Computer Science
01/27/2020 1Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Data Mining: Data
Lecture Notes for Chapter 2
Introduction to Data Mining , 2nd Edition by
Tan, Steinbach, Kumar
01/27/2020 2Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Outline
Attributes and Objects
Types of Data
Data Quality
Similarity and Distance
Data Preprocessing
1
2
What is Data?
Collection of data objects and their attributes
An attribute is a property or characteristic of an object
– Examples: eye color of a person, temperature, etc.
– Attribute is also known as variable, field, characteristic, dimension, or feature
A collection of attributes describe an object
– Object is also known as record, point, case, sample, entity, or instance
Tid Refund Marital Status
Taxable Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes 10
Attributes
O b
je c
ts
01/27/2020 4Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
A More Complete View of Data
Data may have parts
Attributes (objects) may have relationships with other attributes (objects)
More generally, data may have structure
Data can be incomplete
We will discuss this in more detail later
3
4
01/27/2020 5Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Attribute Values
Attribute values are numbers or symbols assigned to an attribute for a particular object
Distinction between attributes and attribute values – Same attribute can be mapped to different attribute
values Example: height can be measured in feet or meters
– Different attributes can be mapped to the same set of values Example: Attribute values for ID and age are integers But properties of attribute values can be different
Measurement of Length
The way you measure an attribute may not match the attributes properties.
1
2
3
5
5
7
8
15
10 4
A
B
C
D
E
This scale preserves the ordering and additvity properties of length.
This scale preserves only the ordering property of length.
5
6
01/27/2020 7Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Types of Attributes
There are different types of attributes – Nominal
Examples: ID numbers, eye color, zip codes
– Ordinal Examples: rankings (e.g., taste of potato chips on a
scale from 1-10), grades, height {tall, medium, short}
– Interval Examples: calendar dates, temperatures in Celsius or
Fahrenheit.
– Ratio Examples: temperature in Kelvin, length, counts,
elapsed time (e.g., time to run a race)
01/27/2020 8Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Properties of Attribute Values
The type of an attribute depends on which of the following properties/operations it possesses:
– Distinctness: = – Order: < > – Differences are + -
meaningful :
– Ratios are * / meaningful
– Nominal attribute: distinctness – Ordinal attribute: distinctness & order – Interval attribute: distinctness, order & meaningful
differences – Ratio attribute: all 4 properties/operations
7
8
01/27/2020 9Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Difference Between Ratio and Interval
Is it physically meaningful to say that a temperature of 10 ° is twice that of 5° on – the Celsius scale?
– the Fahrenheit scale?
– the Kelvin scale?
Consider measuring the height above average – If Bill’s height is three inches above average and
Bob’s height is six inches above average, then would we say that Bob is twice as tall as Bill?
– Is this situation analogous to that of temperature?
Attribute Type
Description
Examples
Operations
Nominal
Nominal attribute values only distinguish. (=, )
zip codes, employee ID numbers, eye color, sex: {male, female}
mode, entropy, contingency correlation, 2 test
C a te
g o ri ca
l Q
u a lit
a tiv
e
Ordinal Ordinal attribute values also order objects. (<, >)
hardness of minerals, {good, better, best}, grades, street numbers
median, percentiles, rank correlation, run tests, sign tests
Interval For interval attributes, differences between values are meaningful. (+, - )
calendar dates, temperature in Celsius or Fahrenheit
mean, standard deviation, Pearson's correlation, t and F tests
N u m
e ri c
Q u a n tit
a tiv
e
Ratio For ratio variables, both differences and ratios are meaningful. (*, /)
temperature in Kelvin, monetary quantities, counts, age, mass, length, current
geometric mean, harmonic mean, percent variation
This categorization of attributes is due to S. S. Stevens
9
10
Attribute Type
Transformation
Comments
C a
te g
o ri
ca l
Q u
a lit
a ti ve
Nominal
Any permutation of values
If all employee ID numbers were reassigned, would it make any difference?
Ordinal An order preserving change of values, i.e., new_value = f(old_value) where f is a monotonic function
An attribute encompassing the notion of good, better best can be represented equally well by the values {1, 2, 3} or by { 0.5, 1, 10}.
