and C. Y. Suen. Large tree classifier with heuristic search and global training. IEEE Trons. on Pattern Analysis and Machine Intelligence, 9(1):91-102, 1987.
4.8 Exercises
1. Draw the full decision tree for the parity function of four BooleAil attributes. A, B. C, and D . Is it possible to simplify the tree?
2. Consider the training examples showu in Table 4. 7 for a biuary classification problem.
(a) Compute the Gini index for the overall collection of training examples.
(b) Compute the Gini index for the CUBtomer ID attribute.
(c) Compute the Gini index for the Gender attribute.
(d) Compute the Gini index for the Car Type attribute using multiway split .
(e) Compute the Gini index for the Shirt Size attribute using multiway split.
(f) Which attribute is better, Gender, Car Type , or Shirt Size?
(g) Explain why CUstomer ID should not be used as the attribute test con- dition even though it has the lowest Gini.
3. Consider the training exa1nples shown in Table 4 .8 for a binary classification problem.
(a) What is the entropy of this collection of training examples with respect to the positive class?
4 .8 Exercises 199
Table 4.7. Data set klr Exercise 2. Customer ID Gender Car Type Shirt Size Class
1 M Family Small co 2 1\[ Sports Medium co 3 M Sports Medium co 4 M Sports Large co 5 M Sports Ext ra Large co 6 M Sports Extra Large co 7 F Sports Small co B F Sports Small co 9 F Sports Medium co 10 F Luxury Large co 11 M Family Large C1 12 M Family Extra Large C1 13 M Family Mediwn C1 14 M Luxury Extra Large C1 15 F Luxury Small C1 16 F Luxury Small C1 17 F Luxury Medium C1 lB F Luxury Mediwn C1 19 F Luxury Mediwn C 1 20 F Luxury Large C1
Table 4.8. Data set for Exercise 3. Instance a, a2 aJ Target Class
1 T T 1.0 + 2 T T 6.0 + 3 T F 5.0 - 4 F F 4.0 + 5 F T 7.0 - 6 F T 3.0 - 7 F F B.O - 8 T F 7.0 + 9 F T 5.0 -
(b) What are the information gains of a 1 and a 2 relative to th€8<' training examples?
(c) Fbr a 3 , which iss continuous attribute, compute the infonnation gain for every possible split .
200 Chapter 4 Classification
(d) What is the best split (among a" a,. and a 3 ) aa:ording to the information gain?
(e) What is the best split (between a, and a,) according to the classification error rate?
{f) What is the best split (between a 1 and a 2 ) according to the Gini index?
4. Show that the entropy of a node never increases after splitting it into smaller successor nodes.
5. Consider the following data set for a binary class problem.
A B Class Label T F + T T + T T + T F - T T + F F - F F - F F - T T - T F -
(a) Calculate the information gain when splitting on A 9lld B. Which at- tribute would the decision tree induction algorithm choose?
(b) Calculate the gain in tbe Gini index when splitting on A and B. Which attribute would the decision tree induction algorithm choose?
(c) Figure 4.13 shows that entropy and the Gini inde.x are both monot-onously increasing on the range [0. 0.5[ and they are both monotonously decreasing on the range [0.5, 1]. Is it possible that information gain and the gain in the Gini index favor different attributes? Explain.
6 . Consider the foUowing set of tnrirring examples.
X y z No. of Class C1 Examples No. of Class C2 Examples 0 0 0 5 40 0 0 1 0 15 0 1 0 10 5 0 1 1 45 0 1 0 0 10 5 1 0 1 25 0 1 1 0 5 20 1 1 1 0 15
4 .8 Exercises 201
(a) Compute a two-level decision tree using the greedy approach described in this chapter. Use the cl&SSification error rate as the criterion for splitting. What is the overall error rate of the induced tree?
(b) Repeat part (a) using X as the first splitting attribute and t.hen choose the best remaining attribute for splitting at each of the two successor nodes. What is the error rate of the induced tree?
(c) Compare the results of parts (a) and (b) . Comment on the suitability of the greedy heuristic used for splitting attribute selection.
7. The following table summarizes a data set. with three attributes A. B. C and two class labels+, -. Build a two-level decision tree.
Number of A B c Instances
+ T T T 5 0 F T T 0 20 T F T 20 0 F F T 0 5 T T F 0 0 F T F 25 0 T F F 0 0 F F F 0 25
(a) According to the classification error rate, which attribute would be chosen as the first splitting attribute? For each a.ttribute 1 show the contingency table and the gairu; in d!lSsification error rate.
(b) Repeat for the two children of the root node .
(c) How many instances are misclassified b.r the resultiug decision tree?
(d) Repeat parts (a), (b), !Uld (c) using C"" the splitt ing attribute.
(e) Use the r esults in parts (c) and (d) to conclnde abont the greedy nature of the derision tree induct-ion algorithm.
8. Consider the decision tree shown in Figure 4.30.
(a) Compute the generalizat-ion error rate of t he tree using the optimistic approach.
( b) Compute the generalization error rate of the tree using the pessimistic approach. (For simplicity, use the strategy of adding a factor of 0.5 to each leaf node.)
(c) Compute the generalization error rate of the tree using t he validation set shown above. This approach is known as reduced error pruning.
202 Chapter 4 Classification
Training: Instance A B c Class
1 0 0 0 + 2 0 0 1 + 3 0 1 0 + 4 0 1 1 5 1 0 0 + 6 1 0 0 + 7 1 1 0 8 1 0 1 + 9 1 1 0 10 1 1 0
Validation· Instance A B c Class
11 0 0 0 + 12 0 1 1 + 13 1 1 0 + 14 1 0 1 15 1 0 0 +
Figure 4.30. Decision tree and data sets for Exercise 8.
9 . Consider the decision trees shown in Figure 4.31. Assume they are generatNi from a data set t hat contains 16 binary attributes and 3 classes. cl, c'l~ and C3.
(a) Decision tree witt> 7 errors (b) Decision tree wittl4 errors
Figure 4.31. Decision trees for Exercise 9.
4.8 Exercises 203
Compute the total d"'""ription length of each decision tree acrording to the minimum description length principle.
• The total description length of a tree is given by:
Cos t( tree, data)= Cost( tree) + Cost(data itree) .
• E~Wh internal node of the tree is encoded by the ID of the splitting at- tribute. If there are m attributes1 the cost of encoding each attribute is log2 m hits.
• E~Wh leaf is encoded using the ID of the class it is associated with. II there are k classes, the cost of enroding a class is log2 k bits.
• Cost( tree) is the cost. of encoding aJJ the nodes in the tree. To simpli(y the computation, you can assume t hat the total cost of t.he tree is obtained by adding up the costs of encoding each internal node and each leaf node.
• Cost(dataitree) is encoded using t he classification errors the tree commits on the training set . Each error is encoded by log2 n bits 1 where n is the total number of training .instances.
Which decision t ree is better, according to the MDL principle?
10. While the .632 bootsuap approach is useful for obtaining a reliable estimate of model accuracy, it has a known limitation [127]. Consider a two-class problem, where there are equal number of posit ive and negative exrunples in the data. Suppose tbe class labels for the examples are generated randomiy. The classifier used is an unpruned decision tree (i.e., a perfect memorizer) . Determine the accuracy of the classifier using each of the following methods.
(a) The holdout method, where tw<>-thlrds of the data are used for training and the remaining one-third are used for t esting .
( b) Ten-fold cross-validation.
(c) The .632 bootstrap method.
(d) From the results in parts (a), (b). and (c), which method provides a more reliable evaluation of the classifier's accuracy?
11 . Consider the following approach for testing whether a classifier A beats another clsssifier B. Let N be the size of a given data set, PA be the accuracy of classifier A, PB be the accur~Wy of classifier B, and p = (pA + Ps)/2 be the average accuracy for bot h classifiers. Th test whet her classifier A is significantly better than B, t he following Z-statistic is used :
z - PA - PB - J~r<}?'l.
Classifier A is llllBwned to be better than classifier B if Z > 1.96.
204 Chapter 4 Classification
Table 4.9 compares the accuracies of three different classifiers, decision tree classifiers, naive Bayes classifiers~ and support vector machines, on various data sets. (The lat.ter two classifiers""" described in Chapter .5.)
Table 4.9. Comparing the accuracy of various classification methods.
Data Set Size Decision naive Support vector (N) Tree(%) Bayes(%) machine(%)
Anneal 898 92.09 79.62 87.19 Australia 600 85.51 76.81 84.78 Auto 205 81.95 58.05 70.73 Breast 699 95.14 95.99 96.42 Cleve 303 76.24 83.50 84.49 Credit 690 85.80 77.54 85.07 Diabetes 708 72.40 75.91 76.82 German 1000 70.00 74.70 74.40 Glass 214 67.29 48.59 50.81 Heart 270 80.00 84.07 83.70 Hepatitis 155 81.94 83.23 87.10 Horse 368 85.33 78.80 82.61 Ionosphere 351 80.17 82.34 88.89 Iris 150 94.07 95.33 96.00 Labor 57 78.05 94.74 92.98 Led7 3200 73.34 73.16 73.56 Lymphography 148 77.03 83.11 86.49 Pima 768 74.35 70.04 76.95 Sonar 208 78.85 69.71 76.92 Tic-tac-t.oe 958 83.72 70.().1 98.33 Vehicle 846 71.04 45.04 74.94 \Vine 178 94.38 00.63 98.88 Zoo 101 93.07 93.07 96.().1
Sununarize the p<!rformance of the classifiers given in Table 4.9 using the fol- lowing 3 x 3 table:
win-loss-draw Decision t.ree Naive Bayes Support vector machine
Decision tree 0- 0- 23 Nai've Bayes 0- 0- 23 :Support vector maclLine 0-0-23
Each cell in the table conta.i.ns the number of wins. losses, and draws when comparing the classifier in a given row to the classifier in a given column.
4.8 Exercises 205
12. Let X be a binomial random variable with mean Np and variance Np(l- p). Show that the ratio XjN also has a binomial distribution with mean p and variance p{l- p)jN.
I
Association Analysis: Basic Concepts and Algorithms
6
Many business enterprises accumulate la.rge quantities of data from their day- to-day opera.lions. For example, huge amounts of customer purehase data are collected daily at the checkout coUDtcm of gyo=y store~. T&ble 6.1 illwtratco an e:xa.mple of ouch data., commonly known as market basket transactions. Each row in thls table oart'eSpond.& to a transaction, which contains a unique identifier labeled TID and a set of iteiDB bought by a given customer. Retail- ers are interested in ana.lyzing the data to learn about the purcha.s.ing behavior of their customers. Such valuable informo.tion Cllll be used to support a VllZi- ety of busin...,.rela.tod applications such os msrbting pramotions, inwntory management, and customer relationship ma.na.gement.
This chapter presents a methodology known as association analysis, which is useful for discovering interesting relatioiJShips hidden in large dat a ocis. The uncovered rel&tiODBhips C6ll be repr"""nted in the furm of as5ocia-
Tablo 6.1. An sxamp& of marf<st baskst transacticns.
TID ltemB I 1~read, ~ilk} 2 {Bread, IJiap.,., Beer, Ew} 3 {Milk, Diapera, Beer, Cola} 4 {Bread, Milk, Diapers, Beer} 5 {Bread, Milk, Diapers, Cola}
328 Chapter 6 Association Analysis
tion rules or sets of frequent items. For example, the following rule can be extracted from tbe data set shown in Table 6.1:
{Diapers} ~ {Beer}.
The rule suggests that a strong relationship exists between the sale of diapers and beer because many customers who buy diapers also buy beer. Retailers can use this type of rules to help them identify new opportunities for cross- selling their products to the customers.
Besides market basket data, association ana1ysis is also applicable to other application domains such as bioinformatics, medical diagnosis, Web mining, and scientific data analysis. In the analysis of Earth science data, for example, the association patterns may reveal interesting connections among the ocean, land, and atmospheric processes. Such information may help Earth scientists develop a better understanding of how the different elements of the Earth system interact witb each other. Even though the techniques presented here are generally applicable to a wider variety of data sets, for illustrative purposes, our discussion will focus mainly on market basket data.
There are two key issues that need to be addressed when applying associ- ation analysis to market basket data. First, discovering patterns from a large transaction data set can be computationally expensive. Second, some of the discovered patterns are potentially spurious because they may happen simply by chance. The remainder of this chapter is organized around tbese two is- sues. The first part of the chapter is devoted to explaining the basic concepts of association analysis and the algorithms used to efficiently mine s uch pat- terns. T he second part of the chapter deals with the issue of evaluating the discovered patterns in order to prevent the generation of spurious results.
6.1 Proble m Definition
This section reviews the basic terminology used in association analysis and presents a formal description of the task.
Binary Representation Market basket data can be represented in a binary format as shown in Table 6 . 2, where each row corresponds to a transaction and each column corresponds to an item. An item can be treated as a binary variable whose value is one if the item is present in a transaction and zero otherwise . Because the presence of an item in a transaction is often considered more important than its absence, an item is an asynun~tric binary variable.
6.1 Problem Definition 329
Table 6.2. A binruy 0/ 1 representation of market basket data.
TID Bread Milk Diapers Beer Eggs Cola I I I 0 0 0 0 2 1 0 1 1 1 0 3 0 1 I 1 0 1 4 1 1 1 I 0 0 5 1 1 1 0 0 1
This representation is perhaps a very simplistic view of real market basket data because it ignores certain important aspects of the data such as the quantity of items sold or the price paid to purchase them. Methods for handling such non-binary data will be explained in Chapter 7.
lteniSet and Support Count Let I = {it ,i2, ... .id} be the set of all items in a market basket data and T = {t1, t2, . . •• t N} be the set of all transactions. Each transaction ti contains a subset of items chosen from I. In association analysis, a collection of zero or more items is termed an itemset. If an itemset contains 1.: items, it is called a 1.:-itemset. For instance, {Beer, Diapers, Milk} is an example of a 3-itemset. The null (or empty) set is an itemset that does not contain any items.
The transaction width is defined as the nnmber of items present in a tram~ action. A transaction tj is said to contain an itemset X if X is a subset of tj. For example, the second transaction shown in Table 6.2 contains tbe item- set {Bread, Diapers} but not {Bread, Milk}. An important property of an iternset is its support count, which refers to the number of transactions that contain a particular itemset. Mathematically, the support count, u(X). for an itemset X can be stat ed as follows:
u(X) = l{t; IX!:;; t;, t; E T}l.
where the symbol I · I denote the number of elements in a set . In the data set shown in Table 6.2, the support count for {Beer, Diapers , Milk} is equal to two because there are only two transactions that contain all three items.
Association Rule An association rule is an implication expression of the form X ~ Y, where X and Y are disjoint itemsets, i.e., X n Y = 0. The strength of an association rnle can be measured in terms of its support and confidence. Support determines how often a rule is applicable to a given
330 Chapter 6 Association Analysis
data set. while confidence determines how frequently items in Y appear in transactions that contain X. The formal definitions of these metrics are
Support, s(X ~ Y)
Confidence, c(X ~ Y)
a(X uY) - -N-
a(X u Y)
~
(6.1)
(6.2)
Example 6.1. Consider the rule {Milk, Diapers} ~ {Beer}. Since the support count for {Milk, Diapers, Beer} is 2 and the total number of trans- actions is 5, the rule's support is 2/5 = 0.4. The rule's confidence is obtained by dividing the s upport count for {Milk, Diapers , Beer} by the suppmt count for {Milk, Diapers}. Since there are 3 transactions that contain milk and di- apers, the confidence for this rule is 2/3 = 0.67. •
Why Use Support and Confidence? Support is an important measure because a rnle that has very low suppcrt may occur simply by chance. A low support rule is also likely to be uninteresting from a business perspective because it may not be profitable to promote items that cu.stmners seldom bny together (with the exception of the situation described in Section 6.8). For these reasons, support is often used to eliminate uninteresting rules. As will be shown in Sectio n 6.2.1, support a lso has a desirable property t hat can be exploited for the efficient discovery of aSBociation rules.
Confidence, on the other hand, measures the reliability of the inference made by a r ule. For a given rule X ~ Y, tbe higher tbe confidence, the more likely it is for Y to be present in transactions that contain X. Confidence also provides an estimate of the conditional probability of Y given X.
Association analysis results should be interpreted with caution. The infer- ence made by an association rule does not necessarily imply causality. Instead, it snggests a strong co-occurrence relatiouship between items in the antecedent and consequent of the rule. Causality, on the other hand, requires knowledge about the causal and effect a ttributes in the data and typically involves rela- tionships occurring over t ime (e.g .. ozone d epletion leads to global warming).
Formulation of Association Rule Mining Problem The association rule mining problem can be formally stated as follows:
Definition 6.1 (Assoc iation Rule Discovery). Given a set of transactions T, find all the rules having support~ mi.nsup and confidence~ minconf, where minsup and minconf are the corresponding support and confidence thresholds.
6.1 Problem Definition 331
A brute-force approach for mining association rules is to compute the sup- port and confidence for every possible rule. This approach is prohibitively expensive because there are exponentially many rules that can be extracted from a data set. More specifically, the total number of possible rules extracted from a data set that contains d items is
(6.3)
The proof for this equation is left as an exercise to the readers (see Exercise 5 on page 405). E ven for the small data set shown in Table 6.1, this approach requires us to compute tbe support and confidence for 36 -27 + 1 = 602 rules. More than 80% of the rules are discarded after applying minsup = 20% and mincon f = 50%, thus making most of the computations become wasted. To avoid performing needless computations, it would be useful to prune the rules early without having to compute their support and confidence values.
An initia l step toward improving the performance of association rule min- ing algorithras is to decouple the support and confidence requirements. From Equation 6.2, notice that the support of a rule X ~ Y depends only on the support of its corresponding itemset, X U Y. For example, tbe following rules have identical support because they involve items from the same itemset, {Beer, Diapers, Milk}:
{Beer, Diapers} ~ {Milk}, {Diapers. Milk} ~ {Beer}, {Milk} ~ {Beer,Diapers},
{Beer, Milk} ~ {Diapers} , {Beer} ~ {Diapers, Milk}, {Diapers} ~ {Beer,Milk}.
If t he itemset is infrequent, then all six candidate rules can be pruned imme- diately without our having to compute their confidence values.
There fore, a common strategy adopted by many association rule mining algorithms is to decompose the problem into two major subtasks:
1. Frequent Itemset Generation, whose objective is to find all the item- sets that satisfy the minsup threshold. These itemsets are called frequent itemsets.
2. Rule Generation, whose objective is to extract all the high-confidence rules from the frequent iternsets found in the previous step. These rules are called strong rules.
The computational requirements for frequent itemset generation are gen- erally more expensive than those of rule generation. Efficient techniques for generating frequent iternsets and association rilles are discussed in Sections 6.2 and 6.3, respectively.
332 Chapter 6 Association Analysis
Figure 6.1. An ~emset latlice.
6.2 Frequent Itemset Generation
A lattice structure can be used to enumerate the list of all possible itemsets. F igure 6.1 shows an itemset lattice for I = {a, b,c,d,e}. In general, a data set that contains k itell1S can potentially generate up to zk - 1 frequent itell1Sets, excluding the nnll set. Becanse k can be very large in many practical appli- cations, the search space of itemsets that need to be explored is exponentia.Jly large.
A brute-force approach for finding frequent itemsets is to determine the snpport count for every candidate itemset in the lattice stmcture. To do this, we need to cOinpare each candidate against every transaction, an opera- tion that is shown in Fig ure 6.2. If the candidate is contained in a t ransaction, its support count will be incremented. For example, the support for {Bread, Milk} is incremented three times because the itemset is contained in transac- tions 1, 4, and 5. Such an approach can be very expensive because it requires O(N i\fw) comparisot1S, where N is the number of transactions, i\f = zk - 1 is the nnmber of candidate itemsets, and w is the maximum transaction width.
6 . 2 Frequent Iten1Set Generation 333
Candidates
I Transactions TID Items t 1 Bread, Milk M 2 Bread, Diapers, Beer, Eggs
j N 3 Milk, Diapers, Beer, Coke 1 4 Bread, Milk, Diapers, Beer 5 Bread, Milk, Diapers, Coke Figure 6.2. Counting the support of candidate ~emsets.
There are several ways t.o reduce the computational complexity of frequent itemset generation.
1. Reduce the number of candidate ite msets (M). The A priori prin- ciple, described in the next section, is nn effective way to eliminate some of the candidate i temsets without counting their support va.Jues.
2. Reduce the number of comparisons. Instead of matching each can- didate itetnset against every transaction, we can reduce the number of comparisons by using more advanced data structures, either to store the candidate itemsets or to compress the data set. We will discuss these strategies in Sections 6.2.4 and 6.6.
6 .2 .1 The Apriori Principle
T his section describes how the support measure helps to r educe the number of candidate itemsets explored during frequent itemset generation. The use of support for prnning candidate itemsets is gnided by t he following principle .
Theorem 6.1 (A priori Principle). If an itemset is frequent, then all of its subsets must also be frequent.
To illus trate the idea behind the Apriori princ.iple, consider the itemset lattice shown in F igure 6.3. Suppose { c, d, e) is a freqnent it,ell1Set. Clearly, any transaction that contains { c, d, e} must also contain its subsets, { c, d), {c,e}, {d, e}, {c}, {d}, and {e }. As a result, if {c,d,e} is frequent, then all subsets of {c,d,e} (i.e., the s haded itemsets in this figure) must a.!so be frequent .
334 Chapter 6 Association Analysis
Figure 6.3. An illustration of the Apriori principle. If { c, d, e} is frequent, then all subsets of this itemset are frequent.
Conversely, if an item set s ud1 as {a, b} i; infrequent, then all of its supersets must be infrequent too. As illustrated in Figure 6.4, the entire subgraph contairung the supersets of {a, b) can be pruned immediately once {a,b} is found to be infrequent. This strategy of trimming the exponential search space based on the su pport measure is known as support-based pruning. Such a pruning strategy is made possible by a key property of the support measure, namely, that the support for an itemset never exceeds the support for its s ubsets. This property is also known as the anti-monotone property of the support m easure.
De finition 6.2 (Mo notonicity Property). Let I be a set of items, and 1 = 21 be the power set of I. A measure f is monotone (or upward closed) if
VX, Y E 1: (X<;; Y) ___, !(X)~ J(Y),
I I I I I I I I \ \ \
\
' ' ' ........... , ',
Prunecl ', Supersets ' ............
6.2 Frequent Itemset Generation 335
______________ ...
Figure 6.4. An illustration of support-based pruning. ~ {a , b) is infrequent, then all supersetsof {a, b) are infrequent.
which means that if X is a subset of Y , then J(X) must not exceed J(Y) . On the other h and, f is anti-monotone (or downward closed) if
VX, Y E 1: (X<;; Y) ___, f(Y) ~ J(X) ,
which m eans that if X is a subset of Y, then J(Y) must not exceed !(X).
Any measure that possesses an anti-n1onotone property can be incorpo- rated directly into the nlirung algorithm to effectively prune the exponential search space of candidate itemsets, as will be shown in the next section.
6 .2.2 Ft-equent Itemset Generation in the Apriori Algorithm
Apriori is the first association rule mining algorithm that pioneered the use of support-based pruning to systematically control t he exponential growth of candidate itemsets. Figure 6.5 provides a high-level illustration of the frequent itemset generation part of the A priori algorithm for t he transactions shown in
336 Chapter 6 Association Analysis
Candidate 1-ltemsets
Item Count Beer 3 Bread 4 Cola
Minimum support count= 3
2 " . Diapers :l) ;:;:::::: Milk Eggs 1 ltemsel Count
{Beer, Bread} 2 {Beer, 1apers} 3 {Beer. Milk} 2 Bread, Diapers} 3
{Bread, Milk) 3
~::•:;: ~~~':ed {Diapers, Milk} 3 support
" Candidate
r'------clt"'e-:m:=!c:~7:•c.:m.:.:se=ts'r.c"'o"'u::n71t {Bread, Diapers, Milk} 3
Figure 6.5. Illustration of frequent itemset generation using the Apriori algorithm.
Table 6.1. We assume that the support threshold is 60%, which is equivalent to a minimum support count equal to 3.
Initially, every item is considered as a candidate 1-itemset. After count- ing their supports, the candidate iternsets {Cola} and {Eggs } are discarded because t hey appear in fewer than three transactions. In the next iteration, candidate 2-itemset.s are generated using only the frequent 1-itemsets because the Aprior'i principle ensures that all supersets of the infrequent 1-itemsets must be infrequent. Because there are only four freque nt 1-itemsets, the num- ber of candidate 2-itemsets generated by the algorithm is ( ~ ) = 6. Two of t hese six candidates, {Beer, Bread} and {Beer, Milk}, are subsequently found to b e infrequent after computing their support values. The remain- ing four candidates are frequent, and thus will be used to generate candidate 3-itemsets. Without support-based pruning, there are ( ~ ) = 20 candidate 3-itemsets that can be formed usiug the six items given in this example. With the A priori principle, we only need to keep candidate 3-itemsets whose subsets are frequent. The only candid ate that has this property is {Brea d, Diapers , Milk}.
The effectiveness of the A priori pruning strategy can he shown by count- ing the number of candidate itemset.s generated. A brute-force strategy of
6. 2 Frequent Iten=t Generation 337
enumerating all itemsets (up to size 3) as candidates will produce
G) + (~) + G) = 6+ 15+ 20 = 41 candidates. Witl1 the Apriori principle, this number decreases to
G)+(~) +1 =6+6+1 = 13 candidates1 which represents a 68% reduction in the number of candidate itewsets even in this simple example.
The pseudocode for the frequent itemset generation part of the Apriot'i algorithm is shown in Algorithm 6.1. Let ck denote the set of candidate k-itemsets and Fk denote the set of frequent k-itemsets:
• The algorithm initially makes a single pass over the data set to determine the support of each item. Upon completion of this step, the set of all frequent 1-itemsets, F 1 , will be known (steps 1 and 2).
• Next, the algorithm will iteratively generate new candidate k-itemsets using the frequent (k - 1 )-itemsets found in the previous iteration (step 5). Candidate generation is implemented using a function called apriori- gen, which is described in Section 6.2.3.
A lgorithm 6.1 Frequent itemset generation of the A priori a lgorithm. l:k = l. 2: F. = {iIi E I 1\u({i} )?: N x minsup). {Find all frequent 1-itemsets} 3: repeat 4: k = k + 1. 5: Ck = apriori-gen(H- 1). {Generate candidate itemsets} 6: for each transaction t E T do 7: C, = subset(Ck , t). {Identify all candidates that belong tot} 8: for each candidate itemset c E Ct do 9 : CT(c) = u(c) + 1. {Increment support count}
10: end for 11 : end for 12: Fk = { c I c E c. 1\ u(c)?: N x mi nsup} . {Extract the frequent k-itemsets} 13: until Fk = 0 14: Result = UF,.
338 Chapter 6 Associatio n Analysis
• To count the support of the candidates, the algorithm needs to make an additional pass over the data set (steps 6-10). The subset function is used to determine all the candidate itemsets in Ck that are contained in each transaction t . The implementation of this function is described in Section 6.2.4.
• After counting their supports, the algorithm eliminates all candidate iternsets whose support counts are less than minsup (step 12).
• The algorithm terminates when there are no new frequent itemsets gen- erated, i.e., Fk = 0 (step 13).
The frequent itemset generation part of the Apriori algorithm has two im- portrult characteristics. First, it is a level-wise algorithm; i.e., it traverses the itemset lattice one level at a time, from frequent 1-iternsets to the maximum size of frequent itemsets. Second. it employs a generate-and-test strategy for finding frequent itemsets. At each iteration, new candidate itemsets are generated from the frequent itemsets found in the previous iteration. The support for each candidate is then counted and tested against the minsup t hreshold. The total number of iterations needed by t he algorithm is kmax + 1, where kmax is the maximum size of the frequent itemsets.
6.2.3 Candidate Generation and Pruning
The apriori-gen function shown in Step 5 of Algorithm 6.1 geuerates caudidate itemsets by performing the following two operations:
1. Candidate Generation. This operation generates new candidate 1.:- itemsets based on the frequent (k- 1)-iternsets found in the previous iteration.
2. Candidate Pruning. This operation eliminates some of the candidate k-itemsets nsing the snpport-hased pruning strategy.
To illustrate the candidate pruning operation, consider a candidate k-iternset, X= {i,,i2, .. .,ik}. The a lgor ithm must determine whether all of its proper subsets, X - {ij} (lfj = 1, 2, . . . , k), are frequent . If one of them is infre- quent , then X is immediately pruned. This approach can effectively reduce the number of candidate itemsets considered during support cow1ting. The complexity of this operation is 0 ( k) for each candidate k-itemset. However, as will be E~howu later, Vle do not have to examine all k subsets of a given candidate itemset. If m of the k subsets were used to generate a candidat e, we only need to check the remaining k - m subsets during candidate pruning.
6.2 Frequent lternset Generation 339
In principle, there are many ways to generate candidate itemsets. The fol- lowing is a list of requirements for an effective candidate generation procedure:
1. It should avoid generating too many unnecessary candidates. A candi- date itemset is unnecessary if at least one of its subsets is infrequent. Such a candidate is guaranteed to be infrequent according to the anti- monotone property of support.
2. It must ensure that the candidate set is complete, i.e., no frequent item- sets are left out by the candidate generation procedure. To ensure com- pleteness, the set of candidate itemsets must subsume the set of all fre- quent itemsets, i.e .. Vk : Fk <; Ck-
3. It should uot generate the same candidate itemset more than ouce. For example, the candidate iternset {a, b, c, d} can be generated in many ways-by merging {a,b,c} with {d) , {b,d} with {a, c). {c} with {a,b, d) , etc. Generation of duplicate candidates leads to wasted computations and thus should be avoided for efficiency reasons.
Next, we will briefly describe several candidate generation procedtues, in- cluding the one used by the apriori-gen function.
Brute-Force Method The brute-force method considers every k-itemset as a potential candidat e and then applies the candidate pruning step to remove any unnecessary candidates (see Figure 6.6). The number of candidate item- sets generated at level 1.: is equal to ( t ) , where dis the total number of items. Although candidate generation is rather trivial, candidate pruning becomes extremely expensive because a large number of iternsets must be examined. Given that the amount of comput a tions needed for each candidate is O(k), the overall complexity of this method is O(":Lt~t k x ( ~ )) = O(d · 2d- 1 ).
Fk- l x F, Method An alternative method for candidate generation is to extend each frequent (k- 1)-itemset with other frequent items. Figure 6.7 illustrates how a frequent 2-itemset such as {Beer, Diapers} can be a ug- mented with a frequent item such as Bread to produce a candidate 3-itemset {Beer , Diapers, Bread}. This method will produce O(IFk-ll x IFd ) candi- date k·-iternsets, where IFi l is the number of frequent j-itemsets. The overall complexity of this step is O("L,k kiFk- l iiF,I).
Tbe proced.ure is complete because every frequent k-itemset is composed of a frequent (k - 1)-itemset and a frequent 1-itemset. Therefore, all frequent k-itemsets are part of the candidate k-itemsets generated by this procedure.
340 Chapter 6 Association Analysis
Item$
Candidate Pn.mlng
Item &ret {Bread, Diapers, M~k}
Figure 6.6. A brute-force method for generating candidate 3-itemsets.
Candklata G9nsratlon
llemaet {~r. Diapers, Bleed} {Beer. Diaper"$, Mit:} {Bread, Dlape~. Milk} {Broad, Milk. Boor}
Gandlelatg Prunng
ltemset __. {Bread, Diapers, Milk}
Figure 6.7. Generating and prWling candidate k-itemsets by merging a frequent (k -1)-itemset with a frequent item. Note that some of the candidates are unnecessary because their subsets are infrequent.
This approach, however, does not prevent the same candidate itemset from being generated more than once. For instance, {Bread, Diapers , Milk} can be generated by merging {Bread, Diapers} with {Milk}, {Bread, Milk} with {Diapers}, or {Diapers, Milk} with {Bread}. One way to avoid generating
6.2 Frequent ltemset Generation 341
duplicate candidates is by ensuring that the items in each frequent itemset are kept sorted in their lexicographic order. Each frequent (k-1)-itemset X is then extended with frequent items that are lexicographically larger than the items in X. For example, the itemset {Bread, Diapers} can be augmented with {:tvlilk} since Milk is lexicographically larger than Bread and Diapers. How.ever, we should not augment {Diapers, Milk} with {Bread} nor {Bread, Milk} with {Diapers) because they violate the lexicographic ordering condition.
While this procedure is a substantial improvement over the brute-force method
1 it can still produce a large number of unnecessary candidates. For
example, the candidate itemset obtained by merging {Beer, Diapers} with {Milk} is unnecessary because one of its subsets~ {Beer1 Milk}, is infrequent. There are several heuristics available to reduce the numher of unnecessary candidates. For example, note that, for every candidate k-itemset that survives the pruning step, every item in the candidate must be contained in at least k- 1 of the frequent (k -1)-itemsets. Otherwise, the candidate is guaranteed to h e infrequent. For example, {Beer, Diapers , Milk} is a viable candidate 3-itemset only if every item in the candidate, including Beer, is contained in at least two frequent 2-itemsets. Since there is only one frequent 2-itemset containing Beer, all candidate itemsets involving Beer must be infrequent.
F k-1 x F k-1 Method The candidate generation procedure in the apriori-gen function merges a pair of frequent (k -1)-itemeets only if their first k- 2 items are identical. Let A = { a 1 , a2, .. . , ak-d and B = {b~o b2 .... , bk-d be a pair of frequent (k- 1)-itemsete. A and B are merged if they satisfy the following conditions:
a , = b, (fori= 1, 2, .. . , k - 2) and ak-1 f bk-1·
In Figure 6.8, the frequent itemsete {Bread, Diapers} and {Bread, Milk} are merged to form a candidate 3-itemset {Bread, Diapers, Milk}. The algorithm does not have to merge {Beer, Diapers} with {Diapers, Milk} because the first item in both itemsets is different. Indeed, if {Beer, Diapers, Milk} is a viable candidate, it would have been o btained by merging {Beer, Diapers} with {Beer, Milk} instead. This example illustrates both t he completeness of t he candidate generation procedure and the advantages of using lexicographic ordering to prevent duplicate candidates. However, because each candidate is obtained by merging a pair of frequent (k-1 )-itemsets, an additional candidate pruning step is needed to e nsure that the remaining k - 2 subsets of the candidate are frequent.
342 Chapter 6 Association Analysis 6.2 Frequent Iternset Generation 343
Frequent Transaction, t 2-itemset
Candidate Candidate Generation Pruning
lt!lmaet ltemae1 {Bread, Diapers, Milk} ....... {Bread, Diapers, Milk~
Figure 6.8. Genera~ng and pruning candidate k~temsets by merging pairs of frequent (k-1)·itemsets.
6.2.4 Support Counting
Support coWlt.ing is the process of determining t he frequency of occurrence for every candidate itemset that survives the candidate pruning step of the apriori-gen function . Support counting is implemented in steps 6 through 11 of Algorithm 6.1. One approach for doing this is to compare each transaction against every candidate itemset (see Figure 6.2) and to update the support counts of candidates contained in the transaction. This approach is computa- tionally expensive, especially when the numbers of transactions and candidate iternsets are large.
An alternative approach is to e.numerate the iternsets contained in each transaction and U5e them to update the suppor t counts of their respective can- didate iternsets. To illustrate, consider a transaction t. that contains five items, {1 , 2, 3 , 5, 6}. There are ( ~ ) = 10 itemsets of size 3 contained in this t ransac- tion. Some of t he iternsets may correspond to the candidate 3-iternsets under investigation, in which case. their s upport connts are incr emented. Othe r subsets oft that do not correspond to any candidates can be ignored .
Fig ure 6. 9 shows a systematic way for enumerating the 3-itemsets contained in t. Assuming that each itemset keeps its items in increasing lexicographic order, an itemset can be enWl>erated by spec.if'ying tbe smallest item first, followed by t he larger items. For instance, given t = { 1, 2, 3, 5, 6}, all the 3- iternsets contained in t must begin with item 1, 2. or 3. It is no t po,.,ihle to construct a 3-itemset tha t begins with items 5 or 6 because there are only two
Leve/3 Subsets of 3 items
Figure 6.9. Enumerating subsets of three items from a transaction t.
items in t whose labels are greater than or equal to 5. The numbe r of ways to specify the first item of a 3-itemset contained in t is iUnstrated by tbe Level 1 prefix structures depicted in Figure 6.9. For instance. 1 1TIEJ represents a 3-iternset that hegins with item 1, followed by two more items chosen from t he set {2, 3,5,6}.
After fixing the first item, t he prefix structures at Level 2 represent the number of ways to select the second item. For example, 1 2 ~corresponds to iternsets that begin with prefix (1 2) and are followed by items 3, 5, or 6. Finally, the prefix structures at Level 3 represent t he complete set of 3-itemsets contained in t. For example, the 3-itemsets th at begin with prefix { 1 2} are {1 , 2.3}, {1 ,2, 5}, and {1 , 2,6}, whlle those tbat begin wit b p refix {2 3} are {2,3,5} and {2, 3, 6} .
T he prefix structures shown in Figure 6.9 demonstrate how itemsets con- tained in a t ransaction can be systematically enumerated, i.e .. by specifYing their items one by one, from the leftmost item to the rightmost item. We still have to d etermine whether each enumerated 3-itelflset corresponds to an existing candidate itemset. If it matches one of tbe candidates , t hen t he s up- port count of t he corresponding candidate is incremented. In the next section , we illustrate how this matchlng operation can be performed efficiently using a hash tree structure.
344 Chapter 6 Association Analysis
Hash Tree
Leafnodes ~ containing I {Boer, Bread) Ill{ . }II· }I c~ndidate (Beer. Oi~rs) {B[;!dD•::;s} {Diapers, Milk) 2-rtemsets {Beer. Mrlk} '
Transactions I I TID Items t Bread, Milk 2 Bread, Diapers, Beer, Eggs 3 Milk, Diapers, Boor, Cola 4 Bread, Milk, Dlaoers, Beer 5 Bread, Milk, Diapers, Cola
Figure 6.10. Counting the support of itemsels using hash structure.
Suppor t Cou nting Using a H ash Tree
In the Apriori algorithm, candidate itemset,; are partitioned into different buckets and stored in a hash tree. During support counting, itemsets contained in each transaction are also hashed into their appropriate buckets. That way, instead of comparing each itemset in the transaction with every candidate it.emset, it is matched only against candidate itemsets that belong to the same bucket, as shown in Figure 6.10.
F igure 6.11 shows an example of a hash tree structure. Each internal node of the tree uses the following hash function, h(p) = p mod 3, to determine which branch of the current node should be followed next. For example, items 1, 4, and 7 are hashed to the same branch (i.e., the leftmost branch) because they have the same r emainder after dividing t he number by 3. All candidate itemsets ru·e stored at the leaf nodes of the hash tree. The h!lSh tree shown in Figure 6.11 contains 15 candidate 3-itemsets, distributed across 9leaf nodes.
Consider a transaction, t = { 1, 2, 3, 5, 6} . To update the support cow1ts of the candidate itemsets, the hash tree must be tnwersed in such a way that all the leaf nodes containing candidate 3-itemsets belonging to t must be visited at least once. Recall that the 3-itemsets contained in t must begin with items 1, 2, or 3, as indicated by the Level 1 prefix structures shown in Figure 6.9. Therefore, at the root node of the hash tree, the items 1, 2, and 3 of the transaction are hashed separately. Item 1 is hashed to the left child of the root node, item 2 is hashed to the middle child, and item 3 is hashed to the right child. At the next level of the tree, the transaction is hashed on the second
6 .2 Frequent Itemset Generation 345
HII:Sh FundOn
2 ~f~
,./.'/ -- ··r
rti7l ~
Figure 6.11. Hashing a transaction at the root node of a hash tree.
it,em listed in the Level 2 structures shown in Fignre 6.9. For example, after hashing on item 1 at the root node, items 2. 3, and 5 of the transaction are hashed. Items 2 and 5 are hashed t.o the middle child, while item 3 is hashed t.o the right child, as shown in F igure 6 .12. Tlus process continues w1til the leaf nodes of the hash tree are reached. The candidate itemsets stored at the visited leaf nodes are compared against the transaction. If a candidate is a snbset of t he transaction, its support count is incremented. In this example, 5 out of the 9 leaf nodes are visited and 9 out of the 15 itemsets are compared against the transaction.
