Scientific Article #4

profileAp122
C4-Article1.pdf

Report

Streptococcus pyogenes u

pregulates arginine catabolism to exert its pathogenesis on the skin surface

Graphical abstract

Highlights

d S. pyogenes uses arginine catabolism under low-glucose

conditions

d Arginine catabolism contributes to its viability and virulence

on skin surface

d Arginine catabolism is suppressed under high-glucose

conditions in blood

d S. pyogenes acquires arginine from the stratum-

corneum-derived filaggrin

Hirose et al., 2021, Cell Reports 34, 108924 March 30, 2021 ª 2021 The Author(s). https://doi.org/10.1016/j.celrep.2021.108924

Authors

Yujiro Hirose, Masaya Yamaguchi,

Tomoko Sumitomo, ..., Masayuki Amagai,

Victor Nizet, Shigetada Kawabata

Correspondence [email protected] (Y.H.), [email protected] (S.K.)

In brief

Hirose et al. show that S. pyogenes

upregulates arginine catabolism to exert

its pathogenesis under low-glucose

conditions. S. pyogenes changes global

gene expression, including upregulation

of virulence genes, by catabolizing

arginine. S. pyogenes acquires arginine

from stratum-corneum-derived filaggrin

to adapt to glucose starvation on the skin.

ll

OPEN ACCESS

ll

Report

Streptococcus pyogenes upregulates arginine catabolism to exert its pathogenesis on the skin surface Yujiro Hirose,1,2,11,* Masaya Yamaguchi,1 Tomoko Sumitomo,1 Masanobu Nakata,3 Tomoki Hanada,1 Daisuke Okuzaki,4

Daisuke Motooka,5 Yasushi Mori,1 Hiroshi Kawasaki,6,7,8 Alison Coady,2 Satoshi Uchiyama,2 Masanobu Hiraoka,2,9

Raymond H. Zurich,2 Masayuki Amagai,6,8 Victor Nizet,2,10 and Shigetada Kawabata1,* 1Department of Oral and Molecular Microbiology, Osaka University Graduate School of Dentistry, Suita, Osaka 565-0871, Japan 2Department of Pediatrics, University of California at San Diego School of Medicine, La Jolla, CA 92093, USA 3Department of Oral Microbiology, Kagoshima University Graduate School of Medical and Dental Sciences, Kagoshima 890-8544, Japan 4Genome Information Research Center, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 565-0871, Japan 5Department of Infection Metagenomics, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 565-0871, Japan 6Department of Dermatology, Keio University School of Medicine, Tokyo 160-8582, Japan 7Immunology Data Integration Unit, RIKEN Medical Sciences Innovation Hub Program, Yokohama 230-0045, Japan 8Laboratory for Skin Homeostasis, RIKEN Center for Integrative Medical Sciences, Yokohama 230-0045, Japan 9Department of Otorhinolaryngology-Head and Neck Surgery, Wakayama Medical University, Wakayama, Wakayama 641-8509, Japan 10Skaggs School of Pharmaceutical Sciences, University of California at San Diego, La Jolla, CA 92093, USA 11Lead contact

*Correspondence: [email protected] (Y.H.), [email protected] (S.K.)

https://doi.org/10.1016/j.celrep.2021.108924

SUMMARY

The arginine deiminase (ADI) pathway has been found in many kinds of bacteria and functions to supplement energy production and provide protection against acid stress. The Streptococcus pyogenes ADI pathway is upregulated upon exposure to various environmental stresses, including glucose starvation. However, there are several unclear points about the advantages to the organism for upregulating arginine catabolism. We show that the ADI pathway contributes to bacterial viability and pathogenesis under low-glucose conditions. S. pyogenes changes global gene expression, including upregulation of virulence genes, by catabolizing argi- nine. In a murine model of epicutaneous infection, S. pyogenes uses the ADI pathway to augment its patho- genicity by increasing the expression of virulence genes, including those encoding the exotoxins. We also find that arginine from stratum-corneum-derived filaggrin is a key substrate for the ADI pathway. In summary, arginine is a nutrient source that promotes the pathogenicity of S. pyogenes on the skin.

INTRODUCTION

One of the most important human bacterial pathogens of skin is

Streptococcus pyogenes, which can produce superficial impe-

tigo or more deep-seated cellulitis but also more severe invasive

infections such as sepsis, necrotizing fasciitis, and streptococcal

toxic shock syndrome (Cunningham, 2000; Walker et al., 2014).

S. pyogenes typing based on M protein and T antigen (pilus ma-

jor subunit) antigenicity (Falugi et al., 2008) confirms several se-

rotypes are capable of causing severe infections, but in recent

decades, one subclone of the M1 serotype, the globally dissem-

inated clonal M1T1 clone (Chatellier et al., 2000), has persisted

uninterruptedly as the most frequently isolated S. pyogenes

strains from both invasive and noninvasive infections (Lynskey

et al., 2019; Walker et al., 2014).

Human skin is an inhospitable environment that includes the

physical barrier of the stratum corneum (SC), an acidic surface

pH, and the active synthesis of innate defense factors such as

antimicrobial peptides, proteases, lysozymes, cytokines, and

This is an open access article und

chemokines that together serve to recruit immune cells and

prime adaptive immune responses (Cogen et al., 2008; Proksch,

2018). To successfully colonize or establish infection in the skin,

pathogens must possess virulence determinants for evasion of

these immune factors and also for acquisition of nutrients, whose

availability the host may restrict under the concept of nutritional

immunity. Elucidation of such bacterial metabolic pathways that

are essential for in vivo survival can reveal unique targets for

novel therapeutics.

The arginine deiminase (ADI) pathway is a metabolic pathway

found in many kinds of bacteria that serves to supplement energy

production and provide protection against acid stress in vitro

(Abdelal, 1979; Cotter and Hill, 2003). The ADI pathway of

S. pyogenes has been studied in a limited manner and

determined to antagonize nitric oxide (NO) production by

macrophages and contribute to the asymptomatic colonization

of the murine vaginal mucosa (Cusumano et al., 2014). The

S. pyogenes ADI pathway is negatively regulated by the following

three virulence-related transcriptional control systems: the control

Cell Reports 34, 108924, March 30, 2021 ª 2021 The Author(s). 1 er the CC BY license (http://creativecommons.org/licenses/by/4.0/).

A B

C

F G

H

D E

(legend on next page)

2 Cell Reports 34, 108924, March 30, 2021

Report ll

OPEN ACCESS

Report ll

OPEN ACCESS

of virulence (CovRS) two-component gene regulatory system,

catabolite control protein CcpA, and regulator gene of glucosyl-

transferase Rgg (Dmitriev et al., 2006; Shelburne et al., 2010).

CovRS mediates a general stress response to changing tempera-

ture, pH, and osmolarity (Dalton and Scott, 2004); and CcpA and

Rgg are directly linked to environmental glucose deprivation

(Dmitriev et al., 2006; Shelburne et al., 2008). Although CovR dele-

tion induces a several-fold increase of ADI pathway genes, CcpA

or Rgg deletions markedly induce several-log-fold increases in the

pathway (Dmitriev et al., 2006; Shelburne et al., 2010). These find-

ings suggest that the ADI pathway is especially important to

S. pyogenes under low-glucose conditions. Notably, the glucose

concentration in the SC of skin is much lower than that present

in blood (Sylvestre et al., 2010). In this study, we investigated

whether the S. pyogenes ADI pathway contributes to the viability

and pathogenesis of an M1T1 strain under low-glucose conditions

and in the skin.

RESULTS

S. pyogenes ADI pathway contributes to its viability and virulence The S. pyogenes ADI pathway is comprised of ArcA, B, C, and D

(Figure S1A; Cusumano et al., 2014). ArcA, an arginine deimi-

nase, is the first enzyme of the ADI pathway and catalyzes the

irreversible hydrolysis of arginine to citrulline and ammonia. We

constructed a markerless complete arcA deletion mutant (DarcA)

by using a double crossover homologous recombination tech-

nique, preserving as a control a wild-type (WT) revertant strain

(Wr) from the single crossover step back to the integrity of

arcA. We first observed the time course of pH change of bacterial

cultures grown under arginine-rich conditions, using phenol red

as an indicator of elevated pH (Figure 1A). The WT S. pyogenes

parent strain induced pH elevation in the culture medium

beginning in stationary phase, whereas the S. pyogenes DarcA

did not, confirming that a loss of arcA renders the bacterium’s

arginine catabolism dysfunctional. Deletion of arcA led to a

decrease in S. pyogenes viability during the decline phase of

stationary growth in Todd-Hewitt broth supplemented with

0.2% yeast extract (THY broth) (Figure 1B). In contrast, the WT

S. pyogenes strain exhibited a strong increase in arcA gene

expression and ammonium ion production occurring during sta-

tionary phase following glucose starvation (Figures 1C, 1D, and

Figure 1. arcA upregulation under glucose-starvation conditions, and (A) Temporal pH change of bacterial cultures using phenol red broth supplemen

(B) Bacterial growth ability and viability in THY broth. Error bars indicated the me

experiments are shown. **p < 0.01.

(C) The arcA expression of WT S. pyogenes at each growth phase within THY bro

with a box-whisker plot (n = 9). **p < 0.01.

(D and E) Glucose (D) and ammonium ion (E) levels in culture supernatant of WT

mean + SE. **p < 0.01.

(F) Arginine-dependent cytotoxicity of S. pyogenes. HaCaT cells cultured in CDM

cells are indicated green and red, respectively. LDH, lactate dehydrogenase. Va

experiments. Error bars indicated the mean + SE. **p < 0.01. p < 0.01.

(G) Intracellular ATP levels of S. pyogenes. Representative data obtained from a

mean + SE (n = 4). **p < 0.01.

(H) Bacterial viability in only CDM or CDM with cultured HaCaT cells. Error bars in

independent experiments are shown. **p < 0.01.

1E). Although a pH elevation was not detected during the station-

ary phase in THY broth, pH levels in phenol red broth supple-

mented with arginine were elevated above neutral pH for both

the WT and Wr cultures (Figures S1B and S1C). Both WT and

Wr showed the potential for long-term survival in neutral pH for

at least 40 days during the decline phase, whereas the mutant

strain lost viability after only 2 days (Figure S1B). These findings

indicate that S. pyogenes neutralizes excess protons during sta-

tionary phase by synthesizing ammonia in an ADI-dependent

manner, thus promoting long-term viability during the decline

phase.

S. pyogenes cultured in THY broth experienced glucose

starvation beginning in stationary phase. To investigate whether

arginine catabolism contributed to S. pyogenes virulence phe-

notypes under such glucose-starved conditions, we prepared

chemically defined medium (CDM; Table S1) without glucose,

phenol red, or arginine. As a first surrogate marker of virulence,

we evaluated S. pyogenes cytotoxicity against the cultured hu-

man keratinocyte cell line HaCaT. We supplemented 1,000 mM

arginine in the CDM to match the physiological concentration

present in human muscle tissue (Canepa et al., 2002). At 20 h

after infection of HaCaT cells under arginine-supplemented

conditions, WT and Wr showed a dose-dependent increase in

cytotoxic potential compared to the DarcA mutant (Figures

1F and S1D), linking arginine catabolism to this virulence

phenotype.

