Computer Science

profiledhkth54
chap2_data.pdf

01/27/2020 1Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Data Mining: Data

Lecture Notes for Chapter 2

Introduction to Data Mining , 2nd Edition by

Tan, Steinbach, Kumar

01/27/2020 2Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Outline

 Attributes and Objects

 Types of Data

 Data Quality

 Similarity and Distance

 Data Preprocessing

1

2

What is Data?

 Collection of data objects and their attributes

 An attribute is a property or characteristic of an object

– Examples: eye color of a person, temperature, etc.

– Attribute is also known as variable, field, characteristic, dimension, or feature

 A collection of attributes describe an object

– Object is also known as record, point, case, sample, entity, or instance

Tid Refund Marital Status

Taxable Income Cheat

1 Yes Single 125K No

2 No Married 100K No

3 No Single 70K No

4 Yes Married 120K No

5 No Divorced 95K Yes

6 No Married 60K No

7 Yes Divorced 220K No

8 No Single 85K Yes

9 No Married 75K No

10 No Single 90K Yes 10

Attributes

O b

je c

ts

01/27/2020 4Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

A More Complete View of Data

 Data may have parts

 Attributes (objects) may have relationships with other attributes (objects)

 More generally, data may have structure

 Data can be incomplete

 We will discuss this in more detail later

3

4

01/27/2020 5Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Attribute Values

 Attribute values are numbers or symbols assigned to an attribute for a particular object

 Distinction between attributes and attribute values – Same attribute can be mapped to different attribute

values  Example: height can be measured in feet or meters

– Different attributes can be mapped to the same set of values  Example: Attribute values for ID and age are integers  But properties of attribute values can be different

Measurement of Length

 The way you measure an attribute may not match the attributes properties.

1

2

3

5

5

7

8

15

10 4

A

B

C

D

E

This scale preserves the ordering and additvity properties of length.

This scale preserves only the ordering property of length.

5

6

01/27/2020 7Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Types of Attributes

 There are different types of attributes – Nominal

 Examples: ID numbers, eye color, zip codes

– Ordinal  Examples: rankings (e.g., taste of potato chips on a

scale from 1-10), grades, height {tall, medium, short}

– Interval  Examples: calendar dates, temperatures in Celsius or

Fahrenheit.

– Ratio  Examples: temperature in Kelvin, length, counts,

elapsed time (e.g., time to run a race)

01/27/2020 8Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Properties of Attribute Values

 The type of an attribute depends on which of the following properties/operations it possesses:

– Distinctness: =  – Order: < > – Differences are + -

meaningful :

– Ratios are * / meaningful

– Nominal attribute: distinctness – Ordinal attribute: distinctness & order – Interval attribute: distinctness, order & meaningful

differences – Ratio attribute: all 4 properties/operations

7

8

01/27/2020 9Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Difference Between Ratio and Interval

 Is it physically meaningful to say that a temperature of 10 ° is twice that of 5° on – the Celsius scale?

– the Fahrenheit scale?

– the Kelvin scale?

 Consider measuring the height above average – If Bill’s height is three inches above average and

Bob’s height is six inches above average, then would we say that Bob is twice as tall as Bill?

– Is this situation analogous to that of temperature?

Attribute Type

Description

Examples

Operations

Nominal

Nominal attribute values only distinguish. (=, )

zip codes, employee ID numbers, eye color, sex: {male, female}

mode, entropy, contingency correlation, 2 test

C a te

g o ri ca

l Q

u a lit

a tiv

e

Ordinal Ordinal attribute values also order objects. (<, >)

hardness of minerals, {good, better, best}, grades, street numbers

median, percentiles, rank correlation, run tests, sign tests

Interval For interval attributes, differences between values are meaningful. (+, - )

calendar dates, temperature in Celsius or Fahrenheit

mean, standard deviation, Pearson's correlation, t and F tests

N u m

e ri c

Q u a n tit

a tiv

e

Ratio For ratio variables, both differences and ratios are meaningful. (*, /)

temperature in Kelvin, monetary quantities, counts, age, mass, length, current

geometric mean, harmonic mean, percent variation

This categorization of attributes is due to S. S. Stevens

9

10

Attribute Type

Transformation

Comments

C a

te g

o ri

ca l

Q u

a lit

a ti ve

Nominal

Any permutation of values

If all employee ID numbers were reassigned, would it make any difference?