6.2.5 Computational Complexity
The computational complexity of the A priori algorithm can be affected by the following factors.
S u ppor t Thre s h o ld Lowering the support threshold often results in more it,emsets being declared as frequent. This has an adverse effect on the com-
346 Chapter 6 Association Analysis
Transaction
11235~6 1
Candidate Hash Tree ,'
12+ B -- ---.... --., 13+8- ·- -.!>',- ..
15+ @- -
124
457
3+~
Figure 6.12. Subset operati011 on the leftmosl sublree of the root of a candidate hash trl!e.
putational complexity of the algorithm because more candidate itemsets must be generated and counted, as shown in Figure 6.13. The maximum size of frequent itemsets also tends to increase with lower support thresholds. As the maximum size of the frequent itemsets increases, the algorithm will need to make more passes over the data set.
Number of Items (Dimensionality) As the nnmber of items increases. more space will be needed to store the support counts of items. If the number of frequent items also grows with tbe dimensionality of the data, the computation and 1/0 costs will increase because of the larger number of candidate itemsets generated by the algorithm.
Number of Transactions Since the Apriori algorithm makes repeated passes over the data set, its run time increases with a larger number of trans- actions.
Average Trm1saction Width For dense data sets, the average transaction widt h can he very large. This affects the complexity of the A priori algorithm in two ways. First, the maximum size of frequent itemsets tends to increase as the
3.5
i ' j 2.5 ~ 1! 2 ~
~ 1.5 e 1 •
4 x10~
3.5
i ' e ~ 2.5
~ ! 2 ~ A 1.5 e 1 '
6.2 Frequent ltemset Generation 347
" " 20 S~e of lk!IMGI (a) Number of candidate itemsets.
o~,~~~+~~~+~-+~+~-~1~,+-~-+~,.~~.-~~ SIZ8olhemsel
(b) Number of frequent itemsets.
Rgure 6.13. Elect of support threshold on the number of candidate and frequent ilemsets.
average transaction width increases. As a result, more candidate itemsets must be examined during candidate generation and support counting1 as illustrated in Figure 6.14. Second, as the transaction width increases, more itemsets
348 Chapter 6 Association Analysis
l i! i! i!
j i i ; i ; t
10 15 20
(a} Number of c8Ildidal:€ iternsets.
(b} Number of Frequent Itemsets.
25
Figure 6.14. Elect of aYe rage transaction width on the number of candidate and frequent itemsets.
are contained in the transaction. This will increase the number of hash tree t raversals performed during support counting.
A d etailed analysis of the time complexity for the Aprior'i algorithm is presented next.
6.3 Rule Generation 349
Generation of frequent 1-itemsets For each transaction, we need to up- date the support count for every item present in the transaction. Assuming that w is the average transaction width, this operation requires O(N w ) time, where N is the total number of transactions.
Candidate generation To generate candidate k-itemsets, pairs of frequent (k - 1)-iternsets are merged to determine whether they have at leBSt k - 2 iteDlJl in common. Each merging operation requires at most k - 2 equality comparisons. In the best-case scenario, every merging step produces a viable candidate k-itemset. In the worst-case scenario, the algorithm must merge ev- ery pair of frequent ( k -1 )-itemsets found in the previous iterat ion. Therefore, the overall cost of merging frequent itemsets is
w w
~)k - 2)1Ckl < Cost of merging < L)k - 2)1Fk-l l2 .
A hash tree is also constructed during candidate generation to store the can- didate itemsets. Because the maximum depth of tile tree is ~·, the cost for populating the hash tree with candidate itemsets is oO:::J:~2 kiC<I). During candidate pruning, we need to verify that the k- 2 subsets of every candidate k-itemset are frequent. Since the cost for looking up a candidate in a hash tree is O(k), the candidate pruning step requires 0( L~~2 k(k- 2)1Ckl) time.
Support counting Each transaction of length ltl produces (1~1) itemsets of size k. This is also the effective number of hash tree traversals performed for each t ransaction. The cost for support counting is O(N Lk (~)<>k). where w is the maximum transaction width and Ok is the cost for updating the support count of a candidate k-itemset in the hash tree.
6.3 Rule Generation
This section describes how to extract association rules efficiently from a given frequent itemset. Each frequent k-itemset, Y, can produce up to 2k - 2 associa- t ion rules, ignoring rules that have empty antecedents or consequents (0 ~ Y or Y ~ 0). An association rule can be extracted by partitioning the itemset Y into two non-empty subsets, X andY- X , s uch that X ~ Y- X satisfies t he confidence threshold. Note t hat all such rules must have already met the support threshold because they are generated from a frequent iteDlJlet.
350 Chapter 6 Association Analysis
Example 6.2. Let X = {1, 2, 3} be a frequent itemset. There are six candi- date association rules that can be generated from X: { 1, 2} - { 3}, { 1, 3} - {2}, {2,3}- {1}, {1}- {2,3}, {2}- {1,3}, and {3}- {1,2}. As each of their support is identical to the support for X, the rules must satisfy the support threshold. •
Computing the confidence of an association rule does not require additional scans of the transaction data set. Consider the rule {1, 2} __. {3}, which is generated from the frequent itemset X = { 1, 2, 3}. The confidence for this rule is cr( {1, 2,3} )/a({l, 2} ). Because {1, 2, 3} is frequent, the anti-monotone prop- erty of support ensures that { 1. 2} must be frequent, too. Since the support counts for both itemsets were already found during frequent itemset genera- tion, there is no need to read the entire data set again.
6.3.1 Confidence-Based Pruning
Unlike the support measure, confidence does not have any monotone property. For exan1ple, the confidence for X - Y can he larger, smaller, or equal to the confidence for another rule X - Y, where X <;; X and Y <;; Y (see Exercise 3 on page 405). Nevertheless1 if w e co1npare rules generated hom the same frequent itemset Y, the following theorem holds for the confidence measure.
Theorem 6.2. lf a rule X - Y- X does not satisfy the ctmfidence thr-eshold, then any rule X'--.. Y- X', where X' is a subset of X, must not satisfy the confidence thr·eshold as well.
To prove tbis theorem, consider the following two rules: X' - Y- X' and X - Y- X, where X' C X . The confidence of the rules are a(Y)/cr(X') and a(Y)/a(X), respectively. Since X' is a subset of X, a(X') 2: a(X). Therefore, the former rule cannot have a higher confidence than the latter rule.
6 .3 .2 Rule Generation in Apriori Algorithm
The Apriori algorithm uses a level-wise approach for generating association rules, where each level corresponds to the number of items that belong to the rule consequent. Initially, all the high-confidence rules that have only one item in the rule consequent are extracted. These rules are t hen used to generate new candidate rules. For example, if {acd) __, {b) and {abd} __, {c} are high-confidence rules, then the candidate rule {ad} - {be} is generated by merging the consequents of both rules. Figure 6.15 shows a lattice structure for the association rules generated from the frequent itemset {a, b, c, d} . If any node in the lattice has low confidence, then according to Theorem 6.2, the
LCM'~nfidence
Auk!
/, ........ .... ---
f I I I I I I I I I \ \ \ \ I \ \ \
\ ' Pruned ', Rules ',
6 .3 Rule Generation 351
Figure 6.15. Pruning of association rules using the confidence measure.
entire suhgraph spanned by the node can be pruned immediately. Suppose the confidence for {bed} - (a} is low. All the rules containing item a in its consequent, including {cd} - {ab}, {bd} - {ac}, {be} - {ad), and {d) ~ {abc) can be discarded.
A pseudocode for the rule generation step is shown in Algorithms 6.2 and 6.3. Note the similarity between the ap-genrules procedure given in Algo- rithm 6.3 and the frequent itemset generation procedure given in Algorithm 6.1. The only difference is that, in rule generation, we do not have to make additional passes over the data set to compote the confidence of the candidate rules. Instead, w e determine the confidence of each rule by using the support counts computed during frequent itemset generation.
Algorithm 6.2 Rule generation of the A priori algorithm. 1: for each frequent k-itemset fk , k 2: 2 do 2: H, ={iIi E h) {l-item consequents of the rule.} 3: call ap- genrules(J., H..) 4: end for
352 Chapter 6 Association Analysis
Algorithm 6.3 Procedure ap-genrules(fk, Hm)· 1: k = If• I {size of frequent itemset. } 2: m = IHml {size of rule consequent. } 3: if k > m + I then 4: Hm+l = apriori-gen(Hm)· 5: for each hm+l E Hm+l do G: con/= a(fk)ja(J. - hm+t). 7: if con/ ?. minconf then 8: output the rule (J.- hm+t) ~ hm+t· 9: else
10: delete hm+l from Hm+l· 11: end if 12: end for 13: call ap-genrules(/<, H m+t·) 14: end if
6.3.3 An Example: Congressional Voting Records
Thi.'l section demonstrates the results of applying association analysis to the voting records of members of the United States House of Representatives. The data is obtained from the 1984 Congressional Voting Records Database, which is available at the UCI machine learning data repository. Each transaction contains information about the party affiliation for a representative along with his or her voting record on 16 key issueB. There are 435 transactioru; and 34
items in the data set. The set of items a re listed in Table 6.3. The Apriori algorithm is then applied to the data set with minsup = 30%
and minconf = 90%. Some of the hig h-confidence rules extracted by the algorithm are shown in Table 6.4. The first two rules suggest that most of the members who voted yes for aid to El Salvador and no for budget resolution and MX missile are R.epublicaru;; while those who voted no for aid to El Salvador and yes for budget resolution and MX missile are Democrats. These high- confidenc.e rules show the key issues that divide members from both political parties. If minconf is reduced, we may find rules that contain issues t hat cut across the party lines . For example, with m inconf = 40%, the rules suggest that corporation cutbacks is an issue that receives almost equal number of votes from both p arties- 52.3% of the members who voted no are Republicans, while the remaining 47.7% of them who voted no are Democrats.
6.4 Compact Repres entation of Frequent ltemsets 353
Table 6.3. List of binary anoibutes lrom the 1984 United States Congressk>nal Voting Records. Source: The UCI machine learning repository.
I. Republican 2. Democrat 3. handicapped-infants = yes 4. handicapped-infants = no 5. water project cost sharing = yes 6. water project cost sharing = no 7. budget-resolution = yes 8. budget·resolution = no 9. physician fee freeze = yes 10. physician fee freeze = no II. aid to El Salvador = yes 12. a.id to El Salvador = no 13. religious groups in schools = yes 14. religious groups in schools = no 15. a.nti-sateilite test ban = yes 16. anti-satellite test ban = no 17. aid to Nicaragna. = yes
18. aid to Nicaragua = no 19. MX-miss.iie = yes 20. MX-miss.ile = no 21. immigration = yes 22. immigration = no 23. synfuel corporation cutback = yes 24. synfuel corporation cutback = no 25. education spending = yes 26. education spending = no 27. right-to-sue = yes 28. right-to-sue = no 29. C'rime = yes 30. crime = no 31. duty-free-exports = yes 32. duty-free-exports = no 33. export administra.tiou act = yes 34. export administration act = no
Table 6.4. Association rules extracted from the 1984 United States Congressional Voting Records.
Associatiou RulP Confidence {budget resolution = no, MX-missile=no, aid to El Salvador = yes } 91.0%
~ {R~publican} (budget resolution - yes, MJI.-missile-yes, aid to 101 :>alvador - no ) 97.5/',
~ {Democrat} (crime- yes, right-to-sue- yes, physician fee freeze - yes) 93.5%
~ (Republican} {crime - no1 right-to-sue - no, physician fe~ freeze - no} !DO%
~ {DPmocrat}
6.4 Compact Representation of Frequent Itemsets
In practice, the number of frequent itemsets produced from a transaction data set can be very large. It is useful to identify a small representative set of itemsets from which all other frequent itemsets can be d eri ved. Two such representations are presented in t his section in the form of maximal aud closed frequent itemsets.
354 Chapter 6 Association Analysis
0
Infrequent
Figure 6.16. Maximal frequent itemset.
6.4.1 Maximal Frequent lte msets
Frequent ltemSBt Border
Definition 6.3 (Maximal Fre quent Itemset). A maximal frequent item- set is defined as a frequen t itemset for which non e of its immediate snpersets are frequent.
To ill ustra te this concept, consider the itenlSCt lattice shown in Figure 6.16. The itemsets in the lattice are divided into two groups: those that are frequent and those that are infrequent. A frequent itemset border, which is represented by a dashed line, is also illustrated in the diagram. Every itenlSet located above the border is frequent, while those located below t he border (the shaded nodes) are infrequent . Among the itemsets residing near the border, {a, d}, {a, c, e}, and {b, c, d, e } are considered to be maximal frequent itemsets because their inm1ediate supersets are infrequent.. An itemset such as {a, d} is n1a.ximal frequent because all of its immediate supersets, { a ,b,d}, { a,c,d} , and {a,d,e} , nre infrequent. In contrast , {a,c} is non·maximal h ecause one of its immediate s upersets, {a, c, e }, is fre quent .
Maximal frequent itemsets effectively provide a compact representation of frequent itelllSets. In other words, they form the smallest set of itemsets from
6.4 Compact Representation of Frequent ltenlSets 355
which all frequent itemsets can be derived. For example, the frequent itenlSets shown in F igure 6.16 can be divided into two groups:
• Frequent itemsets that begin with item a and that may contain itelllS c, d, or e. This group includes itemsets such as {a}, {a, c}, {a,d}, {a,e}, and {a, c, e}.
• Frequent itemsets t hat begin with items b, c, d, or e. This group includes itelllSets such as {b}, {b,c}, {c,d},{b,c,d,e}, etc.
Frequent itenlSets that belong in the first group are subsets of either {a,c,e} or {a, d} , while those that belong in the second group are subsets of {b, c, d, e }. Hence, the maximal frequent itemsets {a, c, e}, {a, d}, and { b, c, d, e} provide a compact representation of the frequent ite msets shown in Figure 6.16.
Maximal frequent. it.emsets provide a valuable representation for data sets that can produce very long, frequent itemsets, as there are exponentially many frequent itemsets in such data. Nevertheless, this approach is practical only if an efficient algorithm exists to explicitly find the maximal frequent itemsets without having to enumerate all t heir subsets. We briefly describe one such approach in Section 6.5.
Despite providing a compact representation, maximal frequent itenlSets do not contain the support infonnation of their subsets. For example, the support of the maximal frequent itelllSets {a, c,e}, {a,d}, and {b,c,d,e } do not provide any hint about the support of their subsets. An additional pass over t he data set is t herefore needed to determine the support counts of the non-maximal frequent itemsets. In some cases , it might be desirable to have a minimal repr esentation of frequent itemsets that preserves the support infonnation. We illustrate such a representation in the next section.
6.4.2 Closed Frequent Ite mse ts
Closed itemsets provide a minimal representation of itenlSets without losing their support information. A formal definition of a closed itemset is presented below.
D e finition 6 .4 ( C losed ltemset). An it.emset. X is closed if none of its imn1ediate s uperset.s has exactly the san1e snpport count as X.
Put another way, X is not closed if at least one of its immediate s upersets has the same support couut as X. Examples of closed itemsets are shown in Figure 6.17. To bett er illustrate t he support count of each itemset, we have associated each node (itemset) in the lattice with a list of its corresponding
356 Chapter 6 Association Analysis
TID llama f-"=-+~.~bc=-- minsup = 40'Y..
abod
0 Closed Frequent ltemset Figure 6.17. An example of the closed frequent ~emsets (with minimum support count equal to 40%).
transaction IDs. For example, since the node {b,c} is associated with transac- tion IDs 1, 2, and 3, its support count is equal to three. From the transactions given in this diagram, notice that every transaction that contains b also con- tains c. Consequently, the support for { b} is ide ntical to { b, c} and { b} should not be considered a closed itemset. Similarly, since c occurs in every transac- tion that contains hath a and d, the itemset {a, d} is not closed. On the o ther hand, {b, c} is a closed itemset because it does not have the same support count as any of its supersets.
Definition 6.5 (Closed Frequent Itemset), An itemset is a, closed fre.. quent itemset if it is closed and its support is greater than or equal to minsup.
In the previous example, assuming that the support threshold is 40%, {b,c} is a closed frequent itemset because its support is 60%. The rest of the closed frequent i temsets are indicated by the shaded nodes.
Algorithms are available to explicitly extract closed frequent itemsets from a given data set. Interested readers may refer to the bibliographic notes at the end of this chapter for further discussions of these nJgorithms. We can use the closed frequent itemsets to determine t he support counts for the non- closed
6.4 Compact Representation of Frequent ltemsets 357
Algor ithm 6.4 Support counting using closed frequent itemsets. 1: Let C denote the set of closed frequent itemsets 2: Let kr:nu. denote the maximum size of closed frequent itemset.s 3: F•m~ = {II/ E C, 1/1 = km-} {Find all frequent itemsets of size km~·} 4: for k = km~ - I downto I do 5: Fk = {!If c Fk+L• Ill= k} {Find all frequent itemsets of size k.} 6: for each I E Fk do 7: if f ~ C then 8: f.sulJPOrt = me.x{f'.supportlf' E Fk+,, I c /'} 9: end if
10: end for 11: end for
frequent itemsets. For example, consider the frequent itenlSet {a, d} shown in Figure 6.17. Because the itemset is not closed, its support count must be identical to one of its immediate supersets. The key is to determine which superset (among {a, b, d}, {a, c, d}, or {a, d, e }) has exactly the same support cow1t as {a, d}. The A priori principle states that any transaction that contains the superset of {a , d} must also contain {a,d}. However, any transaction that contains {a, d} does not have to contain the supersets of {a,d}. For this reason, the support for {a, d} must be equal to the hugest support among its supersets. Since {a, c, d} has a larger support than both {a, b, d} and {a, d , e}, the support for {a, d} must be identical to the support for {a, c, d}. Using this methodology, an algorithm can b e developed to compute the support for the non-closed frequent itemsets. The pseudocode for this algoritlun is shown in Algorithm 6.4. The a lgorithm proceeds in a specific-to-general fashion, i.e. , from the largest to the smallest frequent itcmsets. This is because, in o rder to find the s upport for a non-closed freqnent itemset, t he support for all of its supersets must be known.
To illustrate the advantage of using closed frequent itemsets, consider the data set shown in Table 6.5, which contains ten transactions and fifteen items. The items can be divided into three groups : (1) Group A, which contains items a 1 through a5; (2) Group B , which contains items b, through b5; and (3) Gronp C, which contains items Ct through cs. Note that items within each group are perfectly associated with eacl1 other a nd they do not appear with items from another group. Ass uming the support threshold is 20%, the total number of frequent itemsets is 3 X (25 - 1) = 93. However, there are only three closed frequent itemsets in the data: ({a,,a2,a3,a4, as}, {bt,b2,b3 , b4,b5}, and {ct, C2,c3 , c.,c5 } ). It is often sufficient to present only the closed frequent itemsets t.o the analysts instead of the entire set of frequent itemsets .
358 Chapter 6 Association Analysis
Table 6.5. A transaction data set for mining closed ~emsets.
TID a, a, a, a, a, b, b, b, b, b, c, ""
c, c, c, 1 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 2 1 1 1 1 1 0 0 0 0 0 0 0 0 0 0 3 1 1 1 1 1 0 0 u 0 0 0 0 0 0 u 4 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 5 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 6 0 0 0 0 0 1 1 1 1 1 0 0 0 0 0 7 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 8 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 9 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1 10 0 0 0 0 0 0 0 0 0 0 1 1 1 1 1
Figure 6.18. Relationships among frequent, maximal frequent, and closed frequent nemsets.
Closed frequent itemse ts are useful for removing some of the redw1dant association rules. An association rule X ---+ Y is rednndant if there e xists another rule X' ___, Y', where X is a subset of X' andY is a subset of Y', such that the support and confidence for both rules are identical. In the example shown in Figure 6.17, {b} is not a closed frequent itemset while {b, c} is closed. The association rule {b} ---> {d, e} is therefore redundant because it has the same support and confidence as { b, c} ---> { d, e}. Such redundaJit rules are not generated if closed frequent itemsets are used for rule generation.
Finally, note that all maximal frequent itemsets are closed because none of the maximal frequent itemsets can have the same support cou.nt as their immediate supersets. The relationships runong frequent, max imal frequent, and closed frequent itemsets are shown in Figure 6.18.
6.5 Alternative l\llethods for Generating Frequent ltemsets 359
6.5 Alternative Methods for Generating Frequent Itemsets
Apriori is one of the earliest algorithms to have successfully addressed the combinatorial e.xplosion of frequent itemset generation. It achieves this by ap- plying the A priori principle to prune the exponential search space. Despite its significant performance improvement, the algorithm still incurs considerable 1/0 overhead since it requires making several passes over the trru1saction data set. In addition, as noted in Section 6.2.5, the performance of the Apriori algorithm may degrade significantly for dense data sets because of the increas- ing width of transactions. Several alternative methods have been developed to overcome these limitations and improve upon the efficiency of the A priori algorithm. The following is a high-level description of these methods.
Traversal of ltemset Lattice A search for frequent itemsets can be con- ceptually viewed as a traversal on the itemset lattice shown in Figure 6.I. T he search strategy employed by an algorithm dictates how the lattice struc- ture is traversed during the frequent itemset generation process. Some search strategies are better than others, depending on the configuration of frequent itemsets in the lattice. An overview of these strategies is presented next.
• General-to-Specific versus Specific-to-General: The Apriori al- gorithm uses a general-to-specific search strategy, where pairs of frequent (k -I )-itemsets are merged to obtain cru1didate k-itemsets. This general- to-specific search strategy is effective, provided the maximum length of a frequent itemset is not too long. The configuration of frequent item- sets that works best with this strategy is shown in Figure 6.19(a) , where the darker nodes r epresent infrequent itmnsets. Alternatively, a specific- to-general search strategy looks for more specific frequent itemsets first, before finding the more general frequent itemset s. This strategy is use- ful to discover maximal frequent itemsets in dense transactions, where the frequent itemset border is located near the bottom of the lattice, as shown in Fignre 6.19(b). The Apriori principle can be applied to prune all subsets of maximal frequent itemset s. Specifica lly, if a candi- date k-itemset is maxima1 frequent , we do not have to exatnine any of its subsets of size k - 1. However , if the candidate k-itemset is infrequent , we need to check all of its k - I subsets in the next iteration. Another approach is to combine both general-to-specific and specific-t o-general search strategies. This bidirectional approach requires more space to
360 Chapter 6 Association Analysis
Frequent ltemset
000'1
! · -~---
(a) Genet"al·tO·specific (b) Specific·tD-genera/
Frequent ltemset null Border'"\ ~ ...,..-,
_--0\ocl oofo--, ,' I ~ I \ I I I : ' I I , ? 0 0/C 10 0 0 '/
I ft ' ' ' ' I ·-~~/' - -'
(c) Bidirectional
Figure 6.19. General·tD-specific, specific·tD-general, and bidirectional search.
store the candidate itemsets, but it can help to rapidly identify the fre- quent itemset border, given the configuration shown in Figure 6.19(c).
• Equivalence Classes: Another way to envision the traversal is to first partition the lattice into disjoint groups of nodes (or equivalence classes). A frequent itemset generation algorithm searches for frequent iternsets within a particular equivalence class first before rnov:ing to another equiv- alence class. As an example, the level-wise strategy used in the A priori algorithm can be considered to be partitioning the lattice on the basis of iternset sizes; i. e. , the algorithm discovers all frequent 1-itemsets first before proceeding to larger-sized itemsets. Equivalence classes can also he defined according to the prefix or suffix labels of an itemset. In this case, two iternsets belong to the same equivalence class if they share a common prefLx or suffix of length k. In the prefix-based approach, the algorithm can search for frequent itemsets starting with the prefix a before looking for those starting with prefixes b, c, and so on. Both prefix-based and suffix-based equivalence classes can be d emonstrated using the tree-like structure shown in Figure 6. 20.
• Breadth-First versus Depth-First: The Aprior-i algorithm traverses the lattice in a breadth-first manner, as s hown in Figure 6.2l(a). It first discovers all the frequent 1-itemsets, followed by the frequent 2-itemsets, and so on, until no new frequent itemsets are gene rated. The itemset
6.5 Alternative Methods for Generating Frequent ltemsets 361
(a) Prefix tree. (b) Suffix tree.
Figure 6.20. EqtJivalence classes based on the prefix and suffix labels of itemsets.
(a) Breadth first
/. /.~j:s~-~~""- 9. 9' 919 9 9 '9 '?''9 ! ! ! 11 ! ! ! ! !
Q, Q 9 :c? <? <? .. 6 .9 .. 6 -- . . .... b 'b'l;/::>'
(b) Depth first
Figure 6.21. Breadth-first and depth-first traversals.
lattice can also be traversed in a depth-first manner, as shown in Figures 6.2l(b) and 6.22. The algorithm can start from, say, node a in Figure 6.22, and count its support to determine whether it is frequent. If so, the algorithm progressively expands the next level of nodes, i.e. , ab, abc, and so on, until an infrequent node is reached , say, abed. It then backtracks to another branch, say, abce, and continues the search from t here.
The depth-first approach is often nsed by algorithms designed to find maximal frequent itemsets. This approach allows the frequent itemset b order to be detected more quickly than using a breadth-first approach. Once a maximal frequent itemset is found, substantial pruning can be
362 Chapter 6 Association Analysis
ab
abc
abed abce abde acde
abcde
--......... ',
/ Cde/"
, _______ ..,..,,,.''
bcde
' I I . : f I I
de/ I
I I
I
Figure 6.22. Generating candidate itemsets using the depth-filS! approach.
performed on its subsets. For example, if the node bcde shown in Figure 6 .22 is ma.ximal frequent, then the algorithm does uot have to visit the subtrees rooted at bd, be, c, d, and e because they will not. contain any maximal frequent itemsets. However, if abc is maximal frequent, only the nodes suel1 as ac and be are not maximal frequent (but the subtrees of ac and be may s till contain maximal frequent iternsets) . The de pth-first approach also allows a different kind of pruning based on the support of itemsets. For example, suppose the support for {a, b, c} is identical to the support for {a, b}. The subtrees rooted at abd and abe can be skipped becalli3e they are guaranteed not to have any maximal frequent itemsets. The proof of t his is left as an exercise to the readers.
Representation of Transaction D a t a Set There are many ways to rep- resent a transaction data set. The choice of representation can affect the I/0 costs incurred wheu computing the support of candidate itemsets. Figure 6.23 shows two differ ent ways of representing market basket transactions . The rep- resentation on the left is called a horizontal data layout, whim is adopted by many association rule mining algorithms, including A priori. Another pos- sibility is to store the list of transaction identifiers (TID-list) associated with each item. Such a representation is known as t he vertical data layout.. The support for eael1 candidate itemse t is obtained by intersecting the TID-lists of its subset items. The length of the TID- lists s hrinks as we progress to larger
Horizontal Data Layout
TID Items 1 a,b,e 2 b,c,d 3 c,e 4 a,c,d 5 a,b,c,d 6 a,e 7 a,b 8 a,b,c 9 a ,c,d 10 b
6.6 FP-Growth Algorithm 363
Vertical Data Layout
a b c d e 1 1 2 2 1 4 2 3 4 3 5 5 4 5 6 6 7 8 9 7 8 9 8 10
9
Figure 6.23. Horizontal and vertical data format.
sized itemsets. However, one problem with this approach is that the initial set of TID-lists may be too large to fit into main memory, thU13 requiring more sophisticated teclmiques to compress the TID-lists. We describe another effective approach to represent the data in the next section.
6.6 FP-Growth Algorithm
T his section presents an alternative algorithm called FP-growt h that takes a radically different approach to discovering frequent itemsets. The algorithm does not subscribe to the generate-and-test paradigm of Apriori. Instead, it encodes the data set U13ing a compact data structure called an FP- tree and extracts frequent itemsets directly from this structure. The d etails of this approach are presented next .
6.6.1 FP- Tree Representation
An FP-tree is a compressed representation of the input data. It is constructed by reading the data set one transaction at a time and rnappin g each transaction onto a path in the FP-tree. As different transactions can have several items in common, their paths may overlap. The more the paths overlap with one another, the rnore compression we can achieve usiug the FP- tree structure. If the size of the FP-tree is small enough to fit into main memory, this will a llow us to extract frequent itemsets directly from the structure in memory instead of making repeated passes over the data stored on disk.
364 Chapter 6 Association Analysis
Transaction Data Set
TID Items 1 {a,b} 2 .Jb.c.d}_ 3 {a.c,d,e} 4 _ja,d.~ 5 {a,b,c} 6 {a,b,c,d} 7 {a} 8 {a,b,c} 9 {a,b,d} 10 {b,c,e}
:;t a b:1
(i) Aller reading TID=1
b:1
e:1
a
b:1 1
d:1 (ii) After reading TID=2
d:1
(Iii) Aller reading TID=3
e:1
(iv) After reading TID=10
Figure 6.24. Construction of an FP·tree.
Figure 6.24 shows a data set that contains ten transactions and five iterus.
The structures of the FP-tree after reading the first three transactions are also depicted in the diagram. Each node in the tree contains the label of an item along with a counter that shows the number of transactions mapped onto the given path. Initially, the FP-tree contains only the root node represented by the null symbol. The FP- tree is subsequently extended in the following way:
1. The data set is scanned once to determine the support count of each item. Infrequent items are discarded. while the frequent ite ms are sorted in d ecreasing support counts. For the data set shown in Figure 6.24, a is the most frequent item , followed by b, c, d, and e.
6.6 FP-Growth Algorithm 365
2. The algorithm makes a second pass over the data to construct the FP- tree. After reading the first transaction, (a, b), the nodes labeled as a and b are created. A path is then formed from null ~ a ~ b to encode the traru;action. Every node along the path has a frequency count of 1.
3. After :reading the second transaction, { b,c,d}, a new set of nodes is cre- ated for items b, c. and d. A path is then formed to represent the transaction by connecting the nodes null _, b _, c _, d. Every node along this path also has a frequency count equal to one. Although the first two transactions have an item in common, which is b, their paths are disjoint because the transactions do not share a common prefix.
4. The third transaction, { a,c,d ,e}, shares a common prefix item (which is a) with the first transaction. As a result, the path for the third transaction, null ~ a ~ c ~ d ~ e, overlaps with the path for the first transaction, null ~ a ~ b. Because of their overlapping path, the frequency count for node a is incremented to two, wbile the frequency counts for the newly created nodes, c, d, and e, are equal to one.
5. This process continues until every transaction has been mapped onto one of the paths given in the FP-tree. The resulting FP-tree after reading all the transactions is shown at the bottom of Figure 6.24 .
The size of an FP-tree is typically smaller than the size of the uncompressed data because many transactions in market basket data often share a few items in common. In the best-cru;e scenario, where all the transactions have the same set of items, the FP-tree contains only a single branch of nodes. The worst-case scenario happens when every transaction ha.s a unique set of items. As none of t he transactions have any items in common, the size of t he FP-tree is effectively the same as the size of the original data. However, the physical storage requirement for the FP-tree is higher because it requires additional space to store pointers between nodes and counters for each item.
T he s ize of an FP-tree also d epends on how the items are ordered. If the ordering scheme in the pre<:eding example is reversed. i.e., from lowest to highest snpport item, the resulting FP-tree is shown in Figure 6. 25. The tree appears to be denser because the branching factor at the root node has increased from 2 to 5 and the number of nodes con taining the high snpport items such as a and b has increased from 3 to 12. Nevertheless. ordering by decreasing support counts does not always lead to the smallest tree. For example, suppose we augment the data set given in Figure 6.24 with 100 transactions that contain {e }, 80 transactions that contain (d}, 60 transactions
366 Chapter 6 Association Analysis
null
a:1
Figure 6.25. An FP-tree representation for the data set shown in Figure 6.24 w~h a difilrent item ordering scheme.
that contain {c}, and 40 transactions that contain {b}. Item e is now most frequent, followed by d, c, b, and a. With the augmented transactions , ordering hy decreasing support counts will result in an FP-tree similar to Figure 6.25, while a scheme bMed on increMing support counts produces a smaller FP-tree similar to Figure 6.24(iv).
An FP-tree also contains a list of pointers connecting between nodes that have the same items. The6e pointers) represented as dashed lines in Figures 6.24 and 6.25, help to facilitate the rapid access of individual items in the tree. We explain how to use the FP-tree and its corresponding pointers for frequent itemset generation in the next section.
6.6.2 Frequent Itemset Generation in FP-Growth Algorithm
FP-growth is an algorithm that generates frequent itemsets from an FP-tree by exploring the tree in a bottom-up fashion. Given the example tree shown in Figure 6.24, the algorithm loo ks for frequent itemsets ending in e first, followed by d, c, b, and finally, a. This bottom-up strategy for finding frequent item- sets ending with a particular item is equivalent to the suffix-based approach described in Section 6.5. Since every transaction is mapped onto a path in the FP-tree, we can derive the frequent itemsets ending with a particular item, say. e. by examining only the paths containing node e . These paths can be accessed rapidly using the pointers associated with node e. The extracted paths are shown in Figure 6.26(a). The details on how to process the paths to obtain frequent itemsets will be explaine d later.
6.6 FP-Growth Algorithm 367
(a) Paths containing node e
null
,,··0·:, c:3t:,f;-.b
c:3
d:1
null
a:aA b/~2 b:5
c:2
d:1
(b) Paths containing node d
null
~ a :e
(c) Paths containing node c (d) Paths containing node b (e) Paths containing node a
Figure6.26. Decomposing the frequent itemset generation problem into multiple subproblems, where each subproblem invoi\OI!s finding frequent hemsets ending in e, d, c, b, and a.
Table 6.6. The list ol frequent itemsets ordered t7f their corresponding suffixes.
Suffix Frequent Itemsets e {e }. {d,e} , {a,d,e}, {c,e},{a,e} d {d}, {c,d}, {b,c,d}, {a,c,d}, {b,d}, {a,b,d}, {a,d} c {c) , (b,c} , {a,b,c}, {a,c} b {b}, {a.b} a {a}
After finding the freqnent itemsets ending in e, the algorithm proceeds to look for frequent itemsets ending in d hy processing the paths associated with node d. The corresponding paths are shown in Figure 6.26(b). This process cont inues until all the paths associated with nodes c, b, and finally a, are processed. Tbe paths for these items are shown in Figures 6.26(c), (d) , and (e), while their corresponding frequent itemsets are summarized in Table 6.6.
FP-growth finds all the frequent itemsets ending with a particular suffix by emplo)~ng a divide-and-conquer strategy to split the problem into smaller subproblems. For example, suppose we are interested in finding all frequent
368 Chapter 6 Association Analysis
c~ 1
:::2 d:1
a:1 e. .
(a) Prefix paths ending in e
c:1a:~null dlb_--1,,
(c) Prefix paths ending in de
a·?~ c:t Z----~ c:f
(e) Prefix paths ending in ce
d:1 d:1
(b) Conditional FP-tree fore
null I a:2
(d) Conditional FP-tree for de
nun I a:2
(f) Prefix paths ending in ae
Figure 6.'lf. Example of applying the FP-growth algorithm to find frequent ijemsets ending in e.
itemsets ending in e. To do this, we must first check whether the itemset { e} itself is frequ.-nt. If it is frequent, we consider the subprobl.-m of finding frequent itemsets ending in de, followed by ce, be, and ae. In turn, each of these subproblems are further decomposed into smaller subproblems. By merging the solutions obtained from the subproblems, all the frequent itemsets ending in e can be found. This divide-and-conquer approach is the key strategy employed by the FP-growth algorithm.
For a more concrete example on how to solve the subproblems, consid.-r the task of finding frequent itemsets ending with e.
I. The first step is to gather a ll the paths containing node e. T hese initial paths are called prefix paths and are shown in Figure 6.27(a) .
2. From the prefix paths shown in Figure 6.27(a), the support count fore is obtained by adding the support counts associated with node e. Assuming that the minimum support count is 2, {e } is declared a frequent itemset because its support count is 3.
6.6 FP-Growth Algorithm 369
3. Because { e} is frequent, the algorithm has to solve the subproblems of finding frequent ite!D.5ets ending in de, ce, be, and ae. Before solving these subproblems, it must first convert the prefix paths into a con- ditional FP-tree, which is structurally similar to an FP-tree, except it is used to find frequent itemsets ending with a particular suffi.x. A conditional FP-tree is obtained in the following way:
(a) First, the support counts along the prefix paths must be updated because son1e of the counts include transactions that do not contain item e . For example, the rightmost path shown in Figure 6.27(a) , null ~ b: 2 ~ c: 2 ~ e: 1, includes a transaction { b, c} that does not contain item e. Tbe counts along the prefix path must therefore be adjusted to I to reflect the actual number of transac- tions containing { b, c, e) .
(b) The prefix paths are truncated by removing the nodes for e. These nodes can be Temoved becalffie the support counts along the prefix paths have been updated to reflect only transactions that contain e and the subproblems of finding frequent itemsets ending iu de, ce, be. and ae no longer need information about node e .
(c) After updating the support counts along the prefix paths, some of the items may no longer be frequent. For example, the node b appears only once and has a support count equal to I, which means that there is only one transaction that contains both band e. Item b can be safely ignored from subsequent analysis because all itemsets ending in be must be infrequent.
The conditional FP-tree fore is shown in Figure 6.27(b). The tree looks different than the original prefix paths because the freqnency counts have be.-n updated a nd th.- nodes b and e have bren eliminated.
4. FP-growth uses the conditional FP-tree fore to solve the snbproblems of finding frequent itemsets ending in de , ce, and ae. To find the frequent ite!D.5ets ending in de, the prefix paths for d a re gathered from the con- ditional FP-tree for e (Figure 6.27(c)). By adding the frequency counts associated with node d~ we obtain the support count for { d, e_}. Since the support count is equal to 2, {d. e} is declared a frequent itemset. Next, the algorithm constructs the conditional FP-tree for de using the approach described in step 3. After updating the support counts and removing the infreque nt item c, the conditional FP-tree for de is shown in Figure 6.27(d). Since the conditional FP- tree contains only one item,
370 Chapter 6 Association Analysis
a, whose support is equal to minsup. the algorithm extracts the fre- quent iternset {a, d, e} and moves on to the next subproblem, which is to generate frequent i temsets ending in ce. After processing the prefix paths for c, only {c, e} is found to be frequent. The algorithm proceeds to solve the next subprogram and found {a, e} to he the only frequent iternset remaining.
This example illustrates the divide-and-conquer approach used in the FP- growth algorithm. At each recursive step, a conditional FP-tree is constructed by updating the frequency counts along the prefix paths and removing all infrequent items. Because the subproblems are disjoint, FP-growth will not generate any duplicate itemsets. In addition, the counts associated with the nodes allow the algorithm to perform support counting while generating the common suffix itemset s.
FP-growth is an interesting algorithm because it illustrates how a compact representation of the transaction data set helps to efficiently generate frequent iternsets. In addition, for certain transaction data sets. FP-growth outperforms the standard A priori algorithm by several orders of rnagnitnde. The run-time performance of FP-growth depends on t he compaction factor of the data set. If the resulting conditional FP-trees are very bushy (in the worst case, a full prefix tree) , then the performance of the algorithm degrades significantly because it has to generate a large number of subproblems and merge the results returned by each subproblem.
6. 7 Evaluation of Association Patterns
Association analysis algorithms have the potential to generate a large number of patterns. For example, although the data set shown in Table 6.1 contains only six items, it can produce up to hundreds of association rules at certain support and confidence thresholds. As the size and dimensionality of real commercial databases can be very large, we could easily end up with thousands or even millions of patterns, many of which might not be interesting. Sifting through the patterns to ident ify the most interesting ones is not a trivial task because ''one person 's trash might be another person's treasure." It is therefore
important to establish a set of well-accepted criteria for evaluating the quality of association patterns.
The first set of c riteria can be established through statistical arguments. Patterns that involve a set of mutually independent items or cover very few transactions are considered uninteresting b ecause they may capture s purious relationships in the data. Such patterns can b e eliminated by applying an
6.7 Evaluation of Association Patterns 371
objective interestingness measure that uses statistics de rived from data to determine whether a pattern is interesting. Examples of objective interest- ingness measures include support. confidence, and correlation.