By metabolizing arginine, S. pyogenes acquires adenosine

triphosphate (ATP) as an energy source, coupled to discharge

of ammonium ion (Figure S1A). Intracellular acidification may

affect the growth and cell viability of streptococci (Dashper

and Reynolds, 2000). We probed the contribution of arginine

catabolism to S. pyogenes intracellular pH and ATP levels under

low-glucose conditions using CDM. No effects on the intracel-

lular pH of S. pyogenes were observed 1 h, 5 h, and 15 h post-

incubation in CDM (Figure S1E). Conversely, at 1 h and 5 h

post-incubation, arginine catabolism contributed to the acquisi-

tion of ATP under the no-glucose condition (Figure 1G), which

correlated with viability of S. pyogenes at 5 h and 15 h post-incu-

bation in CDM (Figure 1H). S. pyogenes WT in CDM at 15 h had

greater viability when cultured in the presence of HaCaT cells

than in their absence (Figure 1H), suggesting that ADI-depen-

dent S. pyogenes cytotoxicity induces release of nutrition from

damaged keratinocytes, promoting S. pyogenes survival.

arginine-catabolism-dependent viability and cytotoxicity ted with 30 mM arginine.

an + SE (n = 4). Representative data obtained from at least three independent

th. Data obtained by combining three independent experiments are displayed

(n = 9) and DarcA (n = 4) during growth in THY broth. Error bars indicated the

were infected with S. pyogenes (MOI = 500) for 20 h. Viable cells and dead

lues are presented as the mean of four wells from one of three independent

t least three independent experiments are shown. Vertical lines represent the

dicated the mean + SE (n = 4). Representative data obtained from at least three

Cell Reports 34, 108924, March 30, 2021 3

Report ll

OPEN ACCESS

S. pyogenes arginine catabolism changes global gene expression We conducted RNA sequencing (RNA-seq) analysis of the

S. pyogenes strains in CDM with arginine (Arg(+)) or without

arginine (Arg(�)) to assesses transcriptional consequences of altering the ADI pathway. Principal-component analysis (PCA)

showed DarcA Arg(�), DarcA Arg(+), and WT Arg(�) samples clustered together, whereas WT Arg(+) samples positioned

clearly apart from the others (Figure 2A). Differentially expressed

genes (DEGs) from comparisons of the Arg(+) and Arg(�) groups were detected only in the WT S. pyogenes background and not

with the DarcA (Figure 2B; Data S1 and S2). The cumulative re-

sults indicated that arginine-dependent transcriptome changes

in S. pyogenes occurred only in the presence of an intact ADI

pathway. A heatmap using selected characteristic genes

showed that upregulated genes in WT Arg(+) samples included

those encoding virulence factors, such as an enzyme for matura-

tion of the cytolysin streptolysin S (sagB), another cytolysin

streptolysin O (slo), nucleases (spd3), and NADase (nga), but

also genes comprising the pyrimidine biosynthesis pathway

(pyrD, pyrE, and pyrF) (Figure 2C). On the other hand, cell-divi-

sion-associated genes (ftsH, ftsL, and ftsZ) and genes encoding

F0F1-type ATP synthase (atpB–H) were downregulated in WT

S. pyogenes in the presence of arginine.

The most well-studied S. pyogenes two-component signal

transduction system is the cluster of virulence (Cov) intracellular

responder (CovR)/extracellular sensor (CovS) CovRS, which influ-

ences 15%–20% of the S. pyogenes genome (Graham et al.,

2002). CovS sensed environmental changes and transmitted to

CovR by phosphorylation-dephosphorylation (Horstmann et al.,

2015). Of particular interest, the covS gene was downregulated

in WT S. pyogenes-sensing arginine (Figure 2C; Data S2). To

investigate whether arginine catabolism influences CovR phos-

phorylation, we monitored phosphorylation of the regulator using

a 50 FLAG-CovR strain (Figure 2D). Exponential phase growth of S. pyogenes in THY broth showed low levels of CovR phosphory-

lation. For S. pyogenes within CDM, the WT Arg(+) sample tended

to show a low levelof CovR phosphorylation, butnosignificant dif-

ference was found by the densitometric analysis (Figure 2E).

ADI pathway contributes to the development of cutaneous lesions The SC of skin is relatively deficient in glucose (Sylvestre et al.,

2010), whereas arginine is abundant (Kubo et al., 2013). We hy-

pothesized that S. pyogenes may use arginine to acquire energy

on the skin surface and examined this possibility by using a

mouse model of epicutaneous infection (Figure 3A). By 3 days

post-challenge, the skin surface of mice infected with WT or

Wr S. pyogenes had peeled off, whereas it remained intact in

DarcA-infected mice (Figure 3B). Furthermore, CFU recovered

from skin lesions 3 days post-infection were significantly

reduced in DarcA-infected mice compared to the WT or Wr

(Figure 3C). An analysis of gene expression showed the WT

S. pyogenes strain had higher in vivo expression of the genes en-

coding the streptolysin S precursor (sagA) and streptolysin O

(slo) but reduced expression of the gene encoding cysteine pro-

tease SpeB (speB) compared to the DarcA mutant (Figure 3D).

These results indicate that arginine catabolism contributes to

4 Cell Reports 34, 108924, March 30, 2021

the pathogenesis of S. pyogenes on the skin surface while pro-

moting the expression of cytolysins.

To assess the ADI-dependent effects on S. pyogenes sys-

temic pathogenicity, we conducted intravenous challenge of

mice along with an ex vivo bactericidal assay by using mouse

blood. In both sets of experiments, there were no significant dif-

ferences between WT and DarcA (Figures 3E and 3F); this argi-

nine catabolism may not be involved in the virulence or viability

of S. pyogenes in blood. We speculated that arginine catabolism

was suppressed in blood due to high concentrations of glucose.

With that in mind, we evaluated arcA gene expression of WT

S. pyogenes in blood and on the skin surface by using qPCR. Us-

ing an expression level of arcA in the exponential phase growth in

THY medium set to 1, we found that arcA expression was 10 to

100 times lower in blood and 10 times greater on the skin than

under the culture conditions (Figure 3G). This result suggests

that the expression on the skin surface was elevated 2- to 3-

log-fold compared to that in blood, where low-glucose concen-

trations are found. Expanding the repertoire of infection models,

we found that in a subcutaneous mouse soft-tissue infection

model, which causes necrosis of fascial tissue and adjoining

muscle, the DarcA showed reduced virulence compared to WT

and Wr (Figure S2A), whereas there were no differences in viru-

lence in another systemic challenge by intraperitoneal infection

(Figure S2B). It is speculated that these contrasting results

reflect differences in available concentrations of glucose and

arginine in localized versus systemic disease compartments.

Next, an epicutaneous infection study was conducted using

streptozotocin-induced diabetic mice. As expected, 48 h after

depilation of dorsal skin, glucose levels on the skin surface in

non-diabetic (WT) mice were below the detection limit (<1 mM)

in nearly all samples, whereas those in the diabetic mice were

much higher (4 mM–70.4 mM; Figures S2C and S2D). In response

to an epicutaneous infection in diabetic mice, DarcA showed

comparable recovered CFU from the skin lesion to WT

(Figure S2E). Both WT and DarcA in CDM showed an upregula-

tion of the slo gene in the presence of glucose (Figures S2F and

S2G). These results suggested that the abundance of glucose on

the skin surface in diabetes allows the pathogen to exhibit path-

ogenicity independently of arginine catabolism, consistent with

the known increased risk of S. pyogenes skin and soft tissue in-

fections in patients with diabetes (Lin et al., 2011).

In our RNA-seq data in vitro, 4 genes associated with phos-

photransferase system (PTS) were upregulated in WT under argi-

nine-rich conditions (ptsD, SP5448_05675, SP5448_08850, and

SP5448_08855). Therefore, we evaluated the expression levels

of these transporter genes at 3 h post-epicutaneous infection

in WT mice (Figure S3). The expression levels of each gene

tended to be upregulated in WT compared to those of the

DarcA mutant. This result also suggests that the skin surface of

WT mice has a low glucose concentration and S. pyogenes up-

regulates the expression of transporter genes in a manner that

depends on arginine catabolism.

ADI-pathway-dependent bacterial virulence was canceled in Flg�/� mice Arginine is abundant in filaggrin, an abundant protein within

the SC of skin, and a filaggrin knockout (Flg�/�) mouse has a

A

C D

E

B

Figure 2. Effect of S. pyogenes arginine catabolism on transcriptome and phosphorylation of CovR

(A) Principal-component analysis (PCA) plot of fragments per kilobase of exon per million mapped fragments (FPKM) data from the RNA-seq dataset.

(B) Volcano plots comparing global gene expression patterns between WT Arg(�) and WT Arg(+) and between DarcA Arg(�) and DarcA Arg(+). Colored circles indicate significantly upregulated (red) and downregulated (blue) genes (absolute log2-fold change, >0.5; adjusted p < 0.2).

(C) Heatmap of up- or downregulated functions. FPKM values were used for the heatmap visualization. Red and blue indicate induced and repressed,

respectively.

(D) Phosphorylation levels of CovR. CovR~P and CovR indicate phosphorylated CovR and non-phosphorylated CovR, respectively. Total protein serves as the

loading control. THY, RNA samples from exponential phase of S. pyogenes in THY medium.

(E) Relative percentage of phosphorylated CovR. Error bars indicated the mean ± SE (n = 4). Arg(�), strains in CDM without arginine. Arg(+), strains in CDM with 1,000 mM arginine.

Report ll

OPEN ACCESS

markedly lower SC arginine level than a corresponding WT

mouse (Kawasaki et al., 2012; Kubo et al., 2013). The degrada-

tion of filaggrin into amino acids occurs in the SC layers by

host-derived enzymes, including caspase-14, calpain 1, and

bleomycin hydrolase (Hoste et al., 2011). We hypothesized that

S. pyogenes acquires arginine from filaggrin in the SC for

nutritional requirements and its pathogenicity on the skin

surface.

Cell Reports 34, 108924, March 30, 2021 5

A

B

C

E F G

D

Figure 3. The roles of arginine catabolism for the virulence of S. pyogenes on the skin surface and in blood

(A) Murine model of epicutaneous infection and its timeline. Mice were epicutaneously infected with 2 3 106 CFU of S. pyogenes.

(B) Skin phenotype and histopathology at 3 days post-infection. Cutaneous tissues from infection sites were stained with H&E. Data shown are representative of

at least three separate experiments.

(C) CFUs in skin lesions at 3 days post-infection. Data shown represent the mean ± SE (n = 8) and are representative of at least three independent experiments. **p

< 0.01, *p < 0.05.

(legend continued on next page)

6 Cell Reports 34, 108924, March 30, 2021

Report ll

OPEN ACCESS

Report ll

OPEN ACCESS

At baseline, it is difficult to appreciate any phenotypic differ-

ences between WT mice and Flg�/� mice (Figure 4A). However, following epicutaneous challenge assessed at 3 days post-infec-

tion, the previously observed difference of virulence between WT

and DarcA disappeared in the skin of Flg�/� mice, as verified at three different challenge inocula (Figure 4B). These results were

corroborated with similar histopathology of the skin lesions at

the 3-day post-infection time point (Figure 4C). The ArcA protein

is associated with the S. pyogenes bacterial cell surface

(Henningham et al., 2012). To confirm that S. pyogenes ex-

presses ArcA during infection on the skin surface, immunofluo-

rescence staining was performed at 24 h post-infection. Strong

signals for ArcA expression were seen only in the case of

S. pyogenes WT on the skin surface of WT mice (Figures 4D

and 4E). In Flg�/� mice, S. pyogenes did not appear to upregu- late ArcA for arginine catabolism to achieve infection.

S. pyogenes showed different expression levels of covS, arcA,

and slo genes on the skin surface 3 h after epicutaneous infection

in WT compared to Flg�/� mice (Figure S4). Because Flg�/�

mouse skin exhibits enhanced permeability of SC as compared

to WT mouse skin (Kawasaki et al., 2012), these transcriptional

differences might reflect differences of nutritional or stress

environments.

