Scientific Article #4
Report
Streptococcus pyogenes u
pregulates arginine catabolism to exert its pathogenesis on the skin surface
Graphical abstract
Highlights
d S. pyogenes uses arginine catabolism under low-glucose
conditions
d Arginine catabolism contributes to its viability and virulence
on skin surface
d Arginine catabolism is suppressed under high-glucose
conditions in blood
d S. pyogenes acquires arginine from the stratum-
corneum-derived filaggrin
Hirose et al., 2021, Cell Reports 34, 108924 March 30, 2021 ª 2021 The Author(s). https://doi.org/10.1016/j.celrep.2021.108924
Authors
Yujiro Hirose, Masaya Yamaguchi,
Tomoko Sumitomo, ..., Masayuki Amagai,
Victor Nizet, Shigetada Kawabata
Correspondence [email protected] (Y.H.), [email protected] (S.K.)
In brief
Hirose et al. show that S. pyogenes
upregulates arginine catabolism to exert
its pathogenesis under low-glucose
conditions. S. pyogenes changes global
gene expression, including upregulation
of virulence genes, by catabolizing
arginine. S. pyogenes acquires arginine
from stratum-corneum-derived filaggrin
to adapt to glucose starvation on the skin.
ll
OPEN ACCESS
ll
Report
Streptococcus pyogenes upregulates arginine catabolism to exert its pathogenesis on the skin surface Yujiro Hirose,1,2,11,* Masaya Yamaguchi,1 Tomoko Sumitomo,1 Masanobu Nakata,3 Tomoki Hanada,1 Daisuke Okuzaki,4
Daisuke Motooka,5 Yasushi Mori,1 Hiroshi Kawasaki,6,7,8 Alison Coady,2 Satoshi Uchiyama,2 Masanobu Hiraoka,2,9
Raymond H. Zurich,2 Masayuki Amagai,6,8 Victor Nizet,2,10 and Shigetada Kawabata1,* 1Department of Oral and Molecular Microbiology, Osaka University Graduate School of Dentistry, Suita, Osaka 565-0871, Japan 2Department of Pediatrics, University of California at San Diego School of Medicine, La Jolla, CA 92093, USA 3Department of Oral Microbiology, Kagoshima University Graduate School of Medical and Dental Sciences, Kagoshima 890-8544, Japan 4Genome Information Research Center, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 565-0871, Japan 5Department of Infection Metagenomics, Research Institute for Microbial Diseases, Osaka University, Suita, Osaka 565-0871, Japan 6Department of Dermatology, Keio University School of Medicine, Tokyo 160-8582, Japan 7Immunology Data Integration Unit, RIKEN Medical Sciences Innovation Hub Program, Yokohama 230-0045, Japan 8Laboratory for Skin Homeostasis, RIKEN Center for Integrative Medical Sciences, Yokohama 230-0045, Japan 9Department of Otorhinolaryngology-Head and Neck Surgery, Wakayama Medical University, Wakayama, Wakayama 641-8509, Japan 10Skaggs School of Pharmaceutical Sciences, University of California at San Diego, La Jolla, CA 92093, USA 11Lead contact
*Correspondence: [email protected] (Y.H.), [email protected] (S.K.)
https://doi.org/10.1016/j.celrep.2021.108924
SUMMARY
The arginine deiminase (ADI) pathway has been found in many kinds of bacteria and functions to supplement energy production and provide protection against acid stress. The Streptococcus pyogenes ADI pathway is upregulated upon exposure to various environmental stresses, including glucose starvation. However, there are several unclear points about the advantages to the organism for upregulating arginine catabolism. We show that the ADI pathway contributes to bacterial viability and pathogenesis under low-glucose conditions. S. pyogenes changes global gene expression, including upregulation of virulence genes, by catabolizing argi- nine. In a murine model of epicutaneous infection, S. pyogenes uses the ADI pathway to augment its patho- genicity by increasing the expression of virulence genes, including those encoding the exotoxins. We also find that arginine from stratum-corneum-derived filaggrin is a key substrate for the ADI pathway. In summary, arginine is a nutrient source that promotes the pathogenicity of S. pyogenes on the skin.
INTRODUCTION
One of the most important human bacterial pathogens of skin is
Streptococcus pyogenes, which can produce superficial impe-
tigo or more deep-seated cellulitis but also more severe invasive
infections such as sepsis, necrotizing fasciitis, and streptococcal
toxic shock syndrome (Cunningham, 2000; Walker et al., 2014).
S. pyogenes typing based on M protein and T antigen (pilus ma-
jor subunit) antigenicity (Falugi et al., 2008) confirms several se-
rotypes are capable of causing severe infections, but in recent
decades, one subclone of the M1 serotype, the globally dissem-
inated clonal M1T1 clone (Chatellier et al., 2000), has persisted
uninterruptedly as the most frequently isolated S. pyogenes
strains from both invasive and noninvasive infections (Lynskey
et al., 2019; Walker et al., 2014).
Human skin is an inhospitable environment that includes the
physical barrier of the stratum corneum (SC), an acidic surface
pH, and the active synthesis of innate defense factors such as
antimicrobial peptides, proteases, lysozymes, cytokines, and
This is an open access article und
chemokines that together serve to recruit immune cells and
prime adaptive immune responses (Cogen et al., 2008; Proksch,
2018). To successfully colonize or establish infection in the skin,
pathogens must possess virulence determinants for evasion of
these immune factors and also for acquisition of nutrients, whose
availability the host may restrict under the concept of nutritional
immunity. Elucidation of such bacterial metabolic pathways that
are essential for in vivo survival can reveal unique targets for
novel therapeutics.
The arginine deiminase (ADI) pathway is a metabolic pathway
found in many kinds of bacteria that serves to supplement energy
production and provide protection against acid stress in vitro
(Abdelal, 1979; Cotter and Hill, 2003). The ADI pathway of
S. pyogenes has been studied in a limited manner and
determined to antagonize nitric oxide (NO) production by
macrophages and contribute to the asymptomatic colonization
of the murine vaginal mucosa (Cusumano et al., 2014). The
S. pyogenes ADI pathway is negatively regulated by the following
three virulence-related transcriptional control systems: the control
Cell Reports 34, 108924, March 30, 2021 ª 2021 The Author(s). 1 er the CC BY license (http://creativecommons.org/licenses/by/4.0/).
A B
C
F G
H
D E
(legend on next page)
2 Cell Reports 34, 108924, March 30, 2021
Report ll
OPEN ACCESS
Report ll
OPEN ACCESS
of virulence (CovRS) two-component gene regulatory system,
catabolite control protein CcpA, and regulator gene of glucosyl-
transferase Rgg (Dmitriev et al., 2006; Shelburne et al., 2010).
CovRS mediates a general stress response to changing tempera-
ture, pH, and osmolarity (Dalton and Scott, 2004); and CcpA and
Rgg are directly linked to environmental glucose deprivation
(Dmitriev et al., 2006; Shelburne et al., 2008). Although CovR dele-
tion induces a several-fold increase of ADI pathway genes, CcpA
or Rgg deletions markedly induce several-log-fold increases in the
pathway (Dmitriev et al., 2006; Shelburne et al., 2010). These find-
ings suggest that the ADI pathway is especially important to
S. pyogenes under low-glucose conditions. Notably, the glucose
concentration in the SC of skin is much lower than that present
in blood (Sylvestre et al., 2010). In this study, we investigated
whether the S. pyogenes ADI pathway contributes to the viability
and pathogenesis of an M1T1 strain under low-glucose conditions
and in the skin.
RESULTS
S. pyogenes ADI pathway contributes to its viability and virulence The S. pyogenes ADI pathway is comprised of ArcA, B, C, and D
(Figure S1A; Cusumano et al., 2014). ArcA, an arginine deimi-
nase, is the first enzyme of the ADI pathway and catalyzes the
irreversible hydrolysis of arginine to citrulline and ammonia. We
constructed a markerless complete arcA deletion mutant (DarcA)
by using a double crossover homologous recombination tech-
nique, preserving as a control a wild-type (WT) revertant strain
(Wr) from the single crossover step back to the integrity of
arcA. We first observed the time course of pH change of bacterial
cultures grown under arginine-rich conditions, using phenol red
as an indicator of elevated pH (Figure 1A). The WT S. pyogenes
parent strain induced pH elevation in the culture medium
beginning in stationary phase, whereas the S. pyogenes DarcA
did not, confirming that a loss of arcA renders the bacterium’s
arginine catabolism dysfunctional. Deletion of arcA led to a
decrease in S. pyogenes viability during the decline phase of
stationary growth in Todd-Hewitt broth supplemented with
0.2% yeast extract (THY broth) (Figure 1B). In contrast, the WT
S. pyogenes strain exhibited a strong increase in arcA gene
expression and ammonium ion production occurring during sta-
tionary phase following glucose starvation (Figures 1C, 1D, and
Figure 1. arcA upregulation under glucose-starvation conditions, and (A) Temporal pH change of bacterial cultures using phenol red broth supplemen
(B) Bacterial growth ability and viability in THY broth. Error bars indicated the me
experiments are shown. **p < 0.01.
(C) The arcA expression of WT S. pyogenes at each growth phase within THY bro
with a box-whisker plot (n = 9). **p < 0.01.
(D and E) Glucose (D) and ammonium ion (E) levels in culture supernatant of WT
mean + SE. **p < 0.01.
(F) Arginine-dependent cytotoxicity of S. pyogenes. HaCaT cells cultured in CDM
cells are indicated green and red, respectively. LDH, lactate dehydrogenase. Va
experiments. Error bars indicated the mean + SE. **p < 0.01. p < 0.01.
(G) Intracellular ATP levels of S. pyogenes. Representative data obtained from a
mean + SE (n = 4). **p < 0.01.
(H) Bacterial viability in only CDM or CDM with cultured HaCaT cells. Error bars in
independent experiments are shown. **p < 0.01.
1E). Although a pH elevation was not detected during the station-
ary phase in THY broth, pH levels in phenol red broth supple-
mented with arginine were elevated above neutral pH for both
the WT and Wr cultures (Figures S1B and S1C). Both WT and
Wr showed the potential for long-term survival in neutral pH for
at least 40 days during the decline phase, whereas the mutant
strain lost viability after only 2 days (Figure S1B). These findings
indicate that S. pyogenes neutralizes excess protons during sta-
tionary phase by synthesizing ammonia in an ADI-dependent
manner, thus promoting long-term viability during the decline
phase.
S. pyogenes cultured in THY broth experienced glucose
starvation beginning in stationary phase. To investigate whether
arginine catabolism contributed to S. pyogenes virulence phe-
notypes under such glucose-starved conditions, we prepared
chemically defined medium (CDM; Table S1) without glucose,
phenol red, or arginine. As a first surrogate marker of virulence,
we evaluated S. pyogenes cytotoxicity against the cultured hu-
man keratinocyte cell line HaCaT. We supplemented 1,000 mM
arginine in the CDM to match the physiological concentration
present in human muscle tissue (Canepa et al., 2002). At 20 h
after infection of HaCaT cells under arginine-supplemented
conditions, WT and Wr showed a dose-dependent increase in
cytotoxic potential compared to the DarcA mutant (Figures
1F and S1D), linking arginine catabolism to this virulence
phenotype.