The second set of criteria can be established through subjective arguments. A pattern is considered subjectively uninteresting unless it reveals unexpected information about the data or provides useful knowledge that can lead to profitable actions. For example, the rule {Butter} ~ {Bread} may not be interesting. despite having high support and confidence values, because the relationship represented by the rule may seem r a ther obvious. On the other hand, the rule {Diape·rs} ~{Bee!'} is interesting because the relationship is quite unexpected and may suggest a new cross-selling opportunity for retailers. Incorporating subjective knowledge into pattern evaluation is a difficult task because it requires a considerable amount of prior information from the domain experts.
The following a re 5ome of the approaches for incorporating subjective knowledge into the pattern discovery task.
Visualization This approach requires a user-friendly environment to keep
the human user in the loop. It also allows the domain experts to interact with t he data mining system by interpreting and verifying the discovered patterns.
Template-based approach This approach allows the users to constrain the type of patterns extracted by the mining algorithm. Instead of reporting all the extracted rules, only rules that satisfy a use r-specified template are returned to the users.
Subjective interestingness measure A subjective measure can be defined based on domain informat ion such as concept hierarchy (to be discussed in Section 7.3) or profit margin of items. The measure can then be used to filter patterns that are obvious and non-actionable.
Readers interested in subjective interestingness measures may refer to re- sources listed in the bibliography at the end of this chapter.
6.7.1 Objective Measures of Interestingness
An objective m easure is a data-driven approach for evaluating the quality of association patterns. It is domain-independent and requires minimal in- put from the users , other than to specify a threshold for filtering low-quality patterns. An objective measure is usnally computed based on the frequency
372 Chapter 6 Association Analysis
Table6.7. A 2-waycontingencytableforvariables A and B.
B B
A fu f,. fl+
A fo1 foo fo +
f+l f +o N
counts tabulated in a contingency table. Table 6. 7 shows an example of a contingency table for a pair of binary variables, A and B. We use the notation A (B) to indicate that A (B) is absent from a trarumction. Eacb entry /;j in this 2 x 2 table denotes a frequency count. For example, fu is the number of times A and B appear together in the same transaction, wh.ile fo1 is the num- ber of transactions that contain B but not A. The row sum /1+ represents the support count for A, wh.ile the column sum fH r epresents the support count for B . Finally, even though our discussion focuses mainly on asymmet- ric binary variables, note that contingency tables are also applicable to other attribute types such as symmetric binary, nominal, and ordinal variables.
Limitations of the Support-Confidence Framework Existing associa- tion rule mining formulation relies on the support and confidence measures to eliminate uninteresting patterns. The drawback of support wos previously de- scribed in Section 6.8, in wh.icb many potentially interesting patterns involving low support items might be eliminated by the support threshold. The draw- back of confidence is more subtle and is best demonstrated with the following example.
Example 6.3. Suppose we are interested in analyzing the relat ionship be- tween people who drink tea and coffee. We may gather information about the beverage preferences among a group of people a nd summarize their responses into a table such as the one shown in Table 6.8.
Table 6.8. Beverage plllferences among a group of 1000 people.
Coffee COJTe€ Tea 150 50 200
Tea 650 150 800
800 200 1000
6.7 Evaluation of Association Patterns 373
The information given in this table can be used to evaluate the association rule (Tea}~ (Coffe e}. At first glance, it may appear that people who drink tea also tend to drink coffee because the rule's support (15%} and confidence (75%) value.<J are reasonably h.igh. Th.is argument would have been acceptable except that the fraction of people who drink coffee, regardless of whether they drink tea, is 80%, wh.ile the fraction of tea drinkers who drink coffee is only 75%. Thus knowing that a person is a tea drinker actually decreases her probability of being a coffee drinker from 80% to 75%! The rule {Tea} ~ {Coffee} is therefore misleading despite its high oonfidence valne. •
The pitfall of confidence can be traced to the fact that the measure ignores the support of the itemset in the rule consequent. Indeed, if the support of coffee drinkers is taken into account, we would not be surprised to find that many of the people who drink tea also drink coffee. What is more surprising is that the fraction of tea drinkers who drink coffee is actually less than the overall fraction of p eople who drink coffee, which points to an inverse relationshlp between tea drinkers and coffee drinkers.
Because of the limitations in the support-confidence framework, various objective measures have been used to evaluate the quality of association pat- terns. Below, we provide a brief description of these measures and explain some of their strengths and limitations.
Interest Factor The t ea-coffee example shows that high-confidence rules can sometimes be misleading because the confidence measure ignores the sup- port of the itemset appearing in the rule consequent. One way to address this problem is by applying a metric known as lift:
L'ft = c(A ~ B) ' s(B) '
(6.4}
which computes the ratio between the rule's confidence and the support of the itemset in the rule consequent. For binary variables, lift is equivalent to another objective measure called interest factor, which is defined as follows:
s(A,B) I (A.B) = s(A) x s(B)
Nfu
h+f+t' (6.5}
Interest factor compares the frequency of a pattern against a baseline fre- quency computed under the statistical independence assumption. The baseline frequency for a pair of mutually independent variables is
(6.6}
37 4 Chapter 6 Association Analysis
Table 6.9. Contingency tables for the word pairs ({p,q} and { r,s }.
p p ,. r q 880 50 930 8 20 50 70
q 50 20 70 s 50 880 930
930 70 1000 70 930 1000
This equation follows from the standard approach of using simple fractions as estimates for probabilities. The fraction fu/N is an estimate for tbe joint probability P(A, B), while f1+/N and f+tfN are the estimates for P(A) and P(B), respectively. If A and Bare statistically independent, then P(A , B) = P(A) x P(B), thus leading to the formula shown in Equation 6.6. Using Equations 6.5 and 6.6, we can interpret tbe measure as follows :
{
= 1. if A and B are independent; I(A. B) > 1. if A and B are positively correlated;
< 1. if A and B are negatively correlated. (6.7)
For tbe tea-coffee example shown in Table 6.8, I = 0_g-~g.B = 0.9375, thns sug- gesting a slight negative c.orrelation between tea drinkers and coffee drinkers.
Limitations of Interest Factor We illustrate the limitation of interest factor with an example from tbe text mining domain. In the text domain, it is reasonable to assume that the association between a pair of words depends on the number of documents that contain both words. For example, because of their stronger association, we expect. the words data and mining to appear together more frequently than the words compiler and mining in a collection of computer science articles.
Table 6. 9 sbows the frequency of occurrences between two pairs of words, {p , q) and {r, s). Using tbe formula given in Equation 6.5, the interest factor for {p, q} is 1.02 and for {r. s} is 4.08. These results are somewhat troubling for the following reasons. Although p and q appear together in 88% of the documents, their interest factor is close to 1, which is the value when p and g are statistically independent. On tbe other hand, the interest factor for {r, s} is hlgher than (p, q} even t hough r and s seldom appear together in the same document. Confidence is perhaps the better choice in this sitnation because it considers the association between p and q (94.6%) to be much stronger than tha t between rand s (28.6%).
6.7 Evaluation of Association Patterns 375
Correlation Analysis Correlation analysis is a statistical-based technique for analyzing relationshlps between a pair of variables. For continuous vari- ables, correlation is defined using Pearson's correlation coefficient (see Equa- tion 2.10 on page 77). For binary variables, correlation can be measured using the 4>-coefficient, which is defined as
¢ = fufoo- fodw V' fi+hdo+f+O
(6.8}
The value of correlation ranges from - 1 (perfect negative correlation) to + 1 (perfect positive correlation). If the variables are statistically independent, then ¢ = 0. For example, the correlation between the tea and coffee drinkers given in Table 6.8 is -0.0625.
Limitations of Correlation Analysis The drawback of using correlation can be seen from the word association example given in Table 6.9. Althongh the words p and q appear together more often than r· and s, tbeir 4>-coefficients are identical, i.e., <f>(p, q) = <f>(r. s) = 0.232. Thls is because the </>-coefficient gives equal importance to both co-presence and co-absenoe of items in a trans- action. It is therefore more suitable for analyzing symmetric binary variables. Another limitation of this measure is that it does not remain invariant when t here are proportional changes to the sample size. This issue will be discussed in greater detail when we describe the properties of objective measures on page 377.
IS Measure IS is an alternative measure that has been proposed for han- dling asymmetric binary variables. The measure is defined as follows:
s(A , B) IS(A,B) = y'I(A,B) x s(A,B) = ~
ys(A)s(B) (6.9)
Note that IS is large when the interest factor and support of the pattern are large. For example, the value of IS for the word p airs {p, g) and {r, s) shown in Table 6.9 are 0.946 and 0.286, respectively. Contrary to the results given by interest factor and the <f>-coefficient, the IS measme suggests that the association between {p,g} is stronger than {r,s}, which agrees with what we expect from word associations in documents.
It is possible to show that IS is mathematically equivalent to the cosine measure for binary variables (see Equation 2.7 on page 75). In this regard, we
376 Chapter 6 Association Analysis
Table 6.10. Example of a contingency table for items p and q.
q q
p 800 100 900
p 100 0 100
900 100 1000
consider A and B as a pair of bit vectors, A • B = s(A, B) the dot product between the vectors, and IA I = yfs{A) the magnitude of vector A. Therefore:
s(A.B) A•B . IS( A. B)= = -I A I IBI = cosme(A, B).
y's(A) x s(B) x (6.10)
The IS measure can also be expressed as the geometric meau between the confidence of association rules extracted from a pair of binary variables:
IS(A,B) = s(A, B ) x s(A , B) = y'c(A ~B) x c(B ~A). s(A) s(B)
(6.11)
Because the geometric mean between any two numbers is always closer to the smaller number, the IS value of an itemset {p, q} is low whenever one of its rules, p ___, q or q - p, bas low confide nce.
Limitations of IS Measure TheIS value for a pair of independent item- sets, A and B, is
IS (A B)= s(A.B) = s(A) x s(B) = y's(A) X s(B). mdep ' y' s(A) X s(B) y' s(A) X s(B)
Since the value depends on s(A) and s(B), IS shares a similar p robletn as the confidence measure-that the value of the measure can be quite large, even for uncorrelat ed and negatively correlated patterns. For example, despite the large IS value between items p and q given in Table 6.10 (0.889), it is still less than the expected value when the items are statistically independent (IS;ndep = 0.9) .
6. 7 Evaluation of Association Patterns 377
Alternative Objective Interestingness Measures
Besides the measures we have described so far, there are other alternative mea- sures proposed for analyzing relationships between pairs of binary variables. These measures can be divided into two cate.gories, symmetric and asym- metric measures. A measure M is symmetric if M(A ~ B)= M(B ~ A). For example
1 interest factor is a symmetric measure because its value is iden-
tical for the rules A ~ B and B ~ A. In coutrast, confidence is an asymmetric measure since the confidence for A ~ B and B ~ A may not be the same. Symmetric measures are generally U6ed for e valuating itemsets, while asymmetric measures are more suitable for analyzing association rules. Tables 6. 11 and 6.12 provide the definitions for some of these measures in terms of the frequency counts of a 2 x 2 contingency table.
Consistency among Objective Measures
Given the wide variety of measures available, it is reasonable to question whether the measures can produce similar ordering results when applied to a set of association patterns. If the measures are consistent, then we can choose any one of them as our evalnation metric. Otherwise, it is important to understand what their differences are in order to determine which measure iB more suitable for analyzing certain types of patterns.
Table 6.11. Examples of symmetric objective measures lor the itemset {A, B}.
Measure (Symbol) Definition
Correlatiou ( oi>) Nfn-!I±f..±l J!t+ IHio+l+o
Odds ratio (a) (/11/oo) / (/10/ot) Kapp"-(K) Nfu +N l oo - !1±1+1 - lo+ i+o N2 h+f+l lo+i+o Interest (/) (N /H)/ {ft+f+t)
Cosine (IS) (!11)/( y' /t+/+t) Piatetsky-Shapiro (PS) J.;;- - 11tf,jl Collective strength ( S) £u+£oo /t+ f+t + /o+]+o X N-~+ ~~-}~;i+o
Jaccard (() fll/(ft+ + f +l - fH) All-confidence (h) ntin [f.'-, k-J
378 Chapter 6 Associatio n Analysis
Table 6.12. Examples of asymmetric objectille measu"'s for the rule A -. B.
Measure (Symbol) Definition
Goodman·Kruskal (A) ( E; nl!I.Xk !;k- maxkf+•)/(N- ma..xk f+.) Mutual Information (AI) (E, E; 1/ log r:1!,)/(- E, J;r log l;r) J.Meosure (J) 1'-log 1~7!, + fllog 1~/J!, Gini index (G) 41- X (-k!:-J' + (f:;J'J- (.W)'
+ l!ft- X ((i;})' + (~)')- (W.J' Laplace (L) (fu + 1)/(/•+ + 2) Conviction (V) (/t+f+o)/(N fw) Certainty factor (F) (~ - Wl/(1 - Wl Added Value (AV) 1:'---.W
Table 6.13. Example of conlingency !abies.
Example fa fw !01 /oo E, 8123 83 424 1370 E, 8330 2 622 1046 E, 3954 3080 5 2961 E, 2886 1363 1320 4431 Es 1500 2000 500 6000 E• 4000 2000 1000 3000 E, 9481 298 127 94 Ea 4000 2000 2000 2000 E, 7450 2483 4 63 Ew 61 2483 4 7452
Suppose the symmetric and asymmetric measures are applied to rank the ten contingency tables shown in Table 6.13. These contingency t ables are cho- sen to illustrate the differences among the existing measures. The ordering produced by these measures are shown in Tables 6.14 and 6.15, respectively (with l as the most interesting and 10 as the least inte resting table) . Although some of the measures appear to be consistent with each other, there are certain measures t hat produce q uite different ordering results. For example. the rank- ings given by the ¢-coefficient agree with those provided by " and collecti ve strength. but are somewhat different than the rankings produced by interest
6. 7 Evaluation of Association Patterns 379
Table 6.14. Ran kings of contingency tables usjng the symmetlic measures given in Tal:le 6.11.
</> (} " I IS PS s ( h E, 1 3 1 6 2 2 1 2 2 E, 2 1 2 7 3 5 2 3 3 Ea 3 2 4 4 5 I 3 6 8 E, 4 8 3 3 7 3 4 7 5 Es 5 7 6 2 9 6 6 g 9 E• 6 9 5 5 6 4 5 5 7 E1 7 6 7 9 1 8 7 1 1 Ea 8 10 8 8 8 7 8 8 7 E, g 4 9 10 4 g 9 4 4 Ew 10 5 10 I 10 10 10 10 10
Table 6.15. Rankings of contingency tables using the asymmetric measures given in Table 6.12.
;. M J G L v F AV J<:, 1 1 1 1 4 2 2 5 E, 2 2 2 3 5 1 1 6 E, 5 3 5 2 2 6 6 4 E, 4 6 3 4 9 3 3 l Es 9 7 4 6 8 5 5 2 Es 3 8 6 5 7 4 4 3 E1 7 5 9 8 3 7 7 9 Ea 8 9 7 7 10 8 8 7 Eo 6 4 10 g 1 9 9 10 E,o 10 10 8 10 6 10 10 8
factor and odds ratio. Furthermore, a contingency table such as E10 is ranked lowest according to the .;i-coefficient, but high est according to interest factor.
Properties of Objective M easures
The results shown in Table 6.14 suggest that a signiJicant number of the mea- sure5 piUvide con.Oicting information about the quality of a pattern. To under- stand their differences, we need to examine the properties of these m easures.
Inversion Property C<>nsider the bit vectors shown in Figure 6.28. The 0/1 bit in each column vector indicates whether a transaction (row) contains a particular item (column). For example, the vector A indicates that item a
380 Chapter 6 Association Analysis
A B c 0 E F 1 0 a 1 a 0 0 0 1 1 1 0 0 0 1 1 1 0 0 0 1 1 1 0 0 1 1 a 1 1 0 0 1 1 1 0 0 0 1 1 1 0 0 0 1 1 0 0 0 1 1 0 1 0 0 1 0 0
(a) (b) (c)
Figure6.28. Effect of the inversion operation. The vectors C and E are inversions of vector A, while the vector D is an inversion of vect0l5 B and F.
belongs to the first and last transactions, whereas the vector B indicates that item b is contained only in the fifth transaction. The vectors C and E are in fact related to the vector A - their bits have been inverted from D's (absence) to 1 's (presence), and vice versa. Similarly, Dis related to vectors Band F by inverting their bits. The process of flipping a bit vector is called inversion. If a measure is invariant under the inversion operation. then its value for the vector pair (C, D) should be identical to its value for (A, B). The inversion property of a measure can be tested as follows.
Definition 6.6 (Inversion Property). An objective measure M is invariant under the inversion operation if its value remains the same when exchanging the frequency counts !11 with foo and fw with fot·
Among the rnea.sures that remain invariant under this operatiou iuclude the <J).-coefficient, odds ratio, K , and collective strength. These measures may not be suitable for analyzing a.symmetric binary data. For example, the <!>- coefficient between C and D is identical to the .;{>.coefficient between A and B, even though items c and d appear together more frequently than a and b. Furthermore, the .;{>.coefficient between C and D is less than that between E and F even though items e and f appear together only once! We had previously raised this issue when discussing the limitations of the <f>.coefficieut ou page 375. For asymmetric binary data, measures that do not remain invariant unde r the inversion operation are pre ferred. Some of the non-invariant measures include interest factor, IS, PS, and the Jaccard coefficient.
6.7 Evaluation of Association Patterns 381
Null Addition Property Suppose we are interested in analyzing the re- lationship between a pair of words, such as data and mining, in a set of documents. If a collection of articles about ice fishing is added to the data set, should the association between data and mining be affected? This process of adding unrelated data (in this case, documents) to a given data set is known as the null addition operation.
Definition 6.7 (Null Addition Property). An objective measure M is invariant under the null addition operation if it is not affected by increasing foo, while all other frequencies in the contingency table stay the same.
For applications such as document analysis or market basket analysis, the measure is expected to remain invariant under the null addition operation. Otherwise, the relationship between words may disappear simply by adding enough documents that do not contain both words! Examples of measures that satisfy this property include cosine (IS) and Jaccard (€) measures, while those that violate this property include interest factor, P S, odds ratio, and the .;{>.coefficient.
Scaling Property Table 6.16 shows the contingency tables for gender and the grades achieved by students enrolled in a particular course in 1993 and 2004. The data in these tables showed that the number of male students has doubled since 1993, while the number of female students has increased by a factor of 3. However, the male students in 2004 are not performing any better than those in 1993 because the ratio of male students who achieve a high grru:le to those who achieve a low grru:le is still the same, i.e., 3:4. Similarly, the female students in 2004 are performing no better than those in 1993. The association between grade and gender is expected to remain unchanged despite changes in the sampling distribution.
Table6.16. The gradla-genderexarnpla.
High Low
Male 30 40 70
Female 20 50 10 50 30 100
(a) Sample data from 1993.
High Low
Male 60 80 140
Female 60 120 30 110 90 230
(b) Sample data. from 2004.
382 Chapter 6 Association Analysis
Table 6.17. Properties of symmetric measures.
Symbol Measure Inversion Null Addition Scaling
4> ¢-coefficient Yes No No a odds ratio Yes No Yes
" Cohen's Yes No No I Interest No No No IS Cosine No Yes No PS Piatetsky-Shapiro's Yes No No s Collective strength Yes No No ( Jaccard No Yes No h All-confidence No No No s Support No No No
Definition 6.8 (Scaling Invariauce Property). An objective measure AI is invariant under the row/column scaling operation if M(T) = M(T'), where T is a contingency table with frequency counts [fu; ho; fo1; foo], T' is a contingency table with scaled frequency counts [k,kJ!n: k2k3fw; k,k.fol: k2k~foo], and kt, k2, k3. k4 are positive constantes.
From Table 6.17, notice that only the odds ratio (a) is invariant under the row and column scaling operations. All other measures such as the </>- coefficient, 1<, IS, interest factor, and collective strength (S) change their val- ues when the rows and colunms of the contingency table are rescaled. Although we do not discuss the properties of asymmetric measures (such as confidence~
J-measure, Gini index, and conviction), it is clear that s uch measures do not preserve their values under invension and row /column scaling operations, but are iuvariant under the uull addition operation.
6.7.2 Measures beyond Pairs of Binary Variables
The measures shown in Tables 6.11 and 6.12 are d efined for pairs of binary vari- ableB (e.g., 2- ite msets or association rules). However, many of them, such as support a nd aU-confidence, are a lso applicable to larger-sized itemsets. Other measures, such a.s interest factor, IS, PS, and Jaccard coefficient, can be ex- tended to more than two variables using the frequency tables tabulated in a multidimensional contingency table. An example of a three-dimensional con- tingency table for a, b, a nd c is s hown in Table 6.18. Each entry f ijk in thiB table repreBents the number o f traru;actions that contain a particular combi- nation of items a, b, a nd c. For example, fto1 is the nwnber of transactions that contain a and c, but not b. On the other hand, a marginal frequency
6.7 Evaluation of Association Patterns 383
Table 6.18. Example of a thre&-dimensional contingency table.
c b b c b b
a hu ho1 fi+t a !no fwo fi+o
a fou foo1 fo+I a fo10 fooo fo+o
f +ll ho1 h+I hiD hoo h+O
such as f1+1 is the number of transactions that contain a and c, irrespective of whether b is present in the transaction.
Given a k-itemset {it. i2, ... , ik}, the condition for statistical independence can be stated as follows:
(6.12)
With this definition, we can extend objective measures such as interest factor and P S, which are based on deviations from statistical independence, to more than two variables:
I = /;1+ .. + X f+i 2 ... + X ··· X f++ ... i.
PS = /;t;, ... i . _ fit+·. + X f +i, ... + X ··· X f++ .. i>
N Nk
Another approach is to define t he objective measure as the maximum, min- imum, or average value for the associations between pairs of items in a pat- tern. For example, given a k-itemset X = { i, i2, . . . , ik} , we may define the </>-coefficient for X as the average ¢-coefficient between every pair of items (ip, ·iq) .in X. However, because the measure considers only pairwise associa- tions, it may uot capture a ll the underly ing relationships within a pattern.
Ana lysis of multidimensional contingency tables is more complicated be- cause of the presence of partial associations in the data. For example, some associations may appear or disappear when conditioned upon the value of cer- tain variables. This problem is known as Simpson's paradox and is described in the next section. 1-Iore sophisticated statilstical techniqueB are available to analyze such relationships , e.g. , loglinear models, but these techniques are beyond the scope of this book.
384 Chapter 6 Association Analysis
Table 6.19. A two-way contingency table between the sale of hig>-defin~ion television and exercise machine.
Buy Buy Exercise Maclllne HDTV Yes No
Yes gg 81 180 No 54 66 120
153 147 300
Table 6.20. Example of a thre&-way contingency table.
Customer Buy Buy Exercise Maclllne Thtal Group HDTV _!es ~0 College Students Yes 1 9 10
No 4 30 34 Working Adult Yes 98 72 170
No 50 36 86
6 .7.3 Simpson's Paradox
It is important to exercise caution when interpreting the association between variables because the observed relationship may be influenced by the presence of other confounding factors, i.e., hidden variables that are not included in the analysis. In some cases, the hidden variables may cause the observed relationship between a pair of variables to disappear or reverse its direction, a phenomenon that is known as Simpson 1s paradox. We illustrate the nature of this paradox with the following example .
Consider the relationship between the sale of high-definition t elevision (HDTV) and exercise machine, as shown in Table 6.19. The rule {HDTV =Yes} ~ {Exercise machine= Yes} bas a confidence of 99/180 = 55% and the rule {HDTV=No} ~ {Exercise machine= Yes} h as a confidence of54/120 = 45%. Together, these rules suggest that customers who buy hig h-definition televi- sions are more likely to buy exercise machines than those who do not b uy high-definition televisions.
However, a deeper analysis reveals that the sales of these items depend on whether the customer is a college student or a working adult. Table 6.20 summarizes the relationship between the sale of HDTV s and exercise machines among college students and working adults. Notice that the support counts given in the table for college students and working adults sum up to the fre- quencies shown in Table 6.19. Furthermore, there are more working adults
6.7 Evaluation of Association Patterns 385
than college students who buy these items. For college students:
c({HDTV=Yes} ~ {Exercise machine= Yes})
c({HDTV=No} ~ {Exercisemachine=Yes} )
while for working adults:
c ({HDTV= Yes} ~(Exercise machine=Yes })
c({HDTV=No} ~(Exercise machine= Yes})
1/10 = 10%,
4/34 = 11.8%,
98/170 = 57.7%,
50/86 = 58.1%.
The rules suggest that, for each group, customers who do not buy high- definition televisions are more likely to buy exercise m achines
1 which contradict
the previous conclusion when data from the two customer groups are pooled together. Even if alternative measures such as correlation, odds ratio, or interest are applied, we still find that the sale of HDTV and exercise machine is positively correlated iu the combined data but is negatively correlated in the stratified data (see Exercise 20 on page 414). The reversal in the direction of association is known as Simpson's paradox.
The paradox can be explained in the following way. Notice that most customers who buy HDTVs are working adults. Working adults are also the largest group of customers who buy exercise machines. Because nearly 85% of the customers are working adults, the observed relationship between HDTV and exercise machine turns out to be stronger in the combined data than what it would have been if the data is stratified. This can also be illustrated mat hematically as follows. Suppose
a/b < cjd and pjq < r/s,
where a/b and pjq may represent the confidence of the rule A ~ B iu two different strata, while cjd and r/s may represent the confidence of the rule A - B iu the two strata. Wheu the data is pooled together, the confidence values of t he rules in t he combined data are (a +p)/(b +q) and (c + r)/(d + s), respectively. Simpson's paradox occurs when
a+p c+r -- > -- b+q d+s'
thus leading to the wrong conclusion about the relationship between the vari- ables. The lesson here is that proper stratification is needed to avoid generat- ing spurious patterns resulting from Simpson's paradox. For example, market
386 Chapter 6 Association Analysis
5 :o:10 4
05 )
0 0L------.oo~-----,o~oo------,.~oo--~~.ooo~----~2soo Items sofied by support
Figure 6.29. Support distribution of items in the oensus data set.
basket data from a major supermarket chain should be stratified according to store locations, while medical records from various patients should be stratified according to confounding factors snch as age and gender.
6.8 Effect of Skewed Support Distribution
The performances of many association analysis algorithms are influenced by properties of their input data. For example, the computational complexity of the Apriori algorithm d epends on properties such as the number of items in the data and average transaction width. This section examines another impor- tant property tbat has significant influence on the performance of association analysis algorithms as well as the quality of extracted patterns. More specifi- cally, we focus on data sets with skewed support distribntion.s, where most of the items have relatively low to moderate frequencies, but a s mall number of them have very high frequencies.
An example of a real data set that exhibits such a distribution is shown in F igure 6.29. The data, taken from the PUMS (Public Use Microdata Sample) census data, contains 49,046 records and 2113 asymmetric binary variables. We shall treat the asymmetric binary variables as items and records as trans- actions in the remainder of this sectio n . While more tha n 80% of the items have support less tban 1%, a handful of them bave support greater than 90%.
6 .8 Effect of Skewed Support Distribution 387
To illustrate tbe effect of skewed support distributiou on frequeut iternset min- ing, we divide the items into three groups, Ct. G2. and G3 , according to their support levels. The number of items that belong to each group is shown in Table 6.21.
Choosing tbe right support threshold for mining this data set can be quite tricky. If we set the threshold too high (e.g .. 20%) , t hen we may miss many interesting patterns involving the low support items from G 1 . In market bas- ket analysis, such low support iteiiiS may correspond to expensive products (such as jewelry) that are seldom bought by customers, but whose patterns are still interesting to re tailers. Conversely, when the tbreshold is set too low, it becomes difficult to find the association patterns due to the following reasons. First, the con1putational and memory requirements of existing asso- ciation analysis algorithms increase considerably with low support thresholds. Second, the number of extracted patterns also increases substantially with low suppo r t thresholds. T hird, we may extract many spurious patterns that relate a high-frequency item such as milk to a low-frequency item such as caviar. Such patterns, which are called cross-support patterns, are likely to be spu- rious because their correlations tend t o be weak. For example, at a support threshold equal to 0.05% , there are 18,84 7 frequent pairs involving items from G, and G3. Out of these, 93%ofthem are cross-support patterns; i.e ., the pat- terns contain items from both G 1 and G3. The maximum correlation obtained from the cross-support patterns is 0.029, which is much lower than the max- imum correlation obtained from frequent patterns involving items from the same group (which is as high as 1.0). Similar statement can be made about many other interestingness measures discussed in the previous section. This example shows t hat a large number of weakly correlated cross-support pat- terns can b e generated when the support threshold is sufficiently low. Before presenting a methodology for eliminating such patterns, we formally define the concept of cross-support patterns.
388 Chapter 6 Association Analysis
Definition 6.9 (Cross-Support Pattern) . A cros&-support pattern is an itemsct X = {it, i2, .. . , ik} whose support r atio
min [s(i!), s(i2) , ... , s(id] r(X)= [ ] ' max s(it), s(i2), ... , s(ik)
(6.13)
is less than a user-specified threshold he.
Example 6.4. Suppose the support for milk is 70%, while the support for sugar is 10% and ca,.iar is 0.04%. Given he = 0.01 , the frequent itemset {milk, sugar, caviar} is a cross-support pattern because its support ratio is
,. =min [0.7,0.1,0.0004] = 0.0004 = 0.000 58
< O.Ol. max [0.7,0.1,0.0004] 0.7
• Existing measures such as support and confidence may not be sufficient
to eliminate cross-support patterns, a.s illustrated by the data set shown in Fignre 6.30. Assuming that he= 0.3, the ite msets {p,q}, {p,r}, and {p, q,r} arc cross-support patterns because their support ratios, which arc equal to 0.2, are less than the threshold he. Although we can apply a high support threshold, say, 20%, to eliminate the cross-support patterns, this may come at the expense of discarding other interest ing patte rns s uch as the strongly correlated itemset, {q,,-} that has support equa.l to 16.7%.
Confidence pruning also does not h elp because the confidence of t he rules
extracted from cross-support patte rns can b e very high. For example, the confidence for {q} ~ {p} is 80% even though {p,q} is a cross-support pat- tern. The fact that the cross-support pattern can produce a high-confidence rule should not come a.s a surprise because one of its items (p) appears ve ry frequently in the data. Therefore, p is expected to appear in many of the trausactions that contain q. Meanwhile, the rule { q} ~ { r} a.lso has high confidence even though { q, r} is not a cross-support pattern. This example demonstrates the difficnlty of nsing the confidence measure to distingwsh be- tween rules extracted from cross-support and non-cross-support patterns.
Retuming to the previous example, notice that the rule {p} ~ { q} has very low confidence because most of the transactions t hat contain p do not contain q. In contrast, the rule {r} ~ { q}, which is derived from the pattern { q, r}, ha.s very high confidence. This observation suggests that cross-support patterns can be detected by examining the lowest confidence rule that can be extracted from a given itemset. The proof of this statement can he understood a.s follows.
6 .8 Effect of Skewed Support Distribution 389
p q r 1 1
1 1
1 0 0
1
1 0 0 0 0
1 0 0
1
0
Figure 6.30. A transaction data set containing three items, p, q, and,., where pis a high support item and q and r are la.v support items.
1. Recall the following anti-monotone property of confidence:
This property suggests that confidence never increases as we shift more items from the left- to the right-hand side of an association rnle. Because of this prope r ty, the lowest confidence rule extracted from a frequent iternset contains only one ite m on its left-hand side. We denote the set of all rules with only one item on its left-hand side as R1.
2. G iven a frequent ite mset {i~,i2, .. . ,ik}, the rule
has the lowest confidence in Rt if s(ij) = max[s(it),s(i2), ... ,s(ik)]. This follows directly from the definition of confidence as the ratio be- tween the rule's support and the support of the rule antecedent.
390 Chapter 6 Association Analysis
3. Summarizing the previous points, the lowest confidence attainable from a freque nt itemset {it, .£2, . .. , ik} is
This expression is also known as the h-confidence or all-confidence measure. Because of the anti-monotone property of support, the numer- ator of the h-confidence measure is bounded by the minimum support of any item that appears in the frequent iteffillet. In other words, the h-confidence of an iternset X = { i1, i2, ... , id must not exceed the fol- lowing expression:
) min [s(iJ),s(i2), ... ,s(ik)]
h-confidence (X < . - max [s(iJ),s(io), .. .. s(ik)]
Note the equivalence between the upper bound of h-confidence and the support ratio (r) given in Equation 6.13. Because the support ratio for a cross-support pattern is always less than he, the h-confidence of the pattern is also guaranteed to be less than h0 .
Therefore, cross-support patterns can be eliminated by ensuring that the h-confidence values for the patterns exceed he. As a final note, it is worth mentioning that the ad vantages of using h-confidence go beyond eliminating cross-support patterns. The measure is also anti-monotone, i.e.,
h-confidence( {it. i2, .... ik}) 2': h-confidence( { i,, i2, ... , ik+t} ),
and thus can be incorporated directly into the mining algorithm. Furthermore, h-confidence ensures that the items contained in an itemset are strongly asso- ciated with each other. For example, suppose the h-confidence of an iteiiiBet
X is 80%. If one of the items in X is present in a transaction, there is at least an 80% chance that the rest of the items in X also belong to the same trans- action. Such strongly associated patterns are called hyperclique patterns.
6.9 Bibliographic Notes
The association ruJe mining task was first introduced by Agrawal et al. in [228, 229] to discover interesting relationships among items in market basket
6.9 Bibliographic Notes 391
transactions. Since its inception. extensive studies have been conducte d to address the various conceptual, implementation, and application issues per- taining to the association analysis task. A summary of the various research activities in this area is shown in Figure 6.31.
Conceptual Issues
Research in conceptual issues is focused primarily ou (1) developing a frame- work to describe the theoretical underpinnings of association analysis, (2) ex- tending the formuJation to handle new types of patterns, and (3) extending the formulation to incorpo rate attribute types beyond asymmetric binary data.
Following the pioneering work by Agrawal et al., there has been a vast amount of research on developing a theory for the association analysis problem. In [254], Gunopoulos et al. showed a relation b etween the problem of finding maximal frequent itemsets and the hypergraph transversal problem. An upper bound on the complexity of association analysis task was also derived. Zaki et al. [334, 336] and Pasqnier et al. [294] have applied formal concept analysis to study the frequent itemset generation problem. The work by Zaki et al . have subsequently led t hem to introduce t he notion of closed frequent itemsets [336] . Friedman et al. have studied the association analysis problem in the context of bump hunting iu muJtidimensional space [252]. More specifically, they consider frequent itemset generation as the task of finding high probability density regions in multidimensional space.
Over the years, new types of patterns have been defined, such as profile association rules [225], cyclic association ruJes [290], fuzzy association ruJes [273] , exception rules [316]. negative association rules [238, 304], weighted association ruJes [240, 300], dependence rules [308]. peculiar rules[340] , inter- transaction association roles [250, 323], and partial classification ruJes [231, 285]. Other types of patterns include closed itemsets [294, 336], maximal itemsets [234], hypercliqne patterns [330], support envelopes [314], emerging patterns [246], and contrast sets [233]. Association analysis has also been successfully applied to sequential [230, 312], spatial [266], and graph-based [268, 274, 293, 331, 335] data. The concept of cross-support pattern was first introduced by Hui et al. in [330]. An efficient algorithm (called Hypercliqne !\line r) that automatically eliminates cross-support patterns was also proposed by the authors.
Substantial research has been conducted to extend the original association rule formuJation to nominal [311], ordinal [281] , interval [284], and ratio [253, 255, 311, 325, 339] attributes. One of the key issues is how to define t he support measure for these attributes. A methodology was proposed by Steinbach et
-negatva odeperc:lert:e -causal ·WeiQnted -spati!ll &lld co- loc.aflon palloms -tempaal (cycle. sequartil.l) -hay ·&lCePIIOnrtikls
"""""" -maximal -~marglng
P<dtem s ·tftPB'CII(JJe pattems
"""'"" .......
-ser1Bi orpaale1 -arline or bath
-AprCrl -DIC -tree.pro,.,clton ·FP·tree -H.mlne -Partli>n ·$iwnplllg-baS9d ·CHARM
Figure 6.31. A stJ11mary of !he varirus research activities in association analysis.
-ranking -nltemo -sumn-ertzlng
~ 2.. "' ~ p.. ., ., w <'" ....
0 ~..s::!. ::?("!- ::r " 0 "' g a '0 .. ~
(!)
" ...,
" "" ~ p.. <'" ,.. ~ " :q-
; 0 c. " a· g:
" " 2.. > " " g_ " 0 ~ " !;;" g., "' " "" "" ~ b 3 0 (l
·~ " (1 2..
"" ~ 1i" fjl
-dllsSincatbll -regres:sion -cllsterino -racommem• systems
394 Chapter 6 Association Analysis
Implementation Iss ues
Research activities in this area revolve around (1) integrating the milling ca- pability into existing database technology, (2) developing efficient and scalable mining a lgorithms, (3) handling user-specified or domain-specific constraints, and ( 4) post-processing the extracted patterns.
There are several advantages to integrating associatiou analysis into ex- isting database technology. First , it cau make use of the indexing and query processing capabilities of the database system. Second. it can also exploit the DBMS s upport fo r scalability, check-pointing, and parallelization [301]. The SETM algorithm developed by Houtsrna et al. [265] was one of the earUest algorithms to support association rule discovery via SQL queries. Since then. numerous methods have been developed to provide capabilities for mining as- sociation rules in database systems. For example, the DMQL [258] and M-SQL [267] query la nguages extend the basic SQL with new ope rators for mining as- sociation rules. The Mine Rule operator [283] is an expressive SQL operator that can handle both clustered attributes and item hiera rchies. Tsur et al. [322] developed a gene rate-and-test approach called que ry flocks for mining association rules. A distributed OLAP-based infrastructure was developed by Chen et al. [241] for rn.inlng multilevel association rules.
Dunkel and Soparkar [248] investigated the time and s t orage complexity of the Apr"iori algo rithm. The FP-growth algorithm was developed by Han et al. in [259]. Other algorithms for mining frequent itemsets include the DHP (dynamic hashing and pruning) algorithm proposed by Park et al. [292] an d the Partition algorithm develop ed by Savasere et al [303]. A sampling-based frequent itemset gene ration algorithm was proposed by Toivonen [320]. The algorithm requires only a single pass over the data, but it can produce more candidate itemsets than necessar y. The Dynamic ltemset Counting (DI C) algorithm [239] makes only 1.5 passes over the data and generates less candi- date itemsets than t he sampling-based algorithn1. Other notable algorit hms include the t ree-projection algorithm [223] and H-Mine [295]. Survey articles on frequent itemset generation algorithms can be found in [226, 262]. A repos- itory of data sets and algorithn>s is available at the Frequent l temset Mining Implementations (FI MI) repository (http:j /firni.cs.helsinki.fi ). Parallel algo- rithms for rn.inlng associat ion patterns have been developed by various authors [224 , 256, 287, 306. 337]. A survey of s uch a lgorithms can be found in [333]. Online and incremental versions of association rule mining algorithms had also been proposed hy Hidber [260] and Chenog e t al. [242].
Srikant et al. [313] have considered the problem of mining association rules in the presence of boolean constraints such as the following:
6.9 Bibliographic Notes 395
(Cookies II Milk) V (descendents (Cookies) A ~ancestors(Wheat Bread))
G iven such a constraint. the algorithn1 looks for r ules that contain both cook- ies and milk, or rules that contain the descendent items of cookies but not ancestor items of wheat bread. Singh et al. [310] and Ng et al. [288] had also developed alternative techniques for constrained-based association rule min- ing. Constraints can also be imposed on the support for different itemsets. This problem was investiga ted by Wang e t al. [324] , Liu et al. in [279], and Seno et a l. [305].