In intestinal epithelial cells, it is thought that caspase-1 contrib-

utes to both pyroptosis and apoptosis during an inflammation

(Lei-Leston et al., 2017). To investigate whether S. pyogenes

caused programmed cell death of skin epithelial cells, immunoflu-

orescence staining of caspase-1 was performed 24-h post-epicu-

taneous infection. We saw a marked decrease of caspase-1

expression in epithelial cells infected with the DarcA in only WT

mice (Figures 4F and 4G). S. pyogenes induces keratinocyte

apoptosis by SLO-mediated membrane damage (Cywes Bentley

et al., 2005). In S. pyogenes infection of HaCaT cells with CDM, an

increase in released lactate dehydrogenase (LDH) in culture

supernatants indicated that SLO contributed partially to argi-

nine-catabolism-dependent cytotoxicity (Figure S5A). Next, we

determined whether pyroptosis or apoptosis was induced in in-

fected epithelial cells by measuring interleukin-1b (IL-1b) release

and DNA fragmentation by TUNEL staining. Because it was diffi-

cult to discriminate between pro-IL-1b and mature IL-1b by ELISA,

we assessed signaling activity using HEK-Blue IL-1b reporter cells

for quantifying pyroptosis. The secretion of mature IL-1b from Ha-

CaT cells was enhanced in both WT and Dslo by arginine catabo-

lism (Figure S5B), with SLO partially contributing to the pyroptosis

phenotype, paralleling the cytolytic effect. On the other hand, in a

TUNEL assay designed to detect apoptotic cells, arginine-catab-

olism-dependent apoptosis was not observed (Figure S5C).

Taken together, S. pyogenes SLO contributes significantly to the

(D) Expression levels of bacterial virulence genes sagA, slo, and speB on the sk

examined by qPCR and shown relative to that of the WT strain. The 16S rRNA wa

each performed in triplicate, were pooled and normalized. Vertical lines represen

(E) Mouse model of intravenous infections. Mice were intravenously infected with

independent experiments.

(F) Bacterial survival in mouse blood. Bacteria were incubated in heparinized mo

calculated by dividing the CFU value after the period of incubation by the CFU va

one of three independent experiments. Vertical lines represent the mean + SE.

(G) The arcA expression of S. pyogenes WT in blood and on the skin surface. Da

box-whisker plot (n = 9). THY control, RNA samples from exponential phase of S

pyroptosis of HaCaT cells induced by arginine catabolism, and

there are other S. pyogenes factors that are likely involved in argi-

nine-catabolism-independent pyroptosis.

DISCUSSION

The S. pyogenes ADI pathway is controlled by virulence-related

metabolic regulators (Dmitriev et al., 2006; Shelburne et al.,

2010) and is highly expressed in vivo (Graham et al., 2006; Hirose

et al., 2019) and ex vivo (Graham et al., 2005; Shelburne et al.,

2005). Here, we show that the S. pyogenes ADI pathway influ-

ences virulence factor expression and contributes to keratino-

cyte cytotoxicity under low-glucose conditions in vitro and

subcutaneous infection in vivo. Our data support a model in

which S. pyogenes uses arginine abundant in filaggrin of the

SC, can secure nutrition, survive, and produce skin infection

associated with local tissue destruction.

We found that S. pyogenes can survive for more than 40 days

if it can maintain neutral pH by metabolizing arginine during the

stationary phase. This result is consistent with a previous report

that proved the long-term survival potential of S. pyogenes

in neutral pH (Savic and McShan, 2012). The ability of the

S. pyogenes ADI pathway to supplement energy production

and provide protection against acid stress might greatly

contribute to its viability in specialized environments such as

skin.

Comparative transcriptome analysis reveals arginine-catabo-

lism-dependent gene regulation under glucose-starvation con-

ditions. Upregulated genes in the WT strain include genes in

the pyrimidine biosynthesis pathway (pyrD, pyrE, and pyrF). In

S. pyogenes, the ADI pathway cooperates with the pyrimidine

biosynthesis pathway to acquire pyrimidine ribonucleotides

and ATP (Hirose et al., 2019). Conversely, genes encoding

F0F1-type ATP synthase were downregulated in the WT strain

compared to those in the DarcA mutant. Although it has been re-

ported that the generation of ATP by the ADI pathway and a func-

tional F0F1-type ATP synthase work in concert to adapt to acid

stress (Cusumano and Caparon, 2015), it is speculated that

S. pyogenes in CDM at neutral pH decreases the concomitant

hydrolysis of ATP to ADP to reduce ATP consumption. Genes

related to cell division (ftsH, ftsL, and ftsZ) were also downregu-

lated in WT S. pyogenes, which might prioritize the expression of

cytolytic virulence factors when there are not enough local nutri-

tion sources to proliferate.

ThedeletionofcovR inducestheupregulationofvirulencegenes

contained within the streptolysin S operon (sagABCDEFGHI) and

the nga-slo operon and also shows downregulation of a dipeptide

permease operon (dppABCDE) (Shelburne et al., 2010). These

in surface. The sagA, slo, and speB gene expression levels in the DarcA were

s used as the internal control. Data from three independent qRT-PCR assays,

t the mean + SE. **p < 0.01.

2 3 106 CFU of S. pyogenes (n = 8). Data are representative of at least three

use blood at 37�C for 1, 2, or 3 h in a 5% CO2 atmosphere. Survival rate was lue of the original inoculum. Values are presented as the mean of six wells from

ta obtained by combining three independent experiments are displayed with a

. pyogenes in THY medium. **p < 0.01.

Cell Reports 34, 108924, March 30, 2021 7

A

C

D

F

E

G

B

Figure 4. Arginine-catabolism-independent virulence of S. pyogenes on the skin surface of filaggrin knockout mice

(A) Skin phenotype and histology of both WT mice and Flg�/� mice. (B) CFUs in skin lesions at 3 days post-infection. Data shown represent the mean ± SE (n = 10–12). **p < 0.01.

(legend continued on next page)

8 Cell Reports 34, 108924, March 30, 2021

Report ll

OPEN ACCESS

Report ll

OPEN ACCESS

findings were mirrored in our results from RNA-seq analysis.

Although CovR phosphorylation enhances DNA binding of

CovR (Graham et al., 2002) and CovR affects the expression of

15%–20% of S. pyogenes genes (Horstmann et al., 2015),

S. pyogenes arginine catabolism did not significantly influence

CovR phosphorylation in our assay. Taken together, these results

suggest that the main mechanism of S. pyogenes pathogenicity

under glucose-depleted conditions may be dependent on

acquiring ATP by catabolism of arginine.

Although transcript levels of the ADI operon were reduced

in serotype M1 S. pyogenes (MGAS5005) after human blood

exposure, temporal and mild upregulation of ADI operon were

observed within 90 min of blood exposure (Graham et al.,

2005). These investigators also reported that the deletion of

the S. pyogenes covR regulator led to upregulation of the ADI

operon in blood. These results partly contrast with our data.

However, human blood is relatively poor in arginine but rich in

glucose (Canepa et al., 2002; Sylvestre et al., 2010). Therefore,

although CovRS might mediate some environmental signals in

the blood and upregulate ADI operon expression, we speculate

that arginine catabolism changes are not sufficient to drive path-

ogenesis of S. pyogenes in blood. In contrast, the DarcA mutant

showed lower virulence than the WT S. pyogenes strain in a

mouse soft-tissue infection model that was associated with

localized necrosis in adjacent muscle. This difference in patho-

genicity might be explained by high concentrations (approxi-

mately 1,000 mM) of arginine in muscle tissue (Canepa et al.,

2002).

In a murine model of epicutaneous infection and in our

RNA-seq analysis, S. pyogenes WT upregulated the arcA, slo,

and sagA genes. High expression levels of these genes were re-

ported in S. pyogenes isolated directly from mouse soft tissue

infection (Graham et al., 2006) and a mouse model of necrotizing

fasciitis (Hirose et al., 2019). Streptolysin S is involved in cellular

injury, phagocytic resistance, and virulence in murine subcu-

taneous infection models (Datta et al., 2005; Humar et al.,

2002). The upregulation of SLO has been correlated with a highly

virulent S. pyogenes phenotype (Zhu et al., 2015). Our finding

that ADI contributes to the expression of the sagA and slo genes

might be important information for mitigating the pathogenicity

of S. pyogenes.

The SC is the outermost layer of the epidermis and acts as the

first line of structural defense against pathogens and toxins. Fi-

laggrin, a major structural protein in the SC (Sandilands et al.,

2009), contributes to the mechanical strength and integrity of

the SC in vivo (Kawasaki et al., 2012), and filaggrin breakdown

products form natural moisturizing factors that are believed to

(C) Skin phenotype and histopathology at 3 days post-infection. Mice were epicu

infection sites were stained with H&E. Data shown are representative of at least

(D) Representative microscopic images of immunofluorescence staining of S. py

post-infection. Strong merge signals (yellow) were detected only in S. pyogenes

(E) Mean fluorescence intensity (MFI) of ArcA (minimum 10 bacteria per condition

was subtracted from each value. Data represent mean + SE. **p < 0.01.

(F) Representative microscopic images of immunofluorescence staining of S. pyo

infection. Weak signals of epithelial cells were shown only in DarcA-infected WT

(G) The percentage of caspase-1-positive cells in epidermis (minimum 20 cells

knockout mouse.

play a major role in SC hydration (Rawlings and Harding,

2004). Arginine is a major component of filaggrin-derived natural

moisturizing factors (Kubo et al., 2013). In our epicutaneous

infection model with Flg�/� mice, S. pyogenes might more easily penetrate to reach viable epidermal cells below the SC where-

upon cytotoxic factors can allow the pathogen to secure nutrition

from the viable host epidermal cells. Thus, DarcA could exert

pathogenesis by using ADI-independent mechanisms on the

skin surface of Flg�/� mice. The SC of skin is also rich in lipids, such as ceramides, choles-

terol, and free fatty acids (Elias and Schmuth, 2009), and bacte-

rial infection of the skin also activates the host immune response

(Cogen et al., 2008) and promotes acidic pH (Proksch, 2018). In

our results, there were certain differences between our in vitro

and in vivo findings that could not be explained based solely

on S. pyogenes ADI pathway activity. Further experiments will

be required to confirm whether other factors are involved in the

pathogenesis of S. pyogenes and reveal more details about in-

teractions between S. pyogenes and host skin tissue.

We revealed that S. pyogenes induced increased pyroptosis of

HaCaT cells in a manner dependent on arginine catabolism,

whereas almost no apoptosis was observed both dependently

and independently of arginine catabolism. However, Cywes

Bentley et al. (2005) reported that S. pyogenes SLO contributed

to keratinocyte apoptosis. This discrepancy may be due to the

difference of the keratinocyte cell line used or nutritional condi-

tions. Because SLO was not fully responsible for the observed

pyroptosis, further exploration will be needed to fully clarify the

arginine-catabolism-dependent pyroptosis-inducing factors of

S. pyogenes.

In summary, our findings suggest that S. pyogenes uses argi-

nine from SC-derived filaggrin to adapt to glucose starvation on

the skin surface. Despite the fact that arginine is a molecule that

contributes to natural moisturizing of the skin, it can be simulta-

neously exploited by S. pyogenes that may metabolize arginine

to promote its pathogenesis.

STAR+METHODS

Detailed methods are provided in the online version of this paper

and include the following:

d KEY RESOURCES TABLE

d RESOURCE AVAILABILITY

taneou

three se

ogenes

WT on

, n = 8)

genes (r

mice.

per con

B Lead contact

B Materials availability

B Data and code availability

sly infected with 2 3 107 CFU of S. pyogenes. Cutaneous tissues from

parate experiments.

(red) and arginine deiminase, ArcA (green), on the skin surface at 24 h

the skin surface of WT mice.