By metabolizing arginine, S. pyogenes acquires adenosine
triphosphate (ATP) as an energy source, coupled to discharge
of ammonium ion (Figure S1A). Intracellular acidification may
affect the growth and cell viability of streptococci (Dashper
and Reynolds, 2000). We probed the contribution of arginine
catabolism to S. pyogenes intracellular pH and ATP levels under
low-glucose conditions using CDM. No effects on the intracel-
lular pH of S. pyogenes were observed 1 h, 5 h, and 15 h post-
incubation in CDM (Figure S1E). Conversely, at 1 h and 5 h
post-incubation, arginine catabolism contributed to the acquisi-
tion of ATP under the no-glucose condition (Figure 1G), which
correlated with viability of S. pyogenes at 5 h and 15 h post-incu-
bation in CDM (Figure 1H). S. pyogenes WT in CDM at 15 h had
greater viability when cultured in the presence of HaCaT cells
than in their absence (Figure 1H), suggesting that ADI-depen-
dent S. pyogenes cytotoxicity induces release of nutrition from
damaged keratinocytes, promoting S. pyogenes survival.
arginine-catabolism-dependent viability and cytotoxicity ted with 30 mM arginine.
an + SE (n = 4). Representative data obtained from at least three independent
th. Data obtained by combining three independent experiments are displayed
(n = 9) and DarcA (n = 4) during growth in THY broth. Error bars indicated the
were infected with S. pyogenes (MOI = 500) for 20 h. Viable cells and dead
lues are presented as the mean of four wells from one of three independent
t least three independent experiments are shown. Vertical lines represent the
dicated the mean + SE (n = 4). Representative data obtained from at least three
Cell Reports 34, 108924, March 30, 2021 3
Report ll
OPEN ACCESS
S. pyogenes arginine catabolism changes global gene expression We conducted RNA sequencing (RNA-seq) analysis of the
S. pyogenes strains in CDM with arginine (Arg(+)) or without
arginine (Arg(�)) to assesses transcriptional consequences of altering the ADI pathway. Principal-component analysis (PCA)
showed DarcA Arg(�), DarcA Arg(+), and WT Arg(�) samples clustered together, whereas WT Arg(+) samples positioned
clearly apart from the others (Figure 2A). Differentially expressed
genes (DEGs) from comparisons of the Arg(+) and Arg(�) groups were detected only in the WT S. pyogenes background and not
with the DarcA (Figure 2B; Data S1 and S2). The cumulative re-
sults indicated that arginine-dependent transcriptome changes
in S. pyogenes occurred only in the presence of an intact ADI
pathway. A heatmap using selected characteristic genes
showed that upregulated genes in WT Arg(+) samples included
those encoding virulence factors, such as an enzyme for matura-
tion of the cytolysin streptolysin S (sagB), another cytolysin
streptolysin O (slo), nucleases (spd3), and NADase (nga), but
also genes comprising the pyrimidine biosynthesis pathway
(pyrD, pyrE, and pyrF) (Figure 2C). On the other hand, cell-divi-
sion-associated genes (ftsH, ftsL, and ftsZ) and genes encoding
F0F1-type ATP synthase (atpB–H) were downregulated in WT
S. pyogenes in the presence of arginine.
The most well-studied S. pyogenes two-component signal
transduction system is the cluster of virulence (Cov) intracellular
responder (CovR)/extracellular sensor (CovS) CovRS, which influ-
ences 15%–20% of the S. pyogenes genome (Graham et al.,
2002). CovS sensed environmental changes and transmitted to
CovR by phosphorylation-dephosphorylation (Horstmann et al.,
2015). Of particular interest, the covS gene was downregulated
in WT S. pyogenes-sensing arginine (Figure 2C; Data S2). To
investigate whether arginine catabolism influences CovR phos-
phorylation, we monitored phosphorylation of the regulator using
a 50 FLAG-CovR strain (Figure 2D). Exponential phase growth of S. pyogenes in THY broth showed low levels of CovR phosphory-
lation. For S. pyogenes within CDM, the WT Arg(+) sample tended
to show a low levelof CovR phosphorylation, butnosignificant dif-
ference was found by the densitometric analysis (Figure 2E).
ADI pathway contributes to the development of cutaneous lesions The SC of skin is relatively deficient in glucose (Sylvestre et al.,
2010), whereas arginine is abundant (Kubo et al., 2013). We hy-
pothesized that S. pyogenes may use arginine to acquire energy
on the skin surface and examined this possibility by using a
mouse model of epicutaneous infection (Figure 3A). By 3 days
post-challenge, the skin surface of mice infected with WT or
Wr S. pyogenes had peeled off, whereas it remained intact in
DarcA-infected mice (Figure 3B). Furthermore, CFU recovered
from skin lesions 3 days post-infection were significantly
reduced in DarcA-infected mice compared to the WT or Wr
(Figure 3C). An analysis of gene expression showed the WT
S. pyogenes strain had higher in vivo expression of the genes en-
coding the streptolysin S precursor (sagA) and streptolysin O
(slo) but reduced expression of the gene encoding cysteine pro-
tease SpeB (speB) compared to the DarcA mutant (Figure 3D).
These results indicate that arginine catabolism contributes to
4 Cell Reports 34, 108924, March 30, 2021
the pathogenesis of S. pyogenes on the skin surface while pro-
moting the expression of cytolysins.
To assess the ADI-dependent effects on S. pyogenes sys-
temic pathogenicity, we conducted intravenous challenge of
mice along with an ex vivo bactericidal assay by using mouse
blood. In both sets of experiments, there were no significant dif-
ferences between WT and DarcA (Figures 3E and 3F); this argi-
nine catabolism may not be involved in the virulence or viability
of S. pyogenes in blood. We speculated that arginine catabolism
was suppressed in blood due to high concentrations of glucose.
With that in mind, we evaluated arcA gene expression of WT
S. pyogenes in blood and on the skin surface by using qPCR. Us-
ing an expression level of arcA in the exponential phase growth in
THY medium set to 1, we found that arcA expression was 10 to
100 times lower in blood and 10 times greater on the skin than
under the culture conditions (Figure 3G). This result suggests
that the expression on the skin surface was elevated 2- to 3-
log-fold compared to that in blood, where low-glucose concen-
trations are found. Expanding the repertoire of infection models,
we found that in a subcutaneous mouse soft-tissue infection
model, which causes necrosis of fascial tissue and adjoining
muscle, the DarcA showed reduced virulence compared to WT
and Wr (Figure S2A), whereas there were no differences in viru-
lence in another systemic challenge by intraperitoneal infection
(Figure S2B). It is speculated that these contrasting results
reflect differences in available concentrations of glucose and
arginine in localized versus systemic disease compartments.
Next, an epicutaneous infection study was conducted using
streptozotocin-induced diabetic mice. As expected, 48 h after
depilation of dorsal skin, glucose levels on the skin surface in
non-diabetic (WT) mice were below the detection limit (<1 mM)
in nearly all samples, whereas those in the diabetic mice were
much higher (4 mM–70.4 mM; Figures S2C and S2D). In response
to an epicutaneous infection in diabetic mice, DarcA showed
comparable recovered CFU from the skin lesion to WT
(Figure S2E). Both WT and DarcA in CDM showed an upregula-
tion of the slo gene in the presence of glucose (Figures S2F and
S2G). These results suggested that the abundance of glucose on
the skin surface in diabetes allows the pathogen to exhibit path-
ogenicity independently of arginine catabolism, consistent with
the known increased risk of S. pyogenes skin and soft tissue in-
fections in patients with diabetes (Lin et al., 2011).
In our RNA-seq data in vitro, 4 genes associated with phos-
photransferase system (PTS) were upregulated in WT under argi-
nine-rich conditions (ptsD, SP5448_05675, SP5448_08850, and
SP5448_08855). Therefore, we evaluated the expression levels
of these transporter genes at 3 h post-epicutaneous infection
in WT mice (Figure S3). The expression levels of each gene
tended to be upregulated in WT compared to those of the
DarcA mutant. This result also suggests that the skin surface of
WT mice has a low glucose concentration and S. pyogenes up-
regulates the expression of transporter genes in a manner that
depends on arginine catabolism.
ADI-pathway-dependent bacterial virulence was canceled in Flg�/� mice Arginine is abundant in filaggrin, an abundant protein within
the SC of skin, and a filaggrin knockout (Flg�/�) mouse has a
A
C D
E
B
Figure 2. Effect of S. pyogenes arginine catabolism on transcriptome and phosphorylation of CovR
(A) Principal-component analysis (PCA) plot of fragments per kilobase of exon per million mapped fragments (FPKM) data from the RNA-seq dataset.
(B) Volcano plots comparing global gene expression patterns between WT Arg(�) and WT Arg(+) and between DarcA Arg(�) and DarcA Arg(+). Colored circles indicate significantly upregulated (red) and downregulated (blue) genes (absolute log2-fold change, >0.5; adjusted p < 0.2).
(C) Heatmap of up- or downregulated functions. FPKM values were used for the heatmap visualization. Red and blue indicate induced and repressed,
respectively.
(D) Phosphorylation levels of CovR. CovR~P and CovR indicate phosphorylated CovR and non-phosphorylated CovR, respectively. Total protein serves as the
loading control. THY, RNA samples from exponential phase of S. pyogenes in THY medium.
(E) Relative percentage of phosphorylated CovR. Error bars indicated the mean ± SE (n = 4). Arg(�), strains in CDM without arginine. Arg(+), strains in CDM with 1,000 mM arginine.
Report ll
OPEN ACCESS
markedly lower SC arginine level than a corresponding WT
mouse (Kawasaki et al., 2012; Kubo et al., 2013). The degrada-
tion of filaggrin into amino acids occurs in the SC layers by
host-derived enzymes, including caspase-14, calpain 1, and
bleomycin hydrolase (Hoste et al., 2011). We hypothesized that
S. pyogenes acquires arginine from filaggrin in the SC for
nutritional requirements and its pathogenicity on the skin
surface.
Cell Reports 34, 108924, March 30, 2021 5
A
B
C
E F G
D
Figure 3. The roles of arginine catabolism for the virulence of S. pyogenes on the skin surface and in blood
(A) Murine model of epicutaneous infection and its timeline. Mice were epicutaneously infected with 2 3 106 CFU of S. pyogenes.
(B) Skin phenotype and histopathology at 3 days post-infection. Cutaneous tissues from infection sites were stained with H&E. Data shown are representative of
at least three separate experiments.
(C) CFUs in skin lesions at 3 days post-infection. Data shown represent the mean ± SE (n = 8) and are representative of at least three independent experiments. **p
< 0.01, *p < 0.05.
(legend continued on next page)
6 Cell Reports 34, 108924, March 30, 2021
Report ll
OPEN ACCESS
Report ll
OPEN ACCESS
At baseline, it is difficult to appreciate any phenotypic differ-
ences between WT mice and Flg�/� mice (Figure 4A). However, following epicutaneous challenge assessed at 3 days post-infec-
tion, the previously observed difference of virulence between WT
and DarcA disappeared in the skin of Flg�/� mice, as verified at three different challenge inocula (Figure 4B). These results were
corroborated with similar histopathology of the skin lesions at
the 3-day post-infection time point (Figure 4C). The ArcA protein
is associated with the S. pyogenes bacterial cell surface
(Henningham et al., 2012). To confirm that S. pyogenes ex-
presses ArcA during infection on the skin surface, immunofluo-
rescence staining was performed at 24 h post-infection. Strong
signals for ArcA expression were seen only in the case of
S. pyogenes WT on the skin surface of WT mice (Figures 4D
and 4E). In Flg�/� mice, S. pyogenes did not appear to upregu- late ArcA for arginine catabolism to achieve infection.
S. pyogenes showed different expression levels of covS, arcA,
and slo genes on the skin surface 3 h after epicutaneous infection
in WT compared to Flg�/� mice (Figure S4). Because Flg�/�
mouse skin exhibits enhanced permeability of SC as compared
to WT mouse skin (Kawasaki et al., 2012), these transcriptional
differences might reflect differences of nutritional or stress
environments.