Ordinal An order preserving change of values, i.e., new_value = f(old_value) where f is a monotonic function

An attribute encompassing the notion of good, better best can be represented equally well by the values {1, 2, 3} or by { 0.5, 1, 10}.

N u

m e

ri c

Q u

a n

tit a

tiv e

Interval new_value = a * old_value + b where a and b are constants

Thus, the Fahrenheit and Celsius temperature scales differ in terms of where their zero value is and the size of a unit (degree).

Ratio new_value = a * old_value

Length can be measured in meters or feet.

This categorization of attributes is due to S. S. Stevens

01/27/2020 12Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Discrete and Continuous Attributes

 Discrete Attribute – Has only a finite or countably infinite set of values – Examples: zip codes, counts, or the set of words in a

collection of documents – Often represented as integer variables. – Note: binary attributes are a special case of discrete

attributes

 Continuous Attribute – Has real numbers as attribute values – Examples: temperature, height, or weight. – Practically, real values can only be measured and

represented using a finite number of digits. – Continuous attributes are typically represented as floating-

point variables.

11

12

01/27/2020 13Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Asymmetric Attributes

 Only presence (a non-zero attribute value) is regarded as important

 Words present in documents  Items present in customer transactions

 If we met a friend in the grocery store would we ever say the following? “I see our purchases are very similar since we didn’t buy most of the same things.”

 We need two asymmetric binary attributes to represent one ordinary binary attribute

– Association analysis uses asymmetric attributes

 Asymmetric attributes typically arise from objects that are sets

01/27/2020 14Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Some Extensions and Critiques

 Velleman, Paul F., and Leland Wilkinson. "Nominal, ordinal, interval, and ratio typologies are misleading." The American Statistician 47, no. 1 (1993): 65-72.

 Mosteller, Frederick, and John W. Tukey. "Data analysis and regression. A second course in statistics." Addison- Wesley Series in Behavioral Science: Quantitative Methods, Reading, Mass.: Addison-Wesley, 1977.

 Chrisman, Nicholas R. "Rethinking levels of measurement for cartography."Cartography and Geographic Information Systems 25, no. 4 (1998): 231-242.

13

14

01/27/2020 15Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Critiques

 Incomplete – Asymmetric binary

– Cyclical

– Multivariate

– Partially ordered

– Partial membership

– Relationships between the data

 Real data is approximate and noisy – This can complicate recognition of the proper attribute type

– Treating one attribute type as another may be approximately correct

01/27/2020 16Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Critiques …

 Not a good guide for statistical analysis – May unnecessarily restrict operations and results

 Statistical analysis is often approximate

 Thus, for example, using interval analysis for ordinal values may be justified

– Transformations are common but don’t preserve scales  Can transform data to a new scale with better statistical

properties

 Many statistical analyses depend only on the distribution

15

16

01/27/2020 17Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

More Complicated Examples

 ID numbers – Nominal, ordinal, or interval?

 Number of cylinders in an automobile engine – Nominal, ordinal, or ratio?

 Biased Scale – Interval or Ratio

01/27/2020 18Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Key Messages for Attribute Types

 The types of operations you choose should be “meaningful” for the type of data you have

– Distinctness, order, meaningful intervals, and meaningful ratios are only four properties of data

– The data type you see – often numbers or strings – may not capture all the properties or may suggest properties that are not present

– Analysis may depend on these other properties of the data  Many statistical analyses depend only on the distribution

– Many times what is meaningful is measured by statistical significance

– But in the end, what is meaningful is measured by the domain

17

18

01/27/2020 19Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Types of data sets

 Record – Data Matrix – Document Data – Transaction Data

 Graph – World Wide Web – Molecular Structures

 Ordered – Spatial Data – Temporal Data – Sequential Data – Genetic Sequence Data

01/27/2020 20Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Important Characteristics of Data

– Dimensionality (number of attributes)  High dimensional data brings a number of challenges

– Sparsity  Only presence counts

– Resolution  Patterns depend on the scale

– Size  Type of analysis may depend on size of data

19

20

01/27/2020 21Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Record Data

 Data that consists of a collection of records, each of which consists of a fixed set of attributes

