research

profilemr.frrxtnee
Front__Back_Matter.pdf

Clinical and Experimental Surgery

S. Karger

Medical and Scientifi c Publishers

Basel . Freiburg . Paris .

London . New York .

New Delhi . Bangkok . Beijing .

Tokyo . Kuala Lumpur .

Singapore . Sydney

Eur Surg Res

49(2) 53–106 (2012) 49 | 2 | 12 print

ISSN 0014–312X

online

e-ISSN 1421–9921

www.karger.com/esr

G en

er al

M ed

ic in

e; In

te rn

al M

ed ic

in e;

C ar

d io

va sc

u la

r Sy

st em

, G

er ia

tr ic

s, Im

m u

n o

lo g

y, In

fe ct

io u

s D

is ea

se s,

N eu

ro lo

g y,

M

et ab

o lis

m , N

ep h

ro lo

g y,

O n

co lo

g y,

P h

ar m

ac o

lo g

y, P

sy ch

o lo

g y,

P

sy ch

ia tr

y, S

o ci

al M

ed ic

in e,

U ro

lo g

y

P l e a s e s e e t h e f u l l c o n t e n t s o n : www.karger.com/gender_medicine

Handbook of Clinical Gender Medicine Editors: Schenck-Gustafsson, K. (Stockholm); DeCola, P.R.; Pfaff , D.W. (New York, N.Y.); Pisetsky, D.S. (Durham, N.C.) XVI + 522 p., 62 fi g., 4 in color, 63 tab., soft cover, 2012 CHF 69.– / EUR 51.– / USD 69.00 Prices subject to change EUR price for Germany, USD price for USA only ISBN 978–3–8055–9929–0 e-ISBN 978–3–8055–9930–6

GGTATCCAATGATAAGCATGATAAAAGCTCACGGTATCCAATGATAAGCATCACGGTATCATCCAATGATAAGCATGAT TATCCAATGATAAGCATCACGGTATATCCAATGATAAGCATGATAAGCTCACGGTATCCAAAATGATAAGCATCACGG AGCATGATAAGCTCACGGTATCCAATATGATAAGCATCACGGTATCCAATGATAAGCATGATATAAGCTCACGGTATC AGCATCACGGTATCCAATGATAAGCATTGATAAGCGTG ATCCAATGATAAGCATCACGGTATCCCCAATGATAAGCAT GGTATCCAATGATAAGCATCACGGTATCCCAATGATAAGCATGATAAGCCACGGTATCCAATGAGATAAGCATCACG GATAAGCATGATAAGCTCACGGTATCCAATGTGATAAGCATCACGGTATCCAATGATAAGCATGATATAAGCTCACGG AGCATCACGGTATCCAATGATAAGCATGATAAAGCTCACGGTATCCAATGATAAGCATCACGGTATCTCCAATGATA AGCTCACGGTATCCAATGATAAGCATCACGGTATATCCAATGATAAGCATGATAAGCTCACGGTATCCAAATGATAA TATCCAATGATAAGCATGATAAGCTCACGGTATCCACAATGATAAGCATCACGGTATCCAATGATAAGCATATGATAA CAATGATAAGCATCACGGTATCCAATGATAAGCATGGATAAGCTCAA CGGTATCCAATGATAAGCATCACGGGGTATC AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACACGGTATCCAATGATAAGCATGATAAGCTCACGGTATATC AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGGTATCCAATGATAAGCATCACGGTATCCAATGAATATA AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAGATAAGCATGATAAGCTCACGGTATCAGCATGATA TATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATATAAGCTCACGGTATCCAATGATAAGCATCACGG AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCTCCAATGATAAGCATGATAAGCTCACGGTATC AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCCAATGATAAGA CATCACGGTATCCAATGATA AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCACATGATAAGTCACGGTATCCAATGATAAG TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACACGGTATCCAATGATAAGCATGATAA CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATATCCAATGATAAGCATCACGGTATC AGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAATAAGCATGATAAGCTCACGGTATCC AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAAAGCATCACGGTATCCAATGATA AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGAGCTCACGGTATCCAATGATAA TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCTCCAATGATAAGCATGATAA CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGTGATAAGCATCACGGTATC AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGAGATAAGCTCACGGTATC AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACACGGTATCCAATGATA AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGGTATCCAATGATAA TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATATAAGCATGATA AA CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATATCACGGTATC AGCATGATAAGCGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTGTATCCAATG GGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCGCATGATA TATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATATCACGG AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGGTATC AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAGATA AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATTAAA TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAA CAATGATAAGCATCACGGTATCCAATGATAAG AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATC AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATA AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAA CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGTCACGGTATCC AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATA AGCCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAG TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAA CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATC

TGATA ATCCA

GATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATG GGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGAT TATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGG AGCATGATAAGCTCACGGTATCCAATGATAAGCATCAC AGCATCACGGTATCCAATGATAAGCATGATAAGCGTAT GGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCCACGGTATCCAATGATAAGCATCACG GATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGG AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGAGTATCCAATGAT AGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA TATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAA CAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATC AGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATC AGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATA

TAATCCCAAATGATTAACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCGGTATCCAATGAATAAGCATGATAAA CTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATAAGCATCCAAATGA AAGCCATCACGGTAT CAATGATAAGCAAT

GCATTGATAAGATAAGGTATCGGTATCTATCCCAATGCATCACGGTATCCGCATCACGGTATCCCACGGTATCCAATGCAACGGTATCCCAATGACGGACGGTACGGTACGGTACGGACGGTACGGTCGCGCGACGGACCA TGAGAGAGATGATGATTGATGATGATGATATAAAAAAAAGAGAAAAAAAAAAAA

AGCCATTCACGGGTAATCCAATGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCCAATGATAAGCATCACGGTATCCAAAGCATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTAAGCATAAGGCATCACGGGTATCCAATGATAAGCATGATAAGCTCAACGGTATCCAATGATAAGCATCACGGTAAAAAAACCCCCGGCCGGGGGGG CCACAAAAAAAAAAATATA AGCATAG CACGGGTATCCAATGATAAGCATGATAAG AATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGATATGATAAGCATGATAAGCTCACGGTATCCAATGATAAGCATCACGGTATCCAATGAT TGATAAGCATCACGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAATGATAAGCATCACGGGTATCCAATGATAAGCATGATAAGCTCACGGTATCCAATGATAA

TAAAGCAATGATACAATGATTAATGATAAGCTGATAAGCCATTGATAAAGATCCAATGATAAGATTCCAATGATATAAGGCATGATAAGCTCGCCATGATAAGGCTCACGGAAGCATGATAGCATGATATCACGGTATCACGGTGTGTTGTTTATCCAATCCAATCCAATCCATCCAATCCAATCCATCCATCCACCATCCATCCAATCCACCACCAAA AAAAAAAAAACGGACGACGGACGACGGACGGACGACGGACGGACGGGGACGGACGACGACGA GCAGCACGCACAGCACACACACACAGCAGCATGTGTGTGATGATGATTGATGTGATGAGTGAGTG

Handbook of Clinical Gender Medicine Editors

Karin Schenck-Gustafsson Paula R. DeCola Donald W. Pfaff David S. Pisetsky

K I 1

2 4

3 5

A new vision to understanding medicine

Handbook of Clinical Gender Medicine Editors

Karin Schenck-Gustafsson Paula R. DeCola Donald W. Pfaff David S. Pisetsky

Gender medicine is an important new fi eld in health and disease. It is derived from top-quality research and encompasses the biological and so- cial determinants that underlie the susceptibility to disease and its consequences. In the future, con- sideration of the role of gender will undoubtedly become an integral feature of all research and clinical care. Defi ning the role of gender in medicine requires a broad perspective on biology and diverse skills in biomedical and social sciences. When these scien- tifi c disciplines come together, a revolution in medical care is in the making. Covering twelve dif- ferent areas of medicine, the practical and useful ‘Handbook of Clinical Gender Medicine’ provides up-to-date information on the role of gender in the clinical presentation, diagnosis, and management of a wide range of common diseases. The contributing authors of this handbook are all experts who, in well-referenced chapters, cogently and concisely explain how incorporation of gender issues into research can aff ect the medical under- standing and treatment of heart disease, osteopo- rosis, arthritis, pain, violence, and malaria among other conditions. This intriguing and unique med- ical textbook provides readers with a valuable new perspective to understand biology and incorpo- rate gender issues into the diff erent branches of medicine.

Contents

Foreword: Wainer, J.; Wainer, Z. Preface: Schenck-Gustafsson, K.

Introduction Gender Matters: Wainer, J.; Wainer, Z. Biological Sex and the Genome: What Makes

Us Ourselves? Legato, M.J.

Social and Biological Determinants in Health and Disease Section Editors: DeCola, P.R.; Schober, J.M.

Central Nervous System and Clinical Applications Section Editor: Pfaff , D.W.

Neurology Section Editor: Olsson, T.

Pain Section Editor: Murphy, A.Z.

Circulation Section Editor: Schenck-Gustafsson, K.

Cancer Section Editor: Gustafsson, J.-Å.

Metabolic Disease Section Editor: Werner, S.

Autoimmune, Infl ammatory, and Musculoskeletal Disease Section Editor: Pisetsky, D.S.

Infectious Diseases Section Editor: Britton, S.

Urology, Sexual Dysfunction, and Nephrology Section Editor: Arver, S.

Pharmaceutical Drugs Section Editor: Parekh, A.

Geriatrics Section Editor: Herlitz, A.

Please send: copy/ies Postage and handling free with prepayment Payment: Please charge to my credit card � American Express � Diners � MasterCard � Visa

Card No.:

Exp. date:

CVV/CVC (3 digits in the signature fi eld on the back of Visa and MasterCard)

� Check enclosed � Please bill me

Orders may be placed with any bookshop, subscription agency, directly with the publisher or through a Karger distributor.

Fax: +41 61 306 12 34

S. Karger AG, P.O. Box, CH–4009 Basel (Switzerland) E-Mail [email protected], www.karger.com

Name/Address:

Date:

Signature:

O r

d e

r

F o

r m

Printed in Switzerland on acid-free and non-aging paper (ISO 9706) by Reinhardt Druck, Basel

Appears 6-weekly: 2 volumes per year (8 issues)

Editor-in-Chief

B. Vollmar, Rostock

Accociate Editors

M. Boros, Szeged M. Büchler, Heidelberg W.P. Ceelen, Ghent M.D. Menger, Homburg/Saar H. Thorlacius, Malmö/Lund

Editorial Board

I. Alwayn, Halifax D.K. Bartsch, Marburg C. Bassi, Verona W.O. Bechstein, Frankfurt am Main J.A. Bradley, Cambridge M. Cikirikcioglu, Geneva P.-A. Clavien, Zurich C. Eipel, Rostock R.W.F. de Bruin, Rotterdam H. Friess, Munich

S. Fichtner-Feigl, Regensburg G. Galata, London D.J. Gouma, Amsterdam J.K. Habermann, Lübeck M. Heberer, Basel W.R. Jarnagin, New York, NY J.C. Kalff, Bonn M.W. Laschke, Homburg/Saar H.-A. Lehr, Lausanne C.M. Malata, Cambridge T. Minor, Bonn M. Morino, Torino J. Pirenne, Leuven R. Schramm, Munich L. Steinstraesser, Bochum T.M. van Gulik, Amsterdam M.A. Venermo, Helsinki D.C. Winter, Dublin Y. Yamamoto, Akita