In intestinal epithelial cells, it is thought that caspase-1 contrib-
utes to both pyroptosis and apoptosis during an inflammation
(Lei-Leston et al., 2017). To investigate whether S. pyogenes
caused programmed cell death of skin epithelial cells, immunoflu-
orescence staining of caspase-1 was performed 24-h post-epicu-
taneous infection. We saw a marked decrease of caspase-1
expression in epithelial cells infected with the DarcA in only WT
mice (Figures 4F and 4G). S. pyogenes induces keratinocyte
apoptosis by SLO-mediated membrane damage (Cywes Bentley
et al., 2005). In S. pyogenes infection of HaCaT cells with CDM, an
increase in released lactate dehydrogenase (LDH) in culture
supernatants indicated that SLO contributed partially to argi-
nine-catabolism-dependent cytotoxicity (Figure S5A). Next, we
determined whether pyroptosis or apoptosis was induced in in-
fected epithelial cells by measuring interleukin-1b (IL-1b) release
and DNA fragmentation by TUNEL staining. Because it was diffi-
cult to discriminate between pro-IL-1b and mature IL-1b by ELISA,
we assessed signaling activity using HEK-Blue IL-1b reporter cells
for quantifying pyroptosis. The secretion of mature IL-1b from Ha-
CaT cells was enhanced in both WT and Dslo by arginine catabo-
lism (Figure S5B), with SLO partially contributing to the pyroptosis
phenotype, paralleling the cytolytic effect. On the other hand, in a
TUNEL assay designed to detect apoptotic cells, arginine-catab-
olism-dependent apoptosis was not observed (Figure S5C).
Taken together, S. pyogenes SLO contributes significantly to the
(D) Expression levels of bacterial virulence genes sagA, slo, and speB on the sk
examined by qPCR and shown relative to that of the WT strain. The 16S rRNA wa
each performed in triplicate, were pooled and normalized. Vertical lines represen
(E) Mouse model of intravenous infections. Mice were intravenously infected with
independent experiments.
(F) Bacterial survival in mouse blood. Bacteria were incubated in heparinized mo
calculated by dividing the CFU value after the period of incubation by the CFU va
one of three independent experiments. Vertical lines represent the mean + SE.
(G) The arcA expression of S. pyogenes WT in blood and on the skin surface. Da
box-whisker plot (n = 9). THY control, RNA samples from exponential phase of S
pyroptosis of HaCaT cells induced by arginine catabolism, and
there are other S. pyogenes factors that are likely involved in argi-
nine-catabolism-independent pyroptosis.
DISCUSSION
The S. pyogenes ADI pathway is controlled by virulence-related
metabolic regulators (Dmitriev et al., 2006; Shelburne et al.,
2010) and is highly expressed in vivo (Graham et al., 2006; Hirose
et al., 2019) and ex vivo (Graham et al., 2005; Shelburne et al.,
2005). Here, we show that the S. pyogenes ADI pathway influ-
ences virulence factor expression and contributes to keratino-
cyte cytotoxicity under low-glucose conditions in vitro and
subcutaneous infection in vivo. Our data support a model in
which S. pyogenes uses arginine abundant in filaggrin of the
SC, can secure nutrition, survive, and produce skin infection
associated with local tissue destruction.
We found that S. pyogenes can survive for more than 40 days
if it can maintain neutral pH by metabolizing arginine during the
stationary phase. This result is consistent with a previous report
that proved the long-term survival potential of S. pyogenes
in neutral pH (Savic and McShan, 2012). The ability of the
S. pyogenes ADI pathway to supplement energy production
and provide protection against acid stress might greatly
contribute to its viability in specialized environments such as
skin.
Comparative transcriptome analysis reveals arginine-catabo-
lism-dependent gene regulation under glucose-starvation con-
ditions. Upregulated genes in the WT strain include genes in
the pyrimidine biosynthesis pathway (pyrD, pyrE, and pyrF). In
S. pyogenes, the ADI pathway cooperates with the pyrimidine
biosynthesis pathway to acquire pyrimidine ribonucleotides
and ATP (Hirose et al., 2019). Conversely, genes encoding
F0F1-type ATP synthase were downregulated in the WT strain
compared to those in the DarcA mutant. Although it has been re-
ported that the generation of ATP by the ADI pathway and a func-
tional F0F1-type ATP synthase work in concert to adapt to acid
stress (Cusumano and Caparon, 2015), it is speculated that
S. pyogenes in CDM at neutral pH decreases the concomitant
hydrolysis of ATP to ADP to reduce ATP consumption. Genes
related to cell division (ftsH, ftsL, and ftsZ) were also downregu-
lated in WT S. pyogenes, which might prioritize the expression of
cytolytic virulence factors when there are not enough local nutri-
tion sources to proliferate.
ThedeletionofcovR inducestheupregulationofvirulencegenes
contained within the streptolysin S operon (sagABCDEFGHI) and
the nga-slo operon and also shows downregulation of a dipeptide
permease operon (dppABCDE) (Shelburne et al., 2010). These
in surface. The sagA, slo, and speB gene expression levels in the DarcA were
s used as the internal control. Data from three independent qRT-PCR assays,
t the mean + SE. **p < 0.01.
2 3 106 CFU of S. pyogenes (n = 8). Data are representative of at least three
use blood at 37�C for 1, 2, or 3 h in a 5% CO2 atmosphere. Survival rate was lue of the original inoculum. Values are presented as the mean of six wells from
ta obtained by combining three independent experiments are displayed with a
. pyogenes in THY medium. **p < 0.01.
Cell Reports 34, 108924, March 30, 2021 7
A
C
D
F
E
G
B
Figure 4. Arginine-catabolism-independent virulence of S. pyogenes on the skin surface of filaggrin knockout mice
(A) Skin phenotype and histology of both WT mice and Flg�/� mice. (B) CFUs in skin lesions at 3 days post-infection. Data shown represent the mean ± SE (n = 10–12). **p < 0.01.
(legend continued on next page)
8 Cell Reports 34, 108924, March 30, 2021
Report ll
OPEN ACCESS
Report ll
OPEN ACCESS
findings were mirrored in our results from RNA-seq analysis.
Although CovR phosphorylation enhances DNA binding of
CovR (Graham et al., 2002) and CovR affects the expression of
15%–20% of S. pyogenes genes (Horstmann et al., 2015),
S. pyogenes arginine catabolism did not significantly influence
CovR phosphorylation in our assay. Taken together, these results
suggest that the main mechanism of S. pyogenes pathogenicity
under glucose-depleted conditions may be dependent on
acquiring ATP by catabolism of arginine.
Although transcript levels of the ADI operon were reduced
in serotype M1 S. pyogenes (MGAS5005) after human blood
exposure, temporal and mild upregulation of ADI operon were
observed within 90 min of blood exposure (Graham et al.,
2005). These investigators also reported that the deletion of
the S. pyogenes covR regulator led to upregulation of the ADI
operon in blood. These results partly contrast with our data.
However, human blood is relatively poor in arginine but rich in
glucose (Canepa et al., 2002; Sylvestre et al., 2010). Therefore,
although CovRS might mediate some environmental signals in
the blood and upregulate ADI operon expression, we speculate
that arginine catabolism changes are not sufficient to drive path-
ogenesis of S. pyogenes in blood. In contrast, the DarcA mutant
showed lower virulence than the WT S. pyogenes strain in a
mouse soft-tissue infection model that was associated with
localized necrosis in adjacent muscle. This difference in patho-
genicity might be explained by high concentrations (approxi-
mately 1,000 mM) of arginine in muscle tissue (Canepa et al.,
2002).
In a murine model of epicutaneous infection and in our
RNA-seq analysis, S. pyogenes WT upregulated the arcA, slo,
and sagA genes. High expression levels of these genes were re-
ported in S. pyogenes isolated directly from mouse soft tissue
infection (Graham et al., 2006) and a mouse model of necrotizing
fasciitis (Hirose et al., 2019). Streptolysin S is involved in cellular
injury, phagocytic resistance, and virulence in murine subcu-
taneous infection models (Datta et al., 2005; Humar et al.,
2002). The upregulation of SLO has been correlated with a highly
virulent S. pyogenes phenotype (Zhu et al., 2015). Our finding
that ADI contributes to the expression of the sagA and slo genes
might be important information for mitigating the pathogenicity
of S. pyogenes.
The SC is the outermost layer of the epidermis and acts as the
first line of structural defense against pathogens and toxins. Fi-
laggrin, a major structural protein in the SC (Sandilands et al.,
2009), contributes to the mechanical strength and integrity of
the SC in vivo (Kawasaki et al., 2012), and filaggrin breakdown
products form natural moisturizing factors that are believed to
(C) Skin phenotype and histopathology at 3 days post-infection. Mice were epicu
infection sites were stained with H&E. Data shown are representative of at least
(D) Representative microscopic images of immunofluorescence staining of S. py
post-infection. Strong merge signals (yellow) were detected only in S. pyogenes
(E) Mean fluorescence intensity (MFI) of ArcA (minimum 10 bacteria per condition
was subtracted from each value. Data represent mean + SE. **p < 0.01.
(F) Representative microscopic images of immunofluorescence staining of S. pyo
infection. Weak signals of epithelial cells were shown only in DarcA-infected WT
(G) The percentage of caspase-1-positive cells in epidermis (minimum 20 cells
knockout mouse.
play a major role in SC hydration (Rawlings and Harding,
2004). Arginine is a major component of filaggrin-derived natural
moisturizing factors (Kubo et al., 2013). In our epicutaneous
infection model with Flg�/� mice, S. pyogenes might more easily penetrate to reach viable epidermal cells below the SC where-
upon cytotoxic factors can allow the pathogen to secure nutrition
from the viable host epidermal cells. Thus, DarcA could exert
pathogenesis by using ADI-independent mechanisms on the
skin surface of Flg�/� mice. The SC of skin is also rich in lipids, such as ceramides, choles-
terol, and free fatty acids (Elias and Schmuth, 2009), and bacte-
rial infection of the skin also activates the host immune response
(Cogen et al., 2008) and promotes acidic pH (Proksch, 2018). In
our results, there were certain differences between our in vitro
and in vivo findings that could not be explained based solely
on S. pyogenes ADI pathway activity. Further experiments will
be required to confirm whether other factors are involved in the
pathogenesis of S. pyogenes and reveal more details about in-
teractions between S. pyogenes and host skin tissue.
We revealed that S. pyogenes induced increased pyroptosis of
HaCaT cells in a manner dependent on arginine catabolism,
whereas almost no apoptosis was observed both dependently
and independently of arginine catabolism. However, Cywes
Bentley et al. (2005) reported that S. pyogenes SLO contributed
to keratinocyte apoptosis. This discrepancy may be due to the
difference of the keratinocyte cell line used or nutritional condi-
tions. Because SLO was not fully responsible for the observed
pyroptosis, further exploration will be needed to fully clarify the
arginine-catabolism-dependent pyroptosis-inducing factors of
S. pyogenes.
In summary, our findings suggest that S. pyogenes uses argi-
nine from SC-derived filaggrin to adapt to glucose starvation on
the skin surface. Despite the fact that arginine is a molecule that
contributes to natural moisturizing of the skin, it can be simulta-
neously exploited by S. pyogenes that may metabolize arginine
to promote its pathogenesis.
STAR+METHODS
Detailed methods are provided in the online version of this paper
and include the following:
d KEY RESOURCES TABLE
d RESOURCE AVAILABILITY
taneou
three se
ogenes
WT on
, n = 8)
genes (r
mice.
per con
B Lead contact
B Materials availability
B Data and code availability
sly infected with 2 3 107 CFU of S. pyogenes. Cutaneous tissues from
parate experiments.
(red) and arginine deiminase, ArcA (green), on the skin surface at 24 h
the skin surface of WT mice.