Tid Refund Marital Status

Taxable Income Cheat

1 Yes Single 125K No

2 No Married 100K No

3 No Single 70K No

4 Yes Married 120K No

5 No Divorced 95K Yes

6 No Married 60K No

7 Yes Divorced 220K No

8 No Single 85K Yes

9 No Married 75K No

10 No Single 90K Yes 10

01/27/2020 22Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Data Matrix

 If data objects have the same fixed set of numeric attributes, then the data objects can be thought of as points in a multi-dimensional space, where each dimension represents a distinct attribute

 Such a data set can be represented by an m by n matrix, where there are m rows, one for each object, and n columns, one for each attribute

1.12.216.226.2512.65

1.22.715.225.2710.23

T hickness LoadDistanceProjection of y load

Projection of x Load

1.12.216.226.2512.65

1.22.715.225.2710.23

T hickness LoadDistanceProjection of y load

Projection of x Load

21

22

01/27/2020 23Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Document Data

 Each document becomes a ‘term’ vector – Each term is a component (attribute) of the vector

– The value of each component is the number of times the corresponding term occurs in the document.

01/27/2020 24Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Transaction Data

 A special type of data, where – Each transaction involves a set of items.

– For example, consider a grocery store. The set of products purchased by a customer during one shopping trip constitute a transaction, while the individual products that were purchased are the items.

– Can represent transaction data as record data

TID Items

1 Bread, Coke, Milk

2 Beer, Bread

3 Beer, Coke, Diaper, Milk

4 Beer, Bread, Diaper, Milk

5 Coke, Diaper, Milk

23

24

01/27/2020 25Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Graph Data

 Examples: Generic graph, a molecule, and webpages

5

2

1

2

5

Benzene Molecule: C6H6

01/27/2020 26Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Ordered Data

 Sequences of transactions

An element of the sequence

Items/Events

25

26

01/27/2020 27Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Ordered Data

 Genomic sequence data

GGTTCCGCCTTCAGCCCCGCGCC CGCAGGGCCCGCCCCGCGCCGTC GAGAAGGGCCCGCCTGGCGGGCG GGGGGAGGCGGGGCCGCCCGAGC CCAACCGAGTCCGACCAGGTGCC CCCTCTGCTCGGCCTAGACCTGA GCTCATTAGGCGGCAGCGGACAG GCCAAGTAGAACACGCGAAGCGC TGGGCTGCCTGCTGCGACCAGGG

01/27/2020 28Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Ordered Data

 Spatio-Temporal Data

Average Monthly Temperature of land and ocean

27

28

01/27/2020 29Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Data Quality

 Poor data quality negatively affects many data processing efforts

“The most important point is that poor data quality is an unfolding disaster.

– Poor data quality costs the typical company at least ten percent (10%) of revenue; twenty percent (20%) is probably a better estimate.”

Thomas C. Redman, DM Review, August 2004

 Data mining example: a classification model for detecting people who are loan risks is built using poor data

– Some credit-worthy candidates are denied loans

– More loans are given to individuals that default

01/27/2020 30Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Data Quality …

 What kinds of data quality problems?

 How can we detect problems with the data?

 What can we do about these problems?

 Examples of data quality problems: – Noise and outliers

– Missing values

– Duplicate data

– Wrong data

– Fake data

29

30

01/27/2020 31Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Noise

 For objects, noise is an extraneous object  For attributes, noise refers to modification of original values

– Examples: distortion of a person’s voice when talking on a poor phone and “snow” on television screen

Two Sine Waves Two Sine Waves + Noise

01/27/2020 32Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

 Outliers are data objects with characteristics that are considerably different than most of the other data objects in the data set – Case 1: Outliers are

noise that interferes with data analysis

– Case 2: Outliers are the goal of our analysis  Credit card fraud

 Intrusion detection

 Causes?

Outliers

31

32

01/27/2020 33Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Missing Values

 Reasons for missing values – Information is not collected

(e.g., people decline to give their age and weight) – Attributes may not be applicable to all cases

(e.g., annual income is not applicable to children)

 Handling missing values – Eliminate data objects or variables – Estimate missing values

 Example: time series of temperature

 Example: census results

– Ignore the missing value during analysis

01/27/2020 34Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Missing Values …

 Missing completely at random (MCAR) – Missingness of a value is independent of attributes – Fill in values based on the attribute – Analysis may be unbiased overall

 Missing at Random (MAR) – Missingness is related to other variables – Fill in values based other values – Almost always produces a bias in the analysis

 Missing Not at Random (MNAR) – Missingness is related to unobserved measurements – Informative or non-ignorable missingness

 Not possible to know the situation from the data

33

34

01/27/2020 35Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Duplicate Data

 Data set may include data objects that are duplicates, or almost duplicates of one another – Major issue when merging data from heterogeneous

sources

 Examples: – Same person with multiple email addresses

 Data cleaning – Process of dealing with duplicate data issues

 When should duplicate data not be removed?