N u
m e
ri c
Q u
a n
tit a
tiv e
Interval new_value = a * old_value + b where a and b are constants
Thus, the Fahrenheit and Celsius temperature scales differ in terms of where their zero value is and the size of a unit (degree).
Ratio new_value = a * old_value
Length can be measured in meters or feet.
This categorization of attributes is due to S. S. Stevens
01/27/2020 12Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Discrete and Continuous Attributes
Discrete Attribute – Has only a finite or countably infinite set of values – Examples: zip codes, counts, or the set of words in a
collection of documents – Often represented as integer variables. – Note: binary attributes are a special case of discrete
attributes
Continuous Attribute – Has real numbers as attribute values – Examples: temperature, height, or weight. – Practically, real values can only be measured and
represented using a finite number of digits. – Continuous attributes are typically represented as floating-
point variables.
11
12
01/27/2020 13Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Asymmetric Attributes
Only presence (a non-zero attribute value) is regarded as important
Words present in documents Items present in customer transactions
If we met a friend in the grocery store would we ever say the following? “I see our purchases are very similar since we didn’t buy most of the same things.”
We need two asymmetric binary attributes to represent one ordinary binary attribute
– Association analysis uses asymmetric attributes
Asymmetric attributes typically arise from objects that are sets
01/27/2020 14Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Some Extensions and Critiques
Velleman, Paul F., and Leland Wilkinson. "Nominal, ordinal, interval, and ratio typologies are misleading." The American Statistician 47, no. 1 (1993): 65-72.
Mosteller, Frederick, and John W. Tukey. "Data analysis and regression. A second course in statistics." Addison- Wesley Series in Behavioral Science: Quantitative Methods, Reading, Mass.: Addison-Wesley, 1977.
Chrisman, Nicholas R. "Rethinking levels of measurement for cartography."Cartography and Geographic Information Systems 25, no. 4 (1998): 231-242.
13
14
01/27/2020 15Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Critiques
Incomplete – Asymmetric binary
– Cyclical
– Multivariate
– Partially ordered
– Partial membership
– Relationships between the data
Real data is approximate and noisy – This can complicate recognition of the proper attribute type
– Treating one attribute type as another may be approximately correct
01/27/2020 16Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Critiques …
Not a good guide for statistical analysis – May unnecessarily restrict operations and results
Statistical analysis is often approximate
Thus, for example, using interval analysis for ordinal values may be justified
– Transformations are common but don’t preserve scales Can transform data to a new scale with better statistical
properties
Many statistical analyses depend only on the distribution
15
16
01/27/2020 17Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
More Complicated Examples
ID numbers – Nominal, ordinal, or interval?
Number of cylinders in an automobile engine – Nominal, ordinal, or ratio?
Biased Scale – Interval or Ratio
01/27/2020 18Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Key Messages for Attribute Types
The types of operations you choose should be “meaningful” for the type of data you have
– Distinctness, order, meaningful intervals, and meaningful ratios are only four properties of data
– The data type you see – often numbers or strings – may not capture all the properties or may suggest properties that are not present
– Analysis may depend on these other properties of the data Many statistical analyses depend only on the distribution
– Many times what is meaningful is measured by statistical significance
– But in the end, what is meaningful is measured by the domain
17
18
01/27/2020 19Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Types of data sets
Record – Data Matrix – Document Data – Transaction Data
Graph – World Wide Web – Molecular Structures
Ordered – Spatial Data – Temporal Data – Sequential Data – Genetic Sequence Data
01/27/2020 20Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Important Characteristics of Data
– Dimensionality (number of attributes) High dimensional data brings a number of challenges
– Sparsity Only presence counts
– Resolution Patterns depend on the scale
– Size Type of analysis may depend on size of data
19
20
01/27/2020 21Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Record Data
Data that consists of a collection of records, each of which consists of a fixed set of attributes
Tid Refund Marital Status
Taxable Income Cheat
1 Yes Single 125K No
2 No Married 100K No
3 No Single 70K No
4 Yes Married 120K No
5 No Divorced 95K Yes
6 No Married 60K No
7 Yes Divorced 220K No
8 No Single 85K Yes
9 No Married 75K No
10 No Single 90K Yes 10
01/27/2020 22Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Data Matrix
If data objects have the same fixed set of numeric attributes, then the data objects can be thought of as points in a multi-dimensional space, where each dimension represents a distinct attribute
Such a data set can be represented by an m by n matrix, where there are m rows, one for each object, and n columns, one for each attribute
1.12.216.226.2512.65
1.22.715.225.2710.23
T hickness LoadDistanceProjection of y load
Projection of x Load
1.12.216.226.2512.65
1.22.715.225.2710.23
T hickness LoadDistanceProjection of y load
Projection of x Load
21
22
01/27/2020 23Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Document Data
Each document becomes a ‘term’ vector – Each term is a component (attribute) of the vector
– The value of each component is the number of times the corresponding term occurs in the document.