. MFI was quantified using ImageJ. Average background fluorescence
ed) on the skin surface and caspase-1 (green) in epidermis at 24 h post-
dition, n = 8). Data represent mean + SE. **p < 0.01. Flg�/�, filaggrin
Cell Reports 34, 108924, March 30, 2021 9
Report ll
OPEN ACCESS
d EXPERIMENTAL MODEL AND SUBJECT DETAILS
B Bacterial strains and culture conditions
B Construction of mutant strains
B Cell culture and media
B Murine model of epicutaneous and intravenous infec-
tions
B Mouse model of S. pyogenes necrotizing skin infection
B Mouse model of intraperitoneal infection
B Streptozotocin-induced diabetic mice
d METHOD DETAILS
B Quantitative real-time PCR (qPCR)
B Measurement of glucose and ammonium ion concen-
trations
B Measurement of extracellular pH
B Measurement of intracellular pH
B Infection of HaCaT cells with S. pyogenes
B Cytotoxicity assays
B Measurement of intracellular ATP levels
B RNA-seq and data analysis
B Phos-tag western blotting for the detection of phos-
phorylated CovR
B Detection of glucose concentration on the skin
B Blood bactericidal assay
B Immunofluorescence staining
B IL-1b signaling assay
B Apoptosis determination by Terminal transferase de-
oxytidyl uridine end labeling (TUNEL) staining
d QUANTIFICATION AND STATISTICAL ANALYSIS
SUPPLEMENTAL INFORMATION
Supplemental information can be found online at https://doi.org/10.1016/j.
celrep.2021.108924.
ACKNOWLEDGMENTS
We express our appreciation to Dr. T. Sekizaki and Dr. D. Takamatsu for
providing the pSET4s plasmid, Dr. Riestra for providing IL-1b reporter cells,
and Dr. Choi for providing HaCaT cells. We also thank Dr. Y. Nakamura,
Dr. J. Hisatsune, and Dr. N. Takemoto for the advice on the experimental pro-
cedure and technique. We acknowledge the NGS core facility of the Genome
Information Research Center at the Research Institute for Microbial Diseases
of Osaka University for their support with RNA sequencing and data
analysis. This study was supported in part by AMED (JP19fk0108044,
JP19fm0208007, and JP20fk0108130); Japanese Society for the Promotion
of Science (JSPS) KAKENHI (grant numbers 16K15787, 19H03825,
19K22710, and 20K18474); JSPS Overseas Research Fellowships; Takeda
Science Foundation; Japanese Association for Oral Biology Grant in Aid for
Young Scientists; Secom Science and Technology Foundation; The Naito
Foundation; and Kobayashi International Scholarship Foundation. The funders
had no role in study design, data collection or analysis, decision to publish, or
preparation of the manuscript.
AUTHOR CONTRIBUTIONS
Conceptualization, Y.H., M.Y., and S.K.; methodology, Y.H., M.Y., T.S., M.N.,
Y.M., H.K., S.U., M.H., and M.A.; software, D.O. and D.M.; investigation,
Y.H., A.C., and R.H.Z.; formal analysis, Y.H. and T.H.; data curation, Y.H.;
supervision, M.Y., V.N., and S.K.; visualization, T.H., D.O., and D.M.; funding
acquisition, Y.H., M.Y., V.N., and S.K.; writing - original draft, Y.H.; writing -
review & editing, M.Y., T.S., M.N., V.N., and S.K.; project administration, V.N.
and S.K.
10 Cell Reports 34, 108924, March 30, 2021
DECLARATION OF INTERESTS
The authors declare no conflict of interest.
Received: June 17, 2020
Revised: January 15, 2021
Accepted: March 9, 2021
Published: March 30, 2021
REFERENCES
Abdelal, A.T. (1979). Arginine catabolism by microorganisms. Annu. Rev. Mi-
crobiol. 33, 139–168.
Boukamp, P., Petrussevska, R.T., Breitkreutz, D., Hornung, J., Markham, A.,
and Fusenig, N.E. (1988). Normal keratinization in a spontaneously immortal-
ized aneuploid human keratinocyte cell line. J. Cell Biol. 106, 761–771.
Canepa, A., Filho, J.C., Gutierrez, A., Carrea, A., Forsberg, A.M., Nilsson, E.,
Verrina, E., Perfumo, F., and Bergström, J. (2002). Free amino acids in plasma,
red blood cells, polymorphonuclear leukocytes, and muscle in normal and
uraemic children. Nephrol. Dial. Transplant. 17, 413–421.
Chatellier, S., Ihendyane, N., Kansal, R.G., Khambaty, F., Basma, H., Norrby-
Teglund, A., Low, D.E., McGeer, A., and Kotb, M. (2000). Genetic relatedness
and superantigen expression in group A Streptococcus serotype M1 isolates
from patients with severe and nonsevere invasive diseases. Infect. Immun.
68, 3523–3534.
Cogen, A.L., Nizet, V., and Gallo, R.L. (2008). Skin microbiota: a source of dis-
ease or defence? Br. J. Dermatol. 158, 442–455.
Cotter, P.D., and Hill, C. (2003). Surviving the acid test: responses of gram-
positive bacteria to low pH. Microbiol. Mol. Biol. Rev. 67, 429–453.
Cunningham, M.W. (2000). Pathogenesis of group A streptococcal infections.
Clin. Microbiol. Rev. 13, 470–511.
Cusumano, Z.T., and Caparon, M.G. (2015). Citrulline protects Streptococcus
pyogenes from acid stress using the arginine deiminase pathway and the
F1Fo-ATPase. J. Bacteriol. 197, 1288–1296.
Cusumano, Z.T., Watson, M.E., Jr., and Caparon, M.G. (2014). Streptococcus
pyogenes arginine and citrulline catabolism promotes infection and modulates
innate immunity. Infect. Immun. 82, 233–242.
Cywes Bentley, C., Hakansson, A., Christianson, J., and Wessels, M.R. (2005).
Extracellular group A Streptococcus induces keratinocyte apoptosis by dysre-
gulating calcium signalling. Cell. Microbiol. 7, 945–955.
Dalton, T.L., and Scott, J.R. (2004). CovS inactivates CovR and is required for
growth under conditions of general stress in Streptococcus pyogenes.
J. Bacteriol. 186, 3928–3937.
Dashper, S.G., and Reynolds, E.C. (2000). Effects of organic acid anions on growth,
glycolysis, and intracellular pH of oral streptococci. J. Dent. Res. 79, 90–96.
Datta, V., Myskowski, S.M., Kwinn, L.A., Chiem, D.N., Varki, N., Kansal, R.G.,
Kotb, M., and Nizet, V. (2005). Mutational analysis of the group A streptococcal
operon encoding streptolysin S and its virulence role in invasive infection. Mol.
Microbiol. 56, 681–695.
Dmitriev, A.V., McDowell, E.J., Kappeler, K.V., Chaussee, M.A., Rieck, L.D., and
Chaussee, M.S. (2006). The Rgg regulator of Streptococcus pyogenes influences
utilization of nonglucose carbohydrates, prophage induction, and expression of
the NAD-glycohydrolase virulence operon. J. Bacteriol. 188, 7230–7241.
Do, H., Makthal, N., VanderWal, A.R., Saavedra, M.O., Olsen, R.J., Musser,
J.M., and Kumaraswami, M. (2019). Environmental pH and peptide signaling
control virulence of Streptococcus pyogenes via a quorum-sensing pathway.
Nat. Commun. 10, 2586.
Elias, P.M., and Schmuth, M. (2009). Abnormal skin barrier in the etiopatho-
genesis of atopic dermatitis. Curr. Allergy Asthma Rep. 9, 265–272.
Falugi, F., Zingaretti, C., Pinto, V., Mariani, M., Amodeo, L., Manetti, A.G.,
Capo, S., Musser, J.M., Orefici, G., Margarit, I., et al. (2008). Sequence varia-
tion in group A Streptococcus pili and association of pilus backbone types with
lancefield T serotypes. J. Infect. Dis. 198, 1834–1841.
Report ll
OPEN ACCESS
Ge, S.X., Son, E.W., and Yao, R. (2018). iDEP: an integrated web application
for differential expression and pathway analysis of RNA-Seq data. BMC Bioin-
formatics 19, 534.
Graham, M.R., Smoot, L.M., Migliaccio, C.A., Virtaneva, K., Sturdevant, D.E.,
Porcella, S.F., Federle, M.J., Adams, G.J., Scott, J.R., and Musser, J.M.
(2002). Virulence control in group A Streptococcus by a two-component
gene regulatory system: global expression profiling and in vivo infection
modeling. Proc. Natl. Acad. Sci. USA 99, 13855–13860.
Graham, M.R., Virtaneva, K., Porcella, S.F., Barry, W.T., Gowen, B.B., John-
son, C.R., Wright, F.A., and Musser, J.M. (2005). Group A Streptococcus tran-
scriptome dynamics during growth in human blood reveals bacterial adaptive
and survival strategies. Am. J. Pathol. 166, 455–465.
Graham, M.R., Virtaneva, K., Porcella, S.F., Gardner, D.J., Long, R.D., Welty,
D.M., Barry, W.T., Johnson, C.A., Parkins, L.D., Wright, F.A., and Musser, J.M.
(2006). Analysis of the transcriptome of group A Streptococcus in mouse soft
tissue infection. Am. J. Pathol. 169, 927–942.
Henningham, A., Chiarot, E., Gillen, C.M., Cole, J.N., Rohde, M., Fulde, M.,
Ramachandran, V., Cork, A.J., Hartas, J., Magor, G., et al. (2012). Conserved
anchorless surface proteins as group A streptococcal vaccine candidates.
J. Mol. Med. (Berl.) 90, 1197–1207.
Hirose, Y., Yamaguchi, M., Okuzaki, D., Motooka, D., Hamamoto, H., Hanada,
T., Sumitomo, T., Nakata, M., and Kawabata, S. (2019). Streptococcus pyo-
genes Transcriptome Changes in the Inflammatory Environment of Necrotizing
Fasciitis. Appl. Environ. Microbiol. 85, e01428-19.
Horstmann, N., Sahasrabhojane, P., Saldaña, M., Ajami, N.J., Flores, A.R., Sumby,
P., Liu, C.G., Yao, H., Su, X., Thompson, E., and Shelburne, S.A. (2015). Charac-
terization of the effect of the histidine kinase CovS on response regulator phos-
phorylation in group A Streptococcus. Infect. Immun. 83, 1068–1077.
Hoste, E., Kemperman, P., Devos, M., Denecker, G., Kezic, S., Yau, N., Gilbert,
B., Lippens, S., De Groote, P., Roelandt, R., et al. (2011). Caspase-14 is
required for filaggrin degradation to natural moisturizing factors in the skin.
J. Invest. Dermatol. 131, 2233–2241.
Humar, D., Datta, V., Bast, D.J., Beall, B., De Azavedo, J.C., and Nizet, V.
(2002). Streptolysin S and necrotising infections produced by group G strepto-
coccus. Lancet 359, 124–129.
Kansal, R.G., McGeer, A., Low, D.E., Norrby-Teglund, A., and Kotb, M. (2000).
Inverse relation between disease severity and expression of the streptococcal
cysteine protease, SpeB, among clonal M1T1 isolates recovered from invasive
group A streptococcal infection cases. Infect. Immun. 68, 6362–6369.
Kawasaki, H., Nagao, K., Kubo, A., Hata, T., Shimizu, A., Mizuno, H., Yamada,
T., and Amagai, M. (2012). Altered stratum corneum barrier and enhanced
percutaneous immune responses in filaggrin-null mice. J. Allergy Clin. Immu-
nol. 129, 1538, 46.e6.
Kubo, A., Ishizaki, I., Kubo, A., Kawasaki, H., Nagao, K., Ohashi, Y., and Ama-
gai, M. (2013). The stratum corneum comprises three layers with distinct
metal-ion barrier properties. Sci. Rep. 3, 1731.