01/27/2020 36Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Similarity and Dissimilarity Measures

 Similarity measure – Numerical measure of how alike two data objects are.

– Is higher when objects are more alike.

– Often falls in the range [0,1]

 Dissimilarity measure – Numerical measure of how different two data objects

are

– Lower when objects are more alike

– Minimum dissimilarity is often 0

– Upper limit varies

 Proximity refers to a similarity or dissimilarity

35

36

01/27/2020 37Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Similarity/Dissimilarity for Simple Attributes

The following table shows the similarity and dissimilarity between two objects, x and y, with respect to a single, simple attribute.

01/27/2020 38Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Euclidean Distance

 Euclidean Distance

where n is the number of dimensions (attributes) and xk and yk are, respectively, the kth attributes (components) or data objects x and y.

 Standardization is necessary, if scales differ.

37

38

01/27/2020 39Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Euclidean Distance

0

1

2

3

0 1 2 3 4 5 6

p1

p2

p3 p4

poi nt x y p1 0 2 p2 2 0 p3 3 1 p4 5 1

Distance Matrix

p1 p2 p3 p4 p1 0 2.828 3.162 5.099 p2 2.828 0 1.414 3.162 p3 3.162 1.414 0 2 p4 5.099 3.162 2 0

01/27/2020 40Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Minkowski Distance

 Minkowski Distance is a generalization of Euclidean Distance

Where r is a parameter, n is the number of dimensions (attributes) and xk and yk are, respectively, the k

th

attributes (components) or data objects x and y.

39

40

01/27/2020 41Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Minkowski Distance: Examples

 r = 1. City block (Manhattan, taxicab, L1 norm) distance. – A common example of this for binary vectors is the

Hamming distance, which is just the number of bits that are different between two binary vectors

 r = 2. Euclidean distance

 r  . “supremum” (Lmax norm, L norm) distance. – This is the maximum difference between any component of

the vectors

 Do not confuse r with n, i.e., all these distances are defined for all numbers of dimensions.

01/27/2020 42Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Minkowski Distance

Distance Matrix

poi nt x y p1 0 2 p2 2 0 p3 3 1 p4 5 1

L1 p1 p2 p3 p4 p1 0 4 4 6 p2 4 0 2 4 p3 4 2 0 2 p4 6 4 2 0

L2 p1 p2 p3 p4 p1 0 2.828 3.162 5.099 p2 2.828 0 1.414 3.162 p3 3.162 1.414 0 2 p4 5.099 3.162 2 0

L p1 p2 p3 p4

p1 0 2 3 5 p2 2 0 1 3 p3 3 1 0 2 p4 5 3 2 0

41

42

01/27/2020 43Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Mahalanobis Distance

For red points, the Euclidean distance is 14.7, Mahalanobis distance is 6.

 is the covariance matrix

𝐦𝐚𝐡𝐚𝐥𝐚𝐧𝐨𝐛𝐢𝐬 𝐱, 𝐲 𝐱 𝐲 Ʃ 𝐱 𝐲

01/27/2020 44Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Mahalanobis Distance

Covariance Matrix:

 

  

 

3.02.0

2.03.0

A: (0.5, 0.5)

B: (0, 1)

C: (1.5, 1.5)

Mahal(A,B) = 5

Mahal(A,C) = 4

B

A

C

43

44

01/27/2020 45Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Common Properties of a Distance

 Distances, such as the Euclidean distance, have some well known properties.

1. d(x, y)  0 for all x and y and d(x, y) = 0 only if x = y. (Positive definiteness)

2. d(x, y) = d(y, x) for all x and y. (Symmetry) 3. d(x, z)  d(x, y) + d(y, z) for all points x, y, and z.

(Triangle Inequality)

where d(x, y) is the distance (dissimilarity) between points (data objects), x and y.

 A distance that satisfies these properties is a metric

01/27/2020 46Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Common Properties of a Similarity

 Similarities, also have some well known properties.

1. s(x, y) = 1 (or maximum similarity) only if x = y. (does not always hold, e.g., cosine)

2. s(x, y) = s(y, x) for all x and y. (Symmetry)

where s(x, y) is the similarity between points (data objects), x and y.