. MFI was quantified using ImageJ. Average background fluorescence

ed) on the skin surface and caspase-1 (green) in epidermis at 24 h post-

dition, n = 8). Data represent mean + SE. **p < 0.01. Flg�/�, filaggrin

Cell Reports 34, 108924, March 30, 2021 9

Report ll

OPEN ACCESS

d EXPERIMENTAL MODEL AND SUBJECT DETAILS

B Bacterial strains and culture conditions

B Construction of mutant strains

B Cell culture and media

B Murine model of epicutaneous and intravenous infec-

tions

B Mouse model of S. pyogenes necrotizing skin infection

B Mouse model of intraperitoneal infection

B Streptozotocin-induced diabetic mice

d METHOD DETAILS

B Quantitative real-time PCR (qPCR)

B Measurement of glucose and ammonium ion concen-

trations

B Measurement of extracellular pH

B Measurement of intracellular pH

B Infection of HaCaT cells with S. pyogenes

B Cytotoxicity assays

B Measurement of intracellular ATP levels

B RNA-seq and data analysis

B Phos-tag western blotting for the detection of phos-

phorylated CovR

B Detection of glucose concentration on the skin

B Blood bactericidal assay

B Immunofluorescence staining

B IL-1b signaling assay

B Apoptosis determination by Terminal transferase de-

oxytidyl uridine end labeling (TUNEL) staining

d QUANTIFICATION AND STATISTICAL ANALYSIS

SUPPLEMENTAL INFORMATION

Supplemental information can be found online at https://doi.org/10.1016/j.

celrep.2021.108924.

ACKNOWLEDGMENTS

We express our appreciation to Dr. T. Sekizaki and Dr. D. Takamatsu for

providing the pSET4s plasmid, Dr. Riestra for providing IL-1b reporter cells,

and Dr. Choi for providing HaCaT cells. We also thank Dr. Y. Nakamura,

Dr. J. Hisatsune, and Dr. N. Takemoto for the advice on the experimental pro-

cedure and technique. We acknowledge the NGS core facility of the Genome

Information Research Center at the Research Institute for Microbial Diseases

of Osaka University for their support with RNA sequencing and data

analysis. This study was supported in part by AMED (JP19fk0108044,

JP19fm0208007, and JP20fk0108130); Japanese Society for the Promotion

of Science (JSPS) KAKENHI (grant numbers 16K15787, 19H03825,

19K22710, and 20K18474); JSPS Overseas Research Fellowships; Takeda

Science Foundation; Japanese Association for Oral Biology Grant in Aid for

Young Scientists; Secom Science and Technology Foundation; The Naito

Foundation; and Kobayashi International Scholarship Foundation. The funders

had no role in study design, data collection or analysis, decision to publish, or

preparation of the manuscript.

AUTHOR CONTRIBUTIONS

Conceptualization, Y.H., M.Y., and S.K.; methodology, Y.H., M.Y., T.S., M.N.,

Y.M., H.K., S.U., M.H., and M.A.; software, D.O. and D.M.; investigation,

Y.H., A.C., and R.H.Z.; formal analysis, Y.H. and T.H.; data curation, Y.H.;

supervision, M.Y., V.N., and S.K.; visualization, T.H., D.O., and D.M.; funding

acquisition, Y.H., M.Y., V.N., and S.K.; writing - original draft, Y.H.; writing -

review & editing, M.Y., T.S., M.N., V.N., and S.K.; project administration, V.N.

and S.K.

10 Cell Reports 34, 108924, March 30, 2021

DECLARATION OF INTERESTS

The authors declare no conflict of interest.

Received: June 17, 2020

Revised: January 15, 2021

Accepted: March 9, 2021

Published: March 30, 2021

REFERENCES

Abdelal, A.T. (1979). Arginine catabolism by microorganisms. Annu. Rev. Mi-

crobiol. 33, 139–168.

Boukamp, P., Petrussevska, R.T., Breitkreutz, D., Hornung, J., Markham, A.,

and Fusenig, N.E. (1988). Normal keratinization in a spontaneously immortal-

ized aneuploid human keratinocyte cell line. J. Cell Biol. 106, 761–771.

Canepa, A., Filho, J.C., Gutierrez, A., Carrea, A., Forsberg, A.M., Nilsson, E.,

Verrina, E., Perfumo, F., and Bergström, J. (2002). Free amino acids in plasma,

red blood cells, polymorphonuclear leukocytes, and muscle in normal and

uraemic children. Nephrol. Dial. Transplant. 17, 413–421.

Chatellier, S., Ihendyane, N., Kansal, R.G., Khambaty, F., Basma, H., Norrby-

Teglund, A., Low, D.E., McGeer, A., and Kotb, M. (2000). Genetic relatedness

and superantigen expression in group A Streptococcus serotype M1 isolates

from patients with severe and nonsevere invasive diseases. Infect. Immun.

68, 3523–3534.

Cogen, A.L., Nizet, V., and Gallo, R.L. (2008). Skin microbiota: a source of dis-

ease or defence? Br. J. Dermatol. 158, 442–455.

Cotter, P.D., and Hill, C. (2003). Surviving the acid test: responses of gram-

positive bacteria to low pH. Microbiol. Mol. Biol. Rev. 67, 429–453.

Cunningham, M.W. (2000). Pathogenesis of group A streptococcal infections.

Clin. Microbiol. Rev. 13, 470–511.

Cusumano, Z.T., and Caparon, M.G. (2015). Citrulline protects Streptococcus

pyogenes from acid stress using the arginine deiminase pathway and the

F1Fo-ATPase. J. Bacteriol. 197, 1288–1296.

Cusumano, Z.T., Watson, M.E., Jr., and Caparon, M.G. (2014). Streptococcus

pyogenes arginine and citrulline catabolism promotes infection and modulates

innate immunity. Infect. Immun. 82, 233–242.

Cywes Bentley, C., Hakansson, A., Christianson, J., and Wessels, M.R. (2005).

Extracellular group A Streptococcus induces keratinocyte apoptosis by dysre-

gulating calcium signalling. Cell. Microbiol. 7, 945–955.

Dalton, T.L., and Scott, J.R. (2004). CovS inactivates CovR and is required for

growth under conditions of general stress in Streptococcus pyogenes.

J. Bacteriol. 186, 3928–3937.

Dashper, S.G., and Reynolds, E.C. (2000). Effects of organic acid anions on growth,

glycolysis, and intracellular pH of oral streptococci. J. Dent. Res. 79, 90–96.

Datta, V., Myskowski, S.M., Kwinn, L.A., Chiem, D.N., Varki, N., Kansal, R.G.,

Kotb, M., and Nizet, V. (2005). Mutational analysis of the group A streptococcal

operon encoding streptolysin S and its virulence role in invasive infection. Mol.

Microbiol. 56, 681–695.

Dmitriev, A.V., McDowell, E.J., Kappeler, K.V., Chaussee, M.A., Rieck, L.D., and

Chaussee, M.S. (2006). The Rgg regulator of Streptococcus pyogenes influences

utilization of nonglucose carbohydrates, prophage induction, and expression of

the NAD-glycohydrolase virulence operon. J. Bacteriol. 188, 7230–7241.

Do, H., Makthal, N., VanderWal, A.R., Saavedra, M.O., Olsen, R.J., Musser,

J.M., and Kumaraswami, M. (2019). Environmental pH and peptide signaling

control virulence of Streptococcus pyogenes via a quorum-sensing pathway.

Nat. Commun. 10, 2586.

Elias, P.M., and Schmuth, M. (2009). Abnormal skin barrier in the etiopatho-

genesis of atopic dermatitis. Curr. Allergy Asthma Rep. 9, 265–272.

Falugi, F., Zingaretti, C., Pinto, V., Mariani, M., Amodeo, L., Manetti, A.G.,

Capo, S., Musser, J.M., Orefici, G., Margarit, I., et al. (2008). Sequence varia-

tion in group A Streptococcus pili and association of pilus backbone types with

lancefield T serotypes. J. Infect. Dis. 198, 1834–1841.

Report ll

OPEN ACCESS

Ge, S.X., Son, E.W., and Yao, R. (2018). iDEP: an integrated web application

for differential expression and pathway analysis of RNA-Seq data. BMC Bioin-

formatics 19, 534.

Graham, M.R., Smoot, L.M., Migliaccio, C.A., Virtaneva, K., Sturdevant, D.E.,

Porcella, S.F., Federle, M.J., Adams, G.J., Scott, J.R., and Musser, J.M.

(2002). Virulence control in group A Streptococcus by a two-component

gene regulatory system: global expression profiling and in vivo infection

modeling. Proc. Natl. Acad. Sci. USA 99, 13855–13860.

Graham, M.R., Virtaneva, K., Porcella, S.F., Barry, W.T., Gowen, B.B., John-

son, C.R., Wright, F.A., and Musser, J.M. (2005). Group A Streptococcus tran-

scriptome dynamics during growth in human blood reveals bacterial adaptive

and survival strategies. Am. J. Pathol. 166, 455–465.

Graham, M.R., Virtaneva, K., Porcella, S.F., Gardner, D.J., Long, R.D., Welty,

D.M., Barry, W.T., Johnson, C.A., Parkins, L.D., Wright, F.A., and Musser, J.M.

(2006). Analysis of the transcriptome of group A Streptococcus in mouse soft

tissue infection. Am. J. Pathol. 169, 927–942.

Henningham, A., Chiarot, E., Gillen, C.M., Cole, J.N., Rohde, M., Fulde, M.,

Ramachandran, V., Cork, A.J., Hartas, J., Magor, G., et al. (2012). Conserved

anchorless surface proteins as group A streptococcal vaccine candidates.

J. Mol. Med. (Berl.) 90, 1197–1207.

Hirose, Y., Yamaguchi, M., Okuzaki, D., Motooka, D., Hamamoto, H., Hanada,

T., Sumitomo, T., Nakata, M., and Kawabata, S. (2019). Streptococcus pyo-

genes Transcriptome Changes in the Inflammatory Environment of Necrotizing

Fasciitis. Appl. Environ. Microbiol. 85, e01428-19.

Horstmann, N., Sahasrabhojane, P., Saldaña, M., Ajami, N.J., Flores, A.R., Sumby,

P., Liu, C.G., Yao, H., Su, X., Thompson, E., and Shelburne, S.A. (2015). Charac-

terization of the effect of the histidine kinase CovS on response regulator phos-

phorylation in group A Streptococcus. Infect. Immun. 83, 1068–1077.

Hoste, E., Kemperman, P., Devos, M., Denecker, G., Kezic, S., Yau, N., Gilbert,

B., Lippens, S., De Groote, P., Roelandt, R., et al. (2011). Caspase-14 is

required for filaggrin degradation to natural moisturizing factors in the skin.

J. Invest. Dermatol. 131, 2233–2241.

Humar, D., Datta, V., Bast, D.J., Beall, B., De Azavedo, J.C., and Nizet, V.

(2002). Streptolysin S and necrotising infections produced by group G strepto-

coccus. Lancet 359, 124–129.

Kansal, R.G., McGeer, A., Low, D.E., Norrby-Teglund, A., and Kotb, M. (2000).

Inverse relation between disease severity and expression of the streptococcal

cysteine protease, SpeB, among clonal M1T1 isolates recovered from invasive

group A streptococcal infection cases. Infect. Immun. 68, 6362–6369.

Kawasaki, H., Nagao, K., Kubo, A., Hata, T., Shimizu, A., Mizuno, H., Yamada,

T., and Amagai, M. (2012). Altered stratum corneum barrier and enhanced

percutaneous immune responses in filaggrin-null mice. J. Allergy Clin. Immu-

nol. 129, 1538, 46.e6.

Kubo, A., Ishizaki, I., Kubo, A., Kawasaki, H., Nagao, K., Ohashi, Y., and Ama-

gai, M. (2013). The stratum corneum comprises three layers with distinct

metal-ion barrier properties. Sci. Rep. 3, 1731.