Clinical and Experimental Surgery

Founded 1969 Editors: W. Brendel (1975–1989†) and K. Messmer (1975–2005); O. Kempski (2005–2011)

GzD 2012

EB GL GI

Fax +41 61 306 12 34 E-Mail [email protected] www.karger.com

© 2012 S. Karger AG, Basel

The Guidelines for Authors are available at: www.karger.com/esr_Guidelines

Guidelines for Authors

Aims and Scope The prime mission of European Surgical Research is to publish high-quality original manuscripts of basic and translational research and review articles concerned with laboratory and clinical investigations which are relevant to surgical practice and of general interest to a broad range of academic surgeons and surgical researchers. Manuscripts dealing with research relevance to human surgical diseases are given high priority along with those which explore the pathogenesis, etiology, and mecha- nisms of disease processes. European Surgical Research seeks to preferentially publish research articles that in- tegrate molecular biological methods, along with func- tional studies, into the analysis of biological questions and that advance basic and translational knowledge of surgical pathophysiology. European Surgical Research will provide an international platform for basic and translational research and clinical investigations impact- ing directly on surgical care and management. European Surgical Research also features special articles relating to educational, research, or social issues of interest to the academic surgical community.

Submission Only original papers written in English are considered and should be submitted online:

www.karger.com/esr

All manuscripts must be accompanied by a cover letter and copyright signed by all authors. Assurance should be given in the cover letter that the manuscript is not un- der simultaneous consideration by any other publication.

Authors may suggest up to five referees who have expert knowledge on the subject. Suggested referees should not be from the same institution, not have published with the authors during the last 5 years, and should not be prejudiced.

Manuscripts may be submitted to the following sections: (1) Original Papers on basic, translational and clinical science (2) Technical Notes (3) Systematic Reviews and Meta-Analyses

Original Papers: These manuscripts should represent original research in basic, translational, or clinical sci- ence. Consideration for publication is based on originali- ty, novelty, scientific soundness, and appropriate analysis. European Surgical Research encourages the submission of relevant and well-conducted work in basic, experimental, and clinical science. Manuscripts should be prepared ac- cording to the guidelines for original papers.

Technical Notes: These manuscripts present a new meth- od, experimental model, test procedure, tool, or algo- rithm that is relevant for surgical research and signifi- cantly advances current available knowledge.

Systematic Reviews and Meta-Analyses: European Sur- gical Research aims to publish expert basic and transla- tional reviews of selected up-to-date topics in experimen- tal surgery. On occasion, the Editor-in-Chief will invite additional clinical or basic science reviews on a specific topic, which are usually presented pair-wise. Exceptions include formal true Systematic Reviews with Meta-Anal- yses which are well performed, and which are considered Original Papers.

Should you experience any problems with your submis- sion, please contact: [email protected]

Editorial Office ‘European Surgical Research’ S. Karger AG Angela Lorenz PO Box CH–4009 Basel (Switzerland) Tel. +41 61 306 13 58 Fax +41 61 306 14 34

Conditions All manuscripts are subject to editorial review. Manu- scripts are received with the explicit understanding that they are not under simultaneous consideration by any other publication. Submission of an article for publica- tion implies transfer of the copyright from the author to the publisher upon acceptance. Accepted papers become the permanent property of European Surgical Research and may not be reproduced by any means, in whole or in part, without the written consent of the publisher. It is the author’s responsibility to obtain permission to reproduce illustrations, tables, etc. from other publications.

Disclosure Statement Authors are required to disclose any sponsorship or funding arrangements relating to their research and all authors should disclose any possible conflicts of interest. Disclosure statements will be published at the end of the text of the article.

Plagiarism Policy Whether intentional or not, plagiarism is a serious vio- lation. We define plagiarism as a case in which a paper reproduces another work with at least 25% similarity and without citation. If evidence of plagiarism is found before/after acceptance or after publication of the paper, the author will be offered a chance for rebuttal. If the arguments are not found to be satisfactory, the manuscript will be retracted and the author sanctioned from publishing papers for a period to be determined by the responsible Editor.

Ethics Published research must comply with the guidelines for human studies and animal welfare regulations. Authors should state that subjects have given their informed con- sent and that the study protocol has been approved by the institute’s committee on human research. Further, they should also state that animal experiments conform to in- stitutional standards. Authors are required to declare the approval codes obtained from the corresponding ethical committee on human and/or animal research.

Arrangement The manuscript should conform to the following or- der: title page, abstract and key words, body, acknowl- edgments, references, figure legends, tables and figures. Manuscripts should be written in high-quality English suitable for effective communication to a professional medical audience. Authors who are not native speakers of English sometimes receive negative comments from referees or editors about the English-language usage in their manuscripts, and these problems can contribute to the decision to reject a paper. To help reduce the possi- bility of such problems, we strongly encourage such au- thors (i) to have their manuscript reviewed for clarity by a colleague whose native language is English and/or (ii) to use one of the many English language editing services that are available via the Web. All pages, including the figure legends, should be num- bered in sequence, and the first author’s name should ap- pear at the upper right corner of each page. Papers not conforming to the journal style will be returned with- out review.

Title page: The first page of each paper should indicate a concise title of no more than 150 characters, all authors’ names (first name and surname), authors’ institutional affiliations, and a short title for use as running head.

Corresponding author: The exact postal address of author(s) to whom correspondence, proofs, and reprint requests should be sent, including the postal code, must be given at the bottom of the title page. Please also supply phone and number and e-mail address.

Abstract: Submit the abstract on a separate page. The ab- stract is structured into Background/Purpose, Methods, Results and Conclusions and should be less than 400 words in length.

