DNA Replication/ Protein Synthesis and Mutations

profilefradzoei0x
DNAReplicationProtienSynthesisworksheet.rtf

DNA Replication/ Protein Synthesis and Mutations

Fill in the blanks:

1. The mispairing or substitution of a single base is called a _____________________ mutation.

2. If an event results in the deletion of a nucleotide in the DNA, it is called a ____________________ mutation that results in a ___________________ protein.

3. The _____________, an enzyme, unzippers the DNA during replication.

4. In Eukaryotes the mRNA transcript is derived by removing____________ and splicing the --------------.

5. Exposure to _________ will result in translocations of the DNA in any type of cell.

6. A type of mutation that occurs randomly is called a _______________ mutation whereas one caused by chemicals is an ----------------- mutation.

7. In an inducible operon, the repressor binds to the ____________ to turn the gene off when not needed.

8. Conjugation requires a __________ to transfer DNA which cells can produce if they have acquired an -----------------.

9. During the bacteriophage life cycle, some phage can fragment the host DNA and incorporate any of it into their capsids. They may then infect new host cells. This type of transduction is called ____________.

10. A technology that has lead to the advancement of diagnostic tests has been the fusion of white blood cells that produce monoclonal antibodies and cancer cells. The resulting immortal monoclonal antibody producing cells are called ________________.

Part II—Name that enzyme!

1. synthesizes RNA

2. elongates chains of DNA

3. proofreads DNA chains

4. cuts DNA at specific nucleotide sequences

5. coils or uncoils DNA supercoils

6. binds to the promotor of an operon

7. joins DNA fragments

8. breaks Hydrogen bonds

Protein Synthesis

Directions: Determine the mRNA sequence using the DNA template provided. Then determine the amino acid sequence in the protein using the chart provided.

5’ TACAAAGGACCTTTTAACCCCACT 3’ DNA Template

______________________________________________mRNA

_________________________________________Protein