Lei-Leston, A.C., Murphy, A.G., and Maloy, K.J. (2017). Epithelial Cell Inflam-

masomes in Intestinal Immunity and Inflammation. Front. Immunol. 8, 1168.

Lin, J.N., Chang, L.L., Lai, C.H., Lin, H.H., and Chen, Y.H. (2011). Clinical and

molecular characteristics of invasive and noninvasive skin and soft tissue in-

fections caused by group A Streptococcus. J. Clin. Microbiol. 49, 3632–3637.

Lynskey, N.N., Jauneikaite, E., Li, H.K., Zhi, X., Turner, C.E., Mosavie, M.,

Pearson, M., Asai, M., Lobkowicz, L., Chow, J.Y., et al. (2019). Emergence

of dominant toxigenic M1T1 Streptococcus pyogenes clone during increased

scarlet fever activity in England: a population-based molecular epidemiolog-

ical study. Lancet Infect. Dis. 19, 1209–1218.

Metsalu, T., and Vilo, J. (2015). ClustVis: a web tool for visualizing clustering of

multivariate data using Principal Component Analysis and heatmap. Nucleic

Acids Res. 43, W566–W570.

Nakamura, Y., Oscherwitz, J., Cease, K.B., Chan, S.M., Muñoz-Planillo, R.,

Hasegawa, M., Villaruz, A.E., Cheung, G.Y., McGavin, M.J., Travers, J.B.,

et al. (2013). Staphylococcus d-toxin induces allergic skin disease by activating

mast cells. Nature 503, 397–401.

Nakata, M., Kimura, K.R., Sumitomo, T., Wada, S., Sugauchi, A., Oiki, E., Hi-

gashino, M., Kreikemeyer, B., Podbielski, A., Okahashi, N., et al. (2011). As-

sembly mechanism of FCT region type 1 pili in serotype M6 Streptococcus

pyogenes. J. Biol. Chem. 286, 37566–37577.

Nizet, V., Ohtake, T., Lauth, X., Trowbridge, J., Rudisill, J., Dorschner, R.A.,

Pestonjamasp, V., Piraino, J., Huttner, K., and Gallo, R.L. (2001). Innate antimi-

crobial peptide protects the skin from invasive bacterial infection. Nature 414,

454–457.

Patras, K.A., Coady, A., Babu, P., Shing, S.R., Ha, A.D., Rooholfada, E.,

Brandt, S.L., Geriak, M., Gallo, R.L., and Nizet, V. (2020). Host Cathelicidin

Exacerbates Group B Streptococcus Urinary Tract Infection. MSphere 5,

e00932-19.

Proksch, E. (2018). pH in nature, humans and skin. J. Dermatol. 45, 1044–

1052.

Rawlings, A.V., and Harding, C.R. (2004). Moisturization and skin barrier func-

tion. Dermatol. Ther. 17, 43–48.

Sandilands, A., Sutherland, C., Irvine, A.D., and McLean, W.H. (2009). Filaggrin

in the frontline: role in skin barrier function and disease. J. Cell Sci. 122, 1285–

1294.

Savic, D.J., and McShan, W.M. (2012). Long-term survival of Streptococcus

pyogenes in rich media is pH-dependent. Microbiology (Reading) 158, 1428–

1436.

Shelburne, S.A., III, Sumby, P., Sitkiewicz, I., Granville, C., DeLeo, F.R., and

Musser, J.M. (2005). Central role of a bacterial two-component gene regulato-

ry system of previously unknown function in pathogen persistence in human

saliva. Proc. Natl. Acad. Sci. USA 102, 16037–16042.

Shelburne, S.A., III, Keith, D., Horstmann, N., Sumby, P., Davenport, M.T.,

Graviss, E.A., Brennan, R.G., and Musser, J.M. (2008). A direct link between

carbohydrate utilization and virulence in the major human pathogen group A

Streptococcus. Proc. Natl. Acad. Sci. USA 105, 1698–1703.

Shelburne, S.A., Olsen, R.J., Suber, B., Sahasrabhojane, P., Sumby, P.,

Brennan, R.G., and Musser, J.M. (2010). A combination of independent tran-

scriptional regulators shapes bacterial virulence gene expression during infec-

tion. PLoS Pathog. 6, e1000817.

Sumitomo, T., Mori, Y., Nakamura, Y., Honda-Ogawa, M., Nakagawa, S., Ya-

maguchi, M., Matsue, H., Terao, Y., Nakata, M., and Kawabata, S. (2018).

Streptococcal Cysteine Protease-Mediated Cleavage of Desmogleins Is

Involved in the Pathogenesis of Cutaneous Infection. Front. Cell. Infect. Micro-

biol. 8, 10.

Sylvestre, J.P., Bouissou, C.C., Guy, R.H., and Delgado-Charro, M.B. (2010).

Extraction and quantification of amino acids in human stratum corneum in vivo.

Br. J. Dermatol. 163, 458–465.

Takamatsu, D., Osaki, M., and Sekizaki, T. (2001). Thermosensitive suicide

vectors for gene replacement in Streptococcus suis. Plasmid 46, 140–148.

Valdes, K.M., Sundar, G.S., Vega, L.A., Belew, A.T., Islam, E., Binet, R., El-

Sayed, N.M., Le Breton, Y., and McIver, K.S. (2016). The fruRBA Operon Is

Necessary for Group A Streptococcal Growth in Fructose and for Resistance

to Neutrophil Killing during Growth in Whole Human Blood. Infect. Immun. 84,

1016–1031.

Walker, M.J., Barnett, T.C., McArthur, J.D., Cole, J.N., Gillen, C.M., Henning-

ham, A., Sriprakash, K.S., Sanderson-Smith, M.L., and Nizet, V. (2014). Dis-

ease manifestations and pathogenic mechanisms of Group A Streptococcus.

Clin. Microbiol. Rev. 27, 264–301.

Wattam, A.R., Davis, J.J., Assaf, R., Boisvert, S., Brettin, T., Bun, C., Conrad,

N., Dietrich, E.M., Disz, T., Gabbard, J.L., et al. (2017). Improvements to PAT-

RIC, the all-bacterial Bioinformatics Database and Analysis Resource Center.

Nucleic Acids Res. 45, D535–D542.

Zhu, L., Olsen, R.J., Nasser, W., Beres, S.B., Vuopio, J., Kristinsson, K.G.,

Gottfredsson, M., Porter, A.R., DeLeo, F.R., and Musser, J.M. (2015). A molec-

ular trigger for intercontinental epidemics of group A Streptococcus. J. Clin.

Invest. 125, 3545–3559.

Cell Reports 34, 108924, March 30, 2021 11

Report ll

OPEN ACCESS

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies

Donkey anti-Goat IgG Alexa Fluor 594 Thermo Fisher Scientific Cat# A32758, RRID:AB_2762828

Donkey anti-Rabbit IgG H&L Alexa Fluor 488 Abcam Cat# ab150065, RRID:AB_2860569

Goat polyclonal anti-S. pyogenes carbohydrate Abcam Cat# ab9191, RRID:AB_307061

Rabbit polyclonal anti-caspase-1 GeneTex Cat# GTX14368

Bacterial and virus strains

Streptococcus pyogenes M1T1 strain 5448 Kansal et al., 2000 GenBank: CP008776

XL-10 Gold Agilent Technologies Cat# 200314

Chemicals, peptides, and recombinant proteins

Carboxyfluorescein diacetate succinimidyl ester Invitrogen Cat# C1157

Mutanolysin Sigma Aldrich Cat# M9901

Staurosporine Sigma Aldrich Cat# S6942

Streptozotocin Adipogen Cat# 50-464-382

Critical commercial assays

ATP-bioluminescent assay Kinshiro TOYO B-Net Cat# LL100-1

Click-iT Plus TUNEL Assay Kit (Alexa Fluor 488) Thermo Fisher Scientific Cat# C10617

Glucose Colorimetric Assay Kit II Biovision Cat# K686

LIVE/DEAD Viability/Cytotoxicity Kit Thermo Fisher Scientific Cat# L3224

Deposited data

Raw data files for RNA-sequencing DDBJ SRA SRA: DRA009112

Experimental models: Cell lines

HEK-Blue IL-1b reporter cells InvivoGen Cat# hkb-il1bv2

Human: HaCaT cells (Boukamp et al., 1988) Human: HaCaT cells

Experimental models: Organisms/strains

Filaggrin-null mouse strain (B6.Cg-Flg < tm1 > ) RIKEN BRC RBRC05850

Oligonucleotides

See Table S2 N/A

Recombinant DNA

Plasmid: pSET4-ArcAKO This paper N/A

Plasmid: pSET4-50Flag-CovR This paper N/A

Plasmid: pQE30_arcA This paper N/A

Software and algorithms

CLC Genomics workbench v. 9.5.2 Software https://digitalinsights.qiagen.com/ja/

qiagen-clc-genomics-workbench/

ClustVis Software https://biit.cs.ut.ee/clustvis/

GraphPad Prism7 Software https://www.graphpad.com/scientific-

software/prism/

iDEP.91 Software http://bioinformatics.sdstate.edu/idep/

ImageJ Software https://imagej.nih.gov/ij/

ImageQuant software Software http://www.cytivalifesciences.com/en/us/

shop/protein-analysis/molecular-imaging-

for-proteins/imaging-software/imagequant-

tl-8-1-p-00110

(Continued on next page)

e1 Cell Reports 34, 108924, March 30, 2021

Continued

REAGENT or RESOURCE SOURCE IDENTIFIER

Other

AimStrip Plus blood glucose meter kit Germaine Labs Cat# 37355

Citrate buffer Bioworld Cat# 40320056-2

cOmplete, EDTA (+) Protease Inhibitor Cocktail Roche Molecular Diagnostic Cat# 11697498001

Lysing Matrix B Qbiogene Cat# FAS-210

Lysing Matrix D Qbiogene Cat# FAS-220

Nunc Lab-Tek II Chamber Slide System Thermo Fisher Scientific Cat# 154534

Phenol red broth Sigma Aldrich Cat# P8976

Phos-tag SuperSep Phos-tag Gels Wako Pure Chemical Industries Cat# 195-17991

PhosSTOP Roche Molecular Diagnostic Cat# 4906845001

Quanti-Blue reagent Invivogen Cat# rep-qbs

RNAprotect Animal Blood Tubes QIAGEN Cat# 76544

RNAprotect Bacteria Reagent QIAGEN Cat# 76506

RNeasy Mini Kit QIAGEN Cat# 74104

rRNA removal using a Ribo-Zero rRNA removal kit Illumina Inc Cat# 20040525

Superscript VILO cDNA synthesis kit Thermo Fisher Scientific Cat# 11756050

SYBR green RT-PCR master mix kit Toyobo Cat# QPK-201

Todd-Hewitt broth BD Biosciences Cat# 249240

TruSeq RNA Sample Prep kit, v2 Illumina Inc Cat# RS-122

Yeast extract BD Biosciences Cat# 212750

Report ll

OPEN ACCESS

RESOURCE AVAILABILITY

Lead contact Further information and requests for reagents may be directed to, and will be fulfilled by the corresponding author Yujiro Hirose

([email protected]).

Materials availability This study did not generate new unique reagents.

Data and code availability The accession number for the bacterial RNA-seq reads reported in this paper is SRA: DRA009112 .

