BIO 151 Lab

Name ___________________________ Section ___________BIOL 151 – Spr 2020 Dr. Gulrud

Exercise 4: Chapters 14 and 15

Instructions: Read the corresponding textbook chapters, listen to the lecture recordings and

animations, and check your understanding with Kahoot. Then answer all of the following questions and

submit your completed worksheet to the D2L dropbox before 11:59 pm on May 2nd. Late assignments

will only be accepted in excusable circumstances verified with documentation. Assignments can be

submitted into a dropbox on D2L before 11:59 pm on the due date. An answer key will be posted on

D2L Brightspace on May 3rd. You are strongly encouraged to review the answer key to help prepare for

your unit exam. Be sure to include your name and lab section.

1. You are working on a report for BIOL 151. Describe two observations that support the

CORRECT hypothesis that DNA is the genetic material.

2. Place the following enzymes in the order in which they function during DNA replication

in E. coli and describe their role/function.

(DNA Pol I, DNA Pol III, Primase, Ligase, Helicase)

1.

2.

3.

4.

5.

3. Draw replication of 1 strand of the E. coli genome using different colors to represent

RNA versus DNA.

4. Beadle and Tatum performed experiments with bread mold (Neurospora crassa) that

helped identify the relationship between genes and enzymes. Using their experimental

setup, identify which of the following mutants would grow and which would not grow on

minimal media supplemented with the indicated intermediate molecules. (Hint: Consult

figure 15.1 in your textbook.)

Gene Mutated Molecule

Supplemented Growth or No Growth?

argE Citruline

argF Glutamate

argG Ornithine

argG Citruline

argH Arginine

argG Arginosuccinate

5. Replication and Transcription both use polymerase enzymes to read template DNA and

synthesize a new strand of nucleic acid, however, each process is unique. List or describe

several things that are different between these 2 processes.

6. The overall process of prokaryotic and eukaryotic gene expression are very similar,

employing the same basic mechanisms of transcription initiation, elongation, and

termination by RNA polymerases followed by translation of the mRNA by ribosomes and

charged tRNAs. The eukaryotic process, however, has a few unique aspects to it. List or

describe some of these important differences.

7. Find the first START codon and translate the following mRNA into a protein.

(Hint Consult Table 15.1 in your textbook)

5’ - UAAGGAGGUCGUAUGCCAGGGUGCUCUCUACAAGUUAUCGCCAACUAAGCAG - 3’

8. Describe what is meant by reading frame and how it is specified.

9. A codon is found in the molecule___________ and consists of ______ nucleotides in a row.

10. An anticodon is found in the molecule ___________ and consists of ______ nucleotides in a

row that are complimentary to a codon.

11. Describe the role of each of the following molecules during gene expression.

a. mRNA:

b. tRNA:

c. rRNA:

d. Ribosome:

e. snRNPS/Spliceosome:

12. Describe the function(s) of a PROMOTER.

13. Where are each of the following found? Specify the molecule, the location within the

molecule, and the domain of life.

a. Cap:

b. Poly-A tail:

c. Intron:

14. What amino acid should be attached to a tRNA with the anticodon 3’-UUG-5’?

15. In what order do tRNAs move through the sites of the ribosome?