One potentia l problem with association analysis is the large number of patterns that can be generated by current algorithms. To overcome this prob- lem, methods to ra nk, summarize, and filter patterns have been developed. Toivonen et a l. [321] proposed the idea of eliminat ing redundant rules nsing structural rule covers and to group the remaining rules using clustering. Liu et al. [280] applied the s tat istical chi-square test to prune spur ions patterns and summarized t he remaining patterns using a subset of t he patterns called direct ion settiJ1g ru1es. The use of objective rueasUies to filter patterns has been investigated by many authors, including Brin et al. [238], Bayardo and Agrawal [235], Aggarwal and Yu [227], and DuMouchel and Pregibon[247] . The properties for many of these measnres were analyzed by P iatetsky-Shapiro [297] , Kamber and Singhal [270] , Hilderman and Hamilton [261], and Tan et al. [318]. T he grade-gender example used to highlight the importance of the row and column scaling invariance property was heavily influenced by the discussion given in [286] by Mosteller. Meanwhile, the tea-coffee example il- lustrating the limitation of confidence was motivated b y an example given in [238] by Brin et al. Because of the limitation of confidence, Brin et al. [238] had proposed the idea of using interest factor as a measure of interest ing- ness. The all-confidence measure was proposed by Omiecinski [289]. Xiong et al. [330] introduced the cross-suppor t property and s howed th at the all- confidence measure can be used to eliminate cross-support patterns. A key difficulty in using alternative objective measures besides support is their lack of a monotonicity property, wbicb makes it difficult to incorporate the mea- sures directly into the mining algorithms. Xio ng et al. [328] have proposed an efficient method for rn.inlng correlations by introducing an upper bound function to t he &-coefficient. Alt hough t he measure is non-mo notone , it has an upper bound expression that can be exploited for the efficient mining of strongly correlated itempairs.
Fabris a nd Freitas [249) have proposed a method for discovering inter- esting associations by d etecting the occurrences of Simpson's paradox [309). l\legiddo and Sri kant [282] d escribed an approach for validating the extracted
396 Chapter 6 Association Analysis
patterns using hypothesis testing methods. A resampling-based technique was also developed to avoid generating spurious patterns because of the multiple comparison problem. Bolton et al. [237] have applied the Benjamini-Hochberg [236] and Bonferron.i correction methods to adjust the p-values of discovered patterns in market basket data. Alternative methods for handling the multiple comparison problem were suggested by Webb [326] and Zhang eta!. [338] .
Application of subjective measures to association analysis has been inves- tigated by many authors. Silberschatz and Tuzhilin [307] presented two prin- ciples in which a rule can be consjdered inte resting from a subjective point of
view. The concept of unexpected condition rules was introduced by Liu et al. in [277]. Cooley et a!. [243] analyzed the idea of combining soft belief sets using the Dempster-Shafer theory and applied this approach to identify contra- dictory and novel association patterns in Web data. Alternative approaches include using Bayesian networks [269] and neighborhood-based informat ion [245] to identify subjectively interesting patterns.
Visualization also helps the user to quickly grasp the underlying struc- ture of the discovered patterns. Many commercial data mining tools display t he complete set of rules (which satisfy both support and confidence thresh- old criteria) as a two-dimensional plot, with each axis corresponding to the anteced ent or consequent itemsets of the rule. Hofmann et al. [263] proposed using Mosaic plots and Double Decker plots to visualize association rules. This approach can visualize not only a particular rule, but also the overall contin- gency table between itemsets in the antecedent and consequent parts of the rule. Nevertheless, this technique assumes t hat the ruJe consequeut consists of only a single attribute.
Application Issues
Association analysis has been applied to a variety of application domains such as Weh mining [296, ~17], document analysis [264], telecommunication alarm diagnosis [271 ], network intrusion detection [2~2, 244, 275], and bioinformatics [302, ~27]. Applications of association and correlation pattern analysis to Earth Science studies have been investigated in [298, 299, 319].
Associa tion patterns have also been app1ied to other le arning problems
such as classification [276 , 278], regression [291]. and clustering [257, 329, 332]. A comparison hetweeu classification aud associati on rule mining was made by Freitas in his position paper [251]. The use of association patterns for clustering ha:s been studied by many authors including Han et a!.[257], Kosters et al. [272], Yang eta!. [332] and Xiong et al. [329].
Bibliography 397
Bibliography [223] R. C. Agarwal, C. C. Aggarwal, and V. V. V. Prasad. A Tree Projection Algorithm
for Generation of Frequent ltemsets. Jaumal of Parullel and Distributed Computing (Speool/88ue on High Performance Data M ining), 61(3):35(}-371, 2001.
[224] R. C . Agarwal and J. C. Shafe r. Parallel Mining of Association Rules. IEEE Trnnsac- tion!l on Kn&Wledge and Data Engineering, 8(6):962- 969, :March 1998.
[225] C. C . Aggarwal, Z. Sun. and P. S. Yu. Online Generation of Profile Association Rules. In Proc. of the jth Intl. Conj. on Knowledge fucovery and Data Mining, pages 121}- 133, New York, NY. August 1090.
[226] C. C. Aggarwal and P. S. Yu. Mining Large Itemsets for Association Rules. Data Engineering Bulletin, 21(1):23-31. March 1098.
[227] C. C. Aggarwal and P. S. Yu. Mining Associations with the Collective Strength Approach. IEEE Tmru. on Knowledge and Data Engineering, 13(6):863-873, Jan- uary / February 2001.
[228] R. AgrawaL T. Imielinski, and A. Swami. Database mining: A performance perspec- tive. IEEE Trnnsactions on Knowledge and Data Engineering, 5:914-925. 1993.
[229] R. Agrawal. T. Imielinski, and A. Swami. l\lining association rules between sets of items in large databases. In Proc. A CM SI GM OD Inti. Con/. Management of Dat.a, pages 207 216, Washington, DC, 1003.
[230] R. Agrawal a.nd R. SrikaJlt. Mining Sequential Patterns. In Proc. of I ntl. Conf . on Data Engineering, pages 3- 1-4, Taipei, Taiwan, 1995.
[231] K . Ali, S. Manganaris, and R . Srikant. Partial Classificat ion using ASS)Ciation Rules. In Proc. of the :Jrd. Inti. Cot1j. 0t1 Know ledge DiJ ctwery and Data Mining, pages 115--- 118, Newport Beach, CA. August 1997.
[232] D. Barbara. J. Couto. S. Jajodia, and N. Wu. ADM!: A Testbed for Exploring tbe Use of Data Mining in lntrusion Detection. SIGMOD Record, 30(4):1fr-24, 2001.
[233] S. D. Bay and M. Pazzani. Detecting Group Differences: Mining Contrast Sets. Data Afining and Knowledge ~cov€ry, 5(3):213- 246. 2001.
[234] R. Bayardo. Efficiently Mining Long Patterns from Databases. In Proc. of 1998 ACM- SlGMOD Inti. Conj. on Management of Data. pages 85- 93, Seattle, WA, June 1998.
[235] R. Bayardo and R. Agrawal. Mining the Most lnteresting Rules. 1n Proc. of the 5th Intl. Con/. on Knowledge Discotrery and Data Mining. pages 145 153, San Diego, C A. August 1999.
[236] Y. Benjamini and Y. Hochberg. CQntrolling the False D iscovery Rate: A Practical and Powerful Approach to f\·Iultiple Testing. Journal Royal Statistical Society B. 57 ( 1):289-300, 1995.
[237] R. J. Bolton , D. J. Hand, nnd N. M. Adams. Determining Hit Rate in Pattern Search. In Proc. of the ESF Explorotorv Workshop 0t1 Pattern Detection and DisCtJverv i n Data !vlining, pages 36----48, London, UK, September 2002.
[238] S. Brio, R. Motwani, and C. Silverstein. Beyond tnarkE't baskets: Generalizing associ- ation rules to correlations. In Proc. ACJ..J SJGMOD Intl. Conf. Management of Data, pages 265- 276, Tucson. AZ , 1907.
[239] S. Brin, R. Mot¥.·ani, J. Ullman, and S. Tsur. Dynamic l temset Counting and Impli- cation Rules for market basket data.. In Proc . of 19g7 A CM-SIG.MOD lnU. Conf. on Management of Data, pages 255- 264, Tuc:son. AZ. June 1997 .
[240] C. H. Cai, A. Fu. C. H. Cheng, nnd W. W. Kwong. Mining Association Rules with Weighted Items. In Proc. of IEEE lntL Database Engi neering and Applications Symp .• pages 61>-77, Cardiff, Wales. 1098.
398 Chapter 6 Association Analysis
[241] Q. Chen, U. Dayal, and M. Hsu. A Distributed OLAP infrastructure forE-Commerce. In Proc. of the 4th JFCJS Intl. Con/. on Cooperative Information Systems, pages 200---- 220, Edinburgh, Scotland, lOgo.
[242] D. C. Cheung. S. D. Lee, and B. Kao. A General Increlll€ntal Technique for Maintaining Disoovered Association Rules. In Proc. of the 5th Inti. Conf. on Database Systems for Advanced Applications, pages 185--194, J...·Jelbourne, Australia, 1997.
[243] R. Cooley, P. N. Tan, a.nd J. Srivastava. Discovery of Interesting Usage Patterns from Web Data. In .M. Spiliopoulou and B. :Masand. editors. Advances in Web Usage Analysis and User Profiling, volume 1836. pages 163---.182. Lecture Notes in C..omputer Science, 2000.
[244] P. Dokas, L. ErtOz, V. Kumar, A. LazareYic, J. Srivastava, and P. N. Tan. Data Mining for Network Intrusion Detection. In Pruc. NSF Work...'lhop on Next Genemt-ion Data Mining, Baltimore, MD. 2002.
[245] G. Dong and J. Li. Interestingness of discovered association rules in terms or neighborh<XJd-based unexpectedness. In Pmc. of the 2nd Pacific-Asia Con/. on K nowl- edge DiscotJery and Data Mining. pages 72-86~ Melbourne, Australia. April1098.
[246] G. Dong and J. Li. Efficient Mining of Emerging Patterns: Discovering Trends and Differences. In Proc. of the 5th. Inti. Conf on Knowledge Discot1ery and Data Mining, pages 43-52. San Diego, CA. August 1999.
[247] \V. Du!vlouchel and D. Pregibon. Empirical Bayes Screening for Multi-Item Associa- tions. In Proc. of the 7th Intl. Con f. on Knowledge Discovery and Data M ining. pages 67-76. San Francisco, CA, August 2001.
[248] B. Dunkel and N. Soparkar. Data Organization and Access for Efficient Data Mining. Io Proc. of the 15th Inti. Con/. on Data Engineering, pages 522 529. Sydney, Australia, March 1999.
[249] C. C. Fabris and A. A. Freitas. Discovering surprising patterns by detecting occurrences of Simpson's paradox. In Proc. of the J!Jth. SGES Intl. Conf. on Knowledge-Based Systems and Applied Artifidal Intelligen~). pages 148-160, Cambridge, UK, December 1909.
[250] L. Feng, H. J. Lu. J. X. Yu, and J. Han. Mining inter-transaction associations with templates. In Proc. of the 8th Inti. Con]. on lnfonnation and Knowletige Managemen~ pages 225- 233, Kansas City. Missouri, Nov 19{)9.
[251] A. A. Freitas. Understanding the crucial differences between classification and discov- ery of association rules--a position paper. SIGKDD ExplomtJons, 2(1):65----GO. 2000.
[252] J. H. Friedman and N. I. Fisher. Bump hunting in high-dimensional data. Statistics and Computing, 9(2):123-143, April1999.
[253] T. Fukuda, Y. ~-Iorimoto, S. ~lorishita., and T. Tokuyama. ~-"lining Optimized Asso- ciation Rules for N urneric Attributes. In Proc. of the. 1 Sth Symp. on Principles of Database Systems, pages 182 191 , ~'lontreal, Canada, June 1096.
[254.] D. Gunopulos. R. Khardon, H. Ma.nnila, and H. Toivonen. Data Mining, Hypergra.ph Transversa1s, and Machine Learning. In Proc. of the 16th Symp. on Principles of Database Systems, pages 209- 216 , Tucson. AZ, May 1997.
[255] E.- H. Han, G. Karypis, a.nd V . Kumar. Min- Apriori: An Algorithm for Finding As- sociation Rules in Data with C-ontinuous Attributes. http:/ jwww.cs.urnn.edurhan, 1907.
[256] E.-H. Han. G. Karypis, and V. Kumar. Scalable Parallel Data ~lining for Association Rules. In Proc. of 1997 ACM-SIGMOD Inti. Conf. on Management of Data, pages 277- 288, Tucsoo, AZ. May 1!l!l7.
Bibliography 399
[257] E.-H. Han, G. Karypis, V. Kumar, and B. Mobasher. Clustering Based on Association Rule Hypergraphs. In Proc. of the 1997 ACM SIGMOD Workshop on Research Issues in Data Mining and Knov.lledge .Diuovery, TUcson, AZ, 1907.
[258] J. Han) Y. FU, K. Koperski, "\V. ·wang, and 0. R. Zalane. DMQL: A data mining query lru1guage for relat ional databases. In Proc. of the 1996 ACA! SIGMOD Work...'lhop on Research Issues in Data Mining and Knowledge Di.scot,ery, Montreal. Canada, June 1990.
[259] J. Han, J. Pei. andY. Yin. Mining Frequent Patterns without Candidate Generation. In Proc. A CM-SIGMOD Int. Conf. on Management of Data (SIGMOD 'OO), pages 1-12. Dallas, TX, May 2000.
[200] C. Hidber. Online Association Rule Mining. In Proc. of 1 !199 AC.Af.SIGMOD Inti. Con/. on klanagement of Data, pages 145-156, Philadelphia, PA. 19!J9.
[2Gl] R. J. Hildemaan and H. J. Hamilton. Knou,ledge Di.sc01.1e.ry and MeCJsu.rts of Interest. Kluwer Academic Publishers, 2001.
[262] J. Hipp, U. Guntzer, and G. Nakhaeizadeh. Algorithms for Association Rule Mining- A GeoeraJ Survey. SigKDD Explorntions, 2(1):58-04, Jnne 2000.
[263] H. Hofmann, A. P. J. M. Siebes, and A. F. X. Wilhelm. Visualizing Associotion Rules with Interactive ~·IO"'aic Plots. In Proc. of the 6th. Intl. Conf. on Knowledge Disrovery and Data Mining, pages 1)27 235, Boston, ?\·fA, August 2000.
[264] J. D. Holt and S. M. Chung. Efficient Mining: of Association Rules in Tex\ Databases. In Proc. of the 8th Intl. Conf. on Information and Knowledge .Management, pages 234-242, Kansas City, Mi<lsouci, 199!).
[265] M. Houtsma and A. Swami. Set-oriented Mining for Association Rules in Relational Databases. In Proc. of the 11th Inti. Conf. on Data Engineering, pages 25 33, Taipei, Taiwan, 1995.
[26G] Y. Huang, S. Shekhar, and H. Xiong. Disrovering Co-location Patterns from Spatial Datasets: A General Approach. IEEE Trons. on Knowledge and Data E ngineering, 16 (12):1472-1485. December 2004.
[267] T. Imielinski, A. Virmani. 8Ild A. Abdulghani. DataMine: Application Programming Interface and Query Language for Database Mining. In Proc. of the 2nd l n t1. Conf. on Knowledge Di-scovery and Data Mining, pages 256--262, Portland, Oregon. 1006.
[268] A. Inokuchi, T. Washio. ond H. Motoda. An Apriori-based Algorithm for Mining Frequent Substructures from Graph Dat.a. In Proc. of the ,Jth European Conf. of Prin- ciples and Practice of Knowledge DUeot•ery in Databases, pages 13-23, Lyon, Fra nce, 2000.
[26{)] S. Jaroszewicz and D. Simovici. lnterf"St.ingness of Frequent ltemsets Using Bayesian Networks as Background Knowledge. In Proc. of the 10th Inti. Con/. on Knowledge Discovery and Data Mining, pages 178-186, Seattle. WA, August 2004.
[270] M. Kamber and R. Shingbal. Evaluating the Interestingness of Characteristic Rules. In Proc. of the 2nd Intl. Conf. on Knowledge Discovery and Data Mining. pages 263-266, Portland, Oregon, 1906.
[271] l\1. Klemettinen. A Knowledge Discovery M ethodology for Telecommunication N etwork Alarm Databases. PhD thesis. University of Helsinki. 19{)9.
[272] W. A. Koo;:ters, E . MOichiori, and A. Oerle mans. Mining Clusters with Associat-ion Rules. In The 3rd Symp. on Intelligent Data Analysis (IDA99). pages 39-50, Amster- dant, August 1009.
[273] C. M. Kuok , A. FU, and M. H. Wong. Mining Fuzzy Association Rules in Databases. ACM SIGMOD Record, 27(1):41-46, March 1908.
400 Chapter 6 Association Analysis
[274] M. Kuramochi and G. Karypis. Frequent Subgraph Discovery. In Proc. of the 2001 IEEE Inti. C<m/. on Data Mimng. pages 313-320. San Jooe, CA, November 2001.
[275] W. Lee, S. J. Stolfo, and K. W. Mok. Adaptive Intrusion Detection: A Data Mining Approach. Artificial Intelligence Reviewl 14(6):533-567l 2000.
[276] W. Li, J. Han, and J. Pei. C MAR: Accurate and Efficient Classification Based on Multiple C lass-association Rules. In Proc. of the 2001 IEEE Intt C<m/. on Data Mining, po.ges 360-376. San Jose, CA. 2001.
[277] B. Liu, W. Hsu, and S. Chen. Using General Impressions to Analyze Discovered Classification Rules. In Proc. of the :lrd Intl. Con]. on Knou1ledge Discovery and Data Mining, pages 31-36, Nev.rport Beach, CA, August 1997.
[278] B. Liu, W. Hsu. and Y. !\.b. Integrating ClMsiflcation and Association Rule Mining. In Proc. of the 4th Intl. Ccmf. on Knowledge Discovery and Data Mining, pages 80-86, New York, NY, August 1998.
[279] B. Liu, W. Hsul andY. Ma. Mining a.ssociation rules with multiple- minimum supports. In Proc. of the 5th Intl. Conf. on Knowledge Discot--ery and Data Mining, pages 125-- 134, SaiJ Diego, CA, August 1999.
[280] B. Liu, W. Hsu, andY. M~. Pruning and Summarizing the Discovered Assoda.tions. In Proc. of the 5th inti. Conf. on Knowledge Disco,.!ery and Data Mining, pages 125-134, San Diego, CA, August 1009.
[281] A. Marcus, J. I. Maletic, and K -1. Lin. Ordinal association rules for error identifi- cation in data sets. In Proc. of the 10th Intl. Conf. on Information and Knowledge Management, pages 589-591, Atlanta, GA, October 2001.
[282] N. ~'legiddo and R. Srikant. Discovering Predictive Association RuleB. In Proc. of the 4th lntl. Con]. on Knowledge Di..scot't'f'JI and Data Mini ng. pages 274 278, New York, August 1\l08.
[283] R Meo, G. Psa.ila. and S . Ceri A New SQL-like Operator for Mining AS80ciation Ru les. In Proc. of the ~2nd VLDB Conf., pages 122-133. Bombay, India, 1996.
[284] R. J. Miller and Y. Yang. Association Rules over Interval Data. In Proc. of 1997 ACM-SJGMOD Intl. Con]. on Management of Data. pages 452 4.(}1, Tucson. AZ, May 1907.
[285] Y. 1-lorimoto, T. FUkuda, H . Matsuzawa, T. Tokuyama, and K . Yoda. Algorithms for mining association rules for binary segmentations of huge categorical databases. In Proc. of the 24th VLDB C on{. , pages 380-3D1, New York, August ID98.
[286] F. Mosteller. Associatio n and Estimation in Contingency Tables. Journal of the Amer- ican Statistical Association, 63:1- 28, 1068.
[287] A. Mueller. Fast sequential and parallel algorithms for a ssociation rule mining: A comparison. Technical Report CS-TR-351 5, University of Maryland. August 1095.
[288] R. T. Ng, L. V. S. Lakshmanan, J. Han, and A . Pang. Exploratory Mining and Pruning Optimizations of Constrained Association Rules. In Proc. of 1998 A CM-SI GM OD Inti. Conf. on Management of Data, pages 13- 24. Seattle, VlA, June 1908.
[289] E. Omiecinski. Alternative Interest Measures for Mining Associations in Databases. fEEE Trans. on Knowledge and Data Engineering, 15(1):57- 69. January/February 2003.
[290] B. Ozden, S. Ra.rnaswamy, and A . Silberschatz. Cyclic Association Rules. In Proc. of the 14th l n tl. Conf on Data Eng., pages 412-421. Orlando, FL , February 1998.
[291] A. O.gur, P. N. Tan , alld V. Kumar. RBA: An Integrated Framework for Regression based on Association Rules. In Proc . of the SIAM Inti. Conj. on DaUJ. Mining. pages 210-221, O rlando, FL, April 2004.
Bibliography 401
[~2] J. S. Park, t>.l-S. Chen , and P. S. Yu. An effective hash-based algorithm for mining association rules. SIGMOD Record, 25(2):175-186, 1905.
[293] S. Parthasarathy and M. Coatney. Efficient Discovery o f Common Substructures in Macromolecules. In Proc. of the QOOQ IEEE Inti. Gonj. on Data Mining, pages 362-36{), Maebashi C ity, Japan. December 2002.
[2g4] N . Pasquier, Y. Bast ide, R. Taouil. and L. Lakhal. Discovering frequent closed itewsets for association rules. In Proc. of the 7th lntl. Conj. on Database Theory (JCDT'99) , pages 398 416, Jerusalem, Israel, January lQ{I!)_
[2fl5] J. Pei, J. Han, H. J. Lu, S. Nishio, and S. Tang. H-f\-1ine: Hyper-Structure Mining of Frequent Patterns in Large Databaoes. In Proc. of the 2001 IEEE Inti. C<mf. on Data Mining, pages 441-448. San Jose, CA. November 2001.
[2!16] J. Pei. J. Han. B. fvlortazavi-Asl , and H. Zhu. Mining A cress Patterns Efficiently from Web Logs. In Proc. of the 4th Pacific-A!Iia Conf. on Knowledge Discovery and Data Mining, pages 390--407, Kyoto, Japan. April 2000.
[2!17] G. Piatetsky-Shapiro. Discovery, Analysis and Presentation of Strong Rules. In G. Piatetsky-Shapiro and W. Frawley, editors, Knowledge Discovery in Databases, pages 229-248. MIT Press. Cambridge. MA, 1991.
[298] C. Potter, S. Kloooter, M. Steinbach, P. N . Tan, V. Kumar, S. Shekhar, and C. Car- valho. Underst8Ilding G lobal Teleconnections of Climate to Regional Nlode) Estimates of Amazon Eoosystem C arbon Fluxes. Global Change Biology, 10(5):603-703, 2004.
[299] C. Potter. S. Klooster, M. Steinba<:h. P. N. Tan, V. Kumar , S. Shekhar, R. Myneni, and R. Nemani. Global Teleconnections of Ocean Climate to Te rrestrial Carbon Flux. J. Geophysical Research, 108(D 17), 2003.
[300] G. D. Ramkumar, S. Rankn. and S. Tsur. Weighted Association Rules: Model and Algorithm. http:/ j www.cs .ucla.edu;-czdemojtsur/, JD07.
[301] S. Sarawagi, S. T homas, and R. Agrawal. Integrating Mining with Relational Database Systems: Alternatives and Implications. In Proc. of 1998 ACM.SIGMOD Int.J.. Conf. on Management of Data, pages 343-354, Seattle, WA, 1998.
[302] K. Satou, G. Shibayama, T. Ono, Y. Yamamuro, E. Furoichi, S. Kuhara, and T. Takagi. Finding Association Rules on Heterogeneous Genome Data. In Proc. of the Pacific Symp. on B i ocomputing, page:s 397 -408. Hawaii, January 1997.
[303] A. Savasere, E. Omiecinski, and S. Navathe. An efficient algorithm for mining associ- ation rules in large databases. In Proc. of the £1st Int. Conf. on Very Large Databases (VLDB'95), pages 432-444, Zurich, Switzerland, September 1005.
[304] A . Savasere, E. Omiecinski, and S. Navathe. Mining for Strong Negative Associations in a Large Database of Customer Transaetions. In Proc. of the 14th inti. Con f. on Data Engineering, pages 494- 502, Orlando: Florida, February 1908.
[305] t\·1. Seno and G. Kruypis. LPMiner: An Algorithm for Finding Frequent Itemsets Using Length-Decreasing Support Constraint. In Proc. of the :2001 IEEE lnt.l. Con/. on Data Minong, pages 505 5 12. San Jose, CA. Novembe.r 2001.
[306] T . Shintani and M. Kitsuregawa. Hash based para He-1 algorithms for mining BS50Ciation rules. In Proc of the Jth Intl. Conf on Pamllel and Distributed I nfo. Systems. pages 1!)- 30, Miami Beach, FL, December 1006.
[307] A. SiJberschatz and A. Tuzhilin. What makes patterns interesting in knowledge discov- t>ry systems. IEEE Trans. on Knou1ledge and Data Engineering, 8(6):9~974, 1996.
[308] C. Silverstein, S. Brin, and R. Motw8Ili. Beyond market baskets: Generalizing associ- ation rules to dependence rules. Data Mining and Knowletige Discovery, 2(1) :30--{lS, 1!J!l8.
402 Chapter 6 Association Analysis
[300] E.-H. Simpson. The Interpretation of Interaction in Contingency Tables. Journal of the Royal Statistical Society. 8(13):238-241. 1951.
[310] L. Singh~ B. Chen. R. Haight! a.nd P. Scheuermann. An Algorithm for Const rained Association Rule Mining in Semi-structured Data. In Proc. of the 3rd Pad.fic-Asia Conf- on Knowledge Discovery and Data Mining. pages 148-158, Beijing, China, April U99.
[311] R. Srikant nnd R. Agrawal. Mining Quantitative Association Rules in Large Relational Tables. In Proc. of 1996 ACM-SIGMOD lntl. Con/. on Management of Data, pages 1 12, Montreal, Canada. 1006.
[312] R. Srikant and R. Agrawal. Mining Sequential Patterns: Generalizations and Perfor- manre bnprovements. In Proc. of the 5th Intl Conf. on Extending Database Technology (EDBT'96), pages 1&-32, Avignon, France, 1996.
[313] R. Srikant, Q. Vu, and R. Agrawal. Mining Association Rules with Item Constraiu.ts. In Proc. of the :Jrd Intl. Co nf. on Knowledge Diuovery and Data A-fining~ pages 67-73, Newport Beach, CA, August 1{)97.
[314] M. Steinbach. P. N. Tan. and V. Kumar. Support Envelopes: A Technique for Ex- ploring the Structure of Association Patterns. In Proc. of the 10th Inti. Conj. on Knowledge DiscotJery and Data Mining, pages 2l!G 305. Seattle, WA , August 2()().:1.
[315] M. Steinbech, P. N. Thn. H. Xiong. and V. Kumar. Extending the Notion of Support. In Proc. of the 10th Intl. Conf. on Knowledge Discovery and Data Mining, pages 689--- 694, Seattle, "\VA. August 2004.
[316] E. Suzuki. Autonomous Disoovery of Reliable Exception Rules. In Proc. of the 3rd. Inti. Con/. on Knowledge Discovery and DaW.. Mining. pages 250--2G2. Newport Beach, CA. August 1097.
[317] P. N. Tan and V. Kumar. Mining Association Pattems in Web Usa.ge Data. In Pnx. of the Intl. Conf. on Advances in Infmstructure for e-Busi ness, e-Edumtion. e-Science and e-Medicine on the Internet, L ' Aquila, Italy, January 2002.
[318] P. N. Tan. V. Kumar, and J. Srivastava. Selecting tbe Right Interestingness Measure for Association Patterns. In Proc. of the 8th Intl. Conf. on Kno111ledge Discm1ery and Data Afini.ng, pages 32- 41, Edmonton, Canada, Ju]y 2002.
[319[ P. N. Thn, M. Steinbach. V. Kumar, S. Klooster, C. Potter, and A. Torregrosa. Finding Spa tier Temporal Patterns in Earth Science Data. In KDD 2001 Workshop on Tem7J"ra/ Data A-fining, San Francisco, CA. 2001.
[320] H. Toivonen. Sampling Large Databases for Association Ruta.. In Proc. of the 2f!nd VLDB Conf, pages 134-145, Bombay, India, 199G.
[321] H. Toivonen, 1-t KJemett inen, P. Ronko.inen, K. Hatonen. and H. Ma.nnila.. Pruning and Grouping Discovered Association Rules. In ECML -95 Workshop on Statistics, Machine Learning and Knowledge Discovery in Databases, pages 47 52, Heraklion, Greece, April1995.
[322] S. Tsur, J. Ullman, S. Abiteboul, C. Clifton, R. Motwani. S. NestorO\', and A. Rrnen- thal. Query Flocks: A Generalization of Associatio n Rule Mining. In Pmc. of 1998 ACJ.I-SIGMOD Intl. Con/. on Management of Data. pages 1- 12 , Seattle, WA, June 1998.
[323] A. Tung, H. J. Lu. J. Han, and L. Feng. Breaking the Barrier of Transactions: Mining Inter-Transaction Association Rules. In Proc. of the 5th Int.!. Con/. on Knowledge Discovery and Data A-fining~ pages 207-301~ San Diego, CA, August 1999.
[324] K. Wang, Y. He. and J. Han. Mining Frequent ltemsets Using Support Constraints. lo Proc. of the 26th VLDB Con/., pages 43-52. Cairo, Egypt, September 2000.
BIBLIOGRAPHY 403
[325] K. Wang, S. H. Tay, and B. Liu. Interestingness-Based Interval Merger for Numeric Association Rules. In Pnx. of the 4th Jntl. Con/. on Knowledge Discovery and Data Mining, pages 121 128. NE"W York, NY. August 1098.
[32GJ G. I. Webb. Preliminary investigations into statistically valid exploratory rule di~ covery. In Proc. of the Australasian Data A-fining Workshop (AwDM03). Canberra., Australia, December 2003.
[327] H. Xiong. X. He, C. Ding, Y. Zhang, V. Kumar, and S. R. Holbrook. Identification of Functional Modules in Protein Complexes via Hypercliqne Pattern Discovery. In Proc. of the Pacific Symposium on Biocompu.ting, (PSB 2005). Maui, January 2005.
[328] H. Xiong. S. S~ekhar, P. N. Tan, and V . Kumar. Exploiting a Support-based Upper Bound of Pearson's Correlation Coefficient for Efficiently Identifying Strongly Corre- lated Pairs. In Proc. of the 10th Intl. Con{. on Knowledge Discovery and Data Mining, pages 334-343, Seattle, WA, August 2004.
[32D] H. Xiong, M. Steinbach, P. N. Tan. and V. Kumar. IUCAP: Hierarchial Clustering wit h Pattern Preservation. In Proc. of the SIAM lntl. Conf. on Data Mining. pages 279-290, Orlando~ FL, April 2004.
[330] H. Xiong, P. N. Tan. and V. Kumar. ?\.'lining Strong Affinity Association Patterns in Data Sets with Skewed Support Distribution. In Proc. of the ~003 IEEE Inti. Ccnf. on Data Mining, pages 387 394, tl.felbourne, FL, 200::J.
[331] X. Yan and J . Han. gSpan: Grapl>-based Substructure Pattern Mining. In Proc. of the QOOQ IEEE Inti. Con f on Data A-fining, pages 721-724, ~.'laebashi City. Japan, December 2002.
[332] C. Yang, U. M. Fayyad. and P. S. Bradley. Efficient discovery of error-tolerant frequent itemsets in high dimensions. In Proc. of the 7th Inti. Conf. on Knowledge Discovery and Data M1ning, pages 104--203, San Francisco, CA, Augus t 2001.
[333] M. J. Zaki. Parallel and Distributed Association Mining: A Survey. IEEE Concurrency. special issue on Pamllel Nfechanis1118 for Data M i ning, 7(4):14-25, Derember 1999.
[::J34] M. J. Zaki. Generating Non-Redundant Association Rules. In Proc. of the 6th Inti. Con/. on Knowledge Disco11ery and Data Mining. pages 34 43, Boston. MA, August 2000.
[335] M. J. Zaki. Efficiently mining frequent trees in a for..t. In Proc. of the 8th Inti. Con/. on Knowledge Discovery and Data Mining, pages 71 80. Edmonton, Canada, July 2002.
[336] M. 1 _ Zaki and M. Orihara. Theoretical foundations of association rules. In Proc. of the 1998 ACAf SIGMOD Workshop on R esearch Jssv.es in Data Afining and Knowledge Discovery, Seattle, WA. June 1098.
[337] M. J. Zaki, S. Parthasarathy, M. Ogihara, and W . Li New Algorithms for Fast Discovery of Association Rules. In Proc. of the 3nl Inti. Con/. on Knowledge Discovery and Data Mtning, pages 283- 286, Newport Beoch, CA, August 1907.
[338] H. Zhang, B. Padmanabhan, and A. Tuzbilin. On tbe Disoovery of Significant Stati~ tical Quantitative Rules. In Proc. of the 10th Intl. Conf. on Knowledge Discovery and Data A-fini ng, pages 374-383, Seattle. \¥A, August 2004.
[339] z. Zhang, Y. Lu, and B. Zhang. An Effective Partioning- C.ombining Algorithm for Discovering Quantitative Associatio n Rules. In Proc. of the 1st Pacific-A sia Conf. on Knowledge Discovery and Data },fining, Singapore, 1997.
[340] N. Zhong, Y. Y. Yao, ~nd S. Ohsuga. Peculiarity Oriented Multi-database Mining. In Proc. of the 3ni European Conf. of Principles and Pmctice of Knou1ledge Discmrery in Databases, pages 136 14G. Prague. Czech Republic, 1999.
404 Chapter 6 Associatio n Analysis
6.10 Exercises
1. For each of the following questions, provide an example of an association rule from the market basket domain that satisfies the following conditions. Also. describe wbether such rules are subjective ly interesting.
(a) A rule that has high support and high confidence .
(b) A rule that has reasonably high support but low confidence.
(c) A rule that has low s upport and low confidence .
(d) A rule that has low support- and high confidence.
2. Consider the data set shown in Table 6.22.
Table 6.22. Example of market basket transactions.
Customer ID Transaction ID Items Bought 1 0001 ~a,d,e) 1 0024 {a.b,c,e) 2 0012 {a,b, d, e) 2 0031 {a.c,d,e) 3 0015 {b,c,e) 3 0022 {b,d,e) 4 0029 {c,d ) 4 0040 {a, b,c) 5 0033 {a.d, e) 5 0038 {a,b,e}
(a) Compute the support for itemsets {e). {b, d}, and {b,d, e) by treating each transection ID as a market b88ket.
(b) Use the results in part (a) to oompute the confidence for the associa- tion rules {b,d) - {e} and {e ) _____, {b,d). Is confidence a symmetric measure?
(c) Repeat part (a) by treating each customer ID as a market basket. Each item should be treated as a binary variable (1 if an item appears in at l east one transaction bought by the customer, and 0 otherwise.)
(d) Use the results in part (c) to compute the confidence for the association rules {b,d) _____, {e) and {e) _, {b, d).
(e) Suppose s 1 and c1 are the support and confidence values of an association rule r when treating each t ransaction ID as a market basket. A lso, let s2 and c2 be t he sup port and confideuce values of r when treatiug each cus. tamer ID as a market b asket. Discuss whether there are any relat ionships between Bt and s2 or r1 e.nd c2.
6.10 Exercises 405
3. (a) What is the confidence for the rules 0 ----> A and A _____, 0?
(b) Let c1 , c, , and c3 be the confidence values of the rules {p} ~ {q) , {p} _____, {q, r ), and {p, r) _____, {q}, respectively. If we assume that. c1 , c2 , and c3 have different values, what are the possible relationships t hat may exist among c ,, c2, and ci ? Which rule h as the lowest confidence'?
(c) Repeat the ane.Jysis in part {b) assuming that the rules have identical support . Which rule has t he highest confidence?
(d) Transitivity: Suppose the confidence of the rules A _____, B and B _____, C are larger than some threshold , mincm1f- Is it possible that A _____, C has a confidence less than m inconf?
4. For each of the following measures, determine whether it is monotone, anti· monotone. or non-monotone (i.e., neither monotone nor anti-monotone) .
Example: Snpport, s = ;!Al is anti-monotone because s(X) ~ s(Y) whenever X c Y.
(a) A characte ristic rule is a rule of the form {p} - {q1 , q2 , ... , qn }, where the rule antecedent contains ouly a single item. An itemset of size k can produce up t<> k chanwteristic rules. Let ( be the minimum confidence of all charact e ristic .rulPS ge nerated from a given itemset:
(({P~oP'l. ---.Pk)) = min[ c([Pd _____, {p,, p,, .. . , pk)),. c({pk} _____, {p,, p, .. . ,pk-d)]
Is ( monotone! anti-monotone! or non-monotone?
( b) A d iscriminant rule is a rule of t he form {p 1.7>2, ... , pn}---> {q} , where the rule consequent contains only a single item. An itemset of size k cau produce up to k discriminant rules. Let ry be the minimum confidence of all discriminant rules generated from a given itemset:
min [ c( {J>.>, p3,. . . ,p>) ----> {pl}), ...
c({p" p,,.- -P•-d _____, {pk})]
Is 17 monotone, anti-monotone, or non-monotone? (c) Repeat the ane.lysis in parts (a) and (b) by replacing the min function
with a max function.
5. P rove Equation 6.3. (Hint : First, count the nun1ber of ways to create an itemset that forms the left hand side of the r ule. Next, for each size k itemset selected for the left-h9Jld side, count the number of ways to choose the remaining d - k items to form t he right-hand side of the rule.)
406 Chapter 6 Associatio n Analysis
Table 6.23. Market basket transactions.
Transaction ID Items Bought 1 {Milk, Beer, Diapers} 2 {Bread. Butter, Milk} 3 {!1-lilk, Diapers, Cookies} 4 {Bread, Butter, Cookies} 5 {Beer, Cookies, Diapers} 6 {Milk, Diapers, Bread, Butter} 7 {Bread, Butter, Diapers} 8 {Beer, Diapers} 9 {Milk, Diapers, Bread, Butter} 10 {Beer, Cookies}
6. Consider the market basket transactions shown in Table 6.23.
(a) What is the maximum number of association rules that can he extracted from this data (including rules that have zero support)?
(b) What is the maximum size of frequent itemsets that can be extracted (assuming m.insup > 0)'?
(c) Write an expression for t he maximum number of size-3 itemsets that can be derived from this data set.
(d) Find an itemset (of size 2 or larger) that has the largest support.
(e) Find a pair of items, a and b, such that the rules {a} ----> {b} and {b} ____, {a} have the same conildence.
7. Consider the following set of frequent. 3-itemsets:
{1 , 2, 3}, {1' 2, 4} , {1, 2, 5}, {1, 3, 4}, {1 , 3, 5 }, {2, 3, 4}, {2, 3 , 5}, {3, 4, 5 }.
Assume that there are only five it,ems in the data set.
(a) List all candidate 4-itemsets obtained hy a candidate generation procedure using the Fk-l x F 1 merging strategy.
(b) List all candidate 4-itemsets obtained by the candidate generation proce- dure in Apriori.
(c) List all candidate 4-itemsets that survive t he candidate pruning step of the Apriori algorithm.
8. The Apriori algorithm uses a genera te-and-count strategy for deriving frequent itemsets. Candidate itemsets o f size k + 1 are created by joining a pair of frequent it,emsets of size k (thls is known as the candidate generation step). A candidate is discarded if any one of its subsets is found to be infrequent during the candidate pnming step. Suppose the Apri01'i algorithm is applied to the
6.10 Exercises 407
Table 6.24. Example of markel basket transactions.
Transaction ID Items Bought 1 {a,b,d, e} 2 {b, c,d} 3 {a,b,d,e} 4 {a.c.d,e} 5 {b,c,d,e} 6 {b, d, e} 7 {c,d} 8 {a,b.c} g {a, d, e} lO {b,d}
data set shown in Thble 6.24 with min sup = 30%, i.e. 1 any itemset occurring in less than 3 transactions is considered to be infrequent.
(a) Draw an itemset lattice representing the data set given in Tahle 6.24. Label each node in t he latt ice with t he following letter(s):
• N: If the it.emset is not considered to be a candidate itemset by the A priori algorithm. There are two reasons for an itemset not to he considered as a candidate itemset: (1) it is not generated at all during the candidate generation step, or (2) it is generated during the candidate generation step hut is suhsequently removed during the candidate pruning step because one of its subsets is found to be infrequent.