Key words: Following the abstract, an alphabetical list of five key words that reflect the content of the paper should be given.

Footnotes: Avoid footnotes.

Body of manuscript: The text should be organized into: In- troduction, Materials and Methods, Results, Discussion, Acknowledgments, including grant numbers and sourc- es of support, Disclosure/Duality of Interest (optional), and References. Abbreviations/acronyms are defined in both the abstract and body of the text as follows: vascular permeability factor (VPF); transforming growth factor- b (TGF-b). They should only be used in the abstract if they appear twice after first being mentioned and in the body of the text only if they appear three times after first being mentioned.

Tables and illustrations: Tables and illustrations (both numbered in sequential Arabic numerals) should be pre- pared as separate files. Tables require a brief and concise heading. Figures require a legend, prepared as a separate page, after references. Please use scale markers for elec- tron micrographs, and indicate the type of stain used. For the reproduction of illustrations, only good drawings and original photographs can be accepted; negatives or pho- tocopies cannot be used. Due to technical reasons, fig- ures with a screen background should not be submitted. When possible, group several illustrations in one block for reproduction (max. size 180  223 mm) or provide crop marks. Electronically submitted b/w half-tone and color illustrations must have a final resolution of 300 dpi after scaling, line drawings one of 800–1,200 dpi.

Color illustrations Online edition: Color illustrations are reproduced free of charge. In the print version, the illustrations are repro- duced in black and white. Please avoid referring to the colors in the text and figure legends. Print edition: Up to 6 color illustrations per page can be integrated within the text at CHF 800.– per page.

References: In the text identify references by Arabic numerals [in square brackets]. Material submitted for publication but not yet accepted should be noted as ‘unpublished data’ and not be included in the refer- ence list. The list of references should include only those publications which are cited in the text. Do not alphabetize; number references in the order in which they are first mentioned in the text. The surnames of the authors followed by initials should be given. There should be no punctuation other than a comma to sepa- rate the authors. Preferably, please cite all authors. Ab- breviate journal names according to the Index Medicus system. Also see International Committee of Medical Journal Editors: Uniform requirements for manuscripts submitted to biomedical journals (www.icmje.org).

Guidelines for Authors

Examples (a) Papers published in periodicals: Chatel J-M, Bernard H, Orson FM: Isolation and characterization of two com- plete Ara h 2 isoforms cDNA. Int Arch Allergy Immunol 2003;131:14–18. (b) Papers published only with DOI numbers: Theoharides TC, Boucher W, Spear K: Serum inter- leukin-6 reflects disease severity and osteoporosis in mastocytosis patients. Int Arch Allergy Immunol DOI: 10.1159/000063858. (c) Monographs: Matthews DE, Fare-well VT: Using and Understanding Medical Statistics, ed 3, revised. Basel, Karger, 1996. (d) Edited books: DuBois RN: Cyclooxygenase-2 and colorectal cancer; in Dannenberg AJ, Dubois RN (eds): COX-2. Prog Exp Tum Res. Basel, Karger, 2003, vol 37, pp 124–137.

Reference Management Software: Use of EndNote is recommended for easy management and formatting of citations and reference lists.

Digital Object Identifier (DOI) S. Karger Publishers supports DOIs as unique identifiers for articles. A DOI number will be printed on the title page of each article. DOIs can be useful in the future for identifying and citing articles published online without volume or issue information. More information can be found at www.doi.org.

Supplementary Material Supplementary material is restricted to additional data that are not necessary for the scientific integrity and con- clusions of the paper. Please note that all supplementary files will undergo editorial review and should be submit-

ted together with the original manuscript. The Editors reserve the right to limit the scope and length of the sup- plementary material. Supplementary material must meet production quality standards for Web publication with- out the need for any modification or editing. In general, supplementary files should not exceed 10 MB in size. All figures and tables should have titles and legends and all files should be supplied separately and named clearly. Ac- ceptable files and formats are: Word or PDF files, Excel spreadsheets (only if the data cannot be converted prop- erly to a PDF file), and video files (.mov, .avi, .mpeg).

Author’s ChoiceTM Karger’s Author’s ChoiceTM service broadens the reach of your article and gives all users worldwide free and full access for reading, downloading and printing at www. karger.com. The option is available for a one-time fee of CHF 3000.–, which is a permissible cost in grant alloca- tion. More information can be found at www.karger.com/ authors_choice.

NIH-Funded Research The U.S. National Institutes of Health (NIH) mandates under the NIH Public Access Policy that final, peer-re- viewed manuscripts appear in its digital database within 12 months of the official publication date. As a service to authors, Karger submits your manuscript on your behalf to PubMed Central (PMC) immediately upon publica- tion. It usually receives a PMCID within approximately a month and will appear in PMC after 12 months. For those selecting our premium Author’s ChoiceTM service, the usual embargo will be overridden, accelerating the accessibility of your work.

Self-Archiving Karger permits authors to archive their pre-prints (i.e. pre-refereeing) or post-prints (i.e. final draft post-refer- eeing) on their personal or institution’s servers, provid- ed the following conditions are met: Articles may not be used for commercial purposes, must be linked to the pub- lisher’s version, and must acknowledge the publisher’s copyright. Authors selecting Karger’s Author’s ChoiceTM feature, however, are also permitted to archive the final, published version of their article, which includes copy- editing and design improvements as well as citation links.

Page Charges A charge of CHF 125.– per page will be levied for the first 4 printed pages of an article. Any additional page will be charged to the author at CHF 325.–. The allotted size of a paper is equal to approx. 12 manuscript pages (including tables, illustrations and references).

Proofs Unless indicated otherwise, proofs are sent to the cor- responding author and should be returned with the least possible delay. Alterations other than the correction of printer’s errors are charged to the author.