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Bacterial strains and culture conditions Streptococcus pyogenes M1T1 strain 5448 (GenBank: CP008776.1) was isolated from a patient with toxic shock syndrome and

necrotizing fasciitis that is genetically representative of a globally disseminated clone associated with invasive S. pyogenes infections

(Kansal et al., 2000). S. pyogenes strains were grown at 37�C in a screw-cap glass tube (Pyrex; Iwaki Glass, Tokyo, Japan) filled with Todd-Hewitt broth (BD Biosciences, San Jose, CA, USA) supplemented with 0.2% yeast extract (BD Bioscience) (THY broth) in an

ambient atmosphere and standing cultures. To obtain cultures for experiments and observe pH change, overnight cultures of

S.pyogenes were back diluted 1:50 into fresh THY broth or phenol red broth (Sigma Aldrich, St Louis, MO, USA) supplemented

with 30 mM arginine. CFUs were determined by plating diluted samples on THY blood agar.

Escherichia coli strain XL-10 Gold (Agilent Technologies, Santa Clara, CA, USA) was used as a host for derivatives of plasmids

pSET4s (Takamatsu et al., 2001) and pQE30 (QIAGEN, Hilden, Germany). E. coli strains were cultured in Luria-Bertani medium

(Nacalai Tesque, Kyoto, Japan) at 37�C with agitation. For selection and maintenance of strains, antibiotics were added to the me- dium at the following concentrations: spectinomycin, 100 mg/mL for S. pyogenes and E. coli: carbenicillin, 100 mg/mL for E. coli.

Construction of mutant strains An in-frame arcA deletion mutant (DarcA) and its revertant strain (Wr) with a background of strain 5448 (WT) were constructed using

the pSET4s temperature-sensitive shuttle vector, as previously reported (Nakata et al., 2011). A pSET4-ArcAKO plasmid harboring

the DNA fragment, in which upstream and downstream regions of arcA were linked by overlapping PCR, was electroporated into

Cell Reports 34, 108924, March 30, 2021 e2

Report ll

OPEN ACCESS

strain 5448 and grown in the presence of spectinomycin. The plasmid was then integrated into the chromosome via first allelic

replacement at 37�C, after which it was cultured at 28�C without antibiotics to induce the second allelic replacement. The deletion of arcA was confirmed by site-specific PCR using purified genomic DNA. Primers are listed in Table S2.

Cell culture and media We used the immortal human keratinocyte line, HaCaT cells. HaCaT cells were cultured in Dulbecco’s Modified Eagle Media (DMEM,

Cat#: 10-013-CV, Corning, NY, USA), with 10% Fetal Bovine Serum (Cat# 97068-085, VWR International LLC, Radnor, USA). The cell

culture was maintained in a humidified 5% CO2 atmosphere at 37 �C. The cells were cultured to around 70% confluence. To subcul-

ture cells, adherent cells were rinsed with PBS without calcium and magnesium, and detached by using trypsin/EDTA solution

(0.05% trypsin, 0.53 m EDTA) for ~10 min, added fresh culture medium, centrifuged, resuspended cells in fresh culture medium,

and dispensed into new culture vessels. For all experiments, freshly trypsinized cells were seeded at a density of ~1 3 105cells/

cm2 one day prior to bacterial infection.

Murine model of epicutaneous and intravenous infections All mouse experiments were conducted in accordance with animal protocols approved by the Animal Care and Use Committee of

Osaka University Graduate School of Dentistry (30-011-0) and University of California San Diego Institutional Animal Care and

Use Committee (IACUC). The filaggrin null mouse strain (B6.Cg-Flg < tm1 > , RBRC05850) was provided by RIKEN BRC through

the National Bio-Resource Project of the MEXT, Japan.

Epicutaneousinfectionswereperformed usingapreviouslyreportedwithminormodifications(Nakamuraetal.,2013;Sumitomoetal.,

2018). Briefly, bacterial cultures during exponential phase were centrifuged, washed with and resuspended in PBS. Dorsal skin of

C57BL/6 wild-type (wt) mice (6- to 7-week-old, both female and male; Japan SLC, Shizuoka, Japan) and the filaggrin null (Flg�/�) mice (Kawasaki et al., 2012) (6- to 7-week-old, both female and male) was depilated 2 days before infection. A bacterial suspension

(5 3 105-107 CFU in 100 mL PBS) was placed on a 1 3 1 cm patch of sterile gauze, which is secured to the shaved skin with a transparent

bio-occlusive dressing. At 3 hours post-infection, bacteria on the skin surface were collected by using a stainless dental scaler, then

bacterial RNA was extracted and quantified by qPCR as described above. At 3 days post-infection, cutaneous tissue was excised

for histopathologic analyses and assessment of bacterial burden. Cutaneous tissue samples were obtained and fixed with formalin,

then embedded in paraffin, sectioned, and subjected to hematoxylin and eosin (HE) staining. Bacterial counts in cutaneous tissue ho-

mogenates were determined after plating serial dilutions, with those in the cutaneous tissue corrected for differences in tissue weight.

For intravenous infection, C57BL/6 wild-type mice (6- to 7-week-old, both female and male; Japan SLC) were intravenously in-

fected with 2 3 106 CFU of S. pyogenes during exponential phase, and survival was monitored for 14 days.

Mouse model of S. pyogenes necrotizing skin infection Invasiveness of S. pyogenes in mouse skin was measured by modification of a previously described S. pyogenes infection model

(Nizet et al., 2001). All mouse experiments were conducted in accordance with animal protocols approved by the Animal Care

and Use Committee of Osaka University Graduate School of Dentistry (30-011-0). The CD-1 (Slc: ICR) mice (6 weeks old, female;

Japan SLC, Shizuoka, Japan) were shaved and hair removed by chemical depilation (Veet, Oxy Reckit Benckiser, Chartes, France).

S. pyogenes were cultured until the log phase (OD600 = 0.5~0.6), and adjusted 1 3 10 7 CFU in 200 mL of PBS were injected subcu-

taneously. Areas with ulcer were defined as lesions and areas were measured daily for up to 3 days after infection.

Mouse model of intraperitoneal infection Intraperitoneal infections were performed using a previously reported method with minor modifications (Valdes et al., 2016). C57BL/6

wild-type (wt) mice (6- to 7-week-old, both female and male; Japan SLC, Shizuoka, Japan) and the filaggrin null (Flg�/�) mice (Kawasaki et al., 2012) (6- to 7-week-old, both female and male) were intraperitoneally injected with 2.5 3 108 CFU in 100 mL of

PBS. Mouse survival was monitored for 14 days.

Streptozotocin-induced diabetic mice To induce diabetes mellitus, C57BL/6 male mice (4-week-old) were injected i.p. with streptozotocin (Adipogen, San Diego, CA, USA)

at 80 mg/kg/dose in 200 mL of 0.1 M citrate buffer daily for 4 days (Patras et al., 2020). Control mice received 4 daily treatments of

200 mL of 0.1 M citrate buffer. Mice were weighed weekly thereafter. The concentration of blood glucose in 7-week-old mice was

determined 24 h prior to infection. Sample glucose was determined using an AimStrip Plus blood glucose meter kit (Germaine

Labs, Indianapolis, IN, USA).

METHOD DETAILS

Quantitative real-time PCR (qPCR) Bacterial cultures during exponential phase (OD600 = 0.5-0.6), early stationary phase (OD600 = 1.2), or decline phase (overnight

culture) were centrifuged and immediately placed into RNAprotect Bacteria Reagent (QIAGEN) prior to RNA isolation. In the RNA

isolation from S. pyogenes cultured within CDM, bacterial cultures during exponential phase (OD600 = 0.5-0.6) were centrifuged,

e3 Cell Reports 34, 108924, March 30, 2021

Report ll

OPEN ACCESS

resuspended into CDM, incubated in a screw cap glass tube (Pyrex; Iwaki Glass, Tokyo, Japan) for 1 h at 37�C, and immediately placed into RNAprotect Bacteria Reagent. S. pyogenes was resuspended into lysing Matrix B microtubes containing 0.1-mm silica

spheres (Qbiogene, Carlsbad, CA, USA) with RLT lysis buffer (RNeasy Mini Kit; QIAGEN), and homogenized at 6,500 rpm for 60 s

using the MagNA Lyser (Roche Molecular Diagnostic, Mannheim, Germany). RNA was isolated from the lysate with RNeasy Mini

Kit according to the manufacturer’s guidelines, and then cDNA was synthesized using a Superscript VILO cDNA synthesis kit

(Thermo Fisher Scientific, Waltham, MA, USA). Real-time reverse transcription PCR analysis was performed using a StepOnePlus

real-time PCR system (Applied Biosystems, Foster City, CA, USA) and Toyobo SYBR green RT-PCR master mix kit (Toyobo Life Sci-

ence, Osaka, Japan). Data for 16S rRNA or rpoB were used as the internal control. Primers used for qPCR are listed in Table S2.

Measurement of glucose and ammonium ion concentrations Culture supernatant at each growth phase obtained from S. pyogenes WT and DarcA cultured in THY broth was filtered through a

0.22 mm membrane, then and directly analyzed with BioProfile� FLEX2 analyzer following manufacturer’s instruction (Nova Biomed- ical, Inc., Waltham, MA, USA).

Measurement of extracellular pH For phenol red broth (Sigma Aldrich, St Louis, MO, USA) supplemented with 30 mM arginine, culture supernatant at each point was

measured the absorbance at 550 nm. A calibration curve was determined in phenol red broth which adjusted to pH values ranging

from 4 to 10. The pH values were assessed up to 40 days in the sample which included surviving bacteria. For THY broth, culture

supernatant at each point was supplemented with 5 mg/mL phenol red and the absorbance was measured at 550 nm. A

calibration curve was determined in THY broth which was supplemented with 5 mg/mL phenol red and adjusted to pH values ranging

from 4 to 10.

Measurement of intracellular pH The cytosolic pH of S. pyogenes was determined based on the previously described fluorescent probe method (Do et al., 2019).

Briefly, S. pyogenes grown to log phase of growth in THY broth were centrifugated, washed in 150 mM NaCl, and resuspended in

50 mM HEPES buffer (pH 8.0). The cells were then incubated for 20 min at 37 �C in the presence of 10 mM carboxyfluorescein diac- etate succinimidyl ester (cFDASE, Invitrogen, Grand Island, NY, USA). cFDASE is hydrolyzed to carboxyfluorescein succinimidyl

ester (cFSE) in the cell and subsequently conjugated to aliphatic amines of the intracellular proteins. After incubation, cells were

washed and suspended in 50 mM potassium phosphate buffer (pH 7.5). To eliminate nonconjugated cFSE, cells were incubated

with 10 mM glucose for 30 min at 30 �C. Subsequently, S. pyogenes were washed, and suspended, and incubated in CDM at 37�C within a screw-cap glass tube. At 1 h, 5 h, and 15 h post-incubation, fluorescence intensities were determined with an excitation spectrum of 400-500 nm wavelength range that includes excitation wavelengths 490 nm (pH-sensitive) and 435 nm (pH-insensitive)

(Spark 10M; TEKAN, Männedorf, Switzerland). Emission was determined at 520 nm. The ratio of the emission resulting from

excitation at 490 and 435 nm obtained for both cell suspension (C) and filtrate (F) was calculated as R 490/435 = (C490 - F490)/

(C 435 - F435). A calibration curve was determined in CDM adjusted to pH values ranging from 5.5 to 8.0 and a cubic equation

for the ratio value was determined. Intracellular pH values of S. pyogenes were calculated using the cubic equation from the calibra-

tion curve.

Infection of HaCaT cells with S. pyogenes The composition of Chemically Defined Medium (CDM) is shown in Table S1. S. pyogenes in log phase growth in THY broth

were centrifuged and resuspended into CDM supplemented with or without 1000 mM arginine. HaCaT cells were infected with

S. pyogenes (MOI = 500). At 20 h post-incubation, supernatants were collected by centrifugation and analyzed for cytotoxicity

assays, IL-1b signaling assay, and cells were used for the apoptosis determination.