45

46

01/27/2020 47Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Similarity Between Binary Vectors

 Common situation is that objects, x and y, have only binary attributes

 Compute similarities using the following quantities f01 = the number of attributes where x was 0 and y was 1

f10 = the number of attributes where x was 1 and y was 0

f00 = the number of attributes where x was 0 and y was 0

f11 = the number of attributes where x was 1 and y was 1

 Simple Matching and Jaccard Coefficients

SMC = number of matches / number of attributes = (f11 + f00) / (f01 + f10 + f11 + f00)

J = number of 11 matches / number of non-zero attributes = (f11) / (f01 + f10 + f11)

01/27/2020 48Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

SMC versus Jaccard: Example

x = 1 0 0 0 0 0 0 0 0 0

y = 0 0 0 0 0 0 1 0 0 1

f01 = 2 (the number of attributes where x was 0 and y was 1)

f10 = 1 (the number of attributes where x was 1 and y was 0)

f00 = 7 (the number of attributes where x was 0 and y was 0)

f11 = 0 (the number of attributes where x was 1 and y was 1)

SMC = (f11 + f00) / (f01 + f10 + f11 + f00)

= (0+7) / (2+1+0+7) = 0.7

J = (f11) / (f01 + f10 + f11) = 0 / (2 + 1 + 0) = 0

47

48

01/27/2020 49Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Cosine Similarity

 If d1 and d2 are two document vectors, then

cos( d1, d2 ) = <d1,d2> / ||d1|| ||d2|| ,

where <d1,d2> indicates inner product or vector dot product of vectors, d1 and d2, and || d || is the length of vector d.

 Example:

d1 = 3 2 0 5 0 0 0 2 0 0

d2 = 1 0 0 0 0 0 0 1 0 2 <d1, d2> = 3*1 + 2*0 + 0*0 + 5*0 + 0*0 + 0*0 + 0*0 + 2*1 + 0*0 + 0*2 = 5

| d1 || = (3*3+2*2+0*0+5*5+0*0+0*0+0*0+2*2+0*0+0*0) 0.5 = (42) 0.5 = 6.481

|| d2 || = (1*1+0*0+0*0+0*0+0*0+0*0+0*0+1*1+0*0+2*2) 0.5 = (6) 0.5 = 2.449

cos(d1, d2 ) = 0.3150

01/27/2020 50Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Extended Jaccard Coefficient (Tanimoto)

 Variation of Jaccard for continuous or count attributes – Reduces to Jaccard for binary attributes

49

50

01/27/2020 51Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Correlation measures the linear relationship between objects

01/27/2020 52Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Visually Evaluating Correlation

Scatter plots showing the similarity from –1 to 1.

51

52

01/27/2020 53Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Drawback of Correlation

 x = (-3, -2, -1, 0, 1, 2, 3)

 y = (9, 4, 1, 0, 1, 4, 9)

yi = xi 2

 mean(x) = 0, mean(y) = 4

 std(x) = 2.16, std(y) = 3.74

 corr = (-3)(5)+(-2)(0)+(-1)(-3)+(0)(-4)+(1)(-3)+(2)(0)+3(5) / ( 6 * 2.16 * 3.74 )

= 0

01/27/2020 54Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Comparison of Proximity Measures

 Domain of application – Similarity measures tend to be specific to the type of

attribute and data – Record data, images, graphs, sequences, 3D-protein

structure, etc. tend to have different measures

 However, one can talk about various properties that you would like a proximity measure to have

– Symmetry is a common one – Tolerance to noise and outliers is another – Ability to find more types of patterns? – Many others possible

 The measure must be applicable to the data and produce results that agree with domain knowledge

53

54

01/27/2020 55Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Information Based Measures

 Information theory is a well-developed and fundamental disciple with broad applications

 Some similarity measures are based on information theory – Mutual information in various versions

– Maximal Information Coefficient (MIC) and related measures

– General and can handle non-linear relationships

– Can be complicated and time intensive to compute

01/27/2020 56Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Information and Probability

 Information relates to possible outcomes of an event – transmission of a message, flip of a coin, or measurement

of a piece of data

 The more certain an outcome, the less information that it contains and vice-versa

– For example, if a coin has two heads, then an outcome of heads provides no information