01/27/2020 24Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Transaction Data
A special type of data, where – Each transaction involves a set of items.
– For example, consider a grocery store. The set of products purchased by a customer during one shopping trip constitute a transaction, while the individual products that were purchased are the items.
– Can represent transaction data as record data
TID Items
1 Bread, Coke, Milk
2 Beer, Bread
3 Beer, Coke, Diaper, Milk
4 Beer, Bread, Diaper, Milk
5 Coke, Diaper, Milk
23
24
01/27/2020 25Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Graph Data
Examples: Generic graph, a molecule, and webpages
5
2
1
2
5
Benzene Molecule: C6H6
01/27/2020 26Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Ordered Data
Sequences of transactions
An element of the sequence
Items/Events
25
26
01/27/2020 27Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Ordered Data
Genomic sequence data
GGTTCCGCCTTCAGCCCCGCGCC CGCAGGGCCCGCCCCGCGCCGTC GAGAAGGGCCCGCCTGGCGGGCG GGGGGAGGCGGGGCCGCCCGAGC CCAACCGAGTCCGACCAGGTGCC CCCTCTGCTCGGCCTAGACCTGA GCTCATTAGGCGGCAGCGGACAG GCCAAGTAGAACACGCGAAGCGC TGGGCTGCCTGCTGCGACCAGGG
01/27/2020 28Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Ordered Data
Spatio-Temporal Data
Average Monthly Temperature of land and ocean
27
28
01/27/2020 29Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Data Quality
Poor data quality negatively affects many data processing efforts
“The most important point is that poor data quality is an unfolding disaster.
– Poor data quality costs the typical company at least ten percent (10%) of revenue; twenty percent (20%) is probably a better estimate.”
Thomas C. Redman, DM Review, August 2004
Data mining example: a classification model for detecting people who are loan risks is built using poor data
– Some credit-worthy candidates are denied loans
– More loans are given to individuals that default
01/27/2020 30Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Data Quality …
What kinds of data quality problems?
How can we detect problems with the data?
What can we do about these problems?
Examples of data quality problems: – Noise and outliers
– Missing values
– Duplicate data
– Wrong data
– Fake data
29
30
01/27/2020 31Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Noise
For objects, noise is an extraneous object For attributes, noise refers to modification of original values
– Examples: distortion of a person’s voice when talking on a poor phone and “snow” on television screen
Two Sine Waves Two Sine Waves + Noise
01/27/2020 32Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Outliers are data objects with characteristics that are considerably different than most of the other data objects in the data set – Case 1: Outliers are
noise that interferes with data analysis
– Case 2: Outliers are the goal of our analysis Credit card fraud
Intrusion detection
Causes?
Outliers
31
32
01/27/2020 33Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Missing Values
Reasons for missing values – Information is not collected
(e.g., people decline to give their age and weight) – Attributes may not be applicable to all cases
(e.g., annual income is not applicable to children)
Handling missing values – Eliminate data objects or variables – Estimate missing values
Example: time series of temperature
Example: census results
– Ignore the missing value during analysis
01/27/2020 34Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Missing Values …
Missing completely at random (MCAR) – Missingness of a value is independent of attributes – Fill in values based on the attribute – Analysis may be unbiased overall
Missing at Random (MAR) – Missingness is related to other variables – Fill in values based other values – Almost always produces a bias in the analysis
Missing Not at Random (MNAR) – Missingness is related to unobserved measurements – Informative or non-ignorable missingness
Not possible to know the situation from the data
33
34
01/27/2020 35Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Duplicate Data
Data set may include data objects that are duplicates, or almost duplicates of one another – Major issue when merging data from heterogeneous
sources
Examples: – Same person with multiple email addresses
Data cleaning – Process of dealing with duplicate data issues
When should duplicate data not be removed?