Cytotoxicity assays Cell viability was assessed using the LIVE/DEAD� Viability/Cytotoxicity Kit (Thermo Fisher Scientific). LDH activity in the culture su- pernatant was measured by using LDH Assay Kit-WST (Dojindo, Kumamoto, Japan). At 1 h, 5 h, and 15 h post-infection, the bacterial

count in CDM with cultured HaCaT cells was evaluated by combining CFUs from supernatant and those from associated with HaCaT

cells. To determine bacterial association, HaCaT cells were harvested with PBS containing 0.05% trypsin and 0.025% Triton X-100.

Measurement of intracellular ATP levels At 1 h, 5 h, and 15 h post-incubation in CDM, the intracellular ATP levels of S. pyogenes were also evaluated by an ATP-biolumines-

cent assay using Kinshiro (TOYO B-Net, Tokyo, Japan) according to manufacturer’s instructions. Briefly, ATP extractant solution was

added to equal amount of the mixture of CDM and S. pyogenes. After the incubation for 10 s at room temperature, 100 mL samples

were mixed with equal amount of bioluminescent reagent, and bioluminescence was measured with a luminometer (Infinite 200 Pro

multiplate reader, TEKAN, Männedorf, Switzerland), immediately. After establishing of the calibration curve, the ATP concentrations

in the samples were determined, and the percentage of ATP levels for S. pyogenes at 0 h post-incubation was calculated.

Cell Reports 34, 108924, March 30, 2021 e4

Report ll

OPEN ACCESS

RNA-seq and data analysis Bacterial cultures during exponential phase were centrifuged, resuspended into CDM, and incubated in a screw-cap glass tube

(Pyrex; Iwaki Glass, Tokyo, Japan) for 1 h at 37�C. RNA samples of S. pyogenes were obtained after incubation, as described above. RNA integrity was assessed using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). For RNA-seq, bacterial RNA was

treated for rRNA removal using a Ribo-Zero rRNA removal kit (Illumina Inc., San Diego, CA, USA). RNA-seq libraries were created

using a TruSeq RNA Sample Prep kit, v2 (Illumina Inc.), according to the manufacturer’s recommendations. Libraries were sequenced

using Illumina HiSeq 2500 systems, with 75-bp single-end reads. RNA-seq reads were mapped against the S. pyogenes strain

5448 genome using the commercially available CLC Genomics workbench, v. 9.5.2 (CLC Bio, Aarhus, Denmark). Global analyses

of RNA-seq expression data were performed using iDEP (Ge et al., 2018), with the FPKM value of each sample. We classified the

differentially expressed genes (DEGs) into functional categories based on the bacterial bioinformatics database and analysis

resource PATRIC (Wattam et al., 2017). The heatmap was visualized by use of the web tool ClustVis (Metsalu and Vilo, 2015) with

default parameters.

Phos-tag western blotting for the detection of phosphorylated CovR For this experiment, we constructed in-frame 50-3xflag-tagged covR insertion mutants (50Flag-CovR) of WT and DarcA. Utilizing strain 5448 genome DNA as a template, two other DNA fragments were amplified using primer sets 50Flag-CovRF1 and 50Flag- CovRR1, or 50Flag-CovRF1 and 50Flag-CovRR1 (Table S2). Then, two fragments were PCR-linked, and a fragment encoding 50-3xflag-tagged covR was created. Finally, a pSET4-50Flag-CovR plasmid harboring 50-3xflag-tagged covR was transformed to generate 50Flag-CovR strain, as described above.

Bacterial cultures during exponential phase were centrifuged, resuspended into CDM, and incubated in a screw-cap glass tube for

1 h at 37�C. To extract total protein from S. pyogenes, we prepared our original lysis buffer which contains 10 U mutanolysin (Sigma Aldrich), cOmplete, EDTA (+) Protease Inhibitor Cocktail (Roche Molecular Diagnostic, Pleasanton, CA, USA), and PhosSTOP (Roche

Molecular Diagnostic) in PBS. Bacterial cultures in THY broth during exponential phase or incubated S. pyogenes in CDM were

centrifuged, and resuspended into lysing Matrix B microtubes containing 0.1-mm silica spheres with our original lysis buffer, and ho-

mogenized at 6,500 rpm for 30 s using the MagNA Lyser (Roche Molecular Diagnostic). The lysates were centrifuged, and the super-

natants were applied to SDS-PAGE (Phos-tag SuperSep Phos-tag Gels; Wako Pure Chemical Industries, Osaka, Japan). The gel was

transferred onto the Immobilon-FL PVDF (Millipore, Billerica, MA, USA) and phosphorylated CovR was detected by Anti-DDDDK-tag

mAb-Alexa Fluor� 488 (MBL, Nagoya, Japan). Labeled proteins were visualized using Amersham Typhoon RGB Biomolecular Imager (Amersham Biosciences-GE Healthcare, Piscataway, NJ, USA). Relative percentage of phosphorylated CovR were calcu-

lated using ImageQuant software (Molecular Dynamics, Sunnyvale, CA, USA).

Detection of glucose concentration on the skin At 48 h after depilation of dorsal skin of mice, a cup was placed on the skin and 100 mL PBS was injected. Then the skin was scratched

by disposable inoculating loops and the sample was collected. Glucose concentration was measured with Glucose Colorimetric

Assay Kit II (Biovision, Milpitas, CA, USA) following manufacturer’s instruction.

Blood bactericidal assay Heparinized mouse blood (190 mL) and exponential phase bacteria (1.5 3 106 CFU in 10 mL of PBS) were mixed in 96-well plates and

incubated at 37�C in 5% CO2 for 1, 2, or 3 hours. Viable cell counts were determined by plating diluted samples on THY blood agar. At 3 hours post mixing, bacterial RNA in blood were also isolated for qPCR. Blood samples were mixed with the component

of RNAprotect� Animal Blood Tubes (QIAGEN), and centrifuged. Pellets were placed in lysing Matrix D microtubes containing 1.4-mm silica spheres (Qbiogene) with RLT lysis buffer (RNeasy kit; QIAGEN) and homogenized at 6,500 rpm for 45 s using a MagNA

lyser. The lysate was centrifuged, and the obtained pellet was resuspended in lysing Matrix B microtubes containing 0.1-mm silica

spheres (Qbiogene) with the RLT lysis buffer and homogenized at 6,500 rpm for 60 s using the MagNA lyser. The final lysate was

centrifuged and bacterial RNA was isolated from the collected supernatant with a RNeasy kit, according to the manufacturer’s

guidelines.

Immunofluorescence staining Paraffin sections of cutaneous tissues of non-infected mice were subjected to immunofluorescence staining to detect filaggrin of

mice. Following deparaffinization, sections in a 10 mM sodium citrate solution (pH 6.0) were heated for 5 min in a pressure cooker

to retrieve the antigens.

Paraffin sections of cutaneous tissues at 24 hours post-infection were subjected to immunofluorescence staining to detect

S. pyogenes, bacterial ArcA, and caspase-1 of host cells. ArcA was detected with rabbit antiserum against recombinant ArcA pro-

teins which were purified from pQE30-ArcA transformed XL10-Gold by using Ni-NTA resin. Following deparaffinization, sections in a

10 mM sodium citrate solution (pH 6.0) were heated for 5 min in a pressure cooker. To visualize S. pyogenes and bacterial ArcA, goat

polyclonal antibody to S. pyogenes carbohydrate (1/100; Abcam, Cambridge, MA, USA) and rabbit antiserum against recombinant

ArcA (1/100) were applied after blocking with PBS containing 2% normal donkey serum. To visualize S. pyogenes and caspase-1

of host cells, goat polyclonal antibody to S. pyogenes carbohydrate (1/100) and rabbit polyclonal antibody to caspase-1 (1/100;

e5 Cell Reports 34, 108924, March 30, 2021

Report ll

OPEN ACCESS

GeneTex, Irvine, CA, USA) were applied after blocking with PBS containing 2% normal donkey serum. Then, to visualize both of them,

donkey anti-Goat IgG Alexa Fluor 594 (1/200; Thermo Fisher Scientific), and donkey anti-Rabbit IgG H&L Alexa Fluor 488 (1/200; Ab-

cam) were applied as the secondary antibody.

Finally, all sections were mounted with ProLong Gold (Thermo Fisher Scientific). Stained tissue sections were examined with a

Keyence microscope (Keyence Japan, Tokyo, Japan).

IL-1b signaling assay Stably transfected HEK-Blue IL-1b reporter cells (InvivoGen, San Diego, CA, USA) (40,000 cells per well in 96-well plates), were

stimulated at 37�C in 5% CO2 with 50 mL of supernatants from infected HaCaT cells. After 18 h stimulation, supernatants from the HEK-Blue cells were analyzed for secreted alkaline phosphatase activity by the addition of 50 mL of supernatants onto 150 mL of

Quanti-Blue reagent (Invivogen) and monitoring the optical density at 620 nm via EnSpire plate reader (PerkinElmer).

Apoptosis determination by Terminal transferase deoxytidyl uridine end labeling (TUNEL) staining At 20 h post-incubation, detection of apoptosis by TUNEL was performed using Click-iT Plus TUNEL Assay Kit (Alexa Fluor 488)

(Thermo Fisher Scientific, Waltham, MA, USA) following manufacturer’s instruction. HaCaT cells were cultured and infected on pre-

coated poly-L-lysine-chamber slide (Nunc Lab-Tek II Chamber Slide System) (Thermo Fisher Scientific). As a control, apoptosis of

HaCaT cells were induced by treating with 0.5 mM staurosporine for 4 hours to induce apoptosis. Coverslips were mounted on slide

glasses with ProLong Gold Antifade Reagent with DAPI (Thermo Fisher Scientific). The number of TUNEL-positive and DAPI-stained

nuclei were determined and the apoptosis percentage was expressed as the ratio between TUNEL-positive and DAPI-stained nuclei.

Six fields per condition (100 cells each) were observed. Cells were visualized using a Zeiss Axio Observer.D1 fluorescence

microscope.

QUANTIFICATION AND STATISTICAL ANALYSIS

Statistical analysis was performed using GraphPad Prism version 7.0 (GraphPad Software Inc., La Jolla, CA, USA). Kruskal-Wallis

test with Dunn’s post hoc test was used for multiple comparisons. Differences between groups were analyzed using a Mann-Whitney

U test. A Mouse survival was analyzed with a log-rank test. Sample sizes and p values are indicated in figure legends.

Cell Reports 34, 108924, March 30, 2021 e6

Cell Reports, Volume 34

Supplemental information

Streptococcus pyogenes upregulates

arginine catabolism to exert

its pathogenesis on the skin surface

Yujiro Hirose, Masaya Yamaguchi, Tomoko Sumitomo, Masanobu Nakata, Tomoki Hanada, Daisuke Okuzaki, Daisuke Motooka, Yasushi Mori, Hiroshi Kawasaki, Alison Coady, Satoshi Uchiyama, Masanobu Hiraoka, Raymond H. Zurich, Masayuki Amagai, Victor Nizet, and Shigetada Kawabata

1

Figure S1. Effects of arginine catabolism on extracellular or intracellular pH, and the cytotoxicity.

Related to Figures 1 and 2. (A) Arginine catabolism in S. pyogenes. Through the multienzyme pathway,

arginine is transported into the cell via the antiporter ArcD and catabolized by ArcA, ArcB, and ArcC to

produce one molecule of carbon dioxide, one molecule of ATP, and two molecules of ammonia. ArcA,

2

arginine deiminase; ArcB, ornithine carbamoyltransferase; ArcC, carbamate kinase; ArcD,

arginine/ornithine antiporter. (B) Relationship between pH level of bacterial culture and bacterial viability.

A picture indicates pH levels of bacterial cultures in phenol red broth supplemented with 30 mM arginine

at 24 h post-incubation. (C) Temporal pH change of bacterial cultures in THY broth. (D) Arginine

catabolism-dependent cytotoxicity of S. pyogenes against HaCaT cells in a dose-dependent manner.