– More quantitatively, the information is related the probability of an outcome  The smaller the probability of an outcome, the more information it

provides and vice-versa

– Entropy is the commonly used measure

55

56

01/27/2020 57Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Entropy

 For – a variable (event), X, – with n possible values (outcomes), x1, x2 …, xn – each outcome having probability, p1, p2 …, pn – the entropy of X , H(X), is given by

𝐻 𝑋 𝑝 log 𝑝

 Entropy is between 0 and log2n and is measured in bits

– Thus, entropy is a measure of how many bits it takes to represent an observation of X on average

01/27/2020 58Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Entropy Examples

 For a coin with probability p of heads and probability q = 1 – p of tails

𝐻 𝑝 log 𝑝 𝑞 log 𝑞

– For p= 0.5, q = 0.5 (fair coin) H = 1

– For p = 1 or q = 1, H = 0

 What is the entropy of a fair four-sided die?

57

58

01/27/2020 59Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Entropy for Sample Data: Example

Maximum entropy is log25 = 2.3219

Hair Color Count p -plog2p

Black 75 0.75 0.3113

Brown 15 0.15 0.4105

Blond 5 0.05 0.2161

Red 0 0.00 0

Other 5 0.05 0.2161

Total 100 1.0 1.1540

01/27/2020 60Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Entropy for Sample Data

 Suppose we have – a number of observations (m) of some attribute, X,

e.g., the hair color of students in the class,

– where there are n different possible values

– And the number of observation in the ith category is mi – Then, for this sample

𝐻 𝑋 𝑚 𝑚

log 𝑚 𝑚

 For continuous data, the calculation is harder

59

60

01/27/2020 61Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Mutual Information

 Information one variable provides about another

Formally, 𝐼 𝑋, 𝑌 𝐻 𝑋 𝐻 𝑌 𝐻 𝑋, 𝑌 , where

H(X,Y) is the joint entropy of X and Y,

𝐻 𝑋, 𝑌 𝑝𝑖𝑗log 𝑝𝑖𝑗

Where pij is the probability that the i th value of X and the jth value of Y

occur together

 For discrete variables, this is easy to compute

 Maximum mutual information for discrete variables is log2(min( nX, nY ), where nX (nY) is the number of values of X (Y)

01/27/2020 62Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Mutual Information Example

Student Status

Count p -plog2p

Undergrad 45 0.45 0.5184

Grad 55 0.55 0.4744

Total 100 1.00 0.9928

Grade Count p -plog2p A 35 0.35 0.5301

B 50 0.50 0.5000

C 15 0.15 0.4105

Total 100 1.00 1.4406

Student Status

Grade Count p -plog2p

Undergrad A 5 0.05 0.2161

Undergrad B 30 0.30 0.5211

Undergrad C 10 0.10 0.3322

Grad A 30 0.30 0.5211

Grad B 20 0.20 0.4644

Grad C 5 0.05 0.2161

Total 100 1.00 2.2710

Mutual information of Student Status and Grade = 0.9928 + 1.4406 - 2.2710 = 0.1624

61

62

01/27/2020 63Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Maximal Information Coefficient

 Reshef, David N., Yakir A. Reshef, Hilary K. Finucane, Sharon R. Grossman, Gilean McVean, Peter J. Turnbaugh, Eric S. Lander, Michael Mitzenmacher, and Pardis C. Sabeti. "Detecting novel associations in large data sets." science 334, no. 6062 (2011): 1518-1524.

 Applies mutual information to two continuous variables

 Consider the possible binnings of the variables into discrete categories

– nX × nY ≤ N 0.6 where

 nX is the number of values of X

 nY is the number of values of Y

 N is the number of samples (observations, data objects)

 Compute the mutual information – Normalized by log2(min( nX, nY )

 Take the highest value

01/27/2020 64Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

General Approach for Combining Similarities

 Sometimes attributes are of many different types, but an overall similarity is needed.

1: For the kth attribute, compute a similarity, sk(x, y), in the range [0, 1].

2: Define an indicator variable, k, for the kth attribute as follows:

k = 0 if the kth attribute is an asymmetric attribute and both objects have a value of 0, or if one of the objects has a missing value for the kth attribute

k = 1 otherwise

3. Compute

63

64

01/27/2020 65Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Using Weights to Combine Similarities

 May not want to treat all attributes the same.