01/27/2020 36Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Similarity and Dissimilarity Measures
Similarity measure – Numerical measure of how alike two data objects are.
– Is higher when objects are more alike.
– Often falls in the range [0,1]
Dissimilarity measure – Numerical measure of how different two data objects
are
– Lower when objects are more alike
– Minimum dissimilarity is often 0
– Upper limit varies
Proximity refers to a similarity or dissimilarity
35
36
01/27/2020 37Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Similarity/Dissimilarity for Simple Attributes
The following table shows the similarity and dissimilarity between two objects, x and y, with respect to a single, simple attribute.
01/27/2020 38Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Euclidean Distance
Euclidean Distance
where n is the number of dimensions (attributes) and xk and yk are, respectively, the kth attributes (components) or data objects x and y.
Standardization is necessary, if scales differ.
37
38
01/27/2020 39Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Euclidean Distance
0
1
2
3
0 1 2 3 4 5 6
p1
p2
p3 p4
poi nt x y p1 0 2 p2 2 0 p3 3 1 p4 5 1
Distance Matrix
p1 p2 p3 p4 p1 0 2.828 3.162 5.099 p2 2.828 0 1.414 3.162 p3 3.162 1.414 0 2 p4 5.099 3.162 2 0
01/27/2020 40Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Minkowski Distance
Minkowski Distance is a generalization of Euclidean Distance
Where r is a parameter, n is the number of dimensions (attributes) and xk and yk are, respectively, the k
th
attributes (components) or data objects x and y.
39
40
01/27/2020 41Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Minkowski Distance: Examples
r = 1. City block (Manhattan, taxicab, L1 norm) distance. – A common example of this for binary vectors is the
Hamming distance, which is just the number of bits that are different between two binary vectors
r = 2. Euclidean distance
r . “supremum” (Lmax norm, L norm) distance. – This is the maximum difference between any component of
the vectors
Do not confuse r with n, i.e., all these distances are defined for all numbers of dimensions.
01/27/2020 42Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Minkowski Distance
Distance Matrix
poi nt x y p1 0 2 p2 2 0 p3 3 1 p4 5 1
L1 p1 p2 p3 p4 p1 0 4 4 6 p2 4 0 2 4 p3 4 2 0 2 p4 6 4 2 0
L2 p1 p2 p3 p4 p1 0 2.828 3.162 5.099 p2 2.828 0 1.414 3.162 p3 3.162 1.414 0 2 p4 5.099 3.162 2 0
L p1 p2 p3 p4
p1 0 2 3 5 p2 2 0 1 3 p3 3 1 0 2 p4 5 3 2 0
41
42
01/27/2020 43Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Mahalanobis Distance
For red points, the Euclidean distance is 14.7, Mahalanobis distance is 6.
is the covariance matrix
𝐦𝐚𝐡𝐚𝐥𝐚𝐧𝐨𝐛𝐢𝐬 𝐱, 𝐲 𝐱 𝐲 Ʃ 𝐱 𝐲
01/27/2020 44Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Mahalanobis Distance
Covariance Matrix:
3.02.0
2.03.0
A: (0.5, 0.5)
B: (0, 1)
C: (1.5, 1.5)
Mahal(A,B) = 5
Mahal(A,C) = 4
B
A
C
43
44
01/27/2020 45Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Common Properties of a Distance
Distances, such as the Euclidean distance, have some well known properties.
1. d(x, y) 0 for all x and y and d(x, y) = 0 only if x = y. (Positive definiteness)
2. d(x, y) = d(y, x) for all x and y. (Symmetry) 3. d(x, z) d(x, y) + d(y, z) for all points x, y, and z.
(Triangle Inequality)
where d(x, y) is the distance (dissimilarity) between points (data objects), x and y.
A distance that satisfies these properties is a metric
01/27/2020 46Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Common Properties of a Similarity
Similarities, also have some well known properties.