Means + S.E. (n = 4) are shown. Differences between groups were analyzed using a Mann-Whitney U

test. **p < 0.01. (E) Intracellular pH values of S. pyogenes in CDM. Arg(-), strains in CDM without

arginine. Arg(+), strains in CDM with 1000 μM arginine.

3

Figure S2. The virulence of S. pyogenes strains in other infection model, and arginine- or glucose-

dependent up-regulation of slo gene expression levels of S. pyogenes. Related to Figures 3 and 4. (A)

Mouse model of S. pyogenes necrotizing skin infection. Error bars indicated the mean Error bars indicated

the mean ± S.E (n = 16). Statistical differences between groups were analyzed using a Kruskal-Wallis test

with Dunn's post hoc test. **p < 0.01. (B) Mouse model of intraperitoneal infection (n = 10). Flg-/-,

filaggrin knock-out mice. (C, D, E) Arginine catabolism independent virulence on the skin of diabetic

mice. (C) An image of the sample collection for measuring the glucose concentration on the skin. (D) The

4

glucose concentration on the skin both wild-type (wt) mice and diabetic mice (n = 10). (E) CFUs in skin

lesions at 3 days post-infection in murine model of epicutaneous infection (n = 5). Error bars indicated the

mean ± S.E. Statistical differences between groups were analyzed using a Mann-Whitney U test. **p <

0.01. (F, G) Arginine- or glucose- dependent up-regulation of slo gene expression levels of S. pyogenes.

qRT-PCR was conducted by using RNA samples cultured in CDM for 1 h. Arginine (+), strains in CDM

with 1000 μM arginine. Glucose (+), strains in CDM with 1000 μM glucose. The 16S rRNA was used as

the internal control. Data from three independent qRT-PCR assays, each performed in triplicate, were

pooled and normalized. Vertical lines represent the mean + S.E. (n = 9). **p < 0.01. *p < 0.05.

5

Figure S3. The expression of transporter genes of S. pyogenes during epicutaneous infection. Related

to Figure 3. qRT-PCR was conducted by using RNA samples which were collected from wild-type mice

skin surface at 3 hours post-infection. Figure shows the gene expression of WT as compared to that in

ΔarcA. In our RNA-seq data in vitro, 4 genes associated with phosphotransferase system (PTS) were

upregulated in WT strain under arginine-rich condition, including mannose/fructose/sorbose family IID

component (ptsD), mannose/fructose/sorbose family IIA component (SP5448_05675), cellobiose-specific

IIB component (SP5448_08850), cellobiose-specific IIA component (SP5448_08855). Therefore, we

evaluated the expression of transporter genes at 3 hours post-infection. The 16S rRNA was used as the

internal control. Data from three independent qRT-PCR assays, each performed in triplicate, were pooled

and normalized. Vertical lines represent the mean + S.E. (n = 9).

6

Figure S4. The expression of covS, slo, and arcA genes of S. pyogenes during epicutaneous infection.

Related to Figures 3 and 4. qRT-PCR was conducted by using RNA samples which were collected from

wild-type (wt) or filaggrin knock-out (Flg-/-) mice skin surface at 3 hours after epicutaneous infection.

Data shown are log2-fold expression normalized to rpoB transcript levels. Shelburne et al. used proS

transcript levels for normalization relative to a housekeeping gene (Shelburne et al., 2008 DOI:

10.1073/pnas.0711767105). However, our RNA-seq results indicate proS transcript levels were

significantly downregulated dependently of arginine-catabolism. Therefore, rpoB transcript levels were

used for normalization. Data from two independent qRT-PCR assays, each performed in triplicate, were

pooled and normalized. Vertical lines represent the mean + S.E. (n = 6). Statistical differences between

groups were analyzed using a Mann-Whitney U test. **p < 0.01.

7

Figure S5. Involvement of Streptolysin O (SLO) in arginine-dependent cytotoxicity. Related to

Figure 4. A-D, In CDM supplemented with or without 1000μM arginine, HaCaT cells were co-incubated

with S. pyogenes WT or Δslo mutant at MOI 500 for 20 h. (A) Detection of LDH in culture supernatants.

(B) Quantification of mature IL-1β in culture supernatants for detecting pyroptosis. (C) TUNEL reaction

for detecting apoptosis. TUNEL-positive and DAPI-stained cells are indicated green and blue,

respectively. The percentage of TUNEL-positive cells was calculated as the ratio between TUNEL-

positive and DAPI-stained nuclei ×100. Representative data obtained from at least 3 independent

experiments are shown. Vertical lines represent the mean + S.E. (n = 6). Statistical differences between

groups were analyzed using a Mann-Whitney U test. **p < 0.01.**p < 0.01.

8

Table S1: Composition of the chemically defined medium. Related to Figures 1 and 2

Supplemental Table 2: Composition of the chemically defined medium.

Effective chemical Amount (mg/L) L-Arginine 0.00

L-Cystine 48.34

L-Glutamine 584.00

Glycine 30.00

L-Histidine HCl H2O 42.00

L-Isoleucine 105.00

L-Leucine 105.00

L-Lysine HCl 146.00

L-Methionine 30.00

L-Phenylalanine 66.00

L-Serine 42.00

L-Threonine 95.00

L-Tryptophan 16.00

L-Tyrosine 71.59

L-Valine 94.00

D-1/2Ca Pantothenate 4.00

Choline Chloride 4.00

Folic Acid 4.00

i-Inositol 7.20

Niacinamide 4.00

Pyridoxine HCl 4.00

Riboflavin 0.40

Thiamine HCl 4.00

CaCl2 200.00

KCl 400.00

MgSO4 97.67

NaCl 6400.00

NaHCO3 3700.00

NaH2PO4 108.70

Trace elements Fe(NO3)3 9H2O 0.10

Amino acids

Vitamins

Inorganic components

9

Table S2. Primers used in this study. Related to Figures 1, 2, and 3.

Primer Sequence (5’-3’) Purpose

ArcAKOF1 GTTAAGCTTGTTGAGGGTCC Construction of pSET4-ArcAKO

ArcAKOR1 AAGAGATATCTCTTTCTAATTGG Construction of pSET4-ArcAKO

ArcAKOF2 TAAGATATCGTAAAGGTGGTTAT Construction of pSET4-ArcAKO

ArcAKOR2 AAGGATCCATGAGGCACACC Construction of pSET4-ArcAKO

ArcAKOcheckF AGAGATGAGGGAACGTATGAGTTG Confirmation of arcA deletion

ArcAKOcheckR AAGGATAGCACCAGTCACAAGAAG Confirmation of arcA deletion

5'Flag-CovRF1 CGCGGATCCCGGTCTCTCGTTTGATCGTT Construction of pSET4-5’Flag-CovR

5'Flag-CovRR1 CTTGTCATCGTCATCCTTGTAATCGATGTCATGATCTTTATAATCACC GTCATGGTCTTTGTAGTCCATTTATACCAACCCTTATCC

Construction of pSET4-5’Flag-CovR

5'Flag-CovRF2 GACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTA CAAGGATGACGATGACAAGACAAAGAAAATTTTAATTATTG

Construction of pSET4-5’Flag-CovR

5'Flag-CovRR2 CCGGAATTCGGCAGAGAAAATGCAGAAAAA Construction of pSET4-5’Flag-CovR

5'FlagCovRCheckF GACGGTGATTATAAAGATCATG Confirmation of 5'Flag-CovR

5'FlagCovRCheckR CATGATTGCCATACGGTCAG Confirmation of 6'Flag-CovR

5448arcAF GGTGGCAAAGTGCCTATGGTT qPCR of arcA

5448arcAR AAGTTCGTCCCCACCTTCAAT qPCR of arcA

5448sagAF TGAGAATTACCACTTCCAGTAGCAA qPCR of sagA

5448sagAR CTCCTGGAGGCTGCTGTTG qPCR of sagA

5448sloF ACCTATCCAGCAGCCCTTCA qPCR of slo

5448sloR CTACCGCGTCTGGTTTGTTTTC qPCR of slo

5448speBF GGCGGACATGCCTTTGTT qPCR of speB

5448speBR TCCACCCCAACCCCAGTTA qPCR of speB

544816SrRNAF GTTTCAACCTTGCGGTCGTACT qPCR of 16SrRNA

544816SrRNAR GGGCTTAGTGCCGGAGCTA qPCR of 16SrRNA

5448rpoBF CGTCCAGGTGAGCCAAAAA qPCR of rpoB

5448rpoBR CATCAAAGAAACGCGCAATC qPCR of rpoB

5448covSF TTGGCTACTAGTTGTTGAGTTATTTGG qPCR of covS

5448covSR GCGCCGCGTAGTAATTAAGATG qPCR of covS

5448ptsDF GCTCAATGACGGCTTCAAAT qPCR of ptsD

5448ptsDR CTGCTTCTTTGGCACCTTTC qPCR of ptsD

544808850F AAGCCTATGCTCAAGGGAAA qPCR of SP5448_08850

544808850R GCCTAAAAGTGCCACATCAA qPCR of SP5448_08850

544808855F CTTGCCCAAGAAGCTAGTGGTA qPCR of SP5448_08855

544808855R CGTCATCAAGTGATCCTGTGAGT qPCR of SP5448_08855

544805675F AGCAGATGAGCAGGGCCTTAT qPCR of SP5448_05675

544805675R AGCGGTTACCATTTTCTGATTCA qPCR of SP5448_05675

arcA_pQE30_F1 CACCATCACCATCACATGACTGCTCAAACACCAATTCATG Construction of pQE30-ArcA

arcA_pQE30_R1 CAAGCTCAGCTAATTTTAAATATCTTCACGTTCAAATGGC Construction of pQE30-ArcA

pQE30_arcA_F1 CGTGAAGATATTTAAAATTAGCTGAGCTTGGACTCCTGTT Construction of pQE30-ArcA

pQE30_arcA_R1 TGTTTGAGCAGTCATGTGATGGTGATGGTGATGCGATCCT Construction of pQE30-ArcA

  • CELREP108924_annotate_v34i13.pdf
    • Streptococcus pyogenes upregulates arginine catabolism to exert its pathogenesis on the skin surface
      • Introduction
      • Results
        • S. pyogenes ADI pathway contributes to its viability and virulence
        • S. pyogenes arginine catabolism changes global gene expression
        • ADI pathway contributes to the development of cutaneous lesions
        • ADI-pathway-dependent bacterial virulence was canceled in Flg−/− mice
      • Discussion
      • Supplemental information
      • Acknowledgments
      • Author contributions
      • Declaration of interests
      • References
      • STAR★Methods
        • Key Resources Table
        • Resource availability
          • Lead contact
          • Materials availability
          • Data and code availability
        • Experimental model and subject details
          • Bacterial strains and culture conditions
          • Construction of mutant strains
          • Cell culture and media
          • Murine model of epicutaneous and intravenous infections
          • Mouse model of S. pyogenes necrotizing skin infection
          • Mouse model of intraperitoneal infection
          • Streptozotocin-induced diabetic mice
        • Method details
          • Quantitative real-time PCR (qPCR)
          • Measurement of glucose and ammonium ion concentrations
          • Measurement of extracellular pH
          • Measurement of intracellular pH
          • Infection of HaCaT cells with S. pyogenes
          • Cytotoxicity assays
          • Measurement of intracellular ATP levels
          • RNA-seq and data analysis
          • Phos-tag western blotting for the detection of phosphorylated CovR
          • Detection of glucose concentration on the skin
          • Blood bactericidal assay
          • Immunofluorescence staining
          • IL-1β signaling assay
          • Apoptosis determination by Terminal transferase deoxytidyl uridine end labeling (TUNEL) staining
        • Quantification and statistical analysis