– Use non-negative weights 𝜔

– 𝑠𝑖𝑚𝑖𝑙𝑎𝑟𝑖𝑡𝑦 𝐱, 𝐲 ∑ 𝐱,𝐲

 Can also define a weighted form of distance

01/27/2020 66Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Density

 Measures the degree to which data objects are close to each other in a specified area

 The notion of density is closely related to that of proximity  Concept of density is typically used for clustering and

anomaly detection  Examples:

– Euclidean density  Euclidean density = number of points per unit volume

– Probability density  Estimate what the distribution of the data looks like

– Graph-based density  Connectivity

65

66

01/27/2020 67Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Euclidean Density: Grid-based Approach

 Simplest approach is to divide region into a number of rectangular cells of equal volume and define density as # of points the cell contains

Grid-based density. Counts for each cell.

01/27/2020 68Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Euclidean Density: Center-Based

 Euclidean density is the number of points within a specified radius of the point

Illustration of center-based density.

67

68

01/27/2020 69Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Data Preprocessing

 Aggregation

 Sampling

 Dimensionality Reduction

 Feature subset selection

 Feature creation

 Discretization and Binarization

 Attribute Transformation

01/27/2020 70Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Aggregation

 Combining two or more attributes (or objects) into a single attribute (or object)

 Purpose – Data reduction

 Reduce the number of attributes or objects

– Change of scale

 Cities aggregated into regions, states, countries, etc.

 Days aggregated into weeks, months, or years

– More “stable” data

 Aggregated data tends to have less variability

69

70

01/27/2020 71Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Example: Precipitation in Australia

 This example is based on precipitation in Australia from the period 1982 to 1993. The next slide shows

– A histogram for the standard deviation of average monthly precipitation for 3,030 0.5◦ by 0.5◦ grid cells in Australia, and

– A histogram for the standard deviation of the average yearly precipitation for the same locations.

 The average yearly precipitation has less variability than the average monthly precipitation.

 All precipitation measurements (and their standard deviations) are in centimeters.

01/27/2020 72Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Example: Precipitation in Australia …

Standard Deviation of Average Monthly Precipitation

Standard Deviation of Average Yearly Precipitation

Variation of Precipitation in Australia

71

72

01/27/2020 73Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Sampling

 Sampling is the main technique employed for data reduction.

– It is often used for both the preliminary investigation of the data and the final data analysis.

 Statisticians often sample because obtaining the entire set of data of interest is too expensive or time consuming.

 Sampling is typically used in data mining because processing the entire set of data of interest is too expensive or time consuming.

01/27/2020 74Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Sampling …

 The key principle for effective sampling is the following:

– Using a sample will work almost as well as using the entire data set, if the sample is representative

– A sample is representative if it has approximately the same properties (of interest) as the original set of data

73

74

01/27/2020 75Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Sample Size

8000 points 2000 Points 500 Points

01/27/2020 76Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Types of Sampling  Simple Random Sampling

– There is an equal probability of selecting any particular item

– Sampling without replacement  As each item is selected, it is removed from the

population – Sampling with replacement

 Objects are not removed from the population as they are selected for the sample.

 In sampling with replacement, the same object can be picked up more than once

 Stratified sampling – Split the data into several partitions; then draw random

samples from each partition

75

76

01/27/2020 77Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Sample Size

 What sample size is necessary to get at least one object from each of 10 equal-sized groups.

01/27/2020 78Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Curse of Dimensionality

 When dimensionality increases, data becomes increasingly sparse in the space that it occupies

 Definitions of density and distance between points, which are critical for clustering and outlier detection, become less meaningful • Randomly generate 500 points

• Compute difference between max and min distance between any pair of points

77

78

01/27/2020 79Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Dimensionality Reduction

 Purpose: – Avoid curse of dimensionality – Reduce amount of time and memory required by data

mining algorithms – Allow data to be more easily visualized – May help to eliminate irrelevant features or reduce

noise

 Techniques – Principal Components Analysis (PCA) – Singular Value Decomposition – Others: supervised and non-linear techniques

01/27/2020 80Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Dimensionality Reduction: PCA

 Goal is to find a projection that captures the largest amount of variation in data

x2

x1

e

79

80

01/27/2020 81Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Dimensionality Reduction: PCA

01/27/2020 82Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Feature Subset Selection

 Another way to reduce dimensionality of data  Redundant features

– Duplicate much or all of the information contained in one or more other attributes