• F: If the candidate itemset is found to be frequent by the A priori algorithm.
• 1: If the candidate itemset is found to be infrequent. after support COUllting .
(b) What is the percentage of frequent it.emsets (with respect to all itemsets in the lattice)?
(c) What is t.he pruning ratio of the Apriori algorithm on this data set? (Pruni.ng ratio is defined as the percentage of itemsets not considered to be a candidate because ( 1) they are not generated during candidate generation or (2) they ru:e pruned during the candidate pruning step. )
(d) What is the false alarm rate (i.e, percentage of candidate itemsets that are found to be infrequent after performing support counting)?
9. The Apriori algorithm uses a hash tree data structure t.o efficiently coUllt t.he support of candidate itemsets. Conside r the hash tree for candidate 3-itemsets shown in F igure 6.32.
408 Chapter 6 Association Analysis
Figure 6.32. An example of a hash tree structure.
(a) Given a transaction that contains items {I. 3,4, 5, 8}, which of the hash tree leaf nodes will be visited when finding the candidates of the transao- tion?
(b) Use the visited leaf nodes in part (b) to determine the candidate itemsets that are contained in the transaction {1 ,3, 4 ,5,8} .
10 . Consider the following set of csndidate 3-itemsets:
{1, 2, 3}, {1 , 2, 6}, {1, 3, 4}, {2,3, 4}, {2, 4, 5}, {3 , 4, 6} , { 4, 5, 6}
(a) Construct a hash tree for the above candidate 3-itemsets. Assume the tree uses a hash function where all odd-numbered items are hashed to the left child of a node, while the even-numbered items are hashed to the right child. A candidate k-itemset is inserted into the tree by bashing on each successive item in the candidate and then following the appropriate branch of the t ree according to the hash value. Once a leaf node is reached, the candidate is inserted based on one of the following conditions:
Condition 1: If the depth of the leaf node is equal to k (the root is assumed to be at depth 0), then the candidate is inserted regardless of the number of itemsets already stored at the node.
Condition 2: If the depth of the leaf node is less than k, then tbe candi- date ca.n be inserted as long as the nwnber of iteUlSets stored at the node is less than maxsi: e. Assume mal· size = 2 for this question.
Condition 3: If the depth of the leaf node is less thll.!l k and the number of itemsets stored at the node is equal to mru:size, then the leal node is converted into an internal nodE". New leaf nodes arE' creatf'd as children of the old leaf node. Candidate itemsets previously stored
6.10 Exercises 409
Figure 6.33. An itemset lattice
in the old leaf node are distributed to the children based on their hash values. The new candidate is also hashed to its appropriate leaf node.
(b) How mll.!ly leaf nodes are there in the candidate hash tree? How many internal nodes are there?
(c) Consider a transaction that contains the following items: {1,2,3.5,6}. Using the hash tree constructed in part (a) , which leaf nodes will be checked agains t the transaction? What s.ce the CRlldidate 3-iteiru>:ets con- tained in the t ransaction?
11. Given the lattice structure shown in Figure 6.33 and the transactions given in Table 6.24, label each node with the following letter(s):
• llf if the node is a maximal frequent itemset,
• C if it is a closed frequent itemset,
• N if it is frequent but neither maximal nor closed, and
• I if it is inlreqnent.
Assume that the support threshold is equal t o 30%.
12. The original association rule mining formulation uses the snppon and confi- dence measures to prune ullinteresting rules.
410 Chapter 6 Association Analysis
(a) Draw a contingency table for each of the following rules using the tran»- sctions shown in Table 6.25.
Table 6.25. Example of marl<et basket transactions.
rrtansaction ID Items Bought 1 {a, b, d,e) 2 {b,c,d) 3 {a,b,d,e) 4 {a, c,d.e) 5 {b,c,d,e} 6 {b,d,e) 7 {c,d) 8 {a, b, c) g {a, d. e) 10 {b. d}
Rules: {b) ~ {c), {a} -> {d), {b) ~ {d). {e) -> {c), {c) -> {a}.
(h) Use the contingency tables in part (a) to compute and rank the rnles in decreasing order according to the following measures.
i. Support.
ii. Confidenre.
iii. Interest(X _, Y) = P~·fx~1P(Y}.
. IS(X-Y)=~. IV. v'P(X)P(l')
v. Klosgen(X ~ Y) = J P(X, Y)x(P(YIX)-P(Y)), where P(YIX) = P(X.Y) ~-
. Odd . (X Y) P(X.Y)P~,Y) Vl. S ratiO - = P(X,V)P(,Y ) .
13. Given the rankings you had obtained in Exercise 12, compute the correlation between the rankings of confidence and the other five measnres. Which measure is most highly correlated with confidence? Which measure is least correlated with confidence?
14. Answer the following questions using the data sets shown in Figure 6.34. Note that each data set contains 1000 items !lJld 10,000 transactions. Dark cells indicate the presence of items and white cells indicate the absence of items. We will apply the A priori algorithm to extract frequent itemsets wit h minsup = 10% (i.e., itemsets must be contained in at least 1000 transactions)?
(a) Which data set(s) will produce the most number of frequent itemsets?
6.10 Exercises 411
(b) Which data set(s) will produce the fewest number of frequent itemsets?
(c) Which data set(s) will produce the longest frequent itemset?
(d) Which data set(s} will produce frequent itemsets with highest maximum support?
(e) Which data set(s} will produce frequent itemsets containing items with wide-varying support levels (i.e., items with mixed snpport, ranging from less than 20% to more than 70%).
15. (a) Prove that the ¢coefficient is equal to 1 if and only if /u = ft+ = f +t· (b) Show that if Aa.nd Bare independent, then P(A,B)xP(A,H) = P(A,H) x
P(A,B).
(c) Show that Yule's Q and Y coefficients
Q
y
[ /u/oo - fwfm] /u/oo + /to/ot
[ .JJllToo - .JJlOToll .JJllToo + .JJ10To1 a.re normalized versions of the odds ratio.
(d) Write a simplified expression for the value of each lll€ll.Sure shown in Tables 6.11 and 6.12 when the variables are statistically independent.
16. Consider the interestingness measure, frf = P(~IAJ,(J)(.B). for an sssociation rule A -> B .
(a) What is the range of this measure? \\>'hen does the measure attain its maximum and minimum values?
(b) How does M behave when P(A, B) is increl!S€d while P(A) and P(B) remain unchanged?
(c) How does M behave when P(A) is increased while P(A. B) and P(B) remain unchanged?
(d) How does M behave when P(B) is increased while P(A, B) and P(A) remain unchanged?
(e) Is the m easure symmetric under variable permutation?
(f) What is the value of the measure when A and B are statistically indepen- dent?
(g) Is the measure null-invariant?
(h) Does the me.asure remain invariant under row or column scaling opera- tiOI18?
(i) How does the measure behave under the inversion operation?
412 Chapter 6 Association Analysis
Items
• 2000 "' "' 6 4000 :s u u ~ ~ -,g 6000 ,g
8000 I. - 200 400 600 800
(a) (b)
Items Items
- ·II
2000 ., :g c 0 4000 .Q
~ N " iii 6000 c -I .. F F 8000 200 400 600 800 200 400 600 800
(c) (d)
Items Items
lllllljllll r-- 2000 "' ~ c . Q 4000 . Q 10% are 1s 1l 1l 90%are Os :X :X c 6000 $
(uniformly distributed) $ II I
. I 8000
200 400 600 800 200 400 600 800
(e) (f)
Figure 6.34. Figures for Exercise 14.
2000
4000
6000
8000
2000
4000
6000
8000
2000
4000
6000
8000
6.10 Exercises 413
17. Suppose we have market basket data consisting of 100 transactions and 20 items. If the support for item a is 25%, the support for item b is 90% and the support for itemset {a , b) is 20%. Let the support. and confidence thresholds be 10% and 60%, respect ively .
(a) Compute the confidence of the association rule {a) --; {b). Is the rule interesting according to the confidence measure?
(b) Compute the interest measure for the association pattern {a , b). Describe the nature of the relationship bet.ween item a and item b in terms of the interest measure.
(c) What conclusions can you draw from the results of parts (a) and (b)?
(d) Prove that if the confidence of the rule {a) ~ {b) is less than the support of {b), then:
i. c({l!} ~{b))> c({l!} ~{b)), ii. c{{a) ~ {b}) > s({b)),
where c( ·) denote the rule confidence and s( ·) denote the support of an itemset.
18. Table 6.26 shows a 2 x 2 x 2 contingency table for the binary v!U'iables A and B at different values of the oontrol variable C.
Table 6.26. A Contingency Table.
A
1 0
1 0 15 C=O 8 0 15 30
1 5 0 C=1 8
0 0 15
(a) Compute the ¢coefficient for A and B when C = 0, C = 1, and C = 0 or 1. Note that ¢((A.B}) = P(A.B)-P(A)P(B) •
y' P(A)P(B)(l P(A ))(l P(B) ) (b) What conclusions can you draw from the above result?
19. Consider the contingency tables shown in Table 6.27.
(a) For table I, compute support, the interest measure, and the 1> correla,. tion coefficient for the association pattern {A. B}. Also, compute the confid ence of rules A --> B and B ~ A.
414 Chapter 6 Association Analysis
Table 627. Contingency tables for Exercise 19.
B 11
ACIIIJ A~
(a) Table I.
B 11
~~ A~
(b) Table II.
(b) For table II, compute support, the interest measure, and tbe rP correla- tion coefficient for the association pattern {A, B}. Also, compute the confidence of rules A -> B and B -> A.
(c) What conclusions can you draw from the results of (a) and (b)?
20 . Consider the relationship between customers who buy high-definition televisions and exercise machines as shown in Tables 6.19 and 6.20.
(a) Compute the odds ratios for both tables.
(b) Compute the <P-coefficient for both tables.
(c) Compute the inteiT'St factor for both tables.
For each of the measures given above , describe how the direction of association changes when data i s pooled together instead of being stratified.
I
Cluster Analysis: Basic Concepts and Algorithms
8
Cluster !Lilalysis divides data. into groups (clusters) t hat are mea.ningful, useful, or both. If meanlngful groups a.re the goal, then the clusters should capture the natura.l•tructurc: of the data. In oome casco, hawcv.:r, clwter o.na.l~io ie ooly a useful starting point for other purposes, such aa data. summ.a.:rization. Whether for underat!Lilding or utility, cluster a.nal.ysis has long played a.n import!Lilt role in a. wide Vlll"iety of fields: psychology !Lild other social sciences, biology, statistics, pattern recognition, information retrieval, machine learning, a.nd dllta mining.
There have been many applica.tions of cluster analyois t o practical prol>- lemo. We provide some spedfic examples, ocganized by whether the purpose of the clustering is understanding or utility.
Clustering for Understanding Cl""""", or oonceptually meanJngful groups of objtds tbn.t ,:,hare common cha.racter.iJitia~, pllLy an impartl2llt role in bow people analyze and describe the world. Indeed, human beings are skilled at dividing objects into groupe (clustering) and assigning particular objects t o these groups (classification) . For exa.mple, even relatively young children C!Lil quickly label the objects in • photograph as buildings, vehicles, people, ani- mo.IB, plants, etc. In the context of underetanding data., clusters are potential clllBSes and cluster lloiiB!ysis iB the study of techniques £01 automatica.lly finding classes. The following are some examples:
488 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
• Biology. Biologists have spent many years creating a taxonomy (hi- erarchical classification) of all living thlngs: kingdom, phylum, class, order, family, genus, and species. Thus, it is perhaps not surprising that much of the early work in cluster analysis sought to create a discipline of mathematical taxonomy that could automatically find such classifi- cation structures. More recently, biologists have applied clustering to analyze the large amounts of genetic information that are now available. For example, clustering has been used to find groups of genes that have similar functions.
• Information Retrieval. The World Wide Web consists of billions of Web pages. and the results of a query to a search engine can return thousands of pages. Clustering can be used to group these search re- sults into a small number of clnsters, each of which captures a particular aspect of the query. For instance, a query of ·'movie" might return Web pages grouped into categories such M reviews~ trailers, stars, and theaters. Each category (cluster) can be broken into subcategories (sub- clusters), producing a hierarchical structure that further assists a user's exploration of the query results.
• Climate. Understanding the Earth's climate requires finding patterns in the atmosphere and ocean. To that end, cluster analysis has been applied to find patterns in the atmospheric pressure of polar regions and areas of the ocean that have a significant impact on land climate.
• Psychology and Medicine. An illness or condition frequently has a number of variations, and cluster analysis can be used to identify these different snbcategories. For example, clnstering has been used to identify different types of depression. Cluster analysis can also be used to detect patterns in the spatial or temporal distribution of a disease.
• Business. Businesses collect large amounts of information on current and pote ntial customers. Clustering can b e used to segment customers into a small number of groups for additional analysis and marketing activities.
Clustering for Utility Cluster analysis provides an abstraction from in- dividual data objects to the clusters in whlch those data obje cts reside. Ad- ditionally, some clustering techniques characterize each cluster in t erms of a cluster prototype; i.e., a data object that is representative of the other ob- jects in the cluster. These cluster prototypes can be used as the basis for a
489
number of data analysis or data processing techniques. Therefore, in the con- text of utility, cluster analysis is the study of techniques for finding the most representative cluster prototypes.
• Summarization. Many data analysis techniques, such as regression or PCA, have a time or space complexity of O(m2 ) or higher (where m is the number of objects), and thus, are not practical for large data sets. However, instead of applying the algorithm to the entire data set, it can be applied to a reduced data set consisting only of cluster prototypes. Depending on the type of analysis, the nnmber of prototypes, a nd the accuracy with which the prototypes represent the data, the results can be comparable to thO!<e that would have been obtained if all the data could have been used.
• Compression. Cluster prototypes can also be used for data compres- sion. In particular, a table is created that consists of the prototypes for each cluster; i.e., each prototype is assigned an integer value that is its position (index) in the table. Each object is represented by the index of the prototype associated with its cluster. Thls type of compression is known as vector quantization and is often applied to image, sonnd, and video data, where (l) many of the data objects are highly similar to one a nother, (2) some loss of information is acceptable, and (3) a substantial reduction in the data size is desired.
• Efficiently Finding Nearest Neighbors. Finding nearest neighbors can require computing the pairwise dis tance between all points. Often clusters and their cluster prototypes can be found much more efficiently. If objects are relatively close to the prototype of their cluster, then we can use the prototypes to reduce the number of distance computations that are necessary to find the nearest neighbors of an object. Intuitively, if two cluster prototypes are far apart, then the objects in the corresponding clusters cannot be nearest neighbors of each other. Conseqnently, to find an object's nearest neighbors it is only necessary to compute the distance to objects in nearby clusters, where the nearness of two clusters is measured by the distance between their prototypes. This idea is made more precise in Exercise 25 on page 94.
This chapter provides an introduction to cluster analysis. We begin with a high-level overview of clustering, including a discussion of the various ap- proaches to dividing objects into sets of clusters and the different types of clusters. We then describe tbree specific clustering techniques t hat represent
490 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
broad categories of algorithms and illustrate a variety of concepts: K-means, agglomerative hierarchical clustering, and DBSCAN. The final section of this chapter is devoted to cluster validity-methods for evaluating the goodness of the clusters produced by a c.lustering algorithm. More advanced clustering concepts and algorithms will be discussed in Chapter 9. Whenever possible, we discuss the strengths and weakne&Ses of different schemes. In addition, the bibliographic notes provide references to relevant books and papers that explore cluster analysis in greater depth.
8.1 Overview
Before discussing specific clustering techniques, we provide some necessary background. First, we further define cluster analysis, illustrating why it is difficult and explaining its relationship to other techniques that group data. Then we explore two important topics: (1) different ways to group a set of objects into a set of clusters, and (2) types of clusters.
8 .1.1 What Is Cluster Analysis?
Cluster analysis groups data objects based only on information found in the data that describes the objects and their relationships. The goal is that the objects within a group be similar (or related) to one another and rlilferent from (or unrelated to) the objects in other groups. The greater the similarity (or homoge neity) within a group and the greater the rlifference between groups, the better or more distinct the clustering.
In many applications, the notion of a cluster is not well defined. To better understand the difficulty of deciding what constitutes a cluster, consider Figure 8.1, which shows twenty points and three different ways of dividing theru into clusters. The shapes of the markers indicate cluster membership. Figures 8.l(b) and 8.l(d) divide the data into two and six parts, respectively. However, the apparent division of each of the two larger clusters into three subclusters may simply be an artifact of the human visual system. Also, it may not be unreasonable to say that the points form four clusters, as shown in Figure 8.l(c). This figure illustrates that the definition of a cluster is in1precise and that the best definition depends on the nature of d at a and the d esired results.
Cluster analysis is related to other techniques that are used to divide data objects into groups. For instance, clustering can be regarded as a form of classification in that it creates a labeling of objects with class (cluster) labels. However, it derives these labels only from the d ata. In contrast, classification
.. . . . . . . • •• . .. .. (a) Origina.l points.
+.t+ + + •• + . * ·· .. : . ..
(c) Four clusters.
Yo • • • •• •
8.1 Overview 491
. .. . . . .. .. (b) Two clusters.
* ** • I •••••
(d) Six clusters.
Figure 8.1. Di~"'nt weys of clustering the same set of points.
in the sense of Chapter 4 is supervised classification; i.e. , new, unlabeled objects are assigned a elMS label using a model d eveloped from objects with known class labels . For this reason, cluster analysis is sometimes referred to as unsupervised classification. When the term classification is used without any qualification within data mining, it typically refers to supervised classification.
Also, while the terms segmentation and partitioning are sometimes used as synonyms for clustering, these terms are frequently used for approaches outside the trarlitional bounds of cluster analysis. For example, the term partitioning is often used in connection with techniques that divide graphs into subgraphs and that are not strongly connected to clustering. Segmentation often refers to the division of data into groups using simple techniques; e.g. , an image can be split into segments based only on pixel intensity and color, or people can be divided into groups based on their income. Nonetheless, some work in graph partitioning and in image and market segmentation is related to clus ter analysis.
8 .1.2 Different Types of Clusterings
An entire collection of clusters is commonly referred to as a clustering, and in this section, we distinguish vario us types of clnsterings: hierarchical (nested) versus partitional ( unnested) , exclusive versus overlapping versus fuzzy, and complete versus partial.
Hierarchical versus Partitional The ma.;t commonly discussed rlistinc- tion among different types of clusterings is whether the set of clusters is nested
492 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
or unnested, or in more traditional terminology. hierarchical or partitional. A partitional clustering is simply a division of the set of data objects into non-overlapping subsets (clusters) such that each data object is in exactly one subset. Taken individually, each collection of clusters in Figures 8.1 (b--d) is a parti tiona! clustering.
If we permit clusters to have subclusters, then we obtain a h.ierarchlcal clustering, which is a set of nested clusters that are organized as a tree. Each node (cluster) in the tree (except for the leaf nodes) is the union of its children (subclusters), and tbe root of the tree is the cluster containing all the objects. Often, but not always, the leaves of the tree are singleton clusters of individual data objects. If we allow clusters to be nested, then one interpretation of Figure 8.1(a) is that it has two subclusters (Figure 8.1(b)). each of which, in turn, bas three subclusters (Figure 8.l(d)). The clusters shown in Figures 8.1 {a-d), when taken in that order, also form a hierarchical (nested) clustering with, respective1y, 1, 2, 4, and 6 clUJSters on each level. FinaUy, note that a hierarchical clustering can be viewed as a sequence of partitional clusterings and a partitionaJ clustering can be obtained by taking any member of that sequence; i.e., by cutting the hierarchical tree at a particular level.
Exclusive versus Overlapping versus Fuzzy The clusterings shown in Figure 8.1 are all exclusive, as they assign each object to a single cluster. There are many situations in which a point could reasonably be placed in more than one cluster, and these situations are better addressed by non-exclusive clustering. In the most general sense, an overlapping or non-exclusive
clustering is used to reflect the fact that an object can simultaneously belong to more than one group (class) . For instance, a person at a university can be both an enrolled student and an employee of the university. A non-exclusive clustering is also often nsed when, for example, an object is '"'between" two
or more clusters and could reasonably be assigned to any of these clusters. Imagine a point halfway between two of the clusters of Figure 8.1. Rather than make a somewhat arbitrary assignment of the object to a single cluster, it is placed in all of the "equally good" clusters.
In a fuzzy clustering. every object belongs to every cluste r with a mem- bership weight that is between 0 (absolutely doesn't belong) and 1 (absolutely belongs). In other words, clusters are treated as fuzzy sets. (Mathematically, a fuzzy set is one in which an object belongs to any set with a weight that is between 0 and 1. In fuzzy clustering, we often impose the additional con- straint that the sum of the weights for each object must equal 1.) Similarly, probabilistic clustering techniques compute tbe probability with whicb each
8.1 Overview 493
point belongs to each cluster, and these probabilities must also sum to 1. Be- cause the membership weights or probabilities for any object sum to 1, a fuzzy or probabilistic clustering does not address true multiclass situations, such as the case of a student employee, where an object belongs to multiple classes. Instead, these approaches rue most appropriate for avoiding the arbitrariness of assigning an object to only one cluster when it may be close to seve.ral. In practice, a fuzzy or probabilistic clustering is often converted to an exclusive clustering by assigning each object to the cluster in which its membership weight or probability is highest.
Complete versus Partial A complete clustering assigns every object to a cluster, whereas a partial clustering does not. The motivation for a partial clustering is that some objects in a data set may not belong to well-defined groups. Many times objects in the data set may represent noise, outliers, or "'uninteresting background." For example, some ne.wspaper stories may share a common theme, such as global warming, while other stories are more generic or one-of-a-kind. Thus, to find the important topics in last month's stories, we may want to search only for clusters of documents that are tightly related by a common theme. In other cases, a complete clustering of the objects is desired. For example, an application that uses clustering to organize documents for browsing needs to guarantee that all documents can be browsed.
8.1.3 Different Types of Clusters
Clustering aims to find useful groups of objects (clusters), where usefulness is defined by the goals of the data analysis. Not surprisingly. there are several different notious of a cluster that prove useful in practice. In order to visnaJly illustrate the differences among these types of clusters, we use two-dimensional points, as shown in Figure 8.2, as our data objects. We stress, however, that the types of clusters described here are equally vaJid for other kinds of data.
Well- Se para ted A cluster is a set of objects in which each object is closer (or more similar) to every other object in the cluster than to any object not in the cluster. Sometimes a threshold is used to specify tbat aJI the objects in a cluster must be sufficiently close (or similar) to one another. This idealistic definition of a cluster is satisfied only when the data contaius natural clusters that are quite far from each other. Figure 8.2(a) gives an example of well- separated clusters that comists of two groups of points in a two-dimensional space. The distance between any two points in different groups is larger than
494 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
the distance between any two points within a group. Well-separated clusters do not need to be globular, but can have any shape.
Prototype-Based A cluster is a set of objects in whlch each object is closer (more similar) to the prototype that defines the cluster than to the prototype of any other cluster. For data with continuous attributes, the prototype of a duster is often a centroid, i.e., the average (mean) of all the points in the dns- ter. When a centroid is not meaningful, such as when the data has categorical attributes, the prototype is often a medoid, i.e., the most representative point of a cluster. For many types of data, the prototype can be regarded as the most central point, and in such instances, we commonly refer to prototype-
based clusters as center- based clusters. Not surprisingly, such clusters tend to be globular. Figure 8.2(b) shows an example of cente.r-based clusters.
Graph-Based If the data is represented as a graph. where the nodes are objects and the links represent connections among objects (see Section 2.1.2), then a cluster can be defined as a connected component: i.e., a group of objects that are connected to one another, but that have no connection to objects outside the group. An important example of graph-based clusters are contiguity-based clusters , where two objects are connected ouly if they are withln a specified distance of each other. This implies that each object in a contiguity-based cluster is closer to some other object in the cluster than to any point in a different cluster. Figure 8.2( c) shows an example of such clusters for two-dimensional points. This definition of a cluster is useful when clusters
are irregular or intertwined, but can have trouble when noise is present since, as illustrated by the two spherical clusters of Figure 8.2(c), a small bridge of points can merge two distinct clusters.
Other types of graph-based clusters are also possible. One such approach (Section 8.3.2) defines a cluster as a clique; i.e., a set of nodes in a graph that are completely connected to each other. Specifically, if we add connections between objects in the order of tbeir distance from one another, a cluster is formed when a set of objects forms a clique. Like prototype-based clusters, such clusters tend to be globular.
Density-Based A cluster is a dense region of objects that is surrounded by a region of low density. Figure 8.2( d) shows some density-based clusters for data created by adding noise to the data of Figure 8.2(c). The two circular clusters are not merged, as in Figure 8.2(c), because the bridge between them fades into the noise. Likewise, the curve that is present in Figure 8.2(c) also
8.1 Overview 495
fades into the noise and does not form a cluster in Figure 8.2(d). A density- based definition of a cluster is often employed when the clusters are irregular or intertwined, and when noise and outliers are present. By contrast. a contiguity- based definition of a cluster would not work well for the data of Figure 8.2{d) since the noise would tend to form bridges between clusters.
Shared-Property (Conceptual Clusters) More generally, we can define a cluster as a set of objects that share some property. This definition enoom- passes all the previous definitions of a cluster; e.g., objects in a center-based cluster share the property that they are all closest to the same centroid or medoid. However, tbe shared-property approach also includes new types of clusters. Consider the clusters shown in Figure 8.2(e). A triangular area (cluster) is adjacent to a rectangular one, and there are two intertwined circles (clusters). In both cases, a clustering algorithm would need a very specific concept of a cluster to successfully detect these clusters. The process of find- ing such clusters is called conceptual clustering. However, too sophisticated a notion of a cluster would take us into the area of pattern recognition, and thns, we only consider sim.pler types of clusters in this book.
Road Map
In this chapter, we use the following three simple, but important techniques to introduce many of the concepts involved in cluster analysis.
• K -means. This is a prototype-based, partitional clustering technique that attempts to find a user-specified number of clusters (K), whlch are represented by their centroids.
• Agglomerative Hierarchical Clustering. Thls clustering approach refers to a collection of closely related clustering techniques that produce a hierarchical clustering by starting with each point as a singleton cluster and then repeatedly merging the two closest clusters until a single, all- encompassing cluster remains. Some of these techniques have a natural interpretation in terms of graph-based clustering, whlle others have an interpretation in terms of a prototype-based approach.
• DBSCAN. This is a density-based clustering algorithm that produces a partitional clustering, in which the number of clusters is a utomatically determined by the algorithm. Points in low-density regions are classi- fied as noise and omitted; thns, DBSCAN does not produce a complete clustering.
496 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
0 0 (a) Well-separated clusters. Ea.ch point is closer to all of the points in its cluster than to any point in another duster.
(c) CQntiguity-ba5ed dusters. Each po int is closer to at. least one point in its duster than to any point in another duster.
(b) Cenrer-based clusters. Eocb point is closer to the center of its cluster than to the center of any other cluster.
(d) Density-based clusters. Clus- ters are regions or high density sep- ara.tOO by regions of low density.
(e-) Conce-ptual clusters. Points in a cluster share some general property that derives from the entire set of points. (Points in the intersec tion of the circles belong to both.)
Figure 8.2. Different types of clusters as illuslmled by sets of two-dimensional points.
8.2 K-means
Prototype-based clustering techniques create a one-level partitioning of the data objects. There are a number of such teclmiques, hut two of the most prominent are K-means a nd K-medoid. K-means defines a prototype in terms of a centroid, whlch is usually the mean of a group of points, lUld is typically
8.2 K-means 497
applied to objects in a continuous n-dimensional space. K-medoid defines a prototype in terms of a medoid, whlch is the most representative point for a group of points, and can be applied to a wide range of data since it requires only a proximity measure for a pair of objects. While a centroid almost never corresponds to an actual data point, a m edoid, by its definition, must be an actual data point. In this section, we will focus solely on K-means, whlch is one of the oldest and most widely used clustering algorithms.
8.2.1 The Basic K-means Algorithm
The K-means clustering technique is simple, and we begin with a description of the basic algorithm. We first choose K initial centroidB~ where K is a user- specified parameter. namely, the number of clusters desired. Each point is then assigned to the closest centroid, and each coUection of points assigned to a centroid is a cluster. The centroid of each cluster is then updated based on the points assigned to the cluster. We repeat the assignment and update steps until no point changes clusters, or equivalently, until the centroids remain the same .
K-means is formally described by Algorithm B. I. The operation ofK-means is illustrated in Figure 8.3, whlch shows how, starting from three centroids, the final clusters are found in four assignment-update steps. In these and other figures displaying K-means clustering, each s ubfigure shows (1) the centroids at the start of the iteration and {2) the assignment of the points to those centroids. The centroids are indicated by the "+" symbol; aU points belonging to the same cluster have the same marker shape.
Algorithm 8 . 1 Basic K-means algorithm. 1: Select K points as initial centroids. 2: repeat 3: Form K clusters by assigning each point to its closest centroid. 4: Recompute the centroid of each cluster. 5: until Centroids do not change.
In the first step, shown in Figure 8.3(a), points are assigned to the initial centroids, which are all in the larger group of points. For this example, we use the mean as the centroid. After points are assigned to a centroid, the centroid is then updated. Again, the figure for each step shows the centroid at the heginning of the step and the assignment of points to those centroids. In the second step, points are assigned t o the updated centroids, and the centroids
498 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
"' "' "' "' "' "' "' "' 6 t: 66 6 6 ~: {!,.6.6 "'"'"' "'"' "' 6 .t::.t:. 6 A :!D..t::.L'l.r:.
0. 66.t:. "'"'~ "'"'" 0 ~ ~~~~ 6 1:!. 6e.6ll
6 6 6 l'l 6. 66~66.6 6 6 6 n.6~6.o.l:J. 6. 6. 6866.t:J. ~ :.t::..g6ag ~ ~~266~ o -t9~o 8
0 0 t:.l:J."'ll, 8
0 0 " 0 "' " 0 " f o + 0 0 oo
~ co
8ft ao
~0 oO
c Da 0 D o [] 0 Ll[)~[] 00~0 8fo 0 c 0 0 c 0 oo oo (a) Iteration 1. (b) Iteration 2. (c) Iteration 3. (d) Iteration 4.
Figure 11.3. Using the K-means algorithm to find three clusters in sample data.
are updated again. In steps 2, 3, and 4, which are shown in Figures 8.3 (b), (c), and (d), respect ively, two of the cent roids move to the two small groups of points at the bottom of the figures. When the K-means algorithm terminates in Figure 8.3( d ), because no more changes occur
1 the centroids have identified
the natural groupings of points. For some combin ations of proximi ty functions and types of centroids, K-
means always converges to a solution; i.e., K-means reaches a state in w hich no points are shifting from one cluster to another, and hence, the centroids don't change. Because most of the convergence occurs in the early steps, however, the condition on line 5 of Algorithm 8.1 is often replaced by a weaker condition, e.g .. repeat until only 1% of the points change clusters.
We consider each of the steps in the basic K-mea.ns algorithm in more detail and then provide an analysis of the algorithm's space and time oomplexity.
Assigning Points to t h e Closest C entroid
To assign a point to the closest centroid, we need a proximity measure that quantifies the notion of '~dosest" for the specific data under consideration. Euclidean (Lz) distance is often used for data points in Euclidean space, while cosine similarity is more appropriate for documents. However, there may be several types of proximity measures that are appropriate for a given type of data. For example, Manhattan (L1 ) distance can be used for Euclidean data, while the Jaccard measure is often employed for documents.
Usually, the similarity measures used for K-means are relatively simple since the algorithm repeatedly calculates the similarity of each point to each centroid. In some cases 1 however, such as w hen the data is in low-dimensional
8.2 K-means 499
Table 8.1. Table of notation. Symbol Description
X An object. c, The ith cluster. C; The centroid of cluster C,. c The centroid of all points.
11loj Tile number of objects iu the ;th duster. m The number of objects in the data set. K The number of clusters.
Euclidean space, it is possible to avoid computing many of the similarities, thus significantly speeding up the K-means algorithm. Bisecting K-means (described in Section 8.2.3) is another approach that speeds up K-means by reducing the number of similarities computed.
Centroids and Objective Functions
Step 4 o f the K-means algorithm was stated rather generally as "recompute the centroid of each cluster," since the centroid can vary, depending on the proximity measure for the data and the goal of the clustering. The goal of the clustering is typically expressed by an objective function that depends on the proximities of the points to one another or to the cluster centroids; e.g., minimize the squared distance of each point to its closest centroid. We illus- trate this with two examples. However, the key point is this: once we have specified a proximity measure and an objective function, the centroid that we should choose can often be determined mathematically. We provide mathe- matical details in Section 8.2.6, and provide a non-mathematical discussion of this observation here.
Data in Euclidean Space Consider data whose proximity measure is Eu- clidean distance. For our objective function, which measures the quality of a clnstering, we use the sum of the squared error (SSE), which is also known as scatter. In other words, we calculate the error of each data point, i.e., its Euclidean distance to the closest centroid, and then compute the total sum of the squared errors . Given t wo different sets of clusters that are produced by two diHe rent runs of K-meanB 1 we prefer the one with the smallest squared error since this m eans that the prototypes (centroids) of this clustering are a better representation of the points in their cluster. Using the notation in Table 8.1, the SSE is formally defined as follows:
500 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
K
SSE= L L dist(c;, x) 2 (8.1) i=l xEC,
where dist is the standard Euclidean (L,) distance between two ohjects in Euclidean space.
Given these assumptions, it can he shown (see Section 8.2.6) that the centroid that minimizes the SSE of the cluster is the mean. Using the notation in Tahle 8.1, the centroid (mean) of the ;th cluster is defined by Equation 8.2.
1 c; = - I;x
m; xEC.: (8.2)
To illustrate, the centroid of a cluster containing the three two-dimensional
points, (1,1), (2,3), and (6,2), is ((1 + 2 + 6)/3, ((1 + 3 + 2)/3) = (3, 2). Steps 3 and 4 of tbe K-means algorithm directly attempt to minimize
the SSE (or more generally, t he objective function) . Step 3 forms clusters hy assigning points to their nearest centroid, which minimizes the SSE for the given set of centroids. Step 4 recomputes the centroids so as to further minimize the SSE. However, the actions of K-means in Steps 3 and 4 are only guaranteed to find a local minimum with respect to the SSE since they are based on optimizing the SSE for specific choices of the centroids and clusters, rathe r than for all possible choices. We will lat e r see an example in which this leads to a suboptimal clustering.
Document Data To illustrate that K-means is not restricted to data in Euclidean space, we consider document data and the cosine sinlilarity measure . Here we assume that the document data is represented as a document-term matrix as described on page 31. Our objective is to maximize the similarity of the documents in a cluster to the cluster centroid; this quantity is known as tbe cohesion of tbe cluster . For this objective it can be shown that the cluster centroid is. as for Euclidean data, the m ean. The analogous quantity to the total SSE is the total cohesion, which is given by Equ ation 8.3.
K
Total Cohesion = L L cosine(x.c; ) i =l x ECa
(8.3)
The General Case There are a numbe r of choices for the proximity func- tion, centroid, and objective function that can be used in the basic K-means
8.2 K-means 501
Table 8.2. K-means: Common choices for proximity, centroids, and objective functions.
Proximity FUnction Centroid Objective Function Manhattan (1.) median Minimize sum of the 1 1 distance of an ob-
ject to its cluster centroid Squared l!:uclidean (L~) mean 1\'linimize sum of the squared L, distance
of BJl object to its duster centroid cailne mesn IV[aximize sum of the cosine similarity of
an object to its cluster centroid Bregman divergence mean IVIinimize sum of the Bregman diverge-nce
of BJl object to its cluster centroid
algorithm and that are guaranteed to converge. Table 8.2 shows some possible choices, including the two that we have just discussed. Notice that for Man- hattan (L1 ) distance and the objective of minimizing the sum of the distances, the appropria te centroid is the median of the points in a cluster.
The last entry in the table, Bregman divergence (Section 2.4.5), is actnally a class of proximity measures that includes the squared Euclidean distance, L~ . the Mahalano bis distance, and cosine similarity. The importance of Bregman divergence functions is that any such function can be used as the basis of a K- means style clustering algorithm with the mean as the centroid. Specifically, if we use a Bregman divergence as our proximity function, then the result- ing clnstering algorithm has the usua1 properties of K-mearu; with respect to converge nce, local minima, etc. Furthermore, the properties of such a cluster- ing algorithm can be developed for all possible Bregman divergences. Indeed, K-means algorithms that use cosine similarity or squared Euclidean dista nce are particular instances of a general clustering algorithm based on Bregman divergences.
For the rest our K-means discussion, we use two-dimensional data since it is easy to explain K- means and its properties for this type of data. But, as suggested by the last few paragraphs, K-means is a very ge neral clustering algorithm and can be used with a wide variety of data types, such as documents and time series.
Choosing Initial Centroids
When random initialization of centroids is used, different runs of K-means typically produce different total SSEs. We illustrate this with the set of two- dimensional points shown in F igure 8.3, which has three natural clusters of points. Figure 8.4(a) shows a clustering solution that is the global minimum of
502 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
g~ 00
(a) Optin1aJ clustering. (b) Suboptimal clustering.
Figure 8.4. Throo optimal and non-optimal clusters.
the SSE for three clusters, while Figure 8.4(b) shows a suboptimal clustering that is only a local minimum.
Choosing the proper initial centroids is the key step of the basic K-means procedure. A cormnon approach is to choose the initial centroids randomly, but the resulting clusters are often poor.
Example 8.1 (Poor Initial Centroids). Randomly selected initial cen- troids may be poor. We provide an example of this using the same data set used in Figures 8.3 and 8.4. Figures 8.3 and 8.5 show tbe clusters that re- sult from two particular choices of iuitial centroids. (For both figures, the positions of the cluster centroids in the various iterations are indicated by crosses.) In Figure 8.3, even though all the initial centroids are from one natu- ral cluster, the minimum SSE clustering is still found. In Figure 8.5, however, even though the initial centroids seem to he better distributed, we obtain a suboptimal clustering, with higher squared error. •
Example 8.2 (Limits of Random Initialization). One technique that is commonly used to address the problem of choosing initial centroids is to perform multiple runs, each with a different set of randomly chosen initial centroids, and then seloct tbe set of clusters with the minimum SSE. While simple~ tbis strategy may not work very wel1, depending on tbe data set and the number of clusters sought. We demonstrate this using the sample data set sbown in Figure 8.6(a). The data consists of two pairs of clusters, where the clusters in each (top-bottom) pair are closer to each other than to the clusters in the other pair. Figure 8.6 (b-d) shows that if we s tart with two initial centroids per pair of clusters, then even when both centroids are in a single
oo Cl Cl+[]
0 0
(a) Iteration I.
8.2 K-means 503
(b) Iteration 2. (c) Iteration 3.
Figure 8.5. Poor starting centroids forK-means.
0 6 . ' . ~b. ft-66 6
o~00a 66 61\ ~ oo~cog
0 " c
(d) Iteration 4.
cluster the centroids will redistribute themselves so that the "true" clusters are fou'nd. However, Figure 8. 7 shows that if a pair of clusters has only one initial centroid and the other pair has three, then two of the true clusters will be combined and o ne true cluster will be split.
Note that an optimal clustering will be obtained as long as two initial centroids fall anywhere in a pair of clusters, since the centroids will redistribute themselves, one to each cluster. Unfortunately, as the number of clusters becomes larger, it is increasingly likely tbat at least one pair of clusters will have only one initial centroid. (See Exercise 4 on page 559.) In this case, because the pairs of clusters are farther apart than clusters within a pair, the K-means algorit hm will not redistribute the centroids between pairs of clusters, and thus, only a local minimum will be achieved. •
B ecause of the problems with using randomly selected initial centroids, which even repeated runs may not overcome, other techniques are often em- ployed for initialization. One effective approach is to take a sample of points and cluster them using a hierarchical dustering technique. K clusters are ex- tracted from the hierarchical clustering, and the centroids of those clusters are used as the initial centroids. This approach often works well, but is practical only if (1) the sample is relatively small, e.g., a few hundred to a few thousand (hierarchical clustering is expensive), and (2) K is relatively small compared to the sample size.