Reprints Order forms and a price list are sent with the proofs. Or- ders submitted after the issue is printed are subject to considerably higher prices.

Frontiers of Gastrointestinal Research

Editor: C. Sakamoto

Vol. 30

Cell/Tissue Injury and Cytoprotection/Organoprotection in the Gastrointestinal Tract Mechanisms, Prevention and Treatment

Editors

L. Filaretova K. Takeuchi

Frontiers of Gastrointestinal Research ISSN 0302–0665 e-ISSN 1662–3754

Listed in bibliographic services, including Current Contents®, Reference Update, Biological Abstracts.

Vol. 30: Cell/Tissue Injury and Cytoprotection/Organoprotec- tion in the Gastrointestinal Tract Mechanisms, Prevention and Treatment Editors: Filaretova, L.P. (St. Petersburg); Takeuchi, K. (Kyoto) VIII + 250 p., 49 fi g., 10 tab., hard cover, 2012 CHF 182.– / EUR 152.– / USD 214.00 ISBN 978–3–318–02183–7 e-ISBN 978–3–318–02184–4

Vol. 29: Free Radical Biology in Digestive Diseases Editors: Naito, Y. (Kyoto); Suematsu, M. (Tokyo); Yoshikawa, T. (Kyoto) VIII + 176 p., 36 fi g., 3 in color, 9 tab., hard cover, 2011 CHF 182.– / EUR 152.– / USD 214.00 ISBN 978–3–8055–9609–1 e-ISBN 978–3–8055–9610–7

Vol. 28: Ascites, Hyponatremia and Hepatorenal Syndrome: Progress in Treatment Editor: Gerbes, A.L. (Munich) VIII + 212 p., 23 fi g., 31 tab., hard cover, 2011 CHF 182.– / EUR 152.– / USD 214.00 ISBN 978–3–8055–9591–9 e-ISBN 978–3–8055–9592–6

Vol. 27: Interventional and Therapeutic Gastrointestinal Endoscopy Editors: Mönkemüller, K. ( Bottrop); Wilcox, C.M. (Birmingham, Ala.); Muñoz-Navas, M. (Pamplona) X + 548 p., 386 fi g., 270 in color, 88 tab., hard cover, 2010 CHF 248.– / EUR 207.– / USD 292.00 ISBN 978–3–8055–9308–3 e-ISBN 978–3–8055–9309–0

Frontiers of Gastrointestinal Research A guide to leading investigations in the fi eld of gastroenterology

This series is designed for both the physician active in the clinical practice of gastroenterol- ogy and the gastroenterologist or student engaged in research. Each volume offers a ready reference guide to current progress and a review of past achievement in a particular area of gastrointestinal study. The series covers pathological, pharmacological, diagnostic and therapeutic considerations relating to the digestive system, as well as the latest techniques and instrumentation used in the management of gastrointestinal disorders.

KI 1

21 19

Series Editor

C. Sakamoto (Tokyo)

Read it online: www.karger.com/fgare

Prices subject to change EUR price for Germany, USD price for USA only

Fax +41 61 306 12 34 E-Mail [email protected] www.karger.com

© 2012 S. Karger AG, Basel

The Journal Home Page is available at: www.karger.com/esr

General Information

ISSN Print Edition: 0014–312X ISSN Online Edition: 1421–9921

Journal Homepage: www.karger.com/esr

Publication Data: ‘European Surgical Research’ is published 8 times a year. Volumes 48 and 49, each with 4 issues, appear in 2012.

Copyright: © 2012 S. Karger AG, Basel (Switzerland). All rights reserved. No part of this publication may be translated into other languages, reproduced or utilized in any form or by any means, electronic or mechanical, including photocopying, recording, microcopying, or by any information storage and retrieval system, with- out permission in writing from the publisher or, in the case of photocopying, direct payment of a specified fee to the Copyright Clearance Center.

Disclaimer: The statements, opinions and data con- tained in this publication are solely those of the indi- vidual authors and contributors and not of the publish- er and the editor(s). The appearance of advertisements in the journal is not a warranty, endorsement, or ap- proval of the products or services advertised or of their effectiveness, quality or safety. The publisher and the editor(s) disclaim responsibility for any injury to per- sons or property resulting from any ideas, methods, instructions or products referred to in the content or advertisements.

Subscription Rates: Subscriptions run for a full calendar year. Prices are given per year. Personal subscription:

Print or Online Print+Online combined CHF 747.– CHF 843.– EUR 598.– EUR 674.– USD 725.00 USD 819.00 postage and handling (added to print and print+online) CHF 54.40 Europe, CHF 80.– Overseas EUR 41.60 USD 75.20

Institutional subscription: Print or Online Print+Online combined CHF 2490.– CHF 2740.– EUR 1992.– EUR 2192.– USD 2418.00 USD 2660.00 postage and handling (added to print and print+online) CHF 68.– Europe, CHF 100.– Overseas EUR 52.– USD 94.00

Airmail surcharge: CHF 68.– / USD 64.00

Back Volumes and Single Issues: Information on availability and prices of single print issues and print or electronic back volumes can be obtained from Cus- tomer Service at [email protected].

Bibliographic Indices: This journal is regularly listed in bibliographic services, including Current Contents® and PubMed/MEDLINE.