Lei-Leston, A.C., Murphy, A.G., and Maloy, K.J. (2017). Epithelial Cell Inflam-
masomes in Intestinal Immunity and Inflammation. Front. Immunol. 8, 1168.
Lin, J.N., Chang, L.L., Lai, C.H., Lin, H.H., and Chen, Y.H. (2011). Clinical and
molecular characteristics of invasive and noninvasive skin and soft tissue in-
fections caused by group A Streptococcus. J. Clin. Microbiol. 49, 3632–3637.
Lynskey, N.N., Jauneikaite, E., Li, H.K., Zhi, X., Turner, C.E., Mosavie, M.,
Pearson, M., Asai, M., Lobkowicz, L., Chow, J.Y., et al. (2019). Emergence
of dominant toxigenic M1T1 Streptococcus pyogenes clone during increased
scarlet fever activity in England: a population-based molecular epidemiolog-
ical study. Lancet Infect. Dis. 19, 1209–1218.
Metsalu, T., and Vilo, J. (2015). ClustVis: a web tool for visualizing clustering of
multivariate data using Principal Component Analysis and heatmap. Nucleic
Acids Res. 43, W566–W570.
Nakamura, Y., Oscherwitz, J., Cease, K.B., Chan, S.M., Muñoz-Planillo, R.,
Hasegawa, M., Villaruz, A.E., Cheung, G.Y., McGavin, M.J., Travers, J.B.,
et al. (2013). Staphylococcus d-toxin induces allergic skin disease by activating
mast cells. Nature 503, 397–401.
Nakata, M., Kimura, K.R., Sumitomo, T., Wada, S., Sugauchi, A., Oiki, E., Hi-
gashino, M., Kreikemeyer, B., Podbielski, A., Okahashi, N., et al. (2011). As-
sembly mechanism of FCT region type 1 pili in serotype M6 Streptococcus
pyogenes. J. Biol. Chem. 286, 37566–37577.
Nizet, V., Ohtake, T., Lauth, X., Trowbridge, J., Rudisill, J., Dorschner, R.A.,
Pestonjamasp, V., Piraino, J., Huttner, K., and Gallo, R.L. (2001). Innate antimi-
crobial peptide protects the skin from invasive bacterial infection. Nature 414,
454–457.
Patras, K.A., Coady, A., Babu, P., Shing, S.R., Ha, A.D., Rooholfada, E.,
Brandt, S.L., Geriak, M., Gallo, R.L., and Nizet, V. (2020). Host Cathelicidin
Exacerbates Group B Streptococcus Urinary Tract Infection. MSphere 5,
e00932-19.
Proksch, E. (2018). pH in nature, humans and skin. J. Dermatol. 45, 1044–
1052.
Rawlings, A.V., and Harding, C.R. (2004). Moisturization and skin barrier func-
tion. Dermatol. Ther. 17, 43–48.
Sandilands, A., Sutherland, C., Irvine, A.D., and McLean, W.H. (2009). Filaggrin
in the frontline: role in skin barrier function and disease. J. Cell Sci. 122, 1285–
1294.
Savic, D.J., and McShan, W.M. (2012). Long-term survival of Streptococcus
pyogenes in rich media is pH-dependent. Microbiology (Reading) 158, 1428–
1436.
Shelburne, S.A., III, Sumby, P., Sitkiewicz, I., Granville, C., DeLeo, F.R., and
Musser, J.M. (2005). Central role of a bacterial two-component gene regulato-
ry system of previously unknown function in pathogen persistence in human
saliva. Proc. Natl. Acad. Sci. USA 102, 16037–16042.
Shelburne, S.A., III, Keith, D., Horstmann, N., Sumby, P., Davenport, M.T.,
Graviss, E.A., Brennan, R.G., and Musser, J.M. (2008). A direct link between
carbohydrate utilization and virulence in the major human pathogen group A
Streptococcus. Proc. Natl. Acad. Sci. USA 105, 1698–1703.
Shelburne, S.A., Olsen, R.J., Suber, B., Sahasrabhojane, P., Sumby, P.,
Brennan, R.G., and Musser, J.M. (2010). A combination of independent tran-
scriptional regulators shapes bacterial virulence gene expression during infec-
tion. PLoS Pathog. 6, e1000817.
Sumitomo, T., Mori, Y., Nakamura, Y., Honda-Ogawa, M., Nakagawa, S., Ya-
maguchi, M., Matsue, H., Terao, Y., Nakata, M., and Kawabata, S. (2018).
Streptococcal Cysteine Protease-Mediated Cleavage of Desmogleins Is
Involved in the Pathogenesis of Cutaneous Infection. Front. Cell. Infect. Micro-
biol. 8, 10.
Sylvestre, J.P., Bouissou, C.C., Guy, R.H., and Delgado-Charro, M.B. (2010).
Extraction and quantification of amino acids in human stratum corneum in vivo.
Br. J. Dermatol. 163, 458–465.
Takamatsu, D., Osaki, M., and Sekizaki, T. (2001). Thermosensitive suicide
vectors for gene replacement in Streptococcus suis. Plasmid 46, 140–148.
Valdes, K.M., Sundar, G.S., Vega, L.A., Belew, A.T., Islam, E., Binet, R., El-
Sayed, N.M., Le Breton, Y., and McIver, K.S. (2016). The fruRBA Operon Is
Necessary for Group A Streptococcal Growth in Fructose and for Resistance
to Neutrophil Killing during Growth in Whole Human Blood. Infect. Immun. 84,
1016–1031.
Walker, M.J., Barnett, T.C., McArthur, J.D., Cole, J.N., Gillen, C.M., Henning-
ham, A., Sriprakash, K.S., Sanderson-Smith, M.L., and Nizet, V. (2014). Dis-
ease manifestations and pathogenic mechanisms of Group A Streptococcus.
Clin. Microbiol. Rev. 27, 264–301.
Wattam, A.R., Davis, J.J., Assaf, R., Boisvert, S., Brettin, T., Bun, C., Conrad,
N., Dietrich, E.M., Disz, T., Gabbard, J.L., et al. (2017). Improvements to PAT-
RIC, the all-bacterial Bioinformatics Database and Analysis Resource Center.
Nucleic Acids Res. 45, D535–D542.
Zhu, L., Olsen, R.J., Nasser, W., Beres, S.B., Vuopio, J., Kristinsson, K.G.,
Gottfredsson, M., Porter, A.R., DeLeo, F.R., and Musser, J.M. (2015). A molec-
ular trigger for intercontinental epidemics of group A Streptococcus. J. Clin.
Invest. 125, 3545–3559.
Cell Reports 34, 108924, March 30, 2021 11
Report ll
OPEN ACCESS
STAR+METHODS
KEY RESOURCES TABLE
REAGENT or RESOURCE SOURCE IDENTIFIER
Antibodies
Donkey anti-Goat IgG Alexa Fluor 594 Thermo Fisher Scientific Cat# A32758, RRID:AB_2762828
Donkey anti-Rabbit IgG H&L Alexa Fluor 488 Abcam Cat# ab150065, RRID:AB_2860569
Goat polyclonal anti-S. pyogenes carbohydrate Abcam Cat# ab9191, RRID:AB_307061
Rabbit polyclonal anti-caspase-1 GeneTex Cat# GTX14368
Bacterial and virus strains
Streptococcus pyogenes M1T1 strain 5448 Kansal et al., 2000 GenBank: CP008776
XL-10 Gold Agilent Technologies Cat# 200314
Chemicals, peptides, and recombinant proteins
Carboxyfluorescein diacetate succinimidyl ester Invitrogen Cat# C1157
Mutanolysin Sigma Aldrich Cat# M9901
Staurosporine Sigma Aldrich Cat# S6942
Streptozotocin Adipogen Cat# 50-464-382
Critical commercial assays
ATP-bioluminescent assay Kinshiro TOYO B-Net Cat# LL100-1
Click-iT Plus TUNEL Assay Kit (Alexa Fluor 488) Thermo Fisher Scientific Cat# C10617
Glucose Colorimetric Assay Kit II Biovision Cat# K686
LIVE/DEAD Viability/Cytotoxicity Kit Thermo Fisher Scientific Cat# L3224
Deposited data
Raw data files for RNA-sequencing DDBJ SRA SRA: DRA009112
Experimental models: Cell lines
HEK-Blue IL-1b reporter cells InvivoGen Cat# hkb-il1bv2
Human: HaCaT cells (Boukamp et al., 1988) Human: HaCaT cells
Experimental models: Organisms/strains
Filaggrin-null mouse strain (B6.Cg-Flg < tm1 > ) RIKEN BRC RBRC05850
Oligonucleotides
See Table S2 N/A
Recombinant DNA
Plasmid: pSET4-ArcAKO This paper N/A
Plasmid: pSET4-50Flag-CovR This paper N/A
Plasmid: pQE30_arcA This paper N/A
Software and algorithms
CLC Genomics workbench v. 9.5.2 Software https://digitalinsights.qiagen.com/ja/
qiagen-clc-genomics-workbench/
ClustVis Software https://biit.cs.ut.ee/clustvis/
GraphPad Prism7 Software https://www.graphpad.com/scientific-
software/prism/
iDEP.91 Software http://bioinformatics.sdstate.edu/idep/
ImageJ Software https://imagej.nih.gov/ij/
ImageQuant software Software http://www.cytivalifesciences.com/en/us/
shop/protein-analysis/molecular-imaging-
for-proteins/imaging-software/imagequant-
tl-8-1-p-00110
(Continued on next page)
e1 Cell Reports 34, 108924, March 30, 2021
Continued
REAGENT or RESOURCE SOURCE IDENTIFIER
Other
AimStrip Plus blood glucose meter kit Germaine Labs Cat# 37355
Citrate buffer Bioworld Cat# 40320056-2
cOmplete, EDTA (+) Protease Inhibitor Cocktail Roche Molecular Diagnostic Cat# 11697498001
Lysing Matrix B Qbiogene Cat# FAS-210
Lysing Matrix D Qbiogene Cat# FAS-220
Nunc Lab-Tek II Chamber Slide System Thermo Fisher Scientific Cat# 154534
Phenol red broth Sigma Aldrich Cat# P8976
Phos-tag SuperSep Phos-tag Gels Wako Pure Chemical Industries Cat# 195-17991
PhosSTOP Roche Molecular Diagnostic Cat# 4906845001
Quanti-Blue reagent Invivogen Cat# rep-qbs
RNAprotect Animal Blood Tubes QIAGEN Cat# 76544
RNAprotect Bacteria Reagent QIAGEN Cat# 76506
RNeasy Mini Kit QIAGEN Cat# 74104
rRNA removal using a Ribo-Zero rRNA removal kit Illumina Inc Cat# 20040525
Superscript VILO cDNA synthesis kit Thermo Fisher Scientific Cat# 11756050
SYBR green RT-PCR master mix kit Toyobo Cat# QPK-201
Todd-Hewitt broth BD Biosciences Cat# 249240
TruSeq RNA Sample Prep kit, v2 Illumina Inc Cat# RS-122
Yeast extract BD Biosciences Cat# 212750
Report ll
OPEN ACCESS
RESOURCE AVAILABILITY
Lead contact Further information and requests for reagents may be directed to, and will be fulfilled by the corresponding author Yujiro Hirose
Materials availability This study did not generate new unique reagents.
Data and code availability The accession number for the bacterial RNA-seq reads reported in this paper is SRA: DRA009112 .