The following procedure is another approach to selecting initial centroids. Select the first point at random or take the centroid of all points. Then, for each successive initial centroid, select the point that is farthest from any of t he initial centroids already selected. In this way, we obtain a set of initial
504 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
~ ~
"'~~ D. ~6~ 0
D. r:.t:J. 6
"' 0 oc 0
0 0 0
D 00 ~ 0
(a) Initial points.
o o o o 0 0 0
c ~[]0
(c) Iteration 2.
0
0 0 0
~0~0 0 0 0
Do 0
0
oooog oO o
0 0 0
"""0
"' "' "'"'"' "' "'"' ""'"' £:.6,{!, CJ.
l'.
(b) Iteration I.
(d) Iteration 3.
0
oooo g oo o
0 0 Q
Do 0
Figure 8.6. Two pairs of clusters with a pair of initial centroids within each pair of dusters.
centroids that is guaranteed to be not only randomly selected hut also well separated. Unfortunately, s uch an approach can select outliers, rather thru1 points in dense regions (clusters). Also, it is expensive to compute the farthest point from the current set of initial centroids. To overcome these problems, this approach is often applied to a sample of the points. Since outliers are rare, they tend not to show up in a random sample. In contrast, points from every dense region are likely to be include d unless the sample size is very small. ALso, the computation involved in finding the initial centroids is greatly reduced because the srunple size is typically much smaller than the number of points.
Later on, we will discuss two other approaches that are useful for produc- ing better-quality (lower SSE) clusterings: using a variant of K-means that
+ ~
6 £:,.0. 6. ~ ~ ~
6. ~~6 ~ l'.
(a) Iteration 1.
~ ~
l'. "'~ " ~ l'. ~[', 6
6. l:l,6 D.
6
+ ~
D. t::.t:J. b. "'6 6
0 0 D. t::. 66
" 6
(c) Iteration 3.
0
0 o o ~o~o
0 0 0
D o 0
8.2 K-means 505
~ "' "'"'"'
D. l:l.ll.~ 6 l'J.t::.ll. 6
" +
+
o" _z c "17
c o 4a _57 0 0 v
(b) Iteration 2.
Do 0
(d) Iteration 4.
Figurl! 8.7. Two pairs of clusters with marl! or fewer than two initial centroids wnhin a pair of clusters.
is less susceptible to initialization problems (bisecting K- means) and using postprocessing to "fixnp'' the set of clust ers produced.
Time and Space Complexity
The space requirements for K-meru1s are modest b ecause only the data points and centroids are stored. Specifically, the storage required is O((m + K)n), where m is the number of points and n is the number of attributes. The time requirements for K-means are also modest-basically linear in the number of data points. In particular, t he time required is O(I * K * m • n), where I is the number of iterations required for convergence. As n1entioned, I is often small and can usually be safely bounded, as most changes typically occur in the
506 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
first few iterations. Therefore, K-means is linear in m, the number of points, and is efficient as well as simple provided tbat K, the number of clusters, is significantly less than m.
8.2.2 K-means: Additional Issues
Handling Empty Clusters
Oue of the problems with the basic K-meaos algorithm given earlier is that empty clusters can be obtained if no points are allocated to a cluster during the assignment step. If this happens, then a strategy is needed to chonse a replacement centroid, since otherwise, the squared error will be larger than necessary. One approach is to choose the point that is farthest away from any current centroid. If nothing else. this eliminates the point that currently contributes most to tbe total squared error. Another approach is to choose the replaceme nt centroid from the cluster that has the highest SSE. This will typically split the cluster and reduce the overall SSE of the clustering. If there are several empty clusters, then this process can he repeated several times.
Outliers
When the squared error criterion is used, outliers can unduly influence the clusters that are found. In particular, when outliers are present, the resulting cluster centroids (prototypes) may not be as representative as they otherwise would be and thus, the SSE will be higher as well. Because of this, it is often
useful to discover outliers and eliminate them b eforehand. It is important, however, to appreciate that there are certain clustering applications for which outliers should not be eliminated. When clustering is used for data com- pression, every point must be clustered , and in some cases, such as financial analysis, apparent outliers, e.g., unusually profitable customers, can be the most interesting points.
An obvious issue is how to identify outliers. A nwnber of techniques for identifying outliers will be discussed in Chapter 10. If we use approaches that remove outliers before clustering, we avoid clustering points that will not clus- ter well. Alternatively, outliers can also be identified in a postprocessing step. For instance, we can keep t rack of the SSE contributed by each point, and eliminate those points with unusually high contributions, especially over mul- tiple runs. Also , we may want to eliminate small clusters s ince they frequently represent groups of outliers.
8.2 K-means 507
Reducing the SSE with Postprocessing
An obvious way to reduce the SSE is to find more clusters, i.e. , to use a larger K. However, in many cases, we would like to improve the SSE, but don't want to increase the number of clusters. This is often possible because K- means typically converges to a local mirumwn. Various techniques are used to "fix up" the resulting clusters in order to produce a clustering that has lower SSE. The s trategy is to focus on individual clusters since the total SSE is simply the sum of the SSE contributed by each cluster. (We will use the terminology total SSE aud cluster SSE, respectively, to avoid any potential confusion.) We can change the total SSE by performing various operations on the clusters, such as splitting or merging clusters . One conunonly used approach is to use alternate cluster splitting and merging phases. During a splittiug phase1 clusters are divided, while during a merging phase, clusters are combined. In this way, it is often possible to escape local SSE minima and still produce a clustering solution with the desired number of clusters. The following are some techniques used in the splitting and merging phases.
Two strategies that decrease the total SSE by increasing the number of clusters are the following:
Split a cluster: The cluster with the largest SSE is usually chnsen, but we could also split the cluster with the largest standard deviation for one particular attribute .
Introduce a new cluster centroid: Often the point that is farthest from any cluster center is chosen. We can easily deterrn.ine this if we keep track of the SSE contributed by each point. Another approach is to choose randomly from all points or from the points with tbe highest SSE.
Two strategies that decrease the number of clusters, while trying to mini- mize the increase in total SSE, are the following:
Disperse a cluster: This is accomplished by removing the centroid that cor- relponds to t he clnster and reassigning tbe points to other clusters. Ide- ally, the cluster that is dispersed should be the one that increases the total SSE the least.
Merge two clusters: The clusters with the closest centroids are typically chosen, although another, perhaps better, approach is to merge the two clusters that relult in the smallest increase in total SSE. These two merging strategies are the same ones that a:re used in the hierarchical
508 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
clustering techniques known as the centroid method and Ward's method, respectively. Both methods are discussed in Section 8.3.
Updating Centroids Incrementally
Instead of updating cluster centroids after all points have been assigned to a cluster, the centroids can be updated incrementally, after each assignment of a point to a cluster. Notice that this requires either zero or two updates to cluster centroids at each step, since a point either moves to a new cluster (two updates) or stays in its current cluster (zero updates). Using an incremental update strategy guarantees that empty clusters are not produced since all clusters start with a single point~ and if a cluster ever has only one point, then that point will always be reassigned to the same cluster.
In addition, if incremental updating is used. the relative weight of the point being added may be adjusted; e.g., the weight of points is often decreased as the clustering proceeds. While this can re:mlt in better accuracy and faster convergence, it can be difficult to make a good choice for the relative weight, especially in a wide variety of situations. These update issues are similar to those involved in updating weights for artificial neural networks.
Yet another benefit of incremental updates has to do with using objectives other than "minimize SSE." Suppose that we are given an arbitrary objective function to measure the goodness of a set of clusters. When we process an individual point, we can compute the value of the objective function for each possible cluster assignment, and then choose the one that optimizes the objec- tive. Specific examples of alternative objective functions are given in Section 8.5.2.
On the negative side, updating centroids incrementally introduces an or- der dependency. In other words, the clusters produced may depend on the order in which the points are processed. Although this can be addressed hy randomizing the order in which the points are processed, the basic K-mean.s approach of updating the centroids after all points have been assigned to clns- ters has no order dependency. Also, incremental updates are slightly more expensive. However, K-means converges rather quickly, and therefore, the numher of points switching clusters quickly becomes relatively small.
8 .2.3 Bisecting K-means
The bisecting K-means algorithm is a straightforward extension of the basic K-means algorithm that is based on a simple idea: to obtain K clnsters, split the set of all points into two clusters, select one of these clusters to split, and
8.2 K-means 509
so on. until K clusters have been produced. The details of bisecting K-mean.s are given by Algorithm 8.2.
Algorithm 8.2 Bisecting K-means algorithm. 1: Initialize the list of clusters to contain the cluster consisting of all points. 2: repeat 3: Remove a cluster from the list of clusters. 4: {Perform several "trial" bisections of the chosen cluster.} 5: fori = 1 to number of trials do 6: Bisect the selected duster using basic K-means. 7: end for 8: Select the two clusters from the bisection with the lowest total SSE. 9 : Add these two clusters to the list of clusters.
10: until Until the list of clusters contains K clusters.
There are a number of different ways to choose which cluster to split. We can choose the largest cluster at each step, choose the one with the largest SSE, or use a criterion based on both size and SSE. Different choices result in different clusters.
We often refine the resulting clusters by nsing their centroids as the initial centroids for the basic K-means algorithm. This is necessary because, although the K-means algorithm is guaxanteed to lind a clustering that represents a local minimum with respect to the SSE, in bisecting K-means we are using the K- mean.s algorithm "locally," i.e., to bisect individual clusters . Therefore, the final set of clnsters does not represent a clustering that is a local minimum with respect to the total SSE.
Example 8.3 (Bisecting K-means and Initialization). To illustrate that bisecting K-means is Jess susceptible to initialization prob1ems, we show, in Figure 8.8, how bisecting K-means finds four clusters in the data set originally shown in Figure 8.6(a). In iteration 1, two pairs of clusters are found; in iteration 2, the rightmost pair of clusters is split; and in iteration 3, the leftmost pair of clusters is split. Bisecting K-means has less trouble with initialization because it performs several trial bisections and takes the one with the lowest SSE, and because there axe only two centroids at each step. •
Finally, by recording the sequence of clusterings produced as K-mean.s bisects clusters, we can also use bisecting K-means to produce a hieraxchical clustering.
510 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
oco c .:: Oo 0
" v
.:,ll.~g- " o 00o8 v vo oooog 3 0o8o •'o ocgo 0o~ D v"~" 0~0 o oo (; ooo ooo fJ V V'V<;>
r. ··. 0 oo v Co 0 + + + c
0
" D
0 0
uo 0
·~~ co 0 off'~ co ~ ,,., ~
001,\~ %ll.Ae 00~~~ "r."t&. 0~~ "''#,"' n o • , o c c 0: D 0 0 : (a) Iteration 1. (b) Iteration 2. (c) Iteration 3.
Figure 8.8. Bisecting K-means on the four clusters example.
8 .2.4 K-means and Different Types of Clusters
K-means and its variations have a uumber of limitations with respect to finding different types of clusters. In particular, K-means has difficulty detecting the '~natural" clusters, when clusters have nonaspherical shape15 or widely different
sizes or densities. This is illustrated by Figures 8.9, 8.10, and 8.11. In Figure 8.9, K-means cannot find the three natural clusters because one of the clusters is much larger than the other two, and hence, the larger cluster is broken, while one of the smaller clusters is combined with a portion of the larger cluster. In Figure 8.10, K-means fails to find the three natural clusters because the two smaller clusters are much denser than the larger cluster. Finally, in Figure 8.11, K-means finds two clusters that mix portions of the two natural clusters because the shape of the natural dusters is not globular.
The difficulty in these three sit uatious is that tbe K-means objective fuuo- tion is a mismatch for the kinds of clusters we are trying to find since it is minimized by globular clusters of eqnal size and de nsity or by clusters that are well separated. However~ these limitations can be overcome, in some sense, if the user is willing to accept a clustering that breaks the natural clusters into a number of subclusters. Figure 8.12 shows what happens to the three previous data sets if we find six clusters instead of two or three. Each smaller cluster is pure in the sense that it contains only points from one of the natural clusters.
8.2.5 Stre ngths and Weaknesses
K-means is simple and can be used for a wide variety of data types. It is also quite efficie nt, even though multiple runs are often performed. Some variants, including bisecting K-means, are even more efficient, and are less suscepti- ble to initialization problems. K-means is not suitable for all types of data,
c 0 0 ;J ~) (") c
O!l 1 0 0~0~0~0 O D c o e go 0 Oc..; C O
0 0 0 ooooo :::J :.J o
0 0 0 o on o c
n o 0 0 o O c Oo oooo
() c 0 c
(a) Origina.J poi nco.
0 0 0 0 0 0 0 0 0
0
8.2 K-means 511
( b} Three K-means dusters.
Figure 8.9. K-rneans with clusters of different size.
(a) Origina.J poincs. (b) Three K-means clusters.
Figure 8.10. K-means w~h clusters of dill3rent density.
<> <> 0 0 0 0 {:} 0 00 C> 0 D O 0 0
0 0 0. 0 0 •;-} 0 D 0 0 0 0 0 0
"" " oo o " " 0
0 0 0 0 0
"" v v {)
{} v v 0 0 -l:r 0 0 0 0 0 o_, v c {}{} vv 0 o o
0 00 0 00 v
o" v v o o 0 ogo vv" "" ~v oo 0
28r-" " V''V'V * {) 0 0 0 0 v v oO 0 0 vv vvv v -v" v v Do OOo 0 00 0 0
v 'V-v v o 0 oo o 0 "vv " oo
(a) Original points. (b ) Two K-meam;; clusters.
Figure 8.11. K-rneans with non-globular clusters.
512 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
(a) Unequal sizes.
0 !::.
0 0 0 !::. * !::. 0 + 0 !::. !::. !::.
ooo 0 0
(b) Unequal dellilities.
0 0 0 O .rJLO
I> 0 d 0 o o
I> I> 1>-h, I> I>
I> I>
0
(c) Non-spherical shapt>s.
Figure &.12. Using K-rneans to find clusters that am subclusters of the natural clusters.
8.2 K-means 513
however. It cannot handle non-globular clusters or clusters of different sizes and densities, although it can typically find pure subcluster• if a large enough number of clusters is specified. K-means also has trouble clustering data that contains outliers. Outlier detection and removal can help significantly in such situations. Finally
1 K-means is restricted to data for which there is a notion of
a center (centroid). A related technique, K-medoid clustering, does not have this restriction, but is more expensive.
8.2.6 K-mean s as an Optimization Proble m
Here, we delve into the mathematics behind K-means. This section, which can be skipped without loss of continuity, requires knowledge of calculus t hrough partial derivatives. Familiarity with optimization techniques, especially those based on gradient descent, may also he helpful.
As mentioned earlier! given an objective function such as "minimize SSE," clustering can he tre ated as an optimization problem. One way to solve this problem- to find a global optimum- is to enumerate all possible ways of di- viding the points into clusters and t heu choose the set of clusters that best satisfies the objective funct ion, e.g., t hat minimizes the total SSE. Of course, this exhaustive strategy is computationally infeasible and as a result, a more practical approach is needed, even if s uch an approach finds solutions that are not guaranteed to be optimal. One technique, which is known as gradient descent, is based on picking an initial solution and the n repeating the fol- lowing two steps: compute the change to the solution that best optimizes the objective function and then update the solut ion.
We assume that the data is on..,.dimensional, i.e., dist(",Y) = (x- y )2 . This does not change anything essential, but greatly simplifies the notation.
Derivation of K-means as an Algorithm to Minimize the SSE
In this Eiection, we show how the centroid for the K-meall6 algorithm_ can be
mathematically derived when the proximity function is Euclidean distance and the objective is to minimize the SSE. Specifically, we investigate how we can best update a cluster centroid so that the cluster SSE is minimized . In mathematical terms, we seek to mitrimize Equation 8.1 , whlch we repeat he re, specialized for one-dimensional da ta.
K
SSE = L L (c;- ")2 (8.4) i=l xEC~
514 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
Here, ci is the ith cluster. X is a point in Gil and Ct is the mean of the ir-h cluster. See Table 8.1 for a complete list of notation.
We can solve for the k'" centroid Cb which minimizes Equation 8.4, by differentiating the SSE, setting it equal to 0, and solving, as indicated below.
Thus, as previously indicated, the best centroid for minimizing the SSE of a cluster is the mean of the points in the cluster.
Derivation of K-means for SAE
To demonstrate that the K-means algorithm can be applied to a variety of different objective functions, we consider how to partition the data into K clusters such that the sum of the Manhattan (LI) distances of points from the center of their clusters is minimized. We are seeking to minimize the sum of the L 1 absolute errors (SAE) as given by the following equation, where disiL, is the Lt djstance. Again, for notational simplicity, we use one-dimensional data, i.e., distL, = lei - 4
K
SAE = L L distL1 (c;J) (8.5) i=1zEC,
We can solve for the k'" centroid C<, which minimizes Equation 8.5, by differentiating the SAE, setting it e qual to 0, and solving.
8.3 Agglomerative Hierarchical Clustering 515
If we solve for q, we find that Ck = median{:c E Ck}, the median of the points in the cluster. The median of a group of points is straightforward to compute and less susceptible to distortion hy outliers.
8.3 Agglomerative Hierarchical Clustering
Hierarchical clustering techniques are a second important category of cluster- ing methods. As with K -rnearlS, these approaches are relatively old compared to many cluste ring algorithms, but they still enjoy widespread use. There are two basic approaches tor generating a hierarchical clustering:
Agglomerative: Start with the points as individual clusters and, at each step, merge the closest pair of clusters. This requires defining a notion of cluster proximity.
Divisive: Start with one, all-inclusive cluster and. at each step, split a cluster until only singleton clusters of individual points remain. In this case, we n eed to decide which cluster to split at each step and how to do the splitting.
Agglomerative hierarchical clustering techniques are by far the most common, and. in this section, we will lOcus exclusively on these methods. A divisive hierarchical clustering techniqne is described in Section 9.4.2.
A hierarchical clustering is often displayed graphically using a tree-like diagram called a dendrogram, which displays both the cluster-subcluster
516 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
p1 p2 p3 p4
(a) Dendrogram. (b) Nested cluster diagram.
Figure 8.13. A hierarchical clusterillg of four points shwm as a dendrogram and as nested clusters.
relationships and the order in which the clusters were merged (agglomerative view) or split (divisive view). For sets of two-dimensional points, such as those that we will use as examples. a hierarchical clustering can also be graphically represented using a nested cluster diagram. Figure 8.13 shows an example of these two types of figures for a set of four two-dimensional points. These points were clustered using the s ingle-link technique that is described in Section 8.3.2.
8.3.1 Basic Agglomerative Hierarchical Clustering Algorithm
~lany agglomerative hierarchical clustering techniques are variations o n a sin- gle approach: starting with individual points as clusters, successively merge the two closest clusters until only one duster remains. This approach is ex- pressed more formally in Algorithm 8.3.
Algorithm 8.3 Basic agglomerative hierarchical clustering algorithm. 1: Compute the proximity ma trix, if necessary. 2: repeat 3: Merge the closest two clusters. 4: Update the proximity matrix to reflect the proximity between the new
duste r and the original dusterB. 5: until Only one cluster r emains.
8.3 Agglomerative Hierarchical Clustering 517
Defining Proximity between Clusters
The key operation of Algorithm 8.3 is the computation of the proximity be- tween two clusters, and it is the definition of cluster proximity that differ- entiates the various agglomerative hierarchical techniques that we will dis- cuss. Cluster proximity is typically defined with a particular type of cluster in mind~ee Section 8.1.2. For example, many agglomerative hierarchical clusteriug t echniques, such as MIN , MAX, aud Group Average, come from a graph-based view of clusters. MIN defines cluster proximity as the prox- imity between the dosest two points that ace in different clusters, or using graph terms, the shortest edge between two nodes in different subsets of nodes. This yields contiguity-based clusters as shown in Figure 8.2(c). Alternatively. MAX takes the proximity between the farthest two points in different clusters to be the cluster proximity, or using graph terms, the longest edge between two nodes in different subsets of nodes. (If our proximities are distances, then tbe names , MIN and !IIAX, are short and suggestive. For similarities, however, where higher values indicate closer points, the names seem reversed. For that reason, we usually prefer to use the alternative namffi, single link and com- plete link, respectively.) Another graph-based approach, the group average technique, defines cluster proximity to be the average pairwise proximities (av- erage length of edges) of all pairs of poiuts from different clusters. Figure 8.14 illustrates these three approaches .
(a) MIN (single link.) (b) MAX (comp lete link.) (c) Group average.
Figun! 8.14. Graph-based definitions of cluster proximity
lf, instead, we take a prototyp e-baBed view, in which each cluster iB repre- sented by a centroid, different definitions of cluster proximity are more natural. 'When using centroids, the cluster proximity is commonly defined as the prox- imity between cluster centroids. An alternative technique, Ward's method, also assumes that a cluster is represented by its centroid, but it measureB t he proximity between two clusters in terms of the increase in the SSE that re-
518 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
suits from merging the two clusters. Like K-means, Ward's method attempts to minimize the sum of the squared distances of points from tbeir cluster centroids.
Time and Space Complexity
The basic agglomerative hierarchical clustering algorithm just presented uses a proximity matrix. This requires the storage of ~m2 proximities (assuming the proximity matrix is symmetric) where m is the number of data points. The space needed to keep track of the clusters is proportional to the number of clusters, which ism -1, excluding singleton clusters. Hence, the total space complexity is O(m2).
The analysis of the basic agglomerative hierarchical clustering algorithm is also straightforward with respect to computational complexity. O(m2) time is required to compute the proximity matrix. After that step, there are m- 1 iterations involving steps 3 and 4 because there are m clusters at the start and two clusters are merged during each iteration. If performed as a linear search of the proximity matrix, then for the ;th iteration, step 3 requires O((m- i + 1)2 ) time, which is proportional to the current number of clusters squared. Step 4 only requires O(m - i + 1) time to update the proximity matrix after the merger of two clusters. (A cluster merger affects only 0( m - i + 1) proximities for the techniques that we consider.) Without modification, this would yield a time complexity of O(m3 ). If the distances from each cluster to all other clusters are stored as a sorted list (or heap), it is possible to reduce the cost of finding the two closest clusters to O(m- i + 1). However, because of the additional complexity of keeping data in a sorted list or h eap, t he overall time required for a hierarchical clustering based on Algorithm 8.3 is 0( m 2 log m).
The space and time complexity of hierarchical clustering severely limits the size of data sets that can be processed. V\'e discuss scalability approaches for clustering algorithms, including hierarchical clustering tedmiques, in Section 9.5.
8.3.2 Specific Techniques
Sample Data
To illustrate the behavior of the various hierarchical clustering algorithms, we shall use sample data that consists of 6 two-dimensional points, which are shown in Figure 8.15. The x andy coordinates of the points and the Euclidean distances between them are shown in Tables 8.3 and 8.4, respectively.
8.3 Agglomerative Hierarchical Clustering 519
Point x Coordinate y Coordinate p1 0.40 0.53 p2 0.22 0.38 p3 0.35 0.32 p4 0.26 0.19 p5 0.08 0.41 p6 0.45 0.30
Figure 8.15. Set of 6 two-dimensional points. Table 8.3. xy coordinates of 6 points.
pi p2 p3 p4 p5 p6 p1 0.00 0.24 0.22 0.37 0.34 0.23 p2 0.24 0.00 0.15 0.20 0.14 0.25 p3 0.22 0.15 0.00 0.15 0.28 0.11 p4 0.37 0.20 0.15 0.00 0.29 0.22 p5 0.34 0.14 0.28 0.29 0.00 0.39 p6 0.23 0.25 0.11 0.22 0.39 0.00
Table 8.4. Euclidean distance matrix lor 6 points.
Single Link or .MIN
For the single link or MIN version of hierarchical clustering, the proximity of two clusters is defined as the minimum of the clistance (maximum of the similarity) between any two points in the two different clusters. Using graph terminology, if you start with all points as singleton clusters and add links between points one at a time, shortest links first, then these single links mm- bine the points into clusters. The single link technlque is good at handling non-elliptical shapes, but is sensitive to noise and outliers.
Example 8.4 (Single Link). Figure 8.16 shows the result of applying the single link technlque to our example data set of six points. Figure 8.16(a) shows the nested clusters as a sequence o f nes t ed e llipses, where the numbers associated with the ellipses indicate the order of the clustering. Figure 8.16(b) s hows tbe same information, but as a dendrogram. The height at which two clusters are merged in the dendrogram reflects the distance of the two clusters. For instance, from Table 8.4, we see that the distance between points 3 and 6
520 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
0. 2
I _[ =-
0.15
0. 1
0.05
(a) Single link clustering. (b) Single link dendrogram.
Figure 8.16. Single link clustering ofthe six points shown in Figure 8.15.
is 0.11, and that is the height at which they are joined into one cluster in the dendrogram. As another example. t he distance between clusters { 3, 6} and {2, 5} is given by
dist( {3,6} , {2. 5}) rnin(dist(3, 2), dist(6, 2), dist(3. 5).dist(6, 5))
rnin(0.15, 0.25, 0 .28, 0.39)
0.15.
Complete Link or MAX or CLIQUE
•
For the complete link or MAX version of hierarchical clustering, the proximity of two clusters is defined as the maximum of the distance (minimum of the similarity) between any two points in the two different clusters. Using graph terminology, if you start with a ll points as single ton clusters and add links between points one at a time, shortest links first, then a group of points is not a cluster until all the points in it are com pletely linked, i.e., form a clique. Complete link is less susceptible to noise and outliers, but it can hreak large clusters and it favors gl obular shapes.
Example 8.5 (Complete Link) . F igure 8.17 shows t he results of applying MAX to the sample data set of six points. As with single link, points 3 and 6
8.3 Agglomerative Hierarchical Clustering 521
(a) Complete link clustering. (b) Complete link dendn:>gTam.
Figure 8.17. Complele link clustering of the six points shC>Yn i1 Figure 8.15.
are merged first. However, {3,6} is merged with {4}, instead of {2 , 5} or {1} because
dist({3,6}. {4))
dist( {3. 6}. {2, 5})
dist({3 .6), {1})
Group Average
max(dist(3, 4), dist(6, 4))
max(0.15, 0.22)
0.22.
max(dist(3, 2), dist(6, 2), dist(3, 5),dist(6, 5))
max(0.15, 0.25. 0.28, 0.39)
0.39.
max(dist(3, 1), dist(6, 1))
max(0.22, 0.23)
0.2 3.
•
For the group average version of hierarchical clustering, the proximity of two clusters is defined as the average pairwise proximity among all pairs of points in the different clusters. This is an intermediate approach between the single and complete link approaches. Thus, for group average, the cluster proxim-
522 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
{a) Group average clustering. (b) Group average dendrogram.
Figure 8.18. Group average clustering of the six points shown in Figure 8.15.
ity proximity(C;, Cj) of clusters C; and C1 , which are of size m, and mj, respectively, is expressed by the fo llowing equation:
L x<c, proximity( x, y) pro.rimity(C;,CJ) = _ _c'cc<c~''--------
11'!.; * 11lj (8.6)
Example 8.6 (Group Average). Figure 8.18 shows the results of applying the group average approach to the sample data set of six points. To illustrate
how group average works, we calculate the distance between some clusters.
dist({3, 6,4}, {1})
dist({2, 5}, {1})
dist( {3,6, 4 ), {2, 5})
(0.22 + 0.37 + 0.23)/(3. 1)
0.28
(0.2357 +0.3421)/(2•1)
0.2889
(0.15 + 0.28 + 0.25 + 0.39 + 0.20 + 0.29)/(6. 2)
0.26
Becausedist( {3, 6,4} , {2, 5}) is smaller than dist({3, 6,4}, {1}) and dist({2, 5}, {1} ), clnsters { 3, 6 , 4} and { 2, 5} are merged at the fourth stage. •
8.3 Agglomerative Hierarchical Clustering 523
(a) Ward'5 clustering. (b) Ward's dendrogram.
Figure 8.19. Ward'sdustering of the six points shown in Figure 8.15.
Ward' s Method and Centroid Methods
For 'Ward's method, the proximity between two clusters is defined as the in- crease in the squared error that results when two clusters are merged. Thus, this method uses the same objective function as K-rueans clustering. While it may seem t hat this feature makes \Vard's method somewhat distinct from other hierar chical techniques, it can be shown mathematically that Ward's method is very similar to t he group average method when the proximity be-
tween two points is taken to be the square of the distance between them.
Example 8.7 (Ward's Method). Figure 8.19 shows the results of applying \Vard's me thod to the sample data set of six points. The cluster ing that is produced is different from those produced by single link, complete link, and group average. •
Centroid methods calculate the proximity between two clusters by calcu- lat ing the distance between the centroids of clusters. These techniques may seem similar to K-means, but as we have remarked, Ward's method is the correct hierarchical analog.
Centroid methods also have a chnracteristic-<>ften considered had-that is not possessed by the other hierarchical clustering t echniques that we have discussed: the possibility of inversions. Specifically, two clusters that are merged may be more similar (less distru1t) thao the pair of clusters that were merged in a previous step. For the other methods, t he distance between
524 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
Table 8.5. Table of laoo&-Williams coefficients for common hierarchical clustering approaches.
Clustering Method <>A <>a i3 ,., Single Link 1/2 1/2 0 -1/2 Complete Link 1/2 1/2 0 1/2 Group Average ---"!A__ ----"'.B__ 0 0 m rn rn rn Centroid rnA ____!!!1L_ mAmB 0
mA.+mB mA.+mB (mA+mB)!l Ward's rnA rn2 rn• rn2 -mQ 0
m +m +m m +m +m m +m +m
merged clusters monotonically iucreases {or is, at worst~ non-increasing) as we proceed from singleton clusters to one all-inclusive cluster.
8.3.3 The Lance-Williams Formula for Cluster Proximity
Any of the cluster proximities that we have discussed in this section can be viewed as a choice of different parameters (in the Lance-\Villiarns formula shown below in Equation 8. 7) for tbe proximity between clusters Q and R, where R is formed by merging clusters A and B. In this equation, p( ... ) is a proximity function, while mA, m 8 , and mq are the number of points in clusters A, B, and Q, respectively. In other words, after we m e rge clusters A and B to form cluster R, the proximity of the new cluster, R, to an existing cluster, Q, is a linear function of the proximities of Q with respect to the original clusters A and B. Table 8.5 shows the values of these coefficients for the techniques that w e have discussed.
p(R. Q) = <>Ap(A, Q) +asp(B,Q) +f3p(A, B) +-, lp{A,Q) - p(B,Q)i (8.7)
Any hierarchical clustering technique that can be expressed using the Lance-Williams formula does not need to keep the original data points. In- stead, tbe proximity matrix is updated as clustering occurs. While a general formula is appealing, especially for implementation, it is easier to understand the different hierarchical methods by looking directly at the definition of clus- ter proximity that eacb method nses.
8.3.4 Key Issues in Hierarchical Clustering
Lack of a Global Obj ective Function
We previously mentioned that agglomerative hierarchical clustering cannot be viewed as globally optimizing an objective function. Instead, agglomerative hierarchical clustering techniques use various criteria to decide locally, at each
8.3 Agglomerative Hierarchical Clustering 525
step. which clusters should be merged (or split for divisive approaches). This approach yields clustering algorithms tbat avoid the difficulty of attempting to solve a hard combinatorial optimization problem. (It can be shown that the general clustering problem for an objective function such as "minimize SSE'' is computationally infeasible.) Furthermore, such approaches do not have problems with local minima or difficulties in choosing initial points. Of course, the time complexity of 0( m 2 log m) and the space complexity of O(m2 ) are prohibitive in many cases.
Ability to Handle Different Cluster Sizes
One aspect of agglomerative hierarchical clustering that we have not yet dis- cussed is how to treat the relative sizes of the pairs of clusters that are merged. (Tbi.s discussion applies only to cluster proximity schemes that involve sums, such as centroid, Ward's, and group average.) There are two approaches: weighted. which treats all clusters equally, and unweighted, which takes the number of points in each cluster into account. Note that the terminology of weighted or unweighted refers to the data points, not the clusters. In other words, t reating clusters of unequal size eqnally gives different weights to t he points in different clusters, while taking the cluster size into account gives points in different dusters the same weight.
We will illustrate this using the group average technique discussed in Sec- tion 8.3.2, whlch is the unweig hted version of the g roup average technique. In the clustering literature, the full name of this approach is the Unweighted Pair Group Method using Arithmetic averages (UPGJ\IA ). In Table 8.5, which gives the formula for updating cluster similarity, the coefficients for UPG!viA involve the size of each of the clusters that were merged: OA = mA:~8 , O B = m ~~8 , ;3 = 0, r = 0. For the weighted version of group average--known as WPGMA- the coefficients are constants: etA= l /2, as = 1/2,/3 = 0,")" = 0. In genera1 , nnweighted approaches are pre ferred unless there is reason to be- lieve that individual points should have different weights; e.g., perhaps classes of objects have been nnevenly sampled.
Merging Decisions Are Final
Agglomerative hierarchical clnstering a lgorithms tend to make good local de- cisions about combining two clusters since tbey can use info rmation about the pairwise similarity of all points. However, once a decision is made to m erge two clusters, it cannot be undone at a later time. This approach prevents a local optimization criterion from becoming a global optimization criterion.
526 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
For example, although the '"minimize squared error" criterion from K-means is used in deciding wblch clusters to merge in Ward's method, the clusters at each level do not represent local minima with respect to the total SSE. Indeed. the clusters are not even stable, in the serue that a point in one cluster may be closer to the centroid of some other cluster than it is to the centroid of its current cluster. Nonetheless, Ward's method is often used as a robust method of initializing a K-mearu clustering, indicating that a local "minimize squared error" objective function does have a connection to a global "minimize squared error" objective function.
There are some techniques that attempt to overcome the limitation that merges are final. One approach attempts to fix up the hierarchical clustering hy moving branches of the tree around so as to improve a global objective function. Another approach uses a partitional clustering technique such as K- meanB to create many small clusters, and then performs hierarchical clustering using these small clusters a.s the starting point.
8.3.5 Strengths and Weaknesses
The strengths and weakness of specific agglomerative hierarchical clustering algorithms were discussed above. More generally, such algorithms are typi- cally used because the und erlying application. e.g., creation of a taxonomy, requires a hierarchy. Also, there have been some studies that s uggest that these algorithms can produce better-quality dusters. However, agg1omerative hierarcblcal clustering algorithms are expensive in terms of their computa- tional and storage requirements. The fact that all merges are final can also cause trouble for noisy, high-dimensional data, such as document data. In turn, these two problems can be addressed to some degree by first partially clustering the data using another technique, such as K-means.
8.4 DBSCAN
Density-based clustering locates regions of high density that are separated from one a nother by regions of low density. DBSCAN is a simple and effec- tive density-based clustering algorithm that illustrates a number of important concepts that are important for any deusity-based clustering approach. In this section, we focus solely on DBSCAN after first considering the key notion of density. Other algorithms for finding density-based clusters are described in the next chapter.
8.4 DBSCAN 527
8.4.1 Traditional Density: Center-Based Approach
Although there are not as many approaches for defining density as there are for defining similarity, there are several distinct methods. In tbls section we dis- cuss the center-based approach on which DBSCAN is based. Other definitions of density will be presented in Chapter 9.
In the center-based approach, density is estimated for a particular point in the data set by counting t he number of points witbln a specified radius, Eps, of that point. This includes the point itself. This technique is graphically illustrated by Figure 8.20. The number of points within a radius of Eps of point A is 7, including A itself.
This method is simple to implement, but the density of any point will depend on the specified radius. For instance, if the radius is large enough, then all points will have a density of m, the number of points in the data set. Likewise, if the radius is too small, then all points will have a d ensity of L An approach for deciding on the appropriate radius for low-dimeruional data is given in the next section in the context of our discussion of DBSCAN.
Classification of Points According to Center-Based Density
The center-based approach to density allows us to classify a point as being ( 1) in the interior of a dense region (a core point) , {2) on the edge of a dense reg ion (a border point) , or (3) in a sparsely occupied region (a noise or background point). Figure 8.21 graphically illustrates the concepts of core, border, and noise points using a collection of two-dimensional points. The following text provides a more precise description.
Core points: These points are in the interior of a density-based cluster. A point is a core point if the number of points within a given neighborhood around the point as determined by the distance function and a user- specified distance parameter, Eps, exceeds a certain threshold, M inPts, which is also a user-specified parameter. In Figure 8.21, point A is a core point, for the indicated radius ( Eps) if M inPts :0: 7.
Border points: A border point is not a core point , but falls within the neigh- borhood of a core point. In Figure 8.21, point B is a border point. A border point can fall within the neighborhoods of several core points.
Noise points: A noise point is any point that is neither a core point nor a border point. In Figure 8.21, point C is a noise point .
528 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
Figure 8.20. Center-based ---~
density. Figure 8.21. Core, border, and noise point&
8.4.2 The DBSCAN Algorithm
Given the previous definitions of core points, border points, and noise poiuts~ the DBSCAN algorithm cau be informally described as follows. Any two core points that ace close enough--within a distance Eps of oue another-are put in the same cluster. Likewise, any border point that is close enough to a core point is put in the same cluster as the core point. (Ties may need to be resolved if a border point is close to core points from different clusters.) Noise points are discarded. The formal details are given in Algorithm 8.4. This algorithm uses the same concepts and finds the sarue clusters as the original DB SCAN, but is optimized for simplicity, uot efficiency.
Algorithm 8.4 DBSCAN a lgorithm. 1: Label aJ..l points as core, border, or noise points. 2: Elimlrulte noise points. 3: Put an edge between all core points that ore within Eps of each other. 4: Make each group of counected core points into a separate cluster. 5: Assign each border point to one of the clusters of its associated core points.
Time and Space Complexity
The basic t ime complexity of the DBSCAN algorithm is O(m X time to fiud points in the Eps-neighborhood), where m is the number of points. In the worst case, this complexity is O(m2 ). However, in low-dimensional spaces, there are data structures, such as kd-trees, that a llow efficient retrieval of all
8.4 DBSCAN 529
points within a given distance of a specified point. and the time complexity can be as low as O(mlogm). The space requirement of DBSCAN, eveu for high-dimensional data. is O(m) because it is only necessary to keep a small amount of data for each point, i.e., the cluster label and the identification of each point as a corel border, or noise point.
Selection of DBSCAN Parameters
There is, of course, the issue of how to determine the parameters Eps and M inPts. The basic approach is to look at the behavior of the distance from a point to its k-'h nearest neighbor. which we will call the k-dist. For points that belong to some cluster, the value of k-dist will be small if k is not larger than the cluster size. Note that there will be some variation, depending on the density of the cluster and the random distribution of points, but on average, t he range of variation will not be huge if t he cluster densities are not ra dically different. However, for points that are not in a cluster, such as noise points. the k-dist will be relatively large. Therefore, if we compute the k-dist for all the data points for some k, sort them in increasing order, and then plot t he sorted valnes, we expect to see a sharp change at the value of k-dist that corresponds to a suitable value of Eps. If we select this distance as the Eps parameter and take the value of k as t he J..fi.nPts parameter, theu poiuts for which k-dist is less than Eps will be labeled as core points, while other points will be labeled as noise or border points.
Figure 8.22 shows a sample data set, while the k-dist graph for the data is given in F igure 8.23. The value of Eps that is determined in this way depends on k, but does not change dramatically as k changes. If the value of k is too small, then even a small number of closely spaced points that a re noise or outliers will be incorrectly labeled as clusters. If the value of k is too large, then small clusters (of size less than k) are likely to be labeled as noise. The original DBSCAN algorithm used a valne of k = 4, which appears to be a reasonable value for most two-dimensional data sets.
Clusters of Varying Density
DBSCAN can have tronble with density if the deusity of clusters varies widely. Consider Figure 8.24, which shows four clusters embedded in noise. The den- sity of the clusters and noise regions is indicated by their darkness. The noise around the pair of denser clusters, A and B, has the same d ensity as clusters C and D. If the Eps threshold i.s low enough that DBSCAN finds C and D as clusters, then A aud Band the points surrounding them will become a siugle
530 C h apter 8 Cluster Analysis: Basic Concepts and Algorithms
Figure 8.22. Sample data. Figure 8.23. K-<list plot for sample data.