Photocopying: This journal has been registered with the Copyright Clearance Center (CCC), as indicated by the code appearing on the first page of each article. For readers in the US, this code signals consent for copying of articles for personal or internal use, or for the per- sonal or internal use of specific clients, provided that the stated fee is paid per copy directly to

Copyright Clearance Center Inc. 222 Rosewood Drive Danvers, MA 01923 (USA)

A copy of the first page of the article must accompa- ny payment. Consent does not extend to copying for general distribution, for promotion, for creating new works, or for resale. In these cases, specific written per- mission must be obtained from the copyright owner,

S. Karger AG, P.O. Box CH–4009 Basel (Switzerland).

Subscription Orders: Orders can be placed at agencies, bookstores, directly with the Publisher

S. Karger AG Medical and Scientific Publishers P.O. Box CH–4009 Basel Switzerland (for courier services only: Allschwilerstrasse 10 CH–4055 Basel) t: +41 61 306 11 11 f: +41 61 306 12 34 e: [email protected] w: www.karger.com

Change of Address: Both old and new address should be sent to the subscription source.

or further Karger offices or representatives:

Germany S. Karger GmbH Postfach 79095 Freiburg Deutschland (Hausadresse: Wilhelmstrasse 20A, 79098 Freiburg) t: +49 761 45 20 70 f: +49 761 45 20 714 e: [email protected] w: www.karger.de

Japan Karger Japan, Inc. Shiba Daimon Asahi Bldg. 2F 1-2-23 Shiba Daimon Minato-ku Tokyo 105-0012 Japan t: +81 3 6435 6242 f: +81 3 6435 6244 e: [email protected] w: www.karger.jp

USA S. Karger Publishers, Inc. 26 West Avon Road P.O. Box 529 Unionville, CT 06085 USA Toll free: +1 800 828 5479 t: +1 860 675 7834 f: +1 860 675 7302 e: [email protected]

France Librairie Médi-Sciences Sarl 36, bd de Latour-Maubourg 75007 Paris France t: +33 (0) 1 45 51 42 58 f: +33 (0) 1 45 56 07 80 e: [email protected] w: www.medi-sciences.fr

Gulf Council Countries, Iran, Middle East, North Africa, Turkey Trans Middle East International Distribution Co. Ltd. (KaSha) 168 B, King Abdullah the 2nd Street Daboog Building 2nd Floor Daboog Area P.O. Box 2376 Amman 11953 Jordan t: +962 6 515 3467 f: +962 6 541 1336 e: [email protected] w: www.KaShaonline.com

South East Asia, China and Taiwan Karger Regional Office (Malaysia) CEO Suite Kuala Lumpur Quill 7, 27th Floor Jalan Stesen Sentral 5 KL Sentral Kuala Lumpur 50470 Malaysia t: +60 3 2776 6803 f: +60 3 2776 6999 e: [email protected]; [email protected]

Karger China 10th Floor, Twin Towers (East) B12 Jianguomenwai Avenue Beijing 100022 China t: +86 10 5123 5033 f: +86 10 5123 5122 e: [email protected]; [email protected] w: www.karger.cn

India, Bangladesh, Sri Lanka Medscience India Plot No. 17, Yusuf Sarai Market B.L. Glass Building, 2nd Floor Sri Aurobindo Marg New Delhi 110 016 India t: +91 11 46029 633 f: +91 11 46029 634 c: +91 98 91052 128 e: [email protected]

Basel • Freiburg • Paris • London • New York • New Delhi • Bangkok • Beijing • Tokyo • Kuala Lumpur • Singapore • Sydney

Contents

See the journal website for contents

P at

h o

lo g

y, G

at ro

en te

ro lo

g y,

H is

to ch

em is

tr y,

N eu

ro p

at h

o lo

g y,

P

ed ia

tr ic

s, P

ro ct

o lo

g y,

S u

rg er

y

www.karger.com/pathology

Meier-Ruge, W.A.; Bruder, E. (Basel) Histopathology of Chronic Constipation 2nd, revised edition X + 54 p., 105 fi g. 93 in color, 6 tab., hard cover, 2012 CHF 79.– / EUR 66.– / USD 93.00 Prices subject to change EUR price for Germany, USD price for USA only ISBN 978–3–318–02174–5 e-ISBN 978–3–318–02175–2

K I1

2 2

6 4

Comprehensive overview of intestinal alterations causing chronic constipation

Histopathology of Chronic Constipation

William A. Meier-Ruge, Elisabeth Bruder

The symptom of chronic constipation is often caused by a series of intestinal diseases, which can be reliably diagnosed histopathologically by histo- chemical techniques and consequently treated by surgical intervention. The following publication is the second and completely revised edition of Pa- thology of Chronic Constipation in Pediatric and Adult Coloproctology published in 2005, and intro- duces several new diseases and fi gures.

It includes characteristics of classical and ultrashort Hirschsprung’s disease as well as total intestinal aganglionosis and hypoganglionosis. New dis- eases such as intestinal neuronal dysplasia, desmo- sis coli, leiomyopathy, architectural malformation, and stretching lesions of muscularis propria are critically discussed. Atrophic desmosis is also cov- ered. This new and frequently observed degenera- tion of muscularis propria in Crohn’s disease, sigmoid diverticulitis, and other infl ammatory intestinal diseases causes focal aperistalsis, fre- quently interpreted as scar stenosis. Histopathology of Chronic Constipation provides a comprehensive overview of intestinal alterations which cause chronic constipation. It is therefore of special interest to diagnostic pathologists, clini- cians, pediatric and abdominal surgeons, coloproc- tologists, and gastroenterologists.

