Gene to protein

Name:__________________________

Gene to Protein Individual Assignment

Due Sun. May 9th

15 Extra Credit Points

Genetics is a very powerful science that has allowed us to actually read and manipulate the genetic code of life. We can now use a DNA sequence to determine the protein it makes. We can use this to find faulty genes, develop drugs to treat disease, compare different organisms and many other things. With this assignment you will walk through the process of making a DNA sequence into a polypeptide sequence and in the process practice various aspects that we are currently learning. Below is actual genetic data generated by the Anoka Ramsey Genetics class in 2010. The class went through a process to extract, amplify and sequence a gene from plants that has an important role to play in glycolysis. The gene is called GAPC and the enzyme (protein) it makes is called glyceraldehyde 3-phosphate dehydrogenase or GAPDH for short. This assignment is very similar to the activity done in lab with a few differences because it is a real gene.

Determination of Amino Acid Sequence of Porcupine Grass GAPDH from its GAPC Sequence

Step 1: The first step is to make the coding strand into the compliment strand of DNA (the template strand). The first three bases are finished for you. Finish the entire sequence.

Step 2: Generate premRNA. This is the RNA that will be made in the nucleus. Remember it is always made from the template strand. In this case there is no promoter sequence we can use because this sequence does not start at the beginning of the gene. So just start from the beginning. Again the first three bases are done for you. There is also no termination sequence because this sequence does not contain one. Finish making all the premRNA all the way to the end.

Step 3: In eukaryotic organisms DNA contains both introns (non-protein coding) and exons (protein coding). In order to make the proper protein we must find where each of these is. In modern genetics this is typically done by aligning a sequence from a different organism in which you know where the exons are. I have put a comparison genome (rice) above the coding strand. Wherever there is a * in the rice sequence this indicates that base was an exon (coded for protein) in rice. You can use that information to find where the exons are in our sequence (we assume they would be nearly identical in a closely related species). Find the introns /exons and label them in some way (highlighter, lines etc.) in the premRNA.

Step 4: On page 3

Transcription

Rice (coding) 5’- Coding Strand 5’- Template Strand 3’- premRNA 5’-	****************** AAGATCTACTGGTGTCTTCACT TTCTAGA AAGAUCUA
Rice (coding) 5’- Coding Strand 5’- Template Strand 3’- premRNA 5’-	********************** GACAAGGACAAAGCTGCAGCTC
Rice (coding) 5’- Coding Strand 5’- Template Strand 3’- premRNA 5’-	********* ATTTGAAGGTACATTCCTCTGT TAAACTTCCAT AUUUGAAGGUA
Rice (coding) 5’- Coding Strand 5’- Template Strand 3’- premRNA 5’-	CAAGTAGTCTATTATTTTAGGA
Rice (coding) 5’- Coding Strand 5’- Template Strand 3’- premRNA 5’-	TACACTGAACTATTCATGTGTG
Rice (coding) 5’- Coding Strand 5’- Template Strand 3’- premRNA 5’-	GAATGGTAGTAATAGTTGTCTG
Rice (coding) 5’- Coding Strand 5’- Template Strand 3’- premRNA 5’-	********* TTTCATTTACAGGGCGGTGCCA U U U C A U U U A C A G G G C GG
Rice (coding) 5’- Coding Strand 5’- Template Strand 3’- premRNA 5’-	********************** AGAAGGTCGTCATTTCTGCTCC
Rice (coding) 5’- Coding Strand 5’- Template Strand 3’- premRNA 5’-	********************** TAGCAAGGATGCTCCCATGTTT

Step 4: During RNA processing eukaryotic organisms splice together (piece together) the exons and remove the introns from the premRNA to make the mRNA that will go to a ribosome to be made into a polypeptide (eventually protein). Use your labeling on the premRNA to piece together only the exons removing any introns as you go. Write your pieced together mRNA below. It will work best if you write 21 letters (bases) across each row. The first codon is done for you. Notice that the sequence continues from one line to the next so to make a full three letter codon you will need to sometimes find the rest of the letters on the following line (or after the intron).

Step 5: Using the codon table on page 5 to translate your mRNA into protein (amino acids, use the three letter amino acid abbreviation from the table). You will soon notice that there is no start codon or stop codon in this sequence. This is again because this sequence was made from the middle of a gene and does not contain the beginning or the end. If you do everything correctly you should not have any stop codons. Notice there is a methionine near the end of the sequence. Had this been at the beginning of the sequence it would have been a start codon but in this case it just codes for the amino acid.

Step 6: Answer the questions at the end of the assignment.

RNA Processing and Translation

mRNA 5’- Amino acid Sequence	UCU ______ ______ ______ ______ ______ ______ ______
mRNA 5’- Amino acid Sequence	______ ______ ______ ______ ______ ______ ______
mRNA 5’- Amino acid Sequence	______ ______ ______ ______ ______ ______ ______
mRNA 5’- Amino acid Sequence	______ ______ ______ ______ ______ ______ ______
mRNA 5’- Amino acid Sequence	______ ______ ______ ______ ______ ______

1.) Let’s say you or the plant cell made a mistake and instead of starting the second exon with GCG you/it started it just before that at the GGC instead.

a. What would happen to the amino acid sequence? (You don’t need to write out the whole change just answer in general)

b. We call this a reading frame error. Why is it called this?

c. Would the enzyme (protein) likely be functional in its normal role if this reading frame error occurred? Why or why not?

2.) Surprisingly when genetic information is stored in large databases such as GenBank it is the coding strand that is stored. What is the advantage to this over having the template strand? (Hint: compare your premRNA and coding strand. Also think about promoters, start and stop codons.)

3.) Below is the amino acid sequence from rice of the same section of the gene you just did. We can now directly compare the amino acid sequence from porcupine grass and rice. Compare the rice amino acid sequence below to the one you generated.

Rice amino acid sequence-

Ser Thr Gly Val Phe Thr Asp Gln Glu Lys Ala Ala Ala His Leu Lys Gly Gly Ala Lys Lys Val Val Ile Ser Ala Pro Ser Lys Asp Ala Pro Met Phe

a.) Are the two amino acid sequences the same? If not, what is different?

b.) Ok so you should have found some differences between the two amino acid sequences. When dealing with genetic information what do we call differences like these (think genetics, one version that is different from another)?

c.) But wait both of these genes are fully functional in the plants they come from. How can these two genes make two different enzymes (proteins) yet both work in the same reaction in glycolysis?

d.) Humans also have the GAPC gene. If we were to find the same section of the gene in humans would you expect the enzyme to be different? Why? More different then rice and porcupine grass were?