8888 Figure 8.24. Four clusters embedded in noise.
cluster. If the Eps threshold is high enough that DBSCAN finds A and B as separate dusters, and the points surrounding them are n1arked as noise, then C and D and the points surrounding them will also be max ked as noise.
An Example
To illu•trate the use of DBSCAN, we show the clusters that it finds in the relatively complicated two-din1ensional data set shown in Figure 8.22. This data set consists of 3000 two-dimensional points. The Eps threshold for this data was found by plotting the sorted distances of the fourth nearest neighbor of each point (Figure 8.23) and identifying the value at, which t.here is a sharp increase. We selected Eps = 10, whicl1 corresponds to the knee of the cmve. The clusters found by DBSCAN using these parameters, i.e., M inPts = 4 and E ps = 10, are shown in Figure 8.25(a). The core points, border points, and noise points are displayed in Figure 8.25(b).
8.4.3 Strengths and W e aknesse s
Because DBSCAN uses a density-based definition of a cluster, it is relatively resistant to noise and can handle clusters of arbitrary shapes and sizes. Thus,
8.4 DBSCAN 531
(•) Clusters found by DB SCAN .
x - Noise Point + - Border Point o- Core Point
(b) C.ore, border, and noise points.
Figure 8.25. DBSCAN clustering of 3000 two-dimensional points.
532 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
DBSCAN can find many clusters that could not be found using K-means, such as those in Figure 8.22. As indicated previously, however, DBSCAN has trouble when the clusters have widely varying densities. It also has trouble with high-dimensional data because density is more difficult to define for such data. One possible approach to dealing with such issues is given in Section 9.4.8. Finally, DBSCAN can be expensive when the computation of nearest neighbors requires computing all pairwise proximities, as is usually the case for high-dimensional data.
8.5 Cluster Evaluation
In supervised classification, the evaluation of the resulting classification model is an integral part of the process of developing a classification model, and there rue well-accepted evaluation measures and procedures, e.g., accuracy and cross-validation1 respectively. However, because of its very nature, cluster evaluation is not a well-developed or commonly nsed part of cluster analysis. Nonetheless, cluster evaluation, or cluster validation as it is more tradition- ally called, is important, and this section will review some of the most common and easily applied approaches.
There might be some confusion as to why cluster evaluation is necessary. Many times, cluster analysis is conducted as a part of an exploratory data analysis. Hence, evaluation seems like an unnecessarily complicated addition to what is suppDBed to be an infonnal proce;s. Furthermore, since there are a number of differe nt types of clusters- in some sense. each clustering algorithm defines its own type of cluster- it may seem that each situation nllght require a different evaluation measure. For instance, K·means clusters might be evaluated in terms of the SSE, but for density-based clusters, which need not be globular, SSE would not work well a t all.
Nouethele88, cluster evaluation should be a part of any cluster analysis. A key motivation is that almost every clustering algorithm will find clusters in a data set, even if that data set has no natural cluster structure. For instance, consider Figure 8.26, which shows the result of clustering 100 points that are randomly (uniformly) distributed on the unit square. The original points are shown in Figure 8.26(a), while the clusters found by DBSCAN, K- mean.s, and complet e link are shown in Figures 8.26(b), 8.26(c), and 8.26(d), respectively. Since DBSCAN found three clusters (after we set Eps by looking at the distances of the fourth nearest neighbors), we set K-means and complete link to find three clusters as well. (In Figure 8.26(b) t he noise is shown by the small markers.) However, the clusters do not look compelling for any of
8.5 Cluster Evaluation 533
the three methods. In higher dimensions, such problems cannot be so easily detected.
8 .5.1 Overview
Being able to distinguish whether there is non-random structure in the data is just one important aspect of cluster validation. The following is a list of several important issues for cluster validation.
1. Determining the clustering tendency of a set of data, i.e. , distinguish- ing whether non-random structure actually exists in t he data.
2. Determining the correct number of clusters.
3. Evaluating how well the results of a cluster analysis fit the data without reference to external information.
4. Comparing the resnlts of a cluster analysis to externally known results, such as externally provided class labels.
5. Comparing two sets of clusters to determine which is better.
Notice that items 1, 2, and 3 do not make use of any external information- they are unsupervised techniques-while item 4 requires external information. Item 5 can be performed in either a supervised or an unBupervised manner. A further distinction can be made with respect to items 3, 4, and 5: Do we want
to evaluate the entire clustering or just individual clusters? While it is possible to d evelop various numerical measures to assess the
different aspects of cluster validity mentioned above, there are a number of challenges. First, a measure of cluster validity may be quite limited in the scope of its applicability. For example, most work on measures of clustering tendency has been done for two- or three-dimeusional spatial data. Second, we need a framework to interpre t any measure. If we obtain a value of 10 for a measure t hat evaluates how well cluster labels match externally prov ided class labels, does this value represent a g ood, fair, or poor match? The goodness of a match often can be measured by looking at the statistical distributiou of this value, i.e., how likely it is that such a value occurs by chance. Finally, if a measure is too complicated to apply or to understand, theu few will use it.
The evaluation measures, or indices, that are applied t o judge various aspects of cluster validity are traditionally classified into the following three types.
534 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
• • • • • • • • • • • •• • • •• • • • • ... • • • • ••• . ... • • • • : .. .. • • • • • • • • • • • • . • • • "' • • ., •• ••• • • •• • • • • • ••• • • • • . • • • • .. • ~ ~ . • • • . '· • • . • .. • • • •• .. •• • • • • ·~ • . .... •• • • . . • •• •• • • . . ~ • •• • • . • . • • • • . . . . . • • • • • • • • • . . . .. •
(a) Original points. (b) Three clusters found by DB SCAN.
• • . . •• • . . • • • . . . • • • • . . •
• • . , • ' ' .. . . • • • . .. • • • . • ••• • • . • • •
. . • .... • • • • • • • • • • • • ·~ • ·~ • •• • • • • • • • •• • • • • • • . • • • .• • • • • •• • • •• • • • • • • ... • • •• ~ •• • • • • • • • • • (c) Thcee clusters found by K-means. (d) Three dusters found by complete
link.
Figure 8.26. Clustering of 100 uniformly distributed points.
8.5 Cluster Evaluation 535
Unsupervised. Measures the goodness of a clustering structure without re-- spect to external information. An example of this is the SSE. Un su. pervised measures of cluster validity are often furt her divided into two classes: measures of cluster cohesion (compactness, tightness), which determine how closely re lated the objects in a cluster are, and m eas ures of cluster separation (isolation), which determine how distinct or well- separated a cluster is from other clusters. Unsupervised measures are often called internal indices because they use only information present in the data set .
Supervised. Measures the extent to which the clustering structure discovered by a clustering algorithm matcbetS some exte rnal structure. An example of a supervised index is entropy, which measures how well cluster labels match externally s upplied class labels. Supervised measures are often called external indices because they use information not present in the data set .
Relative. Compares different clusterings or clusters. A relative cluster eval- uation measure is a supervised or rmsupervised evaluation measure that is used for the purpose of comparison. Thus, re lative m easures are not actually a separate type of cluster evaluation measure, but are instead a specific use of such measures. As an example, two K·means clusterings can be compared using either the SSE or entropy .
In tbe remainder of tbis section, we provide specific details concerning clus- ter validity. We first describe topics related to unsupervised cluster evaluation, beginning with (1) measures based on cohesion and separation, and (2) two techniques based on the proximity matrix. Since these approaches are useful only for partitional sets of clusters, we also describe the popular cophenetic correlation coefficient. which can b e used for the unsupervised evaluation of a hierarchical clustering . We end our diBcussion of Ul15upervised evaluation with brief discussions abo ut finding t he correct nwnber of clusters and evalu- ating clustering tendency. We then consider supervised approaches t o cluster validity, such as entropy, purity, and the Jaccard measure. We conclude this section with a short discussion of how to interpret t he values of (unsupervised or supervised) validity measures.
536 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
8.5.2 Unsupervised Cluster Evaluation Using Cohesion and Separation
Many internal measures of cluster validity for partitional clustering schemes are based on the notions of cohesion or separation. In this section, we use cluster validity measures for prototype- and graph-based clustering techniques to explore these notions in some detail. In the process, we wiU also see some interesting relationshlps between prototype- and graph-based clustering.
In general, we can consider expressing overall cluster validity for a set of K clusters as a weighted sum of the validity of individual clusters,
K
overall validity= L w; validity(C;) . (8.8) i=l
The validity function can be cohesion, separation, or some combination of these quantities. The weights will vary depending on the cluster validity measure. In some cases, the weights are simply 1 or the size of the cluster, while in otber cases they reflect a more complicated property, such as t he square root of the cohesion. See Table 8.6. If the validity function is cohesion, then higher values are better. If it is separation, then lower values are better.
Graph-Based View of Cohesion and Separation
For graph-based clusters, the oohesion of a cluster can be defined as the sum of t he weights of the links in the proximity graph that connect points within the cluster. See Figure 8.27(a). (Recall that the proximity graph has data o bj ects as nodes, a link between each pair of data objects, and a weight assigned to each link that is tbe proximity betweeu the two data objects connected by the linl<.) Likewise, the separation between two clusters can be measured by the sum of the weights of the links from points in one cluster to points in tbe otber cluster . This is illustrated in Figure 8.27{b).
Mathematically, cohesion and separation for a graph-based cluster can be expressed using Equations 8.9 and 8.10, respectively. The proximity function can be a similarity, a dissimilarity, or a simple function of these quantities.
cohesion( C;)
separation(C;, c,)
L proximity( X. y) xEC~ yEC~
L proximity( X, y) x E C 1 y ECJ
{8.9)
(8.10)
8.5 Cluster Evaluation 537
(a) Cohesion. (b) Separation.
Figure 8.27. Graph-based view of cluster cohesion and separation.
Prototype-Based View of Cohesion and Separation
For prototype- based clusters, tbe cohesion of a cluster can b e defined as the sum of the proximities with respect to the prototype (centroid or medoid) of the clugter. Similarly
1 the separation between two clusters can be measured
by the proximity of the two cluster prototypes. This is illustrated in Figure 8.28, where the centroid of a cluster is indicated by a "+".
Cohesion for a prototype-based cluster is given in Equat ion 8.11 , while two measures for separation are given in Equations 8.12 and 8.13, respec- tively, where c., is tbe prototype (centroid) of cluster C; and c is t be overall prototype (centroid). There a re two measures for separation because, as we will see shortly, the separation of cluster prototypes from an overall prototype is sometimes directly related to the separation of cluster prototypes from one another. Note that Equation 8.11 is tbe cluster SSE if we let praximity be the squared Euclidean distance.
cohesion( C;)
separation(C,, Cj)
sepamtion(C;)
L p1'0ximity(x .c; ) x EC,
proximity( C;, c j)
proximity( C;, c)
Overall Measures of Cohesion and Separation
(8.11)
(8.12)
(8.13)
The previous definitions of cluster cohesion and separation gave us some sim- ple a nd well-defined measures of cluster validity that can be combined into an overall measure of cluster validity by using a weighted sum, as indicated
538 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
,-·. ;:'
,' ·-- --+',, + -----l- -------------7------- + · .• . '
(a) Cohesion. (b) Separation.
Figure 8.28. Prototype-basad view of cluster cohesion and separation.
in Equation 8.8. However, we need to decide what weights to use. Not sur- prisingly, the weights used can vary widely, although typically they ace some measure of cluster size.
Table 8.6 provides examples of validity measures based on cohesion and separation. I 1 is a measure of cohesion in terms of the pairwise proximity of objects in the cluster divided by the cluster size. I2 is a measure of cohesion based on the snm of the proximities of objects in the cluster to the cluster centroid. £ 1 is a measure of separation defined as the proximity of a cluster centroid to t he overall centroid multiplied by the number of objects in the duster. (/t, which is a measure based on both cohesion and separation, is the sum of the pairwise pmximity of a ll objects in the cluster with all objects outside the cluster-the tota l weight of the edges of the proximity graph that must be cut to separate the cluster from all other clusters--ilivided by the
sum of the pairwise proximity of objects in the cluster.
Table 8.6. Table of graJ*l.based cluster evaluation measures.
Name Cluster Measure Cluster Weight Type graph-based
I , ~. ,c, proximity(x, y) _!__ cohesion YEC
m,
prototype-bosed I, ~xEG, proximity(x.c;) 1 cohesion
prototype-based £, proximi-ty( C;, c) t1li separation
~~-' ~xEc, proximity(x,y 1 graph-based
g, ~.Ec, proximity(x,y)
separation and J7-t yec1 yec, cohesion
8.5 Cluster Evaluation 539
Note that any unsupervised measure of cluster validity potentially can be used as an objective function for a clustering algorithm and vice versa. The CLUstering TOolkit (CLUTO) (see the bibliographic notes) uses t he cluster evaluation measures described in Table 8.6, as well as some other evaluation measures not mentioned here, to drive the clustering process. It does this by using an algorithm that is similar to the increment al K-means algorithm dis- cussed in Section 8. 2.2. Specifically, each point is assigned to the cluster that produces the best value for the cluster evaluation function. The cluster eval- uation measure I2 corresponds to traditional K-means and produces clusters that have good SSE values. The other measures produce clusters that are not as good with respect to SSE, hut that are more optimal with respect to the specified cluster validity measure.
Relationship between Prototype-Based Cohesion and Graph-Based Cohesion
While the graph-based and prototype-based approaches to measuring the co- hesion and separation of a cluster seem distinct, for some proximity measures they are equivalent. For instance, for the SSE and points in Euclidean spa ce, it can be shown (Equation 8.14) that the average pairwise distance between the points in a cluster is equivalent to the SSE of the cluster. See Exercise 27 on page 566.
1 Cluster SSE= L dist(c;, x)2 =
2 m; L L dist(x,y) 2
xEC. xECt yECo
(8.14)
Two Approaches to Prototype-Based Separation
When proximity is measured by Euclidean distance, the traditional measure of separation between clusters is the between group s um of squares (SSB). which is the sum of the squared distance of a cluster centroid, C;. to the overall mean, c , of all the data points. By summing the SSB over all clusters, we obtain the total SSB, which is given by Equation 8.15, where c; is the mean of the ;th cluster and c is the over all mean. The higher the total SSB of a clustering, the more separated the clusters are fmm one another.
K
Total SSB = L m; dist(c,.c)2 (8.15) i-= 1
It is straightforward to show that the total SSB is directly related to the pairwise distances between the centroids. In particular, if the cluster sizes are
540 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
equal, i.e., m, = m/K, then this relationship takes the simple form given by Equation 8.16. (See Exercise 28 on page 566.) It is this type of equivalence that motivates the definition of prototype separation in terms of both Equations 8.12 and 8.13.
l K K 'Ibtal SSB =
2 K LL 'ji dist(c; , cj) 2
i=lj=l
{8.16)
Relationship between Cohesion and Separation
In some cases, there is also a strong relationship between cohesion and separa- tion. Specifically, it is possible to show that the sum of the total SSE and the total SSB is a coru;tant; i.e., that it is equal to the total sum of squares (TSS), which is the sum of squares of the distance of each point to the overall mean of the data. The importance of this result is that minimizing SSE (cohesion) is equivalent to maximizing SSB (separation).
We provide the proof of this fact below, since the approach illustrates techniques that are also applicable to proving the relationships stated in the last two sections. To simplify the notation, we assume that the data is one- dimensionaL i.e., dist(x, y) = (:r - y)2 . Also. we use the fact that the eros~>- term L;{:, LxEC,(:r- c;)(c- c;) is 0. (See Exercise 29 on page 566.)
TSS K
L L (x-c)2 t=lzECt
K
L L ((x - c; ) - (c - e;))2 1\ F\ 1\
L L (x -ci)' - 22: L (x - c; )(c -ci ) + L L (c- e; )2 l=l z ECt 1=l r ECt i=L x ECt
r: r: L L (x - ci)>+ L L (c - c, )> l=l .rEG, t=l .~:EG, 1\ h-
L L (x- c,)>+ L IC;I{c-e;)2 i=l.r EC, i=l
SSE+ SSB
8.5 Cluster Evaluation 541
Evaluating Individual Clusters and Objects
So far, we have focused on using cohesion and separation in the overall eval- uation of a group of clusters. l'<lany of these measures of cluster validity also can be used to evaluate individual clusters and objects. For example, we can rank individual clusters according to their specific value of cluster validity, i.e .. cluster cohesion or separation. A cluster that has a high value of cohesion may be considered better than a clruster that has a lower value. This information often can be used to improve the quality of a clustering. If. for example, a cluster is not very cohesive, then we may want to split it into several subclu~ ters. On the other hand, if two clusters are relatively cohesive, but not well sep a rated, we may want to merge them into a single cluster.
We can also evaluate the objects within a cluster in terms of their con- tribution to the overall cohesion or separation of the cluster. Objects that contribute more to the cohesion and separation are near the '1interior"' of the cluster. T hose objects for which the opposite is true are probably near the "edge" of the cluster. In the following section, we consider a cluster evalua- tion measure that uses an approach based on these ideas to evaluate points, clusters, and the entire set of clusters.
The Silliouette Coefficient
The popular method of silhouette coefficients combines both cohesion and sep- aration. The following steps explain how to oompute the silhouette ooefficient for an individual point, a process that consists of the following three steps. We use dist!lllces, but an analogous a pproach can be used for similarities.
1. For t h e ;th object, calculate its average distance to all other objects in its cluster. Call this value a ,,
2. For the ;th object and any clruster not containing the object , calculate the object's average distance to all the objects in the given cluster. Find t he minimum s uch value with respect to all clusters; call this value b;.
3. For the ;th object, the silhouette coefficient is'' = (b; - a,)j max( a ;, b;).
The value of the silhouette coefficient can vary between -1 and 1. A negative value is undesirable because this corresponds to a case in which Cli, the average dist!lllce to points in the cluster, is greater than b;, the minimum average distance to points in another clnster. We want the silhouette coefficient to be positive (a; < b, ), and for a; to be as close to 0 as possible, since the coefficient assumes its maximum va1ue of 1 when a;, = 0.
542 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
··- .. .. .. _ .. .. -.;• .. -' . ~ ~ M U U M U ~ M
Slhouetlll Coelllcient
Figure 8.29. Silhouette coeffiCients for points in ten clusters.
We can compute tl1e average silhouette coefficient of a cluster by simply taki11g the average of the silhouette coefficients of points belonging to the cluster. An overall measure of the goodness of a clustering can he obtained by computing the average silhouette coefficient of all points.
Example 8 .8 (Silhouette Coefficient). Figme 8.29 sho'-'"S a plot of the silhouette coefficients for points in 10 clusters. Darker shades indicate lower silhouette coefficients. •
8 .5.3 Unsupervised Clu ster Evaluation Using the Proximity Matrix
In this s ection, we exrunine a couple of unsupervised approaches for assessing
cluster validity that are based on the proximity matrix. The first compares an actual and idealized proximity matrix, while the second uses visualization.
Measuring C luster VaHdity via Correlation
If we are given the similarity matrix for a data set and the cluster labels from a cluster analysis of the data set, then we can evaluate the "goodness" of the clusteru1g by looking at the correlation between the similarity matrix and an ideal version of the similarity matrix based on the cluster labels. (With minor manges, the following applies to proximity matrices, but for sinlplicity, '''" discuss only similarity matrices.) More specifically, an ideal cluster is o ne whose points have a similarity of 1 to all points in the cluster, and a sim.i.larity of 0 to all points in other clusters. Thus, if we sort the rows and columns of the sinlilarity matrix so tl1at all objects belonging to the same class are together, then an ideal similarity matrix has a b loc k diagonal structure. In other words, the similarity is non-zero. i.e., 1, inside the blocks of the similarity
8.5 Cluster Evaluation 543
matrix whose entries represent intra-cluste r sin1ilarity, and 0 elsewhere. The ideal similarity matrix is constructed by creating a matrix that has one row and one column for each data point-just like an actual similarity matrix- and assigning a 1 to an entry if the associated pair of points belongs to the same cluster. All other entries are 0.
High correlation between the ideal and actual similarity matrices indicates that the points that belong to the same cluster are close to each other, while low correlation indicates the opposite. (Since the actual and idea l similarity matrices are symmetric, the correlation is calculated oaly among the n(n-1)/2 entries below or above the diagonal of the matrices.) Consequently, this is not a good measure for many density- or contiguity- based clusters , because they are not globular and may be closely intertwined with other clusters.
Example 8.9 (Correlation of Actual and Ideal Similarity Matrices) . To illustrate this measure, we calculated the correlation between the ideal and actual similarity matrices for the K-means clusters shown in Figure 8.26(c) (random data) and Figure 8.30(a) (data with three well-separated clusters). The correlations were 0.5810 and 0.9235 , respectively, which reflects the ex- pected result that the clusters found by K-means in the random data are worse than the clusters found by K-means in data with well-separated clusters. •
Judging a Clustel"ing Visually by Its Similarity Matrix
The previous technique suggests a more general, qualitative approach to judg- ing a set of clusters: Order the similarity matrix with respect to cluster lahels and then plot it. In theory, if we have well-separated clusters , then the simi- larity matrix should be roughly block-diagonal. If not, t hen the patterns dis- played in the sinlilarity matrix can reveal the relationships between clusters. Again, a ll of this can be applied to dissimilarity matrices, hut for simplicity, we will only discuss similarity matrices.
Example 8.10 (Visualizing a Similarity Matrix). Consider t he points in Figure 8.30(a), which form three well-separated clusters. If we use K-means to group these points into three clusters, then we should have no trouble finding these clusters since they are well-separated. The separation of these clusters is illustrated by the reordered similarity matrix shown in Figure 8.30(b ). (For uniformity, we have transformed the distances into similarities nsing the for- mulas= 1 - (d -min..d)/(max..d-min..d).) Figure 8.31 s hows t he reordered similarity matrices for clusters found in the random data set of F igure 8 .26 by DBSCAN, K-means, and complete link.
544 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
.. 0.6
0.2
'o 0.2 0.4 0.6 ••
(a) Well-separnted dusters. (b) Similarity matrix sorted by K-me ans cluster labels.
Figure 8.30. Similarity matrix for wel~separated clusters.
The well-separated clusters in Figure 8.30 show a very strong, block- diagonal pattern in the reordered similarity matrix. However, there are also weak block diagonal patterns- see Figure 8.31- in the reordered similarity matrices of the clusterings found by K-means, DBSCAN, and complete link in t he random d ata . Just as people can find patterns in clouds, data mining algorithms can find clusters in random data. While it is entertaining to find pat terns in douds, it is pointless and p erhaps embarrassing to find clusters in noise. •
This approach may seem hopelessly expe nsive for large data sets, since the oornpntation of the pra.xirnity matrix takes 0( m 2 ) time, where m is the number of objects, but with sampling, t his method can still be used. We cru1 take a sample of data points from each cluster, compute the sinrilarity between t hese points, ru1d p lot t.he r esult. It may be necessar y to oversample s ma ll clusters and undcrsamplc large ones to obt ain an adequate r eprescntat.ion of all clusters.
8.5.4 Unsupervise d Evaluation of Hie r archica l Clustering
The previous approaches to cluster evaluation are intended for partit.ioual clusterings. Here we discuss the cophenetic corre lation1 a popular evaJuation measure for hierarchical clusterings. T he cophenetic distance between two objects is t he proximity at which an agglomerative hierarchical clustering tecl1-
(a) Similarity matrix sorted by DBSCAN cluster labels.
8.5 Cluster Evaluation 545
(b ) Similarity matrix sorted by K-rueaus cluster labels .
1: u· -
(c) Similarity matrix sorted by complete link cluster labels.
Figure 8.31. Similarity matrices for clusters from random data.
nique puts the objects in the same cluster for the first time. For example, if at some point in the agglomerative hierarchical clustering process, the smallest distance between the two cluste rs that are merged is 0.1, then all points in one cluster have a cophenetic distance of 0.1 with respect to the points in the other cluster. In a cophenetic distance matrix, the entries are the cophenetic distances between ea ch pair of objects. The co phenetic distauce is different for each hierarchical clustering of a set of p oints.
Example 8.11 (Cophenetic Distance Matrix). Table 8. 7 shows the cophen- t ic distance mat rix for the single link clustering shown in Figure 8.16. (The data for this fig ure consists of the 6 two-dimensional points given in T a ble 8.3.)
Table 8.7. Cophenetic distance matrix for single link and data in table 8.3
Point PI P2 P3 P 4 P 5 P 6 PI 0 0.222 0.222 0.222 0.222 0.222 P2 0.222 0 0.148 0.151 0.139 0.148 P3 0.222 0.148 0 0.151 0.148 0.110 P4 0.222 0.151 0.151 0 0.151 0.151 P5 0.222 0. 139 0.148 0.151 0 0.148 P 6 0.222 0.148 0.110 0.151 0.148 0
• The CoPhenetic Corre lation Coefficient (C P CC) is the correlation
between the e ntries of t his matri..x and t he original d.issi.Jnilarity matrix aud is
546 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
a standard measure of how well a hierarchical clustering (of a particular type) fit s the data. One of the most common uses of tbis measure is to evaluate which type of hierarchical clustering is best for a particular type of data.
Example 8.12 (Cophenetic Correlation Coefficient). We calculated the CPCC for the hierarchical clusterings shown in Figures 8.16-8.19.These values are shown in Tahle 8.8. The hierarchical clustering produced by the single link technique seems to fit the data less well than the clusterings produced by complete link, group average, and Ward's method.
Table 8.8. Cophenetic correlation coeffident for data of Table 8.3 and four agglomeralive hierarchical clustering techniques.
Technique CPCC Single Link 0.44
Complete Link 0.63 Group Average 0.66
Ward's 0. 64
• 8.5.5 Determining the Correct Number of Clusters
Various unsupervised cluster evaluation measures can be used to approxi- mately determine the correct or natural nnmber of clusters.
Example 8.13 (Number of Clusters). The data set of Figure 8.29 has 10 nat ural clusters. Figure 8.32 shows a plot of the SSE versus the number of clusters for a (bisect ing) K-means clustering of the data set, while Figure 8.33 shows the a verage silhouette coefficient versus the number of clusters for the same data. There is a distinct knee in the SSE and a distinct peak in the silhouette coefficient when the number of clusters is equal to 10. •
Thns, we can try to find the natural number of clusters in a data set by looking for the number of clusters at wbich there is a knee, peak, or dip in the plot of the evaluation measure when it is plotted against the number of clusters. Of course, such an approach does not always work well. Clusters may be considerably more intertwined or overlapping than those shown in Figure 8.29 . Also, the data may consist of nested clusters. Actually, the clusters in Figure 8.29 are somewhat nested: i. e., there are 5 pairs of clll!'lters since the clusters are closer top to bottom than they are left to right. There is a knee that indicates tbis in the SSE curve, but the silhouette coefficient curve is not
Figure 8.32. SSE versus number of clusters for the data of Figure 9.29.
8.5 Cluster Evaluation 54 7
Figure 8.33. Average silhouette coefficient ver- sus number of cluslets for the data of Figure 8.29.
as clear. In sunmmry, wbile caution is needed, the technique we have just described can provide insight into the number of clusters in the data .
8.5.6 Clustering Tendency
One obvious way to determine if a data set has clusters is to try to cluster it. However, almost all clustering algorithms will dutifully find clusters when given data. To address tbis issue, we conld evaluate the resulting clusters and only claim that a data set has clusters if at least some of the clusters are of good quality. However, tbis approach does not address the fact the clusters in the data can be of a differ ent type than those sought by our clustering algorithm. To handle tbis additional problem, we could use multiple algorithms and again evaluate the quality of the resnlting clusters. If the clusters are uniformly poor, then tbis may indeed indicate that there are no clusters in the data.
Alternatively, and this is the focus of measures of clustering tendency, we can try to evaluate whether a data set has clusters without clustering. The most common approach, especially for data in Euclidean space, haB been to use statistical tests for spatial randonmess. Unfortunately, choosing the cor- rect model, estimating the parameters, and evaluating the statistical siguifi- cance of the hypothesis that the data is non-random can be quite challenging. Nonetheless, many approaches have been developed, most of them for points in low-dimensional Eudidean space.
Example 8.14 (Hopkins Statistic). For this approach, we generatep points that are randomly distributed across the data space and also sample p actual
548 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
data points. For both sets of points we find the distance to the nearest neigh- bor in the original data set. Let the u; be the nearest neighbor distances of the artificially generated points, while the w; are the nearest neighbor distances of the sample of points from the original data set. The Hopkins statistic H is then defined by Equation 8.17.
H = l:f-1 w; Lf=l Ui + Lf=l Wi
(8.17)
If the randomly generated points and the sample of data points have roughly the same nearest neighbor distances, then H will be near 0.5. Values of H near 0 and 1 indicate, respectively, data that is highly clustered and data that is regularly distributed in the data space. To give an example, the Hopkins statistic for the data of Figure 8. 26 was computed for p = 20 and 100 different trials. The average value of H was 0.56 with a standard deviation of 0.03. The same experiment was performed for the well-separated points of Figure 8.30. The average value of H WllB 0.95 with a standard deviation of 0.006. •
8 .5 .7 Supervised Measures of Cluster Validity
When we have external information about data, it is typically in the form of externally derived class labels for the data objects. In such cases, the usual procedure is to measure the degree of correspondence between the cluster labels and the class labels. But why is this of interest? After all, if we have the class labels, then what is the point in performing a cluster analysis? Motivations for such an analysis are the comparison of clustering techniques with the "ground truth" or the evaluation of the extent to which a manual classification process can be automatically produced by cluster analysis.
We consider two different kinds of approaches. The first set of techniques nse measures frum classification, such as entropy, purity, and the F-measure.
These measures evaluate the extent to which a cluste r contains objects of a single class . The second group of methods is related to the similarity measures for binary data, such as the Jaccard measure that we saw in Chapter 2. These approaches measure the extent to which two objects that are in the same class are in the same cluster and vice versa. For convenience, we will refer to these two types of measures as classification-oriented and similarity-oriented, respectively.
8.5 Cluster Evaluation 549
Classification-Oriented Measures of Cluster Validity
There are a number of measures- entropy, purity, precision, recall, and the F-measure-that are commonly used to evaluate the performance of a classi-
fication model. In the case of ciaBSification, we measure the degree to which predicted class labels correspond to actual class labels , but for the measures just mentioned, nothing fundamental is changed by using cluster labels in- stead of predicted class labels. Next, we quickly review the definitions of these meMures, which were discussed in Chapter 4.
Entropy: The degree to which each cluster consists of objects of a single class. For each cluster, the class distribution of the data is calculated first, i.e., for cluster j we compute Pij, the probability that a member of cluster i belongs to class j as Pij = mij / m;, where m; is the number of objects in cluster i and m;; is the number of objects of class j in cluster i. Using this class distribution. the entropy of each cluster i is calculated using the standard formula, e; = - LJ= 1 Pii log2 p;;, where L is the number of classes. The total entropy for a set of clusters is calculated as the swn of the entropies of each cluster weighted by the size of each cluster, i.e., e = 2:~1 ~e,, where K is the number of clusters and m is the total number of dat a points.
Purity: Another measure of the extent to which a cluster contains objects of a single class. Using the previous terminology, the purity of cluster i is p; = maxp;j, the overall purity of a clustering is pu•·ity = 2:~1 ~p;.
1
Precision: The fraction of a cluster that consists of objects of a specified class. The precision of cluster i with respect to class j is precision(i,j) = PiJ·
Recall: The extent to which a cluster contains all objects of a specified class. The recall of cluster i with respect to class j is •·ecall(i.j) = m;;/mj, where mi is the number of objects in class j.
F-measure A combination of both precision and recall that measures the extent to which a cluster contains only objects of a particular class and all objects of that class . The F-measure of cluster i with respect to class j is F(i, j) = {2 x precision(i,j) X recall(i,j)) / (precision (i, j) +recall(i,j)).
Example 8 . 15 (Supervised Evaluation Measures ). We present an exam- ple to illustrate these measures. Specifically, we use K-means with the cosine simila rity measure to clnster 3204 newspaper articles from the Los Angeles
550 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
Table 8.9. K-means clustering results for the lA Times document data set.
Cluster Enter- Financial Foreign Metro National Sports Entropy Purity tainment
1 3 5 40 506 96 27 1.2270 0. 7474 2 4 7 280 29 39 2 1.1472 0.7756 3 1 1 1 7 4 671 0.1813 0.9796 4 10 162 3 119 73 2 1.7487 0.4390 5 331 22 5 70 13 23 1.3976 0.7134 6 5 358 12 212 48 13 1.5523 0.5525
Total 354 555 341 943 273 738 1.1450 0.7203
Times. These articles come from six clifferent classes: Entertainment, Finan- cial, Foreign, Metro, National, and Sports. Table 8.9 shows the results of a K-means clustering to find six clusters. The first column indicates tbe clus- ter, while the next six columns together form t he confusion matrix; i.e. , these columns indicate how the documents of each category are distributed among the clusters. The last two columns are the entropy and purity of each cluster, respectively.
Ideally, each cluster will contain documents from only one class. In reality, each cluster contains documents from many classes. Neverth eless, many clus- ters contain documents primarily from jnst one class. In particular l clnster
3, which contains mostly documents from the Sports section, is exceptionally good, botb in terms of pnrity and entropy. The purity and entropy o f the oth e r clusters is not as good, but can typ ically be greatly improved if the data
is partitioned into a larger number of clusters. Precision, r ecall, and the F-measure can be calculated for each cluster. To
give a concrete example, we consider cluster 1 and the Metro clasB of Table 8.9. The precision is 506/677 = 0.75, recall is 506/943 = 0.26, and hence, the F value is 0.39. I n contrast, the F value for cluster 3 and Sports is 0.94. •
Similarity-Orie nted M e asures of Cluster Validity
The measures that we discnss in this section are all based on the premise that any two objects that are in the same cluste r should b e in the same class and vice versa. We can view this a pproach to closter validity as involving the comparison of two matrices: ( l) the ideal ci uster similarity matrix discussed previously, which has a 1 in the ijlh entry if two objects, i and j, are in the same cluster and 0, otherwise, and (2) an ideal class similarity matrix defined with respect to class labels, which has a 1 in the ;j'h entry if
8.5 Cluster Evaluation 551
two objects, i and j, belong to the same class, and a 0 otherwise. As before, we can take the correlation of these two matrices as the measure of cluster valiclity. This measure is known as the r statistic in clustering validation literature. Example 8.16 (Correlation between Cluster and Class Matrices). To demonstrate this idea more concretely, we give a n example involving five data points, Pl·P2.P3 , P4.P5. two clusters, C1 = {P! ,P2.P3) and Co= {p,,p,), and two classes, Lt = {pJ,P2} and £2 = {P3-P4· P5}- The ideal cluster and class similarity matrices are given in Tables 8.10 and 8 .11. The correlation between the entries of these two matrices is 0.359.
Table 8.10. Ideal cluster sim~arity matrix. Table 8.11 . Ideal class similarity matrix.
Point p1 p2 p3 p4 p5 Point p1 p2 p3 p4 p5 p1 1 1 1 0 0 pl 1 1 0 0 0 p2 1 1 1 0 0 p2 1 1 0 0 0 p3 1 1 1 0 0 p3 0 0 1 1 1 p4 0 0 0 1 1 p4 0 0 1 1 1 p5 0 0 0 1 1 p5 0 0 1 1 1
• More generally, we can use any of the measures for binary similarity that
we saw in Section 2.4.5. (For example, we can convert these two matrices into binary vectors by appending the rows .) We repeat the definitions of the four quantities used to define those similarity measures, but modify our descriptive text to fit the current context. Specifically, we need to compute the following four quantities for all pairs of distinct objects. (The re are m(m - 1) / 2 such pairs, if m is the number of objects.)
loo = numbe r of pairs of objects having a different class and a different cluste r lo1 = number of pairs of objects h aving a clifferent class and the same cluster ho = number of pairs of objects having the same class and a clifferent cluster /11 = nnmher of pairs of objects having the same class and the same cluster
In particular, the simple matching coefficient, which is known as the Rand statistic in this context, and the J accard coefficient are two of the most fre- quently used cluster validity measures.
Rand statistic = /oo + In loo + lot + ho + /11
(8.18)
552 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
Jaccard coefficient= f, ; 11 f (8.19)
01 + 10 + 11 Example 8.17 (Rand and Jaccard Measures). Based on these formulas, we can readily compute the Rand statistic and Jaccard coefficient for the example based o n Tables 8.10 and 8.11. Noting that /oo = 4. /01 = 2 , ho = 2, and !11 = 2, the Rand statistic= (2 + 4)/10 = 0.6 and the Jaccard coefficient = 2/(2+2+ 2 ) = 0.33. •
We also note that the four quantities, foo, /oJ. J,o, and /u. define a con- tingency table as shown in Table 8 .12.
Table 8.12. Twcrway contingency table for determining wt-ett-er pairs of objects are in the same class and same cluster.
.-------<0,-ru~.r~~~~
Previously, in the context of association analysis-see Section 6.7.1- we presented an extensive discussion of measures of association that can be used for this type of contingency table. (Compare Table 8.12 with Table 6. 7.) Those measures can also be applied to cluster validity.
Cluster Validity for Hierarchical Clusterings
So far in this section, we have discussed supervised measures of cluster va- lidity only for partitional clusterings. Supervised evaluation of a hierarchical clustering is more difficult for a variety of reasons , including the. fact that a preexisting hierarchical structure often does not exist. Here, we will give an example o f an approach for evaluating a hierarchical clustering in terms of a (flat) set of class labels, which are more likely to be available than a preexisting hierarchical structure.
The key idea of this approach is to evaluate whether a hierarchical clns- t ering contains, for each class. at least one cluster that is relatively pure and includes most of the objects of that class. To evaluate a hierarchical cluster- ing with r espect to this goal, we compute. for each class, the F-measure for each clnster in the cluster hierarchy. For each class, we take t he maximum F - measure attained for any cluster. Finally, we calculate an overall F -measure for the hierarchical clustering by computing the weighted average. of all per-class F-measures, where the weights are based on the class sizes. More formally,
8.5 Cluster Evaluation 553
this hierarchical F-measure is defined as follows:
F ="' mJ maxF(i.j) ~ m '
j
where the maximum is taken over all clusters i at all levels, m1 is the number of objects in class j, and m is the total number of objects.
8.5.8 Assessing the Significance of Cluster Validity Measures
Cluster validity measures are intended to help us measure the goodness of the cluste rs that we have obtained. Indeed, they typically give us a single number as a measure of that goodness. However, we are then faced with the problem of interpreting the significance of this number. a task that may be even more difficult.
T he minimum and maximum values of cluster evaJuation m ea.sUies may provide some guidance in many cases. For instance, by definition, a purity of 0 is bad, while a purity of 1 is good, at least if we trust our class labels and want our cluster structure to re:Hect the class structure. Likewise, an entropy of 0 is good, as is an SSE of 0.
Sometimes, however, there may not be a mirrimwn or max.imwn value, or the scale of the data may affect the interpretation. Also, even if there are rninimwn and maximum values with obvious interpretations, intern1ediate values stilJ need to be interpreted. In some cases, we can use an absolute standard. If, for example, we are clustering for utility, we may be w illing to tolerate only a certain level of error in the approximation of our points by a cluster centroid .
But if this is not the case, then we must do somethin g else. A common approach is to interpret the value of our validity measure in statistical tenns . Specifically, we attempt to judge how likely it is that our observed value may be achieved by random chance. The value is good if it is unusual; i.e .• if it is unlikely to be the result of random chance. The motivation for this approach is that we are only interested in clusters that reflect non-random structure in the data, and s uch s tructures should generate unusually high (low) values of our cluster validity measure, at least if the validity measures are designed to reflect the presence of strong cluster structure.