1. s(x, y) = 1 (or maximum similarity) only if x = y. (does not always hold, e.g., cosine)
2. s(x, y) = s(y, x) for all x and y. (Symmetry)
where s(x, y) is the similarity between points (data objects), x and y.
45
46
01/27/2020 47Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Similarity Between Binary Vectors
Common situation is that objects, x and y, have only binary attributes
Compute similarities using the following quantities f01 = the number of attributes where x was 0 and y was 1
f10 = the number of attributes where x was 1 and y was 0
f00 = the number of attributes where x was 0 and y was 0
f11 = the number of attributes where x was 1 and y was 1
Simple Matching and Jaccard Coefficients
SMC = number of matches / number of attributes = (f11 + f00) / (f01 + f10 + f11 + f00)
J = number of 11 matches / number of non-zero attributes = (f11) / (f01 + f10 + f11)
01/27/2020 48Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
SMC versus Jaccard: Example
x = 1 0 0 0 0 0 0 0 0 0
y = 0 0 0 0 0 0 1 0 0 1
f01 = 2 (the number of attributes where x was 0 and y was 1)
f10 = 1 (the number of attributes where x was 1 and y was 0)
f00 = 7 (the number of attributes where x was 0 and y was 0)
f11 = 0 (the number of attributes where x was 1 and y was 1)
SMC = (f11 + f00) / (f01 + f10 + f11 + f00)
= (0+7) / (2+1+0+7) = 0.7
J = (f11) / (f01 + f10 + f11) = 0 / (2 + 1 + 0) = 0
47
48
01/27/2020 49Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Cosine Similarity
If d1 and d2 are two document vectors, then
cos( d1, d2 ) = <d1,d2> / ||d1|| ||d2|| ,
where <d1,d2> indicates inner product or vector dot product of vectors, d1 and d2, and || d || is the length of vector d.
Example:
d1 = 3 2 0 5 0 0 0 2 0 0
d2 = 1 0 0 0 0 0 0 1 0 2 <d1, d2> = 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 + 0*2 = 5
| d1 || = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0) 0.5 = (42) 0.5 = 6.481
|| d2 || = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2) 0.5 = (6) 0.5 = 2.449
cos(d1, d2 ) = 0.3150
01/27/2020 50Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Extended Jaccard Coefficient (Tanimoto)
Variation of Jaccard for continuous or count attributes – Reduces to Jaccard for binary attributes
49
50
01/27/2020 51Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Correlation measures the linear relationship between objects
01/27/2020 52Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Visually Evaluating Correlation
Scatter plots showing the similarity from –1 to 1.
51
52
01/27/2020 53Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Drawback of Correlation
x = (-3, -2, -1, 0, 1, 2, 3)
y = (9, 4, 1, 0, 1, 4, 9)
yi = xi 2
mean(x) = 0, mean(y) = 4
std(x) = 2.16, std(y) = 3.74
corr = (-3)(5)+(-2)(0)+(-1)(-3)+(0)(-4)+(1)(-3)+(2)(0)+3(5) / ( 6 * 2.16 * 3.74 )
= 0
01/27/2020 54Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Comparison of Proximity Measures
Domain of application – Similarity measures tend to be specific to the type of
attribute and data – Record data, images, graphs, sequences, 3D-protein
structure, etc. tend to have different measures
However, one can talk about various properties that you would like a proximity measure to have
– Symmetry is a common one – Tolerance to noise and outliers is another – Ability to find more types of patterns? – Many others possible
The measure must be applicable to the data and produce results that agree with domain knowledge
53
54
01/27/2020 55Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Information Based Measures
Information theory is a well-developed and fundamental disciple with broad applications
Some similarity measures are based on information theory – Mutual information in various versions
– Maximal Information Coefficient (MIC) and related measures
– General and can handle non-linear relationships
– Can be complicated and time intensive to compute
01/27/2020 56Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Information and Probability
Information relates to possible outcomes of an event – transmission of a message, flip of a coin, or measurement
of a piece of data
The more certain an outcome, the less information that it contains and vice-versa
– For example, if a coin has two heads, then an outcome of heads provides no information
– More quantitatively, the information is related the probability of an outcome The smaller the probability of an outcome, the more information it
provides and vice-versa
– Entropy is the commonly used measure
55
56
01/27/2020 57Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Entropy
For – a variable (event), X, – with n possible values (outcomes), x1, x2 …, xn – each outcome having probability, p1, p2 …, pn – the entropy of X , H(X), is given by
𝐻 𝑋 𝑝 log 𝑝
Entropy is between 0 and log2n and is measured in bits
– Thus, entropy is a measure of how many bits it takes to represent an observation of X on average
01/27/2020 58Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Entropy Examples
For a coin with probability p of heads and probability q = 1 – p of tails
𝐻 𝑝 log 𝑝 𝑞 log 𝑞
– For p= 0.5, q = 0.5 (fair coin) H = 1
– For p = 1 or q = 1, H = 0
What is the entropy of a fair four-sided die?