EXPERIMENTAL MODEL AND SUBJECT DETAILS
Bacterial strains and culture conditions Streptococcus pyogenes M1T1 strain 5448 (GenBank: CP008776.1) was isolated from a patient with toxic shock syndrome and
necrotizing fasciitis that is genetically representative of a globally disseminated clone associated with invasive S. pyogenes infections
(Kansal et al., 2000). S. pyogenes strains were grown at 37�C in a screw-cap glass tube (Pyrex; Iwaki Glass, Tokyo, Japan) filled with Todd-Hewitt broth (BD Biosciences, San Jose, CA, USA) supplemented with 0.2% yeast extract (BD Bioscience) (THY broth) in an
ambient atmosphere and standing cultures. To obtain cultures for experiments and observe pH change, overnight cultures of
S.pyogenes were back diluted 1:50 into fresh THY broth or phenol red broth (Sigma Aldrich, St Louis, MO, USA) supplemented
with 30 mM arginine. CFUs were determined by plating diluted samples on THY blood agar.
Escherichia coli strain XL-10 Gold (Agilent Technologies, Santa Clara, CA, USA) was used as a host for derivatives of plasmids
pSET4s (Takamatsu et al., 2001) and pQE30 (QIAGEN, Hilden, Germany). E. coli strains were cultured in Luria-Bertani medium
(Nacalai Tesque, Kyoto, Japan) at 37�C with agitation. For selection and maintenance of strains, antibiotics were added to the me- dium at the following concentrations: spectinomycin, 100 mg/mL for S. pyogenes and E. coli: carbenicillin, 100 mg/mL for E. coli.
Construction of mutant strains An in-frame arcA deletion mutant (DarcA) and its revertant strain (Wr) with a background of strain 5448 (WT) were constructed using
the pSET4s temperature-sensitive shuttle vector, as previously reported (Nakata et al., 2011). A pSET4-ArcAKO plasmid harboring
the DNA fragment, in which upstream and downstream regions of arcA were linked by overlapping PCR, was electroporated into
Cell Reports 34, 108924, March 30, 2021 e2
Report ll
OPEN ACCESS
strain 5448 and grown in the presence of spectinomycin. The plasmid was then integrated into the chromosome via first allelic
replacement at 37�C, after which it was cultured at 28�C without antibiotics to induce the second allelic replacement. The deletion of arcA was confirmed by site-specific PCR using purified genomic DNA. Primers are listed in Table S2.
Cell culture and media We used the immortal human keratinocyte line, HaCaT cells. HaCaT cells were cultured in Dulbecco’s Modified Eagle Media (DMEM,
Cat#: 10-013-CV, Corning, NY, USA), with 10% Fetal Bovine Serum (Cat# 97068-085, VWR International LLC, Radnor, USA). The cell
culture was maintained in a humidified 5% CO2 atmosphere at 37 �C. The cells were cultured to around 70% confluence. To subcul-
ture cells, adherent cells were rinsed with PBS without calcium and magnesium, and detached by using trypsin/EDTA solution
(0.05% trypsin, 0.53 m EDTA) for ~10 min, added fresh culture medium, centrifuged, resuspended cells in fresh culture medium,
and dispensed into new culture vessels. For all experiments, freshly trypsinized cells were seeded at a density of ~1 3 105cells/
cm2 one day prior to bacterial infection.
Murine model of epicutaneous and intravenous infections All mouse experiments were conducted in accordance with animal protocols approved by the Animal Care and Use Committee of
Osaka University Graduate School of Dentistry (30-011-0) and University of California San Diego Institutional Animal Care and
Use Committee (IACUC). The filaggrin null mouse strain (B6.Cg-Flg < tm1 > , RBRC05850) was provided by RIKEN BRC through
the National Bio-Resource Project of the MEXT, Japan.
Epicutaneousinfectionswereperformed usingapreviouslyreportedwithminormodifications(Nakamuraetal.,2013;Sumitomoetal.,
2018). Briefly, bacterial cultures during exponential phase were centrifuged, washed with and resuspended in PBS. Dorsal skin of
C57BL/6 wild-type (wt) mice (6- to 7-week-old, both female and male; Japan SLC, Shizuoka, Japan) and the filaggrin null (Flg�/�) mice (Kawasaki et al., 2012) (6- to 7-week-old, both female and male) was depilated 2 days before infection. A bacterial suspension
(5 3 105-107 CFU in 100 mL PBS) was placed on a 1 3 1 cm patch of sterile gauze, which is secured to the shaved skin with a transparent
bio-occlusive dressing. At 3 hours post-infection, bacteria on the skin surface were collected by using a stainless dental scaler, then
bacterial RNA was extracted and quantified by qPCR as described above. At 3 days post-infection, cutaneous tissue was excised
for histopathologic analyses and assessment of bacterial burden. Cutaneous tissue samples were obtained and fixed with formalin,
then embedded in paraffin, sectioned, and subjected to hematoxylin and eosin (HE) staining. Bacterial counts in cutaneous tissue ho-
mogenates were determined after plating serial dilutions, with those in the cutaneous tissue corrected for differences in tissue weight.
For intravenous infection, C57BL/6 wild-type mice (6- to 7-week-old, both female and male; Japan SLC) were intravenously in-
fected with 2 3 106 CFU of S. pyogenes during exponential phase, and survival was monitored for 14 days.
Mouse model of S. pyogenes necrotizing skin infection Invasiveness of S. pyogenes in mouse skin was measured by modification of a previously described S. pyogenes infection model
(Nizet et al., 2001). All mouse experiments were conducted in accordance with animal protocols approved by the Animal Care
and Use Committee of Osaka University Graduate School of Dentistry (30-011-0). The CD-1 (Slc: ICR) mice (6 weeks old, female;
Japan SLC, Shizuoka, Japan) were shaved and hair removed by chemical depilation (Veet, Oxy Reckit Benckiser, Chartes, France).
S. pyogenes were cultured until the log phase (OD600 = 0.5~0.6), and adjusted 1 3 10 7 CFU in 200 mL of PBS were injected subcu-
taneously. Areas with ulcer were defined as lesions and areas were measured daily for up to 3 days after infection.
Mouse model of intraperitoneal infection Intraperitoneal infections were performed using a previously reported method with minor modifications (Valdes et al., 2016). C57BL/6
wild-type (wt) mice (6- to 7-week-old, both female and male; Japan SLC, Shizuoka, Japan) and the filaggrin null (Flg�/�) mice (Kawasaki et al., 2012) (6- to 7-week-old, both female and male) were intraperitoneally injected with 2.5 3 108 CFU in 100 mL of
PBS. Mouse survival was monitored for 14 days.
Streptozotocin-induced diabetic mice To induce diabetes mellitus, C57BL/6 male mice (4-week-old) were injected i.p. with streptozotocin (Adipogen, San Diego, CA, USA)
at 80 mg/kg/dose in 200 mL of 0.1 M citrate buffer daily for 4 days (Patras et al., 2020). Control mice received 4 daily treatments of
200 mL of 0.1 M citrate buffer. Mice were weighed weekly thereafter. The concentration of blood glucose in 7-week-old mice was
determined 24 h prior to infection. Sample glucose was determined using an AimStrip Plus blood glucose meter kit (Germaine
Labs, Indianapolis, IN, USA).
METHOD DETAILS
Quantitative real-time PCR (qPCR) Bacterial cultures during exponential phase (OD600 = 0.5-0.6), early stationary phase (OD600 = 1.2), or decline phase (overnight
culture) were centrifuged and immediately placed into RNAprotect Bacteria Reagent (QIAGEN) prior to RNA isolation. In the RNA
isolation from S. pyogenes cultured within CDM, bacterial cultures during exponential phase (OD600 = 0.5-0.6) were centrifuged,
e3 Cell Reports 34, 108924, March 30, 2021
Report ll
OPEN ACCESS
resuspended into CDM, incubated in a screw cap glass tube (Pyrex; Iwaki Glass, Tokyo, Japan) for 1 h at 37�C, and immediately placed into RNAprotect Bacteria Reagent. S. pyogenes was resuspended into lysing Matrix B microtubes containing 0.1-mm silica
spheres (Qbiogene, Carlsbad, CA, USA) with RLT lysis buffer (RNeasy Mini Kit; QIAGEN), and homogenized at 6,500 rpm for 60 s
using the MagNA Lyser (Roche Molecular Diagnostic, Mannheim, Germany). RNA was isolated from the lysate with RNeasy Mini
Kit according to the manufacturer’s guidelines, and then cDNA was synthesized using a Superscript VILO cDNA synthesis kit
(Thermo Fisher Scientific, Waltham, MA, USA). Real-time reverse transcription PCR analysis was performed using a StepOnePlus
real-time PCR system (Applied Biosystems, Foster City, CA, USA) and Toyobo SYBR green RT-PCR master mix kit (Toyobo Life Sci-
ence, Osaka, Japan). Data for 16S rRNA or rpoB were used as the internal control. Primers used for qPCR are listed in Table S2.
Measurement of glucose and ammonium ion concentrations Culture supernatant at each growth phase obtained from S. pyogenes WT and DarcA cultured in THY broth was filtered through a
0.22 mm membrane, then and directly analyzed with BioProfile� FLEX2 analyzer following manufacturer’s instruction (Nova Biomed- ical, Inc., Waltham, MA, USA).
Measurement of extracellular pH For phenol red broth (Sigma Aldrich, St Louis, MO, USA) supplemented with 30 mM arginine, culture supernatant at each point was
measured the absorbance at 550 nm. A calibration curve was determined in phenol red broth which adjusted to pH values ranging
from 4 to 10. The pH values were assessed up to 40 days in the sample which included surviving bacteria. For THY broth, culture
supernatant at each point was supplemented with 5 mg/mL phenol red and the absorbance was measured at 550 nm. A
calibration curve was determined in THY broth which was supplemented with 5 mg/mL phenol red and adjusted to pH values ranging
from 4 to 10.
Measurement of intracellular pH The cytosolic pH of S. pyogenes was determined based on the previously described fluorescent probe method (Do et al., 2019).
Briefly, S. pyogenes grown to log phase of growth in THY broth were centrifugated, washed in 150 mM NaCl, and resuspended in
50 mM HEPES buffer (pH 8.0). The cells were then incubated for 20 min at 37 �C in the presence of 10 mM carboxyfluorescein diac- etate succinimidyl ester (cFDASE, Invitrogen, Grand Island, NY, USA). cFDASE is hydrolyzed to carboxyfluorescein succinimidyl
ester (cFSE) in the cell and subsequently conjugated to aliphatic amines of the intracellular proteins. After incubation, cells were
washed and suspended in 50 mM potassium phosphate buffer (pH 7.5). To eliminate nonconjugated cFSE, cells were incubated
with 10 mM glucose for 30 min at 30 �C. Subsequently, S. pyogenes were washed, and suspended, and incubated in CDM at 37�C within a screw-cap glass tube. At 1 h, 5 h, and 15 h post-incubation, fluorescence intensities were determined with an excitation spectrum of 400-500 nm wavelength range that includes excitation wavelengths 490 nm (pH-sensitive) and 435 nm (pH-insensitive)
(Spark 10M; TEKAN, Männedorf, Switzerland). Emission was determined at 520 nm. The ratio of the emission resulting from
excitation at 490 and 435 nm obtained for both cell suspension (C) and filtrate (F) was calculated as R 490/435 = (C490 - F490)/
(C 435 - F435). A calibration curve was determined in CDM adjusted to pH values ranging from 5.5 to 8.0 and a cubic equation
for the ratio value was determined. Intracellular pH values of S. pyogenes were calculated using the cubic equation from the calibra-
tion curve.
Infection of HaCaT cells with S. pyogenes The composition of Chemically Defined Medium (CDM) is shown in Table S1. S. pyogenes in log phase growth in THY broth
were centrifuged and resuspended into CDM supplemented with or without 1000 mM arginine. HaCaT cells were infected with
S. pyogenes (MOI = 500). At 20 h post-incubation, supernatants were collected by centrifugation and analyzed for cytotoxicity
assays, IL-1b signaling assay, and cells were used for the apoptosis determination.