– Example: purchase price of a product and the amount of sales tax paid

 Irrelevant features – Contain no information that is useful for the data

mining task at hand – Example: students' ID is often irrelevant to the task of

predicting students' GPA

 Many techniques developed, especially for classification

81

82

01/27/2020 83Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Feature Creation

 Create new attributes that can capture the important information in a data set much more efficiently than the original attributes

 Three general methodologies: – Feature extraction

 Example: extracting edges from images

– Feature construction

 Example: dividing mass by volume to get density

– Mapping data to new space  Example: Fourier and wavelet analysis

01/27/2020 84Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Mapping Data to a New Space

Two Sine Waves + Noise Frequency

 Fourier and wavelet transform

Frequency

83

84

01/27/2020 85Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Discretization

 Discretization is the process of converting a continuous attribute into an ordinal attribute – A potentially infinite number of values are mapped

into a small number of categories

– Discretization is commonly used in classification

– Many classification algorithms work best if both the independent and dependent variables have only a few values

– We give an illustration of the usefulness of discretization using the Iris data set

01/27/2020 86Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Iris Sample Data Set

 Iris Plant data set. – Can be obtained from the UCI Machine Learning Repository

http://www.ics.uci.edu/~mlearn/MLRepository.html

– From the statistician Douglas Fisher – Three flower types (classes):

 Setosa  Versicolour  Virginica

– Four (non-class) attributes  Sepal width and length  Petal width and length Virginica. Robert H. Mohlenbrock. USDA

NRCS. 1995. Northeast wetland flora: Field office guide to plant species. Northeast National Technical Center, Chester, PA. Courtesy of USDA NRCS Wetland Science Institute.

85

86

Discretization: Iris Example

Petal width low or petal length low implies Setosa. Petal width medium or petal length medium implies Versicolour. Petal width high or petal length high implies Virginica.

01/27/2020 88Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Discretization: Iris Example …

 How can we tell what the best discretization is? – Unsupervised discretization: find breaks in the data

values Example:

Petal Length

– Supervised discretization: Use class labels to find breaks

0 2 4 6 8 0

10

20

30

40

50

Petal Length

C o u n ts

87

88

01/27/2020 89Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Discretization Without Using Class Labels

Data consists of four groups of points and two outliers. Data is one- dimensional, but a random y component is added to reduce overlap.

01/27/2020 90Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Discretization Without Using Class Labels

Equal interval width approach used to obtain 4 values.

89

90

01/27/2020 91Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Discretization Without Using Class Labels

Equal frequency approach used to obtain 4 values.

01/27/2020 92Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Discretization Without Using Class Labels

K-means approach to obtain 4 values.

91

92

01/27/2020 93Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Binarization

 Binarization maps a continuous or categorical attribute into one or more binary variables

 Typically used for association analysis

 Often convert a continuous attribute to a categorical attribute and then convert a categorical attribute to a set of binary attributes – Association analysis needs asymmetric binary

attributes – Examples: eye color and height measured as

{low, medium, high}

01/27/2020 94Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Attribute Transformation

 An attribute transform is a function that maps the entire set of values of a given attribute to a new set of replacement values such that each old value can be identified with one of the new values – Simple functions: xk, log(x), ex, |x| – Normalization

 Refers to various techniques to adjust to differences among attributes in terms of frequency of occurrence, mean, variance, range

 Take out unwanted, common signal, e.g., seasonality

– In statistics, standardization refers to subtracting off the means and dividing by the standard deviation

93

94

01/27/2020 95Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Example: Sample Time Series of Plant Growth

Correlations between time series

Minneapolis

Minneapolis Atlanta Sao Paolo Minneapolis 1.0000 0.7591 -0.7581 Atlanta 0.7591 1.0000 -0.5739 Sao Paolo -0.7581 -0.5739 1.0000

Correlations between time series

Net Primary Production (NPP) is a measure of plant growth used by ecosystem scientists.

01/27/2020 96Introduction to Data Mining, 2nd Edition Tan, Steinbach, Karpatne, Kumar

Seasonality Accounts for Much Correlation

Correlations between time series

Minneapolis

Normalized using monthly Z Score:

Subtract off monthly mean and divide by monthly standard deviation

Minneapolis Atlanta Sao Paolo Minneapolis 1.0000 0.0492 0.0906 Atlanta 0.0492 1.0000 -0.0154 Sao Paolo 0.0906 -0.0154 1.0000

Correlations between time series

95

96