57
58
01/27/2020 59Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Entropy for Sample Data: Example
Maximum entropy is log25 = 2.3219
Hair Color Count p -plog2p
Black 75 0.75 0.3113
Brown 15 0.15 0.4105
Blond 5 0.05 0.2161
Red 0 0.00 0
Other 5 0.05 0.2161
Total 100 1.0 1.1540
01/27/2020 60Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Entropy for Sample Data
Suppose we have – a number of observations (m) of some attribute, X,
e.g., the hair color of students in the class,
– where there are n different possible values
– And the number of observation in the ith category is mi – Then, for this sample
𝐻 𝑋 𝑚 𝑚
log 𝑚 𝑚
For continuous data, the calculation is harder
59
60
01/27/2020 61Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Mutual Information
Information one variable provides about another
Formally, 𝐼 𝑋, 𝑌 𝐻 𝑋 𝐻 𝑌 𝐻 𝑋, 𝑌 , where
H(X,Y) is the joint entropy of X and Y,
𝐻 𝑋, 𝑌 𝑝𝑖𝑗log 𝑝𝑖𝑗
Where pij is the probability that the i th value of X and the jth value of Y
occur together
For discrete variables, this is easy to compute
Maximum mutual information for discrete variables is log2(min( nX, nY ), where nX (nY) is the number of values of X (Y)
01/27/2020 62Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Mutual Information Example
Student Status
Count p -plog2p
Undergrad 45 0.45 0.5184
Grad 55 0.55 0.4744
Total 100 1.00 0.9928
Grade Count p -plog2p A 35 0.35 0.5301
B 50 0.50 0.5000
C 15 0.15 0.4105
Total 100 1.00 1.4406
Student Status
Grade Count p -plog2p
Undergrad A 5 0.05 0.2161
Undergrad B 30 0.30 0.5211
Undergrad C 10 0.10 0.3322
Grad A 30 0.30 0.5211
Grad B 20 0.20 0.4644
Grad C 5 0.05 0.2161
Total 100 1.00 2.2710
Mutual information of Student Status and Grade = 0.9928 + 1.4406 - 2.2710 = 0.1624
61
62
01/27/2020 63Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Maximal Information Coefficient
Reshef, David N., Yakir A. Reshef, Hilary K. Finucane, Sharon R. Grossman, Gilean McVean, Peter J. Turnbaugh, Eric S. Lander, Michael Mitzenmacher, and Pardis C. Sabeti. "Detecting novel associations in large data sets." science 334, no. 6062 (2011): 1518-1524.
Applies mutual information to two continuous variables
Consider the possible binnings of the variables into discrete categories
– nX × nY ≤ N 0.6 where
nX is the number of values of X
nY is the number of values of Y
N is the number of samples (observations, data objects)
Compute the mutual information – Normalized by log2(min( nX, nY )
Take the highest value
01/27/2020 64Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
General Approach for Combining Similarities
Sometimes attributes are of many different types, but an overall similarity is needed.
1: For the kth attribute, compute a similarity, sk(x, y), in the range [0, 1].
2: Define an indicator variable, k, for the kth attribute as follows:
k = 0 if the kth attribute is an asymmetric attribute and both objects have a value of 0, or if one of the objects has a missing value for the kth attribute
k = 1 otherwise
3. Compute
63
64
01/27/2020 65Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Using Weights to Combine Similarities
May not want to treat all attributes the same.