Cytotoxicity assays Cell viability was assessed using the LIVE/DEAD� Viability/Cytotoxicity Kit (Thermo Fisher Scientific). LDH activity in the culture su- pernatant was measured by using LDH Assay Kit-WST (Dojindo, Kumamoto, Japan). At 1 h, 5 h, and 15 h post-infection, the bacterial
count in CDM with cultured HaCaT cells was evaluated by combining CFUs from supernatant and those from associated with HaCaT
cells. To determine bacterial association, HaCaT cells were harvested with PBS containing 0.05% trypsin and 0.025% Triton X-100.
Measurement of intracellular ATP levels At 1 h, 5 h, and 15 h post-incubation in CDM, the intracellular ATP levels of S. pyogenes were also evaluated by an ATP-biolumines-
cent assay using Kinshiro (TOYO B-Net, Tokyo, Japan) according to manufacturer’s instructions. Briefly, ATP extractant solution was
added to equal amount of the mixture of CDM and S. pyogenes. After the incubation for 10 s at room temperature, 100 mL samples
were mixed with equal amount of bioluminescent reagent, and bioluminescence was measured with a luminometer (Infinite 200 Pro
multiplate reader, TEKAN, Männedorf, Switzerland), immediately. After establishing of the calibration curve, the ATP concentrations
in the samples were determined, and the percentage of ATP levels for S. pyogenes at 0 h post-incubation was calculated.
Cell Reports 34, 108924, March 30, 2021 e4
Report ll
OPEN ACCESS
RNA-seq and data analysis Bacterial cultures during exponential phase were centrifuged, resuspended into CDM, and incubated in a screw-cap glass tube
(Pyrex; Iwaki Glass, Tokyo, Japan) for 1 h at 37�C. RNA samples of S. pyogenes were obtained after incubation, as described above. RNA integrity was assessed using a 2100 Bioanalyzer (Agilent Technologies, Santa Clara, CA, USA). For RNA-seq, bacterial RNA was
treated for rRNA removal using a Ribo-Zero rRNA removal kit (Illumina Inc., San Diego, CA, USA). RNA-seq libraries were created
using a TruSeq RNA Sample Prep kit, v2 (Illumina Inc.), according to the manufacturer’s recommendations. Libraries were sequenced
using Illumina HiSeq 2500 systems, with 75-bp single-end reads. RNA-seq reads were mapped against the S. pyogenes strain
5448 genome using the commercially available CLC Genomics workbench, v. 9.5.2 (CLC Bio, Aarhus, Denmark). Global analyses
of RNA-seq expression data were performed using iDEP (Ge et al., 2018), with the FPKM value of each sample. We classified the
differentially expressed genes (DEGs) into functional categories based on the bacterial bioinformatics database and analysis
resource PATRIC (Wattam et al., 2017). The heatmap was visualized by use of the web tool ClustVis (Metsalu and Vilo, 2015) with
default parameters.
Phos-tag western blotting for the detection of phosphorylated CovR For this experiment, we constructed in-frame 50-3xflag-tagged covR insertion mutants (50Flag-CovR) of WT and DarcA. Utilizing strain 5448 genome DNA as a template, two other DNA fragments were amplified using primer sets 50Flag-CovRF1 and 50Flag- CovRR1, or 50Flag-CovRF1 and 50Flag-CovRR1 (Table S2). Then, two fragments were PCR-linked, and a fragment encoding 50-3xflag-tagged covR was created. Finally, a pSET4-50Flag-CovR plasmid harboring 50-3xflag-tagged covR was transformed to generate 50Flag-CovR strain, as described above.
Bacterial cultures during exponential phase were centrifuged, resuspended into CDM, and incubated in a screw-cap glass tube for
1 h at 37�C. To extract total protein from S. pyogenes, we prepared our original lysis buffer which contains 10 U mutanolysin (Sigma Aldrich), cOmplete, EDTA (+) Protease Inhibitor Cocktail (Roche Molecular Diagnostic, Pleasanton, CA, USA), and PhosSTOP (Roche
Molecular Diagnostic) in PBS. Bacterial cultures in THY broth during exponential phase or incubated S. pyogenes in CDM were
centrifuged, and resuspended into lysing Matrix B microtubes containing 0.1-mm silica spheres with our original lysis buffer, and ho-
mogenized at 6,500 rpm for 30 s using the MagNA Lyser (Roche Molecular Diagnostic). The lysates were centrifuged, and the super-
natants were applied to SDS-PAGE (Phos-tag SuperSep Phos-tag Gels; Wako Pure Chemical Industries, Osaka, Japan). The gel was
transferred onto the Immobilon-FL PVDF (Millipore, Billerica, MA, USA) and phosphorylated CovR was detected by Anti-DDDDK-tag
mAb-Alexa Fluor� 488 (MBL, Nagoya, Japan). Labeled proteins were visualized using Amersham Typhoon RGB Biomolecular Imager (Amersham Biosciences-GE Healthcare, Piscataway, NJ, USA). Relative percentage of phosphorylated CovR were calcu-
lated using ImageQuant software (Molecular Dynamics, Sunnyvale, CA, USA).
Detection of glucose concentration on the skin At 48 h after depilation of dorsal skin of mice, a cup was placed on the skin and 100 mL PBS was injected. Then the skin was scratched
by disposable inoculating loops and the sample was collected. Glucose concentration was measured with Glucose Colorimetric
Assay Kit II (Biovision, Milpitas, CA, USA) following manufacturer’s instruction.
Blood bactericidal assay Heparinized mouse blood (190 mL) and exponential phase bacteria (1.5 3 106 CFU in 10 mL of PBS) were mixed in 96-well plates and
incubated at 37�C in 5% CO2 for 1, 2, or 3 hours. Viable cell counts were determined by plating diluted samples on THY blood agar. At 3 hours post mixing, bacterial RNA in blood were also isolated for qPCR. Blood samples were mixed with the component
of RNAprotect� Animal Blood Tubes (QIAGEN), and centrifuged. Pellets were placed in lysing Matrix D microtubes containing 1.4-mm silica spheres (Qbiogene) with RLT lysis buffer (RNeasy kit; QIAGEN) and homogenized at 6,500 rpm for 45 s using a MagNA
lyser. The lysate was centrifuged, and the obtained pellet was resuspended in lysing Matrix B microtubes containing 0.1-mm silica
spheres (Qbiogene) with the RLT lysis buffer and homogenized at 6,500 rpm for 60 s using the MagNA lyser. The final lysate was
centrifuged and bacterial RNA was isolated from the collected supernatant with a RNeasy kit, according to the manufacturer’s
guidelines.
Immunofluorescence staining Paraffin sections of cutaneous tissues of non-infected mice were subjected to immunofluorescence staining to detect filaggrin of
mice. Following deparaffinization, sections in a 10 mM sodium citrate solution (pH 6.0) were heated for 5 min in a pressure cooker
to retrieve the antigens.
Paraffin sections of cutaneous tissues at 24 hours post-infection were subjected to immunofluorescence staining to detect
S. pyogenes, bacterial ArcA, and caspase-1 of host cells. ArcA was detected with rabbit antiserum against recombinant ArcA pro-
teins which were purified from pQE30-ArcA transformed XL10-Gold by using Ni-NTA resin. Following deparaffinization, sections in a
10 mM sodium citrate solution (pH 6.0) were heated for 5 min in a pressure cooker. To visualize S. pyogenes and bacterial ArcA, goat
polyclonal antibody to S. pyogenes carbohydrate (1/100; Abcam, Cambridge, MA, USA) and rabbit antiserum against recombinant
ArcA (1/100) were applied after blocking with PBS containing 2% normal donkey serum. To visualize S. pyogenes and caspase-1
of host cells, goat polyclonal antibody to S. pyogenes carbohydrate (1/100) and rabbit polyclonal antibody to caspase-1 (1/100;
e5 Cell Reports 34, 108924, March 30, 2021
Report ll
OPEN ACCESS
GeneTex, Irvine, CA, USA) were applied after blocking with PBS containing 2% normal donkey serum. Then, to visualize both of them,
donkey anti-Goat IgG Alexa Fluor 594 (1/200; Thermo Fisher Scientific), and donkey anti-Rabbit IgG H&L Alexa Fluor 488 (1/200; Ab-
cam) were applied as the secondary antibody.
Finally, all sections were mounted with ProLong Gold (Thermo Fisher Scientific). Stained tissue sections were examined with a
Keyence microscope (Keyence Japan, Tokyo, Japan).
IL-1b signaling assay Stably transfected HEK-Blue IL-1b reporter cells (InvivoGen, San Diego, CA, USA) (40,000 cells per well in 96-well plates), were
stimulated at 37�C in 5% CO2 with 50 mL of supernatants from infected HaCaT cells. After 18 h stimulation, supernatants from the HEK-Blue cells were analyzed for secreted alkaline phosphatase activity by the addition of 50 mL of supernatants onto 150 mL of
Quanti-Blue reagent (Invivogen) and monitoring the optical density at 620 nm via EnSpire plate reader (PerkinElmer).
Apoptosis determination by Terminal transferase deoxytidyl uridine end labeling (TUNEL) staining At 20 h post-incubation, detection of apoptosis by TUNEL was performed using Click-iT Plus TUNEL Assay Kit (Alexa Fluor 488)
(Thermo Fisher Scientific, Waltham, MA, USA) following manufacturer’s instruction. HaCaT cells were cultured and infected on pre-
coated poly-L-lysine-chamber slide (Nunc Lab-Tek II Chamber Slide System) (Thermo Fisher Scientific). As a control, apoptosis of
HaCaT cells were induced by treating with 0.5 mM staurosporine for 4 hours to induce apoptosis. Coverslips were mounted on slide
glasses with ProLong Gold Antifade Reagent with DAPI (Thermo Fisher Scientific). The number of TUNEL-positive and DAPI-stained
nuclei were determined and the apoptosis percentage was expressed as the ratio between TUNEL-positive and DAPI-stained nuclei.
Six fields per condition (100 cells each) were observed. Cells were visualized using a Zeiss Axio Observer.D1 fluorescence
microscope.
QUANTIFICATION AND STATISTICAL ANALYSIS
Statistical analysis was performed using GraphPad Prism version 7.0 (GraphPad Software Inc., La Jolla, CA, USA). Kruskal-Wallis
test with Dunn’s post hoc test was used for multiple comparisons. Differences between groups were analyzed using a Mann-Whitney
U test. A Mouse survival was analyzed with a log-rank test. Sample sizes and p values are indicated in figure legends.
Cell Reports 34, 108924, March 30, 2021 e6
Cell Reports, Volume 34
Supplemental information
Streptococcus pyogenes upregulates
arginine catabolism to exert
its pathogenesis on the skin surface
Yujiro Hirose, Masaya Yamaguchi, Tomoko Sumitomo, Masanobu Nakata, Tomoki Hanada, Daisuke Okuzaki, Daisuke Motooka, Yasushi Mori, Hiroshi Kawasaki, Alison Coady, Satoshi Uchiyama, Masanobu Hiraoka, Raymond H. Zurich, Masayuki Amagai, Victor Nizet, and Shigetada Kawabata
1
Figure S1. Effects of arginine catabolism on extracellular or intracellular pH, and the cytotoxicity.
Related to Figures 1 and 2. (A) Arginine catabolism in S. pyogenes. Through the multienzyme pathway,
arginine is transported into the cell via the antiporter ArcD and catabolized by ArcA, ArcB, and ArcC to
produce one molecule of carbon dioxide, one molecule of ATP, and two molecules of ammonia. ArcA,
2
arginine deiminase; ArcB, ornithine carbamoyltransferase; ArcC, carbamate kinase; ArcD,
arginine/ornithine antiporter. (B) Relationship between pH level of bacterial culture and bacterial viability.
A picture indicates pH levels of bacterial cultures in phenol red broth supplemented with 30 mM arginine
at 24 h post-incubation. (C) Temporal pH change of bacterial cultures in THY broth. (D) Arginine
catabolism-dependent cytotoxicity of S. pyogenes against HaCaT cells in a dose-dependent manner.