Example 8.18 (Significance of SSE). To show how this works, we present an example b!l.'led on K-means and the SSE. Suppose that we want a measure of how good the well-separated clusters o f Figure 8.30 are with respect to random data. We generate many random sets of 100 points having the same range as
554 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
0.04 SSE
Figur11 8.34. Histogram of SSE for 500 random data sets.
the points in the three clusters, find three clusters in each data set using K- means, and accumulate the distribution of SSE values for these clusterings. By using this distribution of the SSE values, we can then estimate the probability of the S SE value for the original clusters. Figure 8.34 shows the histogram of the SSE from 500 random runs. The lowest SSE shown in Figure 8.34 is 0.0173. For the three clusters of Figure 8.30, the SSE is 0.0050. We could therefore conservative ly claim that there is less than a 1% chance that a clustering such as that of Figure 8.30 could occur by chance. •
To conclude, we stress that there is more to cluster evaluation---supervised or urumperv:ised-than obtaining a numerical mem;ure of cluster validity. U n- less this value has a natural interpretation based on the definition of the mea- sure, we need to interpret th.is value in some way. If our cluster evaluation measure is defined such that lower values indicate stronger clusters, then we can use statistics to evaluate whether the value we have obtained is unusually low, provided we have a distribution for the evaluation measure. We have pre- sented an example of how to find such a distribution, but there is considerably more to this topic, and we r efe r the reader to the bibliographic notes for more pointers.
Fina1ly, even when an evaluation measure is used aa a relative measure , i.e., to compare two clusterings, we still need to assess the significance in the difference between the evaluation measures of the two clusterings. Althongh one value will almost always be better than another. it can be difficult to determine if the difference is significant. Note that there are two aspects to this significance: whether the difference is statistically significant (repeatable)
8.6 Bibliographic Notes 555
and whether the magnitude of the difference is meaningful with respect to the application. Many would not regard a difference of 0.1% as significant, even if it is consistently reproducible.
8.6 Bibliographic Notes
Discussion in this chapter has been most heavily influenced by the books on clnster analysis WTitten by Jain and Dubes [396], Anderberg [37 4], and Kauf- man and Rousseeuw [400]. Additional clustering books that may alsc be of interest inclnde t hose by Aldenderfer and Blashfield [373], Everitt et a!. [388] , Hartigan [394], Mirkin [405], Murtagh [407]. Romesburg [409], and Spath [413]. A more statistically oriented approach to cluste ring is given by the pattern recognition book of Duda et a!. [385], the machine learning book of Mitchell [406] , and the book on statistical learning by Hastie et a!. [395]. A general survey of clustering is given by Jain et a!. [397], while a survey of spatial data mining techniques is provided by Han et a!. [393] . Behrkin [379] provides a survey of clustering techniques for data mining. A good sonrce of references to clustering outside of the data miffing field is the article by Arabie and Hu- bert [376]. A paper by Kleinberg [401] provides a discussion of some of the trade-offs that clustering a lgorithms make and proves that it is impossible to for a clustering algorithm to simultaneously possess three simple properties.
The K-means algorithm has a long history, but is still the subject of current research. The original K-meaus algorithm was proposed by MacQueen [403]. The ISO DATA algorithm by Ball and Hall [377] was an early. but sophisticated version of K-me ans that employed various pre- and postprocessing techniques
to improve on the basic algorithm. The K-means a lgorithm and many of its variations are described in detail in the books by Anderberg [374] and Jain and Dubes [396], The bisecting K-means algorithm discussed in this chapter was described in a paper by Steinbach et a!. [4 14], and an implementation of this and other clustering approaches is freely available for academic use in the CLUTO (CLUstering TOolkit) package created by Karypis [382]. Boley [380] h as created a divisive partitioning clustering algorithm (PDDP) based on finding the first principal direction (component) of the data, and Savaresi and Boley [411] have explored its relations hip to bisecting K-means. Recent variations of K-means are a new increment al version of K-means (Dhillon eta!. [383]) , X- means (Pelleg and Moore [408]), and K-barmorric means (Zhang et al [416]). Haruerly and Elkan [392] discuss some clustering algorithms that pro- duce b etter results than K-means. While some of the previously mentioned approaches address the initialization problem of K-means in some manner,
556 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
other approaches to improving K-means initialization can also be found in the work of Bradley and Fayyad [381]. DbiUon and Modha [384] present a gen- eralization of K-means, called spherical K-means, that works with commonly used similarity functions. A general framework for K-means clustering that uses dissimilarity functions based on Bregman divergence s was constructed by Banerjee et aJ. [378].
Hierarchical clustering techniques also have a long history. Much of the initial activity was in the area of taxonomy and is covered in books by Jardine and Sibson [398] and Sneath and Sokal [412]. General-purpose discussions of hierarchical clustering are also available in most of the clustering books men- tioned above. Agglomerative hierarchical clustering is the focus of most work in the area of hierarchical clustering, but divisive approaches have also received some attention. For example, Zahn [415] describes a clivisive hie rarchical tech- nique t hat uses the minimum spanning tree of a graph. While both divisive and agglomerative approaches typically take the view that merging (splitting) decisions are final , there has been some work by Fisher [389] and Karypis et a!. [399] to overcome these limitations.
Ester et a!. proposed DBSCAN [387], which was later generalized to the GDBSCAN algorithm by Sander et a!. [410] in order to handle more general types of data and distance measures. such as polygons whose closeness is mea- sured by the degree of intersection. An incremental version of DBSCAN was developed by Kriegel et a!. [386]. One interesting outgrowth of DBSCAN is OPTICS (Ordering Points To Identify the Clustering Structure) (Ankerst et al. [375]), which allows t he visualization of cluster structure and can also be used for hierarchical clustering.
An authoritative cliscussion of cluster valiclity, which strongly influenced the discussion in this chapter. is provided in Chapter 4 of Jain and Dubes' clustering book [396]. More recent reviews of cluster valiclity are those of Halkidi et a!. [390, 391 J and Milligan [ 404]. Silhouette coefficients are described in Kaufman and R.ousseeuw's clustering book [400]. The source of the cohesion and separation measures in Table 8.6 is a paper by Zhao and Karypis [417], which also contains a discussion of entropy, purity, and the hierarchical F- measure. The original source of the hierarchical F-measure is an article by Larsen and Aone [402].
Bibliography [373] M. S. Aldenderfer and R. K. BIMhfield . Cluster Analysis. Sage Publications, Los
Angeles. 1985. [3i4] M. R. Anderberg. Cluster Analysi!l for Applications. Academic Press, New York,
December 1973.
Bibliography 557
[375] M. Ankerst. M. M. Breunig. H.-P. Kriegel, and J. Sander. OPTICS: Ordering Points To Identify the Clustering Structure. In Proc. of 1999 ACM-SIGMOD Inti. Con/. on Managemfnt of Data, pages 4~60, Philadelphia, Pennsylvania, June togo_ ACM PrE"SS.
[376] P. Arabie1 L. Hubert, Blld G. D. Soete. An overview of combinatorial data analysis. In P. Arabie, L. Hubert, and G. D. Soete, editors. Clustering and Cla3rification, pages 188-217. \Vorld Scientific, Singapore, January 1996.
[377] G. Ball and D. Hall. A Clustering Technique for Summarizing Multivariate Data. Behavior Science. 12:153-155, March 1967.
[378] A . Banerjee, S. Merugu. I. S. Dhillon, and J. Ghooh. C lustering with Bregman Diver- gences. In Proc. of the ~004 SIAM Inti. C01Jj. on Data Mintng, pages 234-245, Lake Buena. V ista, FL. April 2004.
[379] P. Berkhin. Survey Of Clustering Data Mining Techniques. Technical report. Acc rue Softv.-are, San Jose, CA , 2002.
[380] D. Boley. Principal Direction Divisive Partitioning. Dota. M ining and Knou•iedge Discrn•ery, 2(4):325 344. 1008.
[381] P. S. Bradley and U. M. Fayyad. Refining Initial Points for K-Means Clustering. In Proc. of the 15th Inti. Ccm,J. on Machine Learning, pages 01- 90. Madison, WI, July 1908. Morgan Kaufmann Publishers Inc.
[382] CLUTO 2.1.1: Software for Clustering High-D imensio nal Datasets. /www.cs.umn.edu/,..,karypis, Navember 2003.
[383] I. S. Dhillon, Y. Guan, and J. Kogan. Iterative C lustering of High Dimensional Text Data Augmented by Local Search. In Proc. of the 2009 IEEE I nti. Con/. on Data Mining, pages 131- 138. IEEE C.ornputer Society. 2002.
[384] I. S. Dhillon and D . S. Modba. Concept D€<nrnpositions for Large Sparse Text Data Using C lustering. Nfachine Learning. 42(1/2):143--175, 2001.
[385] R . 0 . Duda! P. E. Hart. and D. G. Stork. Pattern Classification. John Wiley & Sons, Inc. l New Yorkl second edition, 2001.
[386] M. Ester, H .-P. Kriegel. J. Sander, M. Wimmer. and X. Xu. Incremental Clustering for Mining in a Data Warehousing Environment. In Proc. of the QJth VLDB Conf., pages 323-333, New York City, August 1998. Morgan Kaufmann .
[387] M. Ester, H.-P. Kriegel, J . Sander, and X. Xu. A Density-Based Algorithm for Dis- covering Clu sters in Large Spatial Databases witb N oise. fu Proc. of the Qnd Inti. Conf. on Knowledge Discovery and Data Mining , pages 226- 231, Portland, Oregon, August 1906. AAAI Press.
[388] B. S. Eve ritt, S. Landau. and M. Leese. Cluster Aoolysis. Arnold Publishers, Londo n . fourth edition, May 2001.
[389] D . Fisher. Iterative Optimization and Simplification of Hierarchical Clusterings. Jour- nal of Artificial Intelligence Remmh, 4:147 179, 1096.
[390] M. Halkidi, Y. Batistakis, and M. Vazirgiannis. C luster validity methods: part I. SIGMOD Record (ACM Sped.al Interest Group on Management of D ata), 31(2) :40-45, June 2002.
[391] M. Halkidi , Y. Batistakis, and l\L Vazirgiannis. Clustering vaJidity checking methods: part II. SIGMOD Record (ACM Special Interest Group on Management of Data). 31 (3) :19 '1:7, Sept. 2002.
[392] G. Hamerly a nd C. Elkan. Alterna tives to the k-mean s algorithm that find better clusterings. In Proc. of the 11th Inti. Con/. on Injonnation and Knowledge Managemen~ pages OOG-607, l\·icLean , V irginia, 2002. ACM Press.
558 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
[3!J3] J. Han. )\[. Kamber, and A. Thng. Spatial Clustering Methods in Data Mining: A review. In H. J. Miller and J. Han, editors. Geographic Data Mifiing and Knowledge Discovery, pages 188 217. Taylor and Francis, London, December 2001.
[394] J. Hartigan. Clustering Algorithm!l. Wiley, New Yorkl 1975.
[395] T. Hastie, R. Tibshirani, and J. H. Friedman. The Elements of Statistic.al Learning: Data Mining, Inference, Prediction. Springer, New York. 2001.
[3!JG] A. K. Jain and R. C. Dubes. Algorithms for Clustering Data. Prentice Hall Advanced Reference Series. Prentice Hall, ~-la.rch 1988. Book available online nt http:/ j www .cse.msu.edu f ,. .... .jain/ Clustering_Jain..D ubes. pdf.
[397] A. K. Jain, M. N. Murty, and P. J. Fl.vnu. Data clustering: A review. ACJ\<1 Computing Suroeys. 31(3):264-323, September 1009.
[398] N. Jardine and R. Sibson. Mathematical Taxcnomy. Wiley. New York. 1971. [:W!l] G. Karypis. E.-H. Han, and V. Kumar. Multilevel Refinement for Hierarchical Clus-
tering. Technical Report TR 99-020, University of J\finnesota, Minneapolis, MN, 199g_
[400] L. Kaufman and P. J. Rousseeuw. Findir~g Groups in Data; An Introduction to Cluster Analysis. \Viley Series in Probability and Statistics. John \Viley and Sons, New York. November 1990.
[401] J. M. Kleinberg. An Impossibility Theorem lor Clustering. In Proc. of the 16th Annual Con}. on Neurollnformation Processing Systems, December, 9-l4 2002.
[402] B. Larsen and C. Aone. Fast 81ld Effeetive Text Mining Using Linear-Time Document Clustering. In Proc. of the Sfh. InU. Conf. on Knou1ledge Discouery and Data Mining. pages 16-22, San Diego, California, 1909. ACM Press.
[403] J. 1tlacQueen. Some methods for classification and analysis of multivariate observa- tlons . In Proc. of the 5th Ber/..:eley Symp. on Mathematical Statistics an d Probability, pages 281- 297. University of California Press. 1967.
[404] G. W. Milligan. Clustering Validation: Results and Implications for Applied Analyses. In P. Arabie, L. Hubert, and G . D. Soete, editors. Clustering and ClfJssifirotion, pages 345-375. World Scientific, Singapore. January 1996.
[405] B. hlirkin. Mathematical Clasfrijication and G1ustering, volume 11 of Noncontlt!X Opti- m i zation and Its Applications. Kluwe r Academic Publishers, August 1996 .
[406] T. Mitchell. Machine Learning. McGraw-Hill, Bo.ton. MA , 1997. [407] F. Murtagh. Multidimensional Clusteri ng Algorith~. Physica-Verlag, Heidelberg and
Vienna, 1085. [408] D. Pelleg and A. W. Moore. X -means: Extending K - means with Efficient Estimation
of the Number of C lusters. In Proc. of the 17th lntl. Con/. on );lachine Lro.,-ning. pages 727- 734. Morgan Kaufmann, San Francisco, CA. 2000.
[409] C. Romesburg. Cluster Analysis for Researcher-s. Life Time Learning, Belmont. CA, !984.
[410] J. Sander, M. E s ter . H.-P. Kriegel , and X. Xu. Density-Based Clustering in Spatial Databases: The Algorithm GDBSCAN and its Applications. Data A-fining and Knowl- edge Discovery, 2(2):16!)-194, 1008.
[411] S. M. Savaresi and D. Boley. A compaxative analysis on the bisectiug K-means and the PDDP clustering algorithms. Intelligent Data Analysis, 8(4):345-362, 2004.
[412] P. H . A . Sneath and R R. Soka.l. Numerical Taxonomy. Fteeman, San Francisco, 1071. [413] H . Sp3.th . Cluste.,- Analysis Algorithm! for Data Reduction and Classification of Ob-
jects, volume 4 of Computers and The?r Appli~ation. Ellis Horwood Publishers, Chich- est er, 1980. ISBN 0-85312-141- 9.
8 . 7 Exercises 559
[414] ~-1. Steinbach, G. Karypis, and V. Kumar. A Comparison of Document Clustering Techniques. In Proc. of KDD Workshop on Text Mming, Proc. of the 6th InU. Conf. on Knowledge Discot1ery and Data Mining, Boston, ~·lA, August 2000.
[415] C. T. Zalm. Graph-Theoretical ~Iethods for Detecting and DesT.ibing Gestalt Clusters. IEEE Transactions on Computers, C- 20(1) :68-86, Jan. 1971.
[416] B. Zhang, M. Hsu, and U. Dayal. K-Harmonic Means A Data Clustering Algorithm. Technical Report HPL-1900-124, Hewlett Packard Laboratories, Oct. 29 1999.
[417] Y. Zhao and G. Karypis. Empirical and theoretical comparisons of selected criterion functions for document clustering. Machine Learning, 55(3):311- 331, 2004.
8. 7 Exercises
I. Consider a data set consisting of 220 data vectors, where each vector has 32 components and each component is a 4-byte value. Suppose that vector quan- tization is: used for compression and that 216 prototype vectors: are used. How many bytes of storage does that data set take before and after compression and what is th£> compression ratio'?
2. Find all well-separated clusters in the set of points shown in Figure 8.35.
. .. . .. . .. . ..
. .. . . . . .. Figure 8.35. Points for Exercise 2.
3. 1'!8Jly pa.rtitional clus:tering algorithms: that automatically determine the num- ber of clusters claim that this is an advantage. List two situations in which this is not the case.
4. Given K equally sized clusters, the probability that a randomly chosen initial centroid will come from any given cluster is 1/ K . but the probability that each cluster will have exactly one initial CPntroid is much lower. (It should be clear that having one initial centroid in each cluster is a good starting s:ituation for K-means.) In general. if there are K clusters and each cluster ha.s n points, then the probability, p, of selecting in a sample of size K one initial centroid frmn each cluster is given by Equation 8.20. (This assumes sampling with replacement.) From this formula we can calculate, for example , that the chance of having one initial centroid from each of fow dusters is 4!/4' = 0.0938.
560 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
number of ways to select one cetltroid from ea.ch cluster K!nK K! p = numbPr of ways to se[Kt K centroids = (Kn)K = KK (8.20)
(a) Plot the probabUity of obtaining one point from each duster in a siUllple of size K for values of K between 2 and 100.
(b) Fbr K dusters. K = 10,100, and 1000, find the probability that a sample of size 2K containB at least one point from each cluster. You can use either mathematical methods or statistical simulation to determine the answer.
5. Identify the clusters in Figure 8.36 w;i.ng the center- , com.iguity-, snd density- based definitions. Also indicate the number of clusters for each case and give a brief indication of your reasouing. Note that darkness or the number of dots indicates density. If it helps, assume center-based means K-mean•, contiguity- based means single link, and density-based means DBSCAN.
(a) (b) (c) (d)
Figure 8.36. Clusters for Exercise 5.
6. For the following sets of two-dimensional points, (1) provide a sketch of how they would be split into clusters by K-means for the given number of clusters and (2) indicate approximately where the resulting centroids would be. Assume that. we are using the squared error objective function. If you think that there is more than one possible solution, then please indicate whether each solution is a global or local minimum. Note that the la.bel of each diagram in Figure 8.37 matdles the corresponding part of this question. e.g., Figure 8.37(a) goes with part (a).
(a) K = 2. Assuming that the points are uniformly distributed in the circle. how many possible ways are there (in theory) to partition the points into two clust£'rs'? \Vbat can you say about d1e positioru; of th() two centroids? (Again, you don!t need to provide exact centroid locatioru;, just a qualitative description.)
0 G (a) (b) (c) (d)
Figure 8.37. Diagrams for Exercise 6.
8 . 7 Exercises 561
0 0 (C?\ u
(e)
(b) K = 3. The distance between the edges of the circles is slightly greater than the radii of the circles.
(c) K = 3. The distance between the edges of the circles is much less than the radii of the circles.
(d) K = 2.
(e) K = 3. Hint: Use the symmetry of the situation and remember that we are looking for a rough sketch of what the result would be.
7. Suppose that for a data set
• the re are m points and K clusters 1 • half the points and clusters are in ''more dense-'' regions:
• half the points and clusters are in "less dense" regions, and • the two regions are well-separated from each other.
For the given data set , which of the following should o~ur in order to minimize the squared error when finding K clusters:
(a) Centroids should be equally distributed between more dense and less dense regions.
(b) More centroids should be allocated to the less dense region.
(c) More centroids should be allocated to t-he denser region.
Note: Do not get distracted by special cases or bring in factors other than density. However, if you feel the true answer is different from any given above, justify your response.
8. Consider the mean of a cluster of objects from a binary transaction data set. \Vhat are the minimum and maximun1 values of the components of the mean? What is the interpretation of components of the cluster mean? Which compo- nents most aecurately charact.erize the objects in the cluster?
9. Give an example of a data set consistiug of three natural clusters, for which (almost always) K-means would likely find the correct clusters, but bisecting K-means would not.
562 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
10. ¥lould the cosine measure he th e- appropriate similarity measure to use with K- means clustering for time series data? Why or why not'? If not, whst similarity measure would be more appropriate?
11. Total SSE is the sum of the SSE for each separate attribute. What does it mean if the SSE for one variable is low for all clusters? Low for just one cluster? High for all clusters? High for just one cluster? How could you use the per varia.hle SSE information to improve your clustering?
12. The leader algorithm (Hartigan [394)) represents each cluster using a point. known as a leader1 and assigns each point to the cluster corresponding to the closest leader, unless this distance is above a user-specified threshold. In that case, the point becomes the leader of a new cluster.
(a) What 81'e the adVlilltages and disadVBlltages of the leader e.lgorithm as compared to K-means'?
(b) Suggest ways in which t.he leader e.lgorithm might be improved.
13. The Voronoi diagram for a set of K points iu the plane is a partition of all the points of the plane into K regions, such that every point (of the plane) is assigned to the closest point among the K specified points. (See Figure 8.38.) \Vhat is the re lationship bPtween Voronoi diagrruns and K-means clus- ters? What do Voronoi diagrams tell us about the possible shapes of K-means clnsters'?
Figure 8.38. Varanai diagram for Exercise 13.
14. You are given a data set with 100 records and are esked to cluster the data. You use K-means to cluster the data, but for all values of K. 1 ~ K ~ 100, the K-means algorithm returns only one non-empty cluster. You then apply an incremental version of K-means, hut obt.ain exactly the same result. How is this possible? How would single link or DBSCAN handle such data?
15 . Traditional agglomerative hierarchical clustering routines merge two clusters at each step. Does it seem likely that such an approach accurately captures the
8. 7 Exercises 563
(nest€<~) cluster structure of a set of data points? If not, explain how you might postprocess the data to obtain a more accurate view of the cluster structure.
16. Use the similarity matrix in Table 8.13 to perform single and complete link hierarchical clustering. Sbow your resuJts by drawing a. dendrogram. Tbe den- drogram should clearly show tbe order in which the points are merged.
Table 8.13. Simiarily matrix far Exercise 16.
pi p2 p3 p4 p5 pl 1.00 0.10 0.41 0.55 0.35 p2 0.10 1.00 0.64 0.47 0.98 p3 0.41 0.64 1.00 0.44 0.85 p4 0.55 0.47 0.44 1.00 0.76 p5 0.35 0.98 0.85 0.76 1.00
17. Hierarchical clustering is sometimes used to generate K clusters, K > 1 by taking the clusters a t the K'h level of the dendrogram. (Root is at level L) By looking at the clusters produced in this way, we can evaluat" the behavior of hierarchical clustering on different types of data and clnsters, and also compare hierarchice.l approaches to K-means.
The following is a set of ou<>-dimensional points: {6,12, 18, 24,30,42,48).
(a) For each of the following sets of initie.l centroids, create two clusters by assignjug each point to the nearest centroid, and then calcnlate the total squa.red error for each set. of two clliSters. Show both the clusters and t.he total squared error for each set of centroids.
i. {18,45}
ii. {15, 40}
(h) Do both sets of cent.roids represent stable solutions; i.e., if t he K-means algorithm was run on this set of points using the given centroids as the starting centroids, would there be any change in the clusters generated?
(c) What are the two clusters produced by single link?
(d) Which technique. K-meaos or single link, seems to produce the "most natural" clustering in this situation? (For K-means, take the clustering with the lowest squared error.)
(e ) What delinition(s) of clustering does t his natnral clustering correspond to? (Well-separatro, cent<>r-based, contiguous. or deusity.)
(f) What well-known characteristic of the K-mesns algorithm explains the previous behavior'?
564 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
18. Suppose we find K clusters using Ward's method, bisecting K-means, and ordi- nary K-means. Which of these solutions represents a local or global minimum? Explain.
19. Hierarchical clustering algorithms require O(m2 log( m)) time, and consequently. are impractical to use directly on larger data sets. One po&Sible technique for reducing the time required is to sample the data set. For exan1ple, if K clusters are desired and rm points ace sampled from the m points. then a hieracchi- cal clustering algorithm will produce a hierarchical clustering in roughly O(m) time. K clusters can be extracted from this hierarchical clustering by taking the clusters on the K 'h level of the dendrogram. The remaining points can then be assigned to a cluster in linear time, by using various strategies. To give a specific exrunple, the centroids of the K dusters can be computed, and thPn each of the m- Jfii remaining points can be assigned to the cluster associated with the closest centroid.
For each of the foUowing types of data or clusters, discuss briefly if ( 1) sampling will cause problems for this approach and (2) what those problems are. Assume that the sampling teclmique randomly chooses points from tbe total set of m points and that any unmentioned characteristics of the data or clusters are as optimal as possible. In other words, focus only on problems caused by the particular dJ.arecteristic n1entionM. Fina.lly, 9S8ume that K is very muc-h less than m .
(a) Data with very different sized clusters.
(b) High-dimensional data.
(c) Data with outliers, i.e ., atypical points.
(d) Data with highly irregular regions.
(e) Data with globnlar clusters.
(f) Data with widely different densities.
(g) Data with a small percentage of noise points.
(h) Non-Euclidean data.
(i) Euclidean data.
(j) Data with many and mixed attribute types.
20. Consider the following fonr faces shown in Figure 8.39. Again, darkness or numher of dots represents density. Lines are used only to distinguish regions and do n ot represent points.
(a) For each figure, conld you use single link to find the patterns represented by the nose , eyes, and mouth? Explain.
(b) For each figure, could you use K-mea.ns to find the patterns represented by the nose, eyes, and mouth? Explain.
8. 7 Exercises 56 5
• . ,::::::::::.®
}(:{ :: 6:: : ® 0 : :.:: : :.o·.··. ::.:: .. :::: "' ..... .. .... ~ : : ;:g:: : ~
· .. ·.· .· .·.·.
(a) (b) (c) (d)
Figure 8.39. Figure for Exercise 20.
(c) What liluitation does clusterh1g have in detecting all the patterns formed by the points in Figure 8.39(c)?
21. Compute the entropy and purity for the confusion matrix in Table 8.14.
Table 8.14. Con~on matrix for Exercise 21 . Cluster Enterta.irunent Financial Foreign Metro National Sports Total
#1 1 1 0 11 4 676 693
#2 27 89 333 827 253 33 1562 #3 326 465 8 105 16 29 949
Total 354 555 341 943 273 738 3204
22. You are given two set s of 100 poiuts that fall within the unit square. One set of points is arranged so that the points are uniformly spaced. The other set o( points is generated from a uniform distribution over the unit square.
(a) J.s there a difference betweeu the two sets of points?
(b) If so, which set of points will typically have a smaller SSE for K=IO clusters?
(c) What will be the behavior of DBSCAN on the unifonn data set? The random data set?
23. Using the data in Exercise 24. compute the silhouette coefficient for each point, each of the two clusters. and the overall clustering.
24. Given the set of cluster labels and similarity matrix shown in Tables 8.15 and 8.16, respectively1 compute the correlation between the similarity matrix and the ideal similarity matrix, i.e., the matrix whose i/h entry is 1 if two objects belong to the same cluster, and 0 otherwise.
566 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
Table 8.15. Table of cluster labels for Exeroioo 24. Table 8.16. Similarity matrix for Exeroioo 24.
Point Cluster Label Point P1 P2 P3 P4 P1 1 PI I 0.8 0.65 0.55 P2 1 P2 0.8 1 0.7 0.6 P3 2 P3 0.65 0.7 1 0.9 P4 2 P4 0.55 0.6 0.9 1
25. Compute the hienJichical F-measure for the eight objects {pi, p2, p3, p4, p5, p6. p7, p8} and hierarchical clustering shown in Figure 8.40. Class A contains points pl, p2, and p3, while p4, p5, p6. p7, and p8 belong to class B.
Figull! 8.40. Hierarchical clustering for Exercise 25.
26 . Compute the cophenet.ic correlation coefficient for the hierarchical clusterings in Exercise 16. (You will need to convert the similarities into dissimilarities.)
27. Prove Equation 8.14.
28. Prove Equation 8.16.
29. Prove that :Lf~1 :L,Ec (x - m,)(m - m;) = 0. This fact was used in the proof that TSS = SSE + SSB in Section 8. 5. 2.
30. Clusters of documents can be summarized by finding the top terms (words ) for the documents in the cluster. e .g., by taking the most frequent k terms, where k is a constant, say !0, or by taking all terms that occur more frequently than a specified threshold. Suppose that K-means is used to find clusters of both documents 8lld words for a document data set.
(a) How might a set of term clusters defined by the top terms in a document cluster differ from the word clusters found by clustering the terms with K- means'?
(b) How could term clustering be used to define clusters of documents?
31. We can represent a d ata set as a collection of object nodes and a collection of attribute nodes. where there is a link between ea.ch object and e<~ch attribute,
8. 7 Exercises 567
and where the weight ofthat link is the value of the object for that attribute. For sparse data, if the value is 0, the link is omitted. Bipartite clustering attempts to partition this graph into disjoint. clusters, where each cluster consist-s of a set of object nodes and a set of attribute nodes. The objective is to mrocimize the weight of links between the object and attribute nodes of a cluster, while minimizing the weight of links between object and attribute links in different clusters. This type of clustering is also known as co-clustering since the objects and attributes are clustered at the same time.
(a) How is bipartite clustering (co-clustering) different from clustering the sets of objects and attributes separately?
(b) Are there any cases in which these approaches yield the same clusters?
(c ) What are the s trengths and weaknesses of co-clustering as compared to ordinary clustering"?
32. In Figure 8.41, ma.tch the similarity matrices, which are sorted according to cluster labels, with the sets of points. Differences in shading and marker shape diBtinguish between clusters , and each set of points contains 100 points and three clusters. In t he set of points labeled 2, there are three very tight, equal- sized clusters.
568 Chapter 8 Cluster Analysis: Basic Concepts and Algorithms
1
•• . .. :: ., .. . 0 .0 "' ... O.t 0.1 . . 0 .1 •• . "1 • ..... . O.t
Jo 0.5 ... .
.. 0.5 .. :· .. 0 .4 ., ... 0 .3 02 . ~ 0 .2 0.1
,. '
.. . . 00
0.0 0.0
0.8 0 .8
0.1
i··"' 0.1
0,6 ~~ :..o.s .~ .. 0.5 .$_ • 0.4 ·it 0.4 0.3 0.3 ,::,.-; .. .-.~. 0 .2 ·'lK- 0.2
0.1 ., .... .~
0.1 ..... · t~·
o. 0> 0.4 0.6
Figure 8.41 . Points and similarity matrioas for Exercise 32.
I
Errata for Introduction to Data Mining by Tan, Steinbach, and Kumar.
Please send all error reports to [email protected]
Preface
Errata 1
Page x, last sentence of first paragraph: The emall address for reporting errata has an error. Please UBe the one given above.
Chapter 2
1. Page 23: The title "What Is an attribute?" should be "What ls a.n Attribute?".
2. Page 60, equation in the last paragraph: "e; = E~=l p;; log2 p;;'' should be "e; = - E~=l Pii log2 Pi/.
3. Page 69, fourth line from bottom: "of x and y" should be "of x a.nd y".
4. Page 70, second line from bottom: "d(x, x) ~ 0 for all x a.nd y" should be "d(x,y) ~ 0 for all x andy".
5. Page 75, second equation before the last paragraph: IIYII should be 2.45, not 2.24.
6. Page 78, last sentence of the first paragraph: "xk = y'f: should be "111c =x~"·
7. Page 91, Exercise 14: "what sort of similarity measure" should be "what sort of proximity measure".
Chapter 3
1. Page 100 Table 3.1: The number of freshman should be 200 a.nd the number of seniors should be llO, as shown in Table 1.
Table 1. aass size for students in a hypothetical college.
Class Size Frequency freshman 200 0.33 sophomore 160 0.27 junior 130 0.22 senior no 0.18
2 Errata
2. Page 126: Example 3.21: "Figure 3.25 is another parallel coordinates plot of the same data,'' should be "Figure 3. 26 is another parallel coordinates plot of the same data,"
Chapter 4
1. Page 160, second line from the bottom of the second paragraph from the bottom: "the Gini index for attribute B is 0.375" should be "'the Gini index for attribute B is 0.371".
2. Page 161, F igure 4.14, bottom rigbt table. "Gini = 0.375" should be "Gini = 0.371" .
3. Page 173, second from bottom line: "Figure 4.23(b) shows the training and test error rates" should be ''Figure 4. 23 shows the training and test error rates" .
4. Page 189, sixth from bottom line, the equation should be:
5. Page 192, Equation 4.17:
df'' = 0.05 ± 1.70 X 0.002.
6. Page 193, Table 4.6. Column headings are given in Table 2.
Table 2. Probability table fort-distribution.
(1-o) k - I 0.90 0.95 0 .975 0.99 0.995
I 3.08 6.31 12.7 31.8 63.7 2 1.89 2.92 4.30 6.96 9.92 4 !.53 2.13 2.78 3.75 4.60 9 1.38 1.83 2.26 2.82 3.25 14 1.34 1.76 2.14 2.62 2.98 19 1.33 1.73 2.09 2.54 2.86 24 1.32 1.71 2.06 2.49 2.80 29 1.31 1.70 2.04 2.46 2.76
7. Page 198, Exer cise 3(a): "What is t he entropy o f this collection of training examples with respect to the positive class?" should be "What is the entropy of this collection of t r runing examples with respect to the class attribute?" .
Errata 3
8 . Page 200, Exercise 5(c) both instances of "monotonously" should be ~'monotonicaJlyl'.
Chapter 5
1. Page 208, s ixth from top line: "and op is a logical operator chosen" should be "and op is a comparison oper ator chosen'' .
2. Page 213, Algorithm 5.1line 8: "R - R V r" should b e "R +- R V r'' .
3. Page 218, tenth from bottom line: "rules r , and Tz given in the preceding example are 43. 12 and 2'1 should be "ru1es q and r2 given in the pre<:eding example a re 63.87 and 2.83".
4. P age 233, Equation 5.16 should be:
5. Page 264, sixtb and seventh from bottom line, equations should be:
2::: A,y,ra = 65.5261 x 1 x 0.3858 + 65.5261 x - 1 x 0.4871 = - 6.64. 2::: A;y;.c;2 = 65.5261 x 1 x 0.4687 + 65.5261 x - 1 x 0.611 = - 9.32.
6. Page 271, Equation (5.55):
In the transformed space, we can find the parameters w = ( WQ, w,, ... , W5) such that:
7. Page 271, tenth from bottom line: "a ll t he circles are located in the lower right-hand side of the diagram" should be "all the circles are located in t he lower left- hand side of tbe diagram".
8. Page 273, second from top line: "instance z can be classified" should be ~'instance z can be classified".
4 Errata
9. Page 273, Equation (5.60):
cl>(u) · cl>(v) (ut , ,q, ./2u,, ./2u,, v'2u, u,, 1) · (vf, v~ . ./2v,, v'2t'2· -/2v,v,,1) uivf + u~vi + 2ut Vi + 2u2v2 + 2ut u2v1 v2 + 1 {U·V+1)2.
10. Page 274, second line in the second paragraph: "A test instance xis classified" should b e '·A test instance z is claSBified''.
11. Page 288, Equation 5.69 should he:
if Cj(X;) = y;
if Cj(X;) # Y;
12. Page 315, Exercise 1{a): "exclustive" should he "exclusive".
13. Page 317, Exercise 5(d) and 5{e): ''examples covered by R1 are discarded)" should be "examples covered by Rl are discarded".
14. Page 323, Exercise 17(c) and 17(d): "part (c)" should be "part (b)".
Chapter 6
1. Page 356, caption in Figure 6.17: "(with minimum support count equal to 40%" should be "(with minimum support equals to 40% )".
2. Page 408, Exercise 9(b): "Use the visited leaf nodes in part (b)" should be "Use the visited leaf nodes in part (a)".
3. Page 411, Exercise 15(b): ''P(A.B) x P(A.B) = P(A, B) x P(A.B)" should be "P(A, B) X P(A, B) = P(A, B) X P(A, B)".
4. Page 413, Exercise 17: "If the support'' sho uld be "Asswne the support'' .
5. Page 413, Exercise 17(d)(i): c({a} ~ {b}) > c({a} ~ {b}) should be c{{O:} ~ {b}) > c({a} ~ {b}).
Chapter 7
1. Page 421, the rule "R\;) : Age E [20, 24) ~ Chat Ouline =No" should be "Rl~ : A geE [20, 24) ~ Chat Online = Yes'.
Errata 5
2. Page 437. fourth from bottom line: "events in one element must occur immediately after the events" should be "events in one element must occur after the events,,.
3. Page 449. Figure 7.13 should be as shown in Figure 1.
+
G1 G2 G3 ~ merge(G1,G2)
[,--,--,, ~]
~.--,-,,
ll ""=[1 p p q 0
I 1 I 0 r 0 0 :p 0 r: p 0 r1 0 0
Met =: • MG::= : ..
~ __ _,. __ ~j ~--~--~! 0 0 0 ? q 0 0 0 ? 0
Figum 1. Vertex-growing strategy.
4. Page 450, Figure 7.14 should be as shown in Figure 2.
•
:-----:--: : : : p i I I I I I I I e : ,r I & I
~--------·
/ :({;: G3 ~ merge(G1,G2)
G1 G2
G4 = merge(G1,G2)
Figum 2. Edge-growing strategy.
(3 Errata
5. Page 480, Exercise 12(c): "w = ({A}{B.C.D}{A))" should be "w = ({A}{A,B,C,D){A))".
6. Page 483, Exercise 19(a): "join the two undirected and unweighted subgraphs shown in Figure 19a" should be "join the two undirected and unweighted subgraphs shown below''.
Chapter 8
Page 519: The numbers in Tables 8.3 ru1d 8.4 were rounded to two decimal places. Thus, if t he x and y coordinates of the points given in Table 8.3 are used to compute the pairwise distances. the results don't quite match those shown in Table 8.4. The origina l. more precise values are given in Tables 3 and 4.
point x coordinate y coordinate pi 0.4005 0.5306 p2 0.2148 0.3854 p3 0.3457 0.3156 p4 0.2652 0.1875 p5 0.0789 0.4139 p6 0.4548 0.3022
Table 3. X-Y coordinates of six points.
pl p2 p3 p4 p5 p6 p1 0.0000 0.2357 0.2218 0.3688 0.3421 0.2347 p2 0.2357 0 .0000 0.1483 0.2042 0.1388 0.2540 p3 0.2218 0.1483 0.0000 0.1513 0.2843 0.1100 p4 0.3688 0.2042 0.1513 0.0000 0.2932 0.2216 p5 0.3421 0.1388 0.2843 0.2932 0.0000 0.3921 p6 0.2347 0.2540 0.1100 0.2216 0.3921 0.0000
Table 4. Distance Matrix for Six Points
Page 517, the fifth line of the first paragraph: "see Section 8. 1.2" should be "see Section 8.1.3,.,. Page 522. the fourth line from the bottom: "dist( {3, 6, 4}. {2, 5}) = (0.15 + 0.28 + 0.25 + 0.39 + 0.20 + 0.29)/(6 • 2)" should b€ "dist({3 .6, 4}, {2, 5}) = (0.15 + 0.28 + 0.25 + 0.39 + 0.20 + 0.29)/(3 • 2)" Page 549, the third line of the paragraph with the heading, Entropy: "for cluster j we compute P;J" should be " for cl UBter i we compute Pij".
Errata 7
Chapter 9
Page 586 , in Equations 9.9 and 9.10, as well as in the first line below Equation 9.10, u should b e I'· Page 596 , the first line after Equation 9.16: "the difference, p(t) - m1 (t), between the centroid, lllj(t) , and the current object, p(t)" should be "the difference, p (t) - m 1(t), between the current object, p(t), and the centroid , IDj(t)". Page 605, Figure 9.11: "(c) View in the x y plane" should be "(c) View in t he xz plane" ; "(d) View in the xy plane" should be "(d) View in the yz plane". Page 618, Equation 9.17: "RC=" should be "RC(C; , C1) = ". Page 619 , Equation 9.18: "Rl =" should be "Rl(Ci, Cj ) =" . Page 637, the fourth line before Algorit hm 9.14: "the total number of clnsters is m/pq" should be ''the total uumber of clusters is m/q" . Page 639, the first line: '•Overall, m / p q clusters are produced" should be "Overall, m /q clusters are produced" . Page 639, the third line: "is not pq'' should b e "is not q". Page 639, the fourth line: "m/ pq of the intermediate clusters" s hould be "mjq of the intermediate clusters".
Chapter 10
Page 661, t he first line below Equation 10.1: "pr·ob(lxl) 2 c = o '' should be "prob(lxl ;:> c) = ex" . Page 669, All occurrences of y should be bold (y) in Equation 10.7.
Appendix A
1. Equation (A.4) should be as follows:
u v cos( u , vJ = ifUii . w·
Page 700. first line of the bibliogr aphic notes: "Stramg" should be ~·strang".
Appendix C
1. Page 727. eighth from bo ttom line: "variance s (X) X s (X) / N" should be "variance s(X) x (1 - s(X))jN''.
2. Page 727, fourth from bottom line: "variance m insup x m insupjN'' should be ''variau ce minsup X (1 - minsup)jN".