– Use non-negative weights 𝜔
– 𝑠𝑖𝑚𝑖𝑙𝑎𝑟𝑖𝑡𝑦 𝐱, 𝐲 ∑ 𝐱,𝐲
∑
Can also define a weighted form of distance
01/27/2020 66Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Density
Measures the degree to which data objects are close to each other in a specified area
The notion of density is closely related to that of proximity Concept of density is typically used for clustering and
anomaly detection Examples:
– Euclidean density Euclidean density = number of points per unit volume
– Probability density Estimate what the distribution of the data looks like
– Graph-based density Connectivity
65
66
01/27/2020 67Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Euclidean Density: Grid-based Approach
Simplest approach is to divide region into a number of rectangular cells of equal volume and define density as # of points the cell contains
Grid-based density. Counts for each cell.
01/27/2020 68Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Euclidean Density: Center-Based
Euclidean density is the number of points within a specified radius of the point
Illustration of center-based density.
67
68
01/27/2020 69Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Data Preprocessing
Aggregation
Sampling
Dimensionality Reduction
Feature subset selection
Feature creation
Discretization and Binarization
Attribute Transformation
01/27/2020 70Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Aggregation
Combining two or more attributes (or objects) into a single attribute (or object)
Purpose – Data reduction
Reduce the number of attributes or objects
– Change of scale
Cities aggregated into regions, states, countries, etc.
Days aggregated into weeks, months, or years
– More “stable” data
Aggregated data tends to have less variability
69
70
01/27/2020 71Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Example: Precipitation in Australia
This example is based on precipitation in Australia from the period 1982 to 1993. The next slide shows
– A histogram for the standard deviation of average monthly precipitation for 3,030 0.5◦ by 0.5◦ grid cells in Australia, and
– A histogram for the standard deviation of the average yearly precipitation for the same locations.
The average yearly precipitation has less variability than the average monthly precipitation.
All precipitation measurements (and their standard deviations) are in centimeters.
01/27/2020 72Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Example: Precipitation in Australia …
Standard Deviation of Average Monthly Precipitation
Standard Deviation of Average Yearly Precipitation
Variation of Precipitation in Australia
71
72
01/27/2020 73Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Sampling
Sampling is the main technique employed for data reduction.
– It is often used for both the preliminary investigation of the data and the final data analysis.
Statisticians often sample because obtaining the entire set of data of interest is too expensive or time consuming.
Sampling is typically used in data mining because processing the entire set of data of interest is too expensive or time consuming.
01/27/2020 74Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Sampling …
The key principle for effective sampling is the following:
– Using a sample will work almost as well as using the entire data set, if the sample is representative
– A sample is representative if it has approximately the same properties (of interest) as the original set of data
73
74
01/27/2020 75Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Sample Size
8000 points 2000 Points 500 Points
01/27/2020 76Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Types of Sampling Simple Random Sampling
– There is an equal probability of selecting any particular item
– Sampling without replacement As each item is selected, it is removed from the
population – Sampling with replacement
Objects are not removed from the population as they are selected for the sample.
In sampling with replacement, the same object can be picked up more than once
Stratified sampling – Split the data into several partitions; then draw random
samples from each partition
75
76
01/27/2020 77Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Sample Size
What sample size is necessary to get at least one object from each of 10 equal-sized groups.