Contents

Foreword Preface Introduction

Histopathological Diagnosis • Enzyme Histochemical Diff erential Diagnosis in

Chronic Constipation • Functional Histopathological Diff erential Diag-

nosis in Colonic Motility Disorder

Diff erent Colon Diseases with Chronic Constipation • Pathogenesis of Hirschsprung’s Disease • ‘Swiss-Roll Technique’ • Intraoperative Evaluation of the Myenteric

Plexus • Ultrashort Hirschsprung’s Disease • Total Aganglionosis of the Colon • Hypoganglionosis of the Colon • Immaturity of the Enteric Nervous System in

Childhood • Intestinal Neuronal Dysplasia Type A • Intestinal Neuronal Dysplasia Type B • Ganglioneuromatosis. Multiple Endocrine

Neoplasia 2B (MEN 2B) • Desmosis Coli • Architectural Malformation of the Muscularis

Propria • Degenerative Leiomyopathy: A Rare Disease

• Stretching Atrophy of Circular and Longitudinal Muscles in the Gut

• Nerve Cell Heterotopias in Mucosa and Muscu- laris Propria

A Laboratory Guide to Histopathological Diagnosis of Intestinal Motility Disorders • The Most Important Technical Factors for

Optimal Pathohistological Results • Recommendations for Taking Mucosal Biopsies

in Chronic Constipation • Instructions for Transportation of Colorectal

Biopsies or Surgical Specimens

Preparation of Cryostat Sections from Biopsies and Colorectal Specimens • The Problem of Section Thickness • Preparation of Incubation Media for Daily Rou-

tine of Enzyme Histochemical Reactions

Immunohistochemical Techniques of Paraffi n Sections in the Diagnosis of Gut Dysmotility

References Index Abbreviations

William A. Meier-Ruge Elisabeth Bruder

Histopathology of Chronic Constipation

Please send: copy/ies Postage and handling free with prepayment Payment: Please charge to my credit card � American Express � Diners � MasterCard � Visa

Card No.:

Exp. date:

CVV/CVC (3 digits in the signature fi eld on the back of Visa and MasterCard)

� Check enclosed � Please bill me

Orders may be placed with any bookshop, subscription agency, directly with the publisher or through a Karger distributor.

Fax: +41 61 306 12 34

S. Karger AG, P.O. Box, CH–4009 Basel (Switzerland) E-Mail [email protected], www.karger.com

Name/Address:

Date:

Signature:

O r

d e

r

F o

r m

Up-to-date meeting report of the Else Kröner-Fresenius Symposium on Adult Stem Cell Aging

T h e e a s i e s t w a y t o o r d e r : w w w. k a r g e r. c o m /e k f s y

Adult stem cells are present in most postnatal tissues of mammals. Tissues with high rates of cell turnover depend on the functional capacity of stem cells for lifelong maintenance of tissue homeostasis. Adult stem cells are also required for the regeneration of tissues in response to injury as in, for example, the regeneration of skeletal muscle. In addition to its function in tissue homeostasis and regeneration, adult stem cells can represent the cell type of origin of various types of cancers including leukemia and colorectal cancer. Stem cells are the most long-lived cells in the proliferative compartment of mammalian tissues. Therefore, stem cells have an increased risk of acquiring mutations that could ultimately lead to the transformation of tissue stem cells. This publication presents the current knowledge in the fi eld of stem cell aging, which was discussed at the Else Kröner-Fresenius Symposium on Advances in Stem Cell Aging in 2011. It will be of special interest to scientists working on stem cell research, aging, regeneration, and cancer as well as physicians and scientists specializing in geriatric medicine, internal medicine, and surgery.

Contents

• Preface: Pahernik, S. • Introduction: Rudolph, K.L. • Speakers at the Symposium: Morita, M. • Aging of the Niche and the Microenvironment and Its Role in Stem Cell Aging: Geiger, H.

• Hematopoietic Stem Cell Aging and Cancer: Chen, Y.; Ju, Z.

• DNA Damage, Checkpoint Responses, and Cell Cycle Control in Aging Stem Cells: Kleinhans, K.N.; Burkhalter, M.D.

• Hematopoietic Stem Cell Aging and Fate Decision: Illing, A.; Morita, Y.

• Stem Cell Therapy and Stress Response in Pancreas and Intestine: Sperka, T.; Omrani, O.

• Niche-Stem Cell Interations and Environmental Infl uences: Tang, D.

• Stem Cells and Metabolism: Missios, P.; Guachalla, L. • Molecular Mechanisms of Muscle Stem Cell Aging: Baig, A.H.; Tümpel, S.

• Neural Stem Cells in Development and Aging: Schmidt-Straßburger, U.

Author Index Subject Index

Advances in Stem Cell Aging Editor Karl Lenhard Rudolph

Else Kröner-Fresenius Symposia

Editor: S. Pahernik

Vol. 3

Advances in Stem Cell Aging Editor

Karl Lenhard Rudolph

Karger – Medical and Scientifi c Publishers CH–4009 Basel, Switzerland [email protected], f: +41 61 306 12 34 www.karger.com

Dear Librarian

I have reviewed this publication and would like to recommend it for our library.

Recommended by:

Department:

Date:

Signature:

Orders may be placed with any bookshop, subscription agency, directly with the publisher or through a Karger distributor.

Advances in Stem Cell Aging Editor: Rudolph, K.L. (Ulm) VIII + 126 p., 20 fi g. in color, hard cover, 2012 CHF 79.– / EUR 66.– / USD 93.00 Prices subject to change EUR price for Germany, USD price for USA only ISBN 978–3–318–02170–7 e-ISBN 978–3–318–02171–4

Else Kröner-Fresenius Symposia, Vol. 3 Series Editor: Pahernik, S. (Heidelberg)

KI 12265

• J O U R N A L

Be at the forefront of the latest developments in experimental surgery

European Surgical Research features original clin- ical and experimental papers, condensed reviews of new knowledge relevant to surgical research, and short technical notes serving the information needs of investigators in various fi elds of operative medicine. Coverage includes surgery, surgical pathophysiology, drug usage, and new surgical techniques. Special consider- ation is given to information on the use of animal models, physiological and biological methods as well as biophysical measuring and recording systems. The journal is of particular value for workers interested in pathophysiologic concepts, new techniques and in how these can be intro- duced into clinical work or applied when critical decisions are made concerning the use of new procedures or drugs.