Means + S.E. (n = 4) are shown. Differences between groups were analyzed using a Mann-Whitney U
test. **p < 0.01. (E) Intracellular pH values of S. pyogenes in CDM. Arg(-), strains in CDM without
arginine. Arg(+), strains in CDM with 1000 μM arginine.
3
Figure S2. The virulence of S. pyogenes strains in other infection model, and arginine- or glucose-
dependent up-regulation of slo gene expression levels of S. pyogenes. Related to Figures 3 and 4. (A)
Mouse model of S. pyogenes necrotizing skin infection. Error bars indicated the mean Error bars indicated
the mean ± S.E (n = 16). Statistical differences between groups were analyzed using a Kruskal-Wallis test
with Dunn's post hoc test. **p < 0.01. (B) Mouse model of intraperitoneal infection (n = 10). Flg-/-,
filaggrin knock-out mice. (C, D, E) Arginine catabolism independent virulence on the skin of diabetic
mice. (C) An image of the sample collection for measuring the glucose concentration on the skin. (D) The
4
glucose concentration on the skin both wild-type (wt) mice and diabetic mice (n = 10). (E) CFUs in skin
lesions at 3 days post-infection in murine model of epicutaneous infection (n = 5). Error bars indicated the
mean ± S.E. Statistical differences between groups were analyzed using a Mann-Whitney U test. **p <
0.01. (F, G) Arginine- or glucose- dependent up-regulation of slo gene expression levels of S. pyogenes.
qRT-PCR was conducted by using RNA samples cultured in CDM for 1 h. Arginine (+), strains in CDM
with 1000 μM arginine. Glucose (+), strains in CDM with 1000 μM glucose. The 16S rRNA was used as
the internal control. Data from three independent qRT-PCR assays, each performed in triplicate, were
pooled and normalized. Vertical lines represent the mean + S.E. (n = 9). **p < 0.01. *p < 0.05.
5
Figure S3. The expression of transporter genes of S. pyogenes during epicutaneous infection. Related
to Figure 3. qRT-PCR was conducted by using RNA samples which were collected from wild-type mice
skin surface at 3 hours post-infection. Figure shows the gene expression of WT as compared to that in
ΔarcA. In our RNA-seq data in vitro, 4 genes associated with phosphotransferase system (PTS) were
upregulated in WT strain under arginine-rich condition, including mannose/fructose/sorbose family IID
component (ptsD), mannose/fructose/sorbose family IIA component (SP5448_05675), cellobiose-specific
IIB component (SP5448_08850), cellobiose-specific IIA component (SP5448_08855). Therefore, we
evaluated the expression of transporter genes at 3 hours post-infection. The 16S rRNA was used as the
internal control. Data from three independent qRT-PCR assays, each performed in triplicate, were pooled
and normalized. Vertical lines represent the mean + S.E. (n = 9).
6
Figure S4. The expression of covS, slo, and arcA genes of S. pyogenes during epicutaneous infection.
Related to Figures 3 and 4. qRT-PCR was conducted by using RNA samples which were collected from
wild-type (wt) or filaggrin knock-out (Flg-/-) mice skin surface at 3 hours after epicutaneous infection.
Data shown are log2-fold expression normalized to rpoB transcript levels. Shelburne et al. used proS
transcript levels for normalization relative to a housekeeping gene (Shelburne et al., 2008 DOI:
10.1073/pnas.0711767105). However, our RNA-seq results indicate proS transcript levels were
significantly downregulated dependently of arginine-catabolism. Therefore, rpoB transcript levels were
used for normalization. Data from two independent qRT-PCR assays, each performed in triplicate, were
pooled and normalized. Vertical lines represent the mean + S.E. (n = 6). Statistical differences between
groups were analyzed using a Mann-Whitney U test. **p < 0.01.
7
Figure S5. Involvement of Streptolysin O (SLO) in arginine-dependent cytotoxicity. Related to
Figure 4. A-D, In CDM supplemented with or without 1000μM arginine, HaCaT cells were co-incubated
with S. pyogenes WT or Δslo mutant at MOI 500 for 20 h. (A) Detection of LDH in culture supernatants.
(B) Quantification of mature IL-1β in culture supernatants for detecting pyroptosis. (C) TUNEL reaction
for detecting apoptosis. TUNEL-positive and DAPI-stained cells are indicated green and blue,
respectively. The percentage of TUNEL-positive cells was calculated as the ratio between TUNEL-
positive and DAPI-stained nuclei ×100. Representative data obtained from at least 3 independent
experiments are shown. Vertical lines represent the mean + S.E. (n = 6). Statistical differences between
groups were analyzed using a Mann-Whitney U test. **p < 0.01.**p < 0.01.
8
Table S1: Composition of the chemically defined medium. Related to Figures 1 and 2
Supplemental Table 2: Composition of the chemically defined medium.
Effective chemical Amount (mg/L) L-Arginine 0.00
L-Cystine 48.34
L-Glutamine 584.00
Glycine 30.00
L-Histidine HCl H2O 42.00
L-Isoleucine 105.00
L-Leucine 105.00
L-Lysine HCl 146.00
L-Methionine 30.00
L-Phenylalanine 66.00
L-Serine 42.00
L-Threonine 95.00
L-Tryptophan 16.00
L-Tyrosine 71.59
L-Valine 94.00
D-1/2Ca Pantothenate 4.00
Choline Chloride 4.00
Folic Acid 4.00
i-Inositol 7.20
Niacinamide 4.00
Pyridoxine HCl 4.00
Riboflavin 0.40
Thiamine HCl 4.00
CaCl2 200.00
KCl 400.00
MgSO4 97.67
NaCl 6400.00
NaHCO3 3700.00
NaH2PO4 108.70
Trace elements Fe(NO3)3 9H2O 0.10
Amino acids
Vitamins
Inorganic components
9
Table S2. Primers used in this study. Related to Figures 1, 2, and 3.
Primer Sequence (5’-3’) Purpose
ArcAKOF1 GTTAAGCTTGTTGAGGGTCC Construction of pSET4-ArcAKO
ArcAKOR1 AAGAGATATCTCTTTCTAATTGG Construction of pSET4-ArcAKO
ArcAKOF2 TAAGATATCGTAAAGGTGGTTAT Construction of pSET4-ArcAKO
ArcAKOR2 AAGGATCCATGAGGCACACC Construction of pSET4-ArcAKO
ArcAKOcheckF AGAGATGAGGGAACGTATGAGTTG Confirmation of arcA deletion
ArcAKOcheckR AAGGATAGCACCAGTCACAAGAAG Confirmation of arcA deletion
5'Flag-CovRF1 CGCGGATCCCGGTCTCTCGTTTGATCGTT Construction of pSET4-5’Flag-CovR
5'Flag-CovRR1 CTTGTCATCGTCATCCTTGTAATCGATGTCATGATCTTTATAATCACC GTCATGGTCTTTGTAGTCCATTTATACCAACCCTTATCC
Construction of pSET4-5’Flag-CovR
5'Flag-CovRF2 GACTACAAAGACCATGACGGTGATTATAAAGATCATGACATCGATTA CAAGGATGACGATGACAAGACAAAGAAAATTTTAATTATTG
Construction of pSET4-5’Flag-CovR
5'Flag-CovRR2 CCGGAATTCGGCAGAGAAAATGCAGAAAAA Construction of pSET4-5’Flag-CovR
5'FlagCovRCheckF GACGGTGATTATAAAGATCATG Confirmation of 5'Flag-CovR
5'FlagCovRCheckR CATGATTGCCATACGGTCAG Confirmation of 6'Flag-CovR
5448arcAF GGTGGCAAAGTGCCTATGGTT qPCR of arcA
5448arcAR AAGTTCGTCCCCACCTTCAAT qPCR of arcA
5448sagAF TGAGAATTACCACTTCCAGTAGCAA qPCR of sagA
5448sagAR CTCCTGGAGGCTGCTGTTG qPCR of sagA
5448sloF ACCTATCCAGCAGCCCTTCA qPCR of slo
5448sloR CTACCGCGTCTGGTTTGTTTTC qPCR of slo
5448speBF GGCGGACATGCCTTTGTT qPCR of speB
5448speBR TCCACCCCAACCCCAGTTA qPCR of speB
544816SrRNAF GTTTCAACCTTGCGGTCGTACT qPCR of 16SrRNA
544816SrRNAR GGGCTTAGTGCCGGAGCTA qPCR of 16SrRNA
5448rpoBF CGTCCAGGTGAGCCAAAAA qPCR of rpoB
5448rpoBR CATCAAAGAAACGCGCAATC qPCR of rpoB
5448covSF TTGGCTACTAGTTGTTGAGTTATTTGG qPCR of covS
5448covSR GCGCCGCGTAGTAATTAAGATG qPCR of covS
5448ptsDF GCTCAATGACGGCTTCAAAT qPCR of ptsD
5448ptsDR CTGCTTCTTTGGCACCTTTC qPCR of ptsD
544808850F AAGCCTATGCTCAAGGGAAA qPCR of SP5448_08850
544808850R GCCTAAAAGTGCCACATCAA qPCR of SP5448_08850
544808855F CTTGCCCAAGAAGCTAGTGGTA qPCR of SP5448_08855
544808855R CGTCATCAAGTGATCCTGTGAGT qPCR of SP5448_08855
544805675F AGCAGATGAGCAGGGCCTTAT qPCR of SP5448_05675
544805675R AGCGGTTACCATTTTCTGATTCA qPCR of SP5448_05675
arcA_pQE30_F1 CACCATCACCATCACATGACTGCTCAAACACCAATTCATG Construction of pQE30-ArcA
arcA_pQE30_R1 CAAGCTCAGCTAATTTTAAATATCTTCACGTTCAAATGGC Construction of pQE30-ArcA
pQE30_arcA_F1 CGTGAAGATATTTAAAATTAGCTGAGCTTGGACTCCTGTT Construction of pQE30-ArcA
pQE30_arcA_R1 TGTTTGAGCAGTCATGTGATGGTGATGGTGATGCGATCCT Construction of pQE30-ArcA
- CELREP108924_annotate_v34i13.pdf
- Streptococcus pyogenes upregulates arginine catabolism to exert its pathogenesis on the skin surface
- Introduction
- Results
- S. pyogenes ADI pathway contributes to its viability and virulence
- S. pyogenes arginine catabolism changes global gene expression
- ADI pathway contributes to the development of cutaneous lesions
- ADI-pathway-dependent bacterial virulence was canceled in Flg−/− mice
- Discussion
- Supplemental information
- Acknowledgments
- Author contributions
- Declaration of interests
- References
- STAR★Methods
- Key Resources Table
- Resource availability
- Lead contact
- Materials availability
- Data and code availability
- Experimental model and subject details
- Bacterial strains and culture conditions
- Construction of mutant strains
- Cell culture and media
- Murine model of epicutaneous and intravenous infections
- Mouse model of S. pyogenes necrotizing skin infection
- Mouse model of intraperitoneal infection
- Streptozotocin-induced diabetic mice
- Method details
- Quantitative real-time PCR (qPCR)
- Measurement of glucose and ammonium ion concentrations
- Measurement of extracellular pH
- Measurement of intracellular pH
- Infection of HaCaT cells with S. pyogenes
- Cytotoxicity assays
- Measurement of intracellular ATP levels
- RNA-seq and data analysis
- Phos-tag western blotting for the detection of phosphorylated CovR
- Detection of glucose concentration on the skin
- Blood bactericidal assay
- Immunofluorescence staining
- IL-1β signaling assay
- Apoptosis determination by Terminal transferase deoxytidyl uridine end labeling (TUNEL) staining
- Quantification and statistical analysis