01/27/2020 78Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Curse of Dimensionality
When dimensionality increases, data becomes increasingly sparse in the space that it occupies
Definitions of density and distance between points, which are critical for clustering and outlier detection, become less meaningful • Randomly generate 500 points
• Compute difference between max and min distance between any pair of points
77
78
01/27/2020 79Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Dimensionality Reduction
Purpose: – Avoid curse of dimensionality – Reduce amount of time and memory required by data
mining algorithms – Allow data to be more easily visualized – May help to eliminate irrelevant features or reduce
noise
Techniques – Principal Components Analysis (PCA) – Singular Value Decomposition – Others: supervised and non-linear techniques
01/27/2020 80Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Dimensionality Reduction: PCA
Goal is to find a projection that captures the largest amount of variation in data
x2
x1
e
79
80
01/27/2020 81Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Dimensionality Reduction: PCA
01/27/2020 82Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Feature Subset Selection
Another way to reduce dimensionality of data Redundant features
– Duplicate much or all of the information contained in one or more other attributes
– Example: purchase price of a product and the amount of sales tax paid
Irrelevant features – Contain no information that is useful for the data
mining task at hand – Example: students' ID is often irrelevant to the task of
predicting students' GPA
Many techniques developed, especially for classification
81
82
01/27/2020 83Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Feature Creation
Create new attributes that can capture the important information in a data set much more efficiently than the original attributes
Three general methodologies: – Feature extraction
Example: extracting edges from images
– Feature construction
Example: dividing mass by volume to get density
– Mapping data to new space Example: Fourier and wavelet analysis
01/27/2020 84Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Mapping Data to a New Space
Two Sine Waves + Noise Frequency
Fourier and wavelet transform
Frequency
83
84
01/27/2020 85Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Discretization
Discretization is the process of converting a continuous attribute into an ordinal attribute – A potentially infinite number of values are mapped
into a small number of categories
– Discretization is commonly used in classification
– Many classification algorithms work best if both the independent and dependent variables have only a few values
– We give an illustration of the usefulness of discretization using the Iris data set
01/27/2020 86Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Iris Sample Data Set
Iris Plant data set. – Can be obtained from the UCI Machine Learning Repository
http://www.ics.uci.edu/~mlearn/MLRepository.html
– From the statistician Douglas Fisher – Three flower types (classes):
Setosa Versicolour Virginica
– Four (non-class) attributes Sepal width and length Petal width and length Virginica. Robert H. Mohlenbrock. USDA
NRCS. 1995. Northeast wetland flora: Field office guide to plant species. Northeast National Technical Center, Chester, PA. Courtesy of USDA NRCS Wetland Science Institute.
85
86
Discretization: Iris Example
Petal width low or petal length low implies Setosa. Petal width medium or petal length medium implies Versicolour. Petal width high or petal length high implies Virginica.
01/27/2020 88Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Discretization: Iris Example …
How can we tell what the best discretization is? – Unsupervised discretization: find breaks in the data
values Example:
Petal Length
– Supervised discretization: Use class labels to find breaks
0 2 4 6 8 0
10
20
30
40
50
Petal Length
C o u n ts
87
88
01/27/2020 89Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Discretization Without Using Class Labels
Data consists of four groups of points and two outliers. Data is one- dimensional, but a random y component is added to reduce overlap.
01/27/2020 90Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Discretization Without Using Class Labels
Equal interval width approach used to obtain 4 values.
89
90
01/27/2020 91Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Discretization Without Using Class Labels
Equal frequency approach used to obtain 4 values.
01/27/2020 92Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Discretization Without Using Class Labels
K-means approach to obtain 4 values.
91
92
01/27/2020 93Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Binarization
Binarization maps a continuous or categorical attribute into one or more binary variables
Typically used for association analysis
Often convert a continuous attribute to a categorical attribute and then convert a categorical attribute to a set of binary attributes – Association analysis needs asymmetric binary
attributes – Examples: eye color and height measured as
{low, medium, high}
01/27/2020 94Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Attribute Transformation
An attribute transform is a function that maps the entire set of values of a given attribute to a new set of replacement values such that each old value can be identified with one of the new values – Simple functions: xk, log(x), ex, |x| – Normalization
Refers to various techniques to adjust to differences among attributes in terms of frequency of occurrence, mean, variance, range
Take out unwanted, common signal, e.g., seasonality
– In statistics, standardization refers to subtracting off the means and dividing by the standard deviation
93
94
01/27/2020 95Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Example: Sample Time Series of Plant Growth
Correlations between time series
Minneapolis
Minneapolis Atlanta Sao Paolo Minneapolis 1.0000 0.7591 -0.7581 Atlanta 0.7591 1.0000 -0.5739 Sao Paolo -0.7581 -0.5739 1.0000
Correlations between time series
Net Primary Production (NPP) is a measure of plant growth used by ecosystem scientists.
01/27/2020 96Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar
Seasonality Accounts for Much Correlation
Correlations between time series
Minneapolis
Normalized using monthly Z Score:
Subtract off monthly mean and divide by monthly standard deviation
Minneapolis Atlanta Sao Paolo Minneapolis 1.0000 0.0492 0.0906 Atlanta 0.0492 1.0000 -0.0154 Sao Paolo 0.0906 -0.0154 1.0000
Correlations between time series
95
96