Selected contributions • Feasibility of Delayed Hyperthermic Intraperitoneal Chemotherapy in Case of

Unforeseen Complications: Mohr, Z.; Hirche, C.; Liebeskind, U.; Rau, B.; Hünerbein, M. (Berlin)

• Intraperitoneal Administration of Bevacizumab Intraoperatively Does Not Aff ect

Abdominal Wound Healing in Rats: Pavlidis, E.T.; Ballas, K.D.; Psarras, K.; Symeonidis, N.G.; Koliakos, G.; Kouzi-Koliakos, K.; Rafailidis, S.F.; Pavlidis, T.E.;

Marakis, G.N.; Sakantamis, A.K. (Thessaloniki)

• Surgeon-Performed Ultrasound as Preoperative Localization Study in Patients

with Primary Hyperparathyroidism: van Ginhoven, T.M. (Delf t/Rotterdam); Mork s, A.N. (Delf t/Groningen); Scheper s, T. (Delf t/Rotterdam); de Graaf, P.W.; Smit, P.C. (Delf t)

• Choosing the Best Animal Species to Mimic Clinical Colon Anastomotic Leakage

in Humans: A Qualitative Systematic Review: Pommergaard, H.C.; Rosenberg, J. (Herlev); Schumacher-Peter sen, C. (Copenhagen); Achiam, M.P. (Herlev)

• Biocompatibility of PLGA/sP(EO-stat-PO)-Coated Mesh Surfaces under Constant

Shearing Stress: Böhm, G.; Ushakova, Y.; Alizai, H.P.; Braunschweig, T.; Lente, C. (Aachen); Hef fels, K.-H.; Groll, J. (Würzburg); Neumann, U.P.; Junge, K. (Aachen)

• Comparative Study of Surgical Margins and Cosmetic Outcome in Lumpectomy

versus Segmental Resection in Breast Cancer: Eggemann, H.; Ignatov, A. (Magdeburg); Krocker, J.; Neuss, K.; Elling, D. (Berlin); John, J.; Costa, S.-D. (Magdeburg)

• Bioabsorbable Staple-Line Reinforcement for Pancreatectomy in a Porcine Model:

A Preliminary Study: Hornez, E. (Marseille/Toulon); Garnier, E.; Sastre, B.; Garcia, S. (Marseille); Mayet, A. (Saint Mande); Berdah, S.V. (Marseille)

• Substance P and Neprilysin in Chronic Pancreatitis : Mascet ta, G. (San Giovanni Rotondo/Verona); di Mola, F.F.; Tavano, F. (San Giovanni Rotondo); Selvaggi, F.; Giese, N. (Heidelberg); Bassi, C. (Verona); Büchler, M.W. (Heidelberg); Friess, H. (Munich); di Sebastiano, P. (San Giovanni Rotondo/Verona/Heidelberg)

European Surgical Research 2013: Volumes 50, 51

4 issues per volume

Language: English

ISSN 0014–312X

ISSN online 1421–9921

Listed in bibliographic services, including

Current Contents®, MEDLINE, Biological Abstracts, EMBASE/Excerpta Medica

KF13035

More information at

www.karger.com/esr • Pay-per-View and Subscriber Access

to Full Text

• Full Table of Contents

• Full Editorial Board

• Free Abstracts and Selected Articles

• Online Sample Issue

• Submission/Guidelines for Authors

• Subscription Details

• Free Alert Service

• Online Library Recommendation

Clinical and Experimental Surgery

Editor-in-Chief

B. Vollmar, Rostock Offi cial Journal of the

European Society for Surgical Research

(ESSR)

Clinical and Experimental Surgery

Original Paper s

53 How Similar Are Inbred Rats? The Influence of Anatomical Variations, Shipment and

Sampling Time on Experimental Surgery

Jin, H.; Huang, H.; Zhang, J. (Essen); Dirsch, O. (Jena); Dahmen, U. (Essen/Berlin)

66 Right- and Left-Subclavian Vein Port-A-Cath Systems: Comparison of Complications

Tsai, Y.-F. (Chiayi/Liouying); Ku, Y.-H.; Chen, S.-W.; Huang, W.-T.; Lu, C.-C.; Tsao, C.-J. (Liouying)

73 In vivo Evaluation of the Chitosan-Based Haemostatic Agent Omni-stat® in Porcine

Liver Resection and in Liver Injury

Jegatheeswaran, S. (Manchester); Bhanot, U. (New York, N.Y.); Siriwardena, A.K. (Manchester)

80 Procurement Regimens to Reduce Ischemia Reperfusion Injury of Vascular Grafts

Abele-Ohl, S.; Heim, C.; Eckl, S.; Weyand, M.; Stamminger, T.; Ensminger, S.M. (Erlangen)

88 Pancreatic Carcinoma Cell Lines Reflect Frequency and Variability of Cancer Stem

Cell Markers in Clinical Tissue

Bünger, S.; Barow, M.; Thorns, C. (Lübeck); Freitag-Wolf, S. (Kiel); Danner, S.; Tiede, S.; Pries, R.; Görg, S.; Bruch, H.-P.; Roblick, U.J.; Kruse, C.; Habermann, J.K. (Lübeck)

99 Oral Administration of Lactoferrin Attenuates Intestinal Ischemia-Reperfusion

Injury in Rats

Zhang, T. (Daqing); Wang, Y. (Harbin); Ban, R.; Tong, L. (Daqing); Qiao, H. (Harbin); Lao, H.; Zhao, H. (Daqing); Jiang, X.; Sun, X. (Harbin); Zhang, F. (Daqing)

www.karger.com/esr 49 | 2 | 12

Reproduced with permission of the copyright owner. Further reproduction prohibited without permission.