FinalBIO110-essay.docx

The Borough of Manhattan Community College

The City University of New York

BIO110-096L Malintha Abeysiri

Final Examination December 16, 2017

Name of the Student; - ………………………………….

Section 3. Essay (60pt)

Part A. Answer all question

A result of recent developments in fuel cell technology, serious consideration is given to direct alcohol fuel cells in which alcohol is used directly as the fuel. Methanol and ethanol are the most promising fuels for transportation applications. To assess the environmental benefits of these fuel choices over petroleum, it is important to analyze their energy uses and emissions during the fuel cycle. Evaluation of greenhouse gas emission is being taken in to consideration in order to evaluate the efficiency of each type of fuel cells. In this experiment only, CO2 was used as a variable. Amount of CO2 in grams per kilometer of driving is used as a unit of measurement.

Type of fuel cell

Amount of CO2

( g/Km)Trial 1

Trial 2

Trial 3

Ethanol

200

185

253

Methanol

180

155

172

Petroleum

250

379

227

Make a bar graph with the information given above and take a conclusion from your data.

Answer only four questions.

01. Compare and contrast all three categories of carbohydrates.

02. Red(R) color is dominant over white color (r)flower petals. Long petal (L) is dominant over short petals. Traits color and length are located on chromosome number 4 and 5 respectively. What are the probability of all genotype and phenotypes of the F1 generation when two heterozygote flowers are crossed.

03. Draw a plant cell and state the function of each organelle.

04. Explain the Miller-Urey experiment and its’ significance

05. What is the primary amino acid sequence of the following DNA sequence

DNA- “AGCATGTTACCCATTGATGGGGGATAA”