Biology

Plastics Derived Endocrine Disruptors (BPA, DEHP and DBP) Induce Epigenetic Transgenerational Inheritance of Obesity, Reproductive Disease and Sperm Epimutations Mohan Manikkam, Rebecca Tracey, Carlos Guerrero-Bosagna, Michael K. Skinner*

Center for Reproductive Biology, School of Biological Sciences, Washington State University, Pullman, Washington, United States of America

Abstract

Environmental compounds are known to promote epigenetic transgenerational inheritance of adult onset disease in subsequent generations (F1–F3) following ancestral exposure during fetal gonadal sex determination. The current study was designed to determine if a mixture of plastic derived endocrine disruptor compounds bisphenol-A (BPA), bis(2- ethylhexyl)phthalate (DEHP) and dibutyl phthalate (DBP) at two different doses promoted epigenetic transgenerational inheritance of adult onset disease and associated DNA methylation epimutations in sperm. Gestating F0 generation females were exposed to either the ‘‘plastics’’ or ‘‘lower dose plastics’’ mixture during embryonic days 8 to 14 of gonadal sex determination and the incidence of adult onset disease was evaluated in F1 and F3 generation rats. There were significant increases in the incidence of total disease/abnormalities in F1 and F3 generation male and female animals from plastics lineages. Pubertal abnormalities, testis disease, obesity, and ovarian disease (primary ovarian insufficiency and polycystic ovaries) were increased in the F3 generation animals. Kidney and prostate disease were only observed in the direct fetally exposed F1 generation plastic lineage animals. Analysis of the plastics lineage F3 generation sperm epigenome previously identified 197 differential DNA methylation regions (DMR) in gene promoters, termed epimutations. A number of these transgenerational DMR form a unique direct connection gene network and have previously been shown to correlate with the pathologies identified. Observations demonstrate that a mixture of plastic derived compounds, BPA and phthalates, can promote epigenetic transgenerational inheritance of adult onset disease. The sperm DMR provide potential epigenetic biomarkers for transgenerational disease and/or ancestral environmental exposures.

Citation: Manikkam M, Tracey R, Guerrero-Bosagna C, Skinner MK (2013) Plastics Derived Endocrine Disruptors (BPA, DEHP and DBP) Induce Epigenetic Transgenerational Inheritance of Obesity, Reproductive Disease and Sperm Epimutations. PLoS ONE 8(1): e55387. doi:10.1371/journal.pone.0055387

Editor: Toshi Shioda, Massachusetts General Hospital, United States of America

Received May 30, 2012; Accepted December 28, 2012; Published January 24, 2013

Copyright: � 2013 Manikkam et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.

Funding: This research was supported by Department of Defense (DOD), and National Institues of Health (NIH) grants to MKS. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.

Competing Interests: The authors have declared that no competing interests exist.

* E-mail: [email protected]

Introduction

Epigenetic transgenerational inheritance involves the transmis-

sion of a phenotypic alteration to subsequent generations (F3)

through germline epimutations following ancestral environmental

exposure of a gestating F0 generation female [1,2]. Previous studies

[2,3,4] with the agricultural fungicide vinclozolin administered to

gestating rats and mice during the gonadal sex determination period

promotes a male germline epigenome reprogramming to induce

transgenerational adult-onset disease. This modification of germline

epigenetic programming occurs during the gonadal sex determina-

tion period when the germline DNA is demethylated and

remethylated in a sex specific manner [1,5]. This modified

epigenetic programming of the male germline subsequently leads

to all tissues propagated from this sperm to have differentially altered

epigenomes and transcriptomes that can influence development of

adult-onset disease. The altered epigenome in the germline is

transmitted through subsequent generations due to apparent

permanent imprinted-like DNA methylation properties [4]. These

germline mediated epimutations enable epigenetic transgenera-

tional inheritance of altered phenotypes.

Environmental chemicals such as vinclozolin and the pesticide

methoxychlor [2] are known to promote epigenetic transgenera-

tional inheritance of adult-onset diseases. The current study was

designed to investigate the actions of a mixture of plastic derived

endocrine disruptor compounds bisphenol-A (BPA), bis(2-ethyl-

hexyl)phthalate (DEHP) and dibutyl phthalate (DBP). This

mixture of plastic derived compounds was selected due to the

common exposures in human populations such as military

personnel [6]. Bisphenol-A is used to make polycarbonate plastic

and epoxy resins which are in turn used in a variety of plastic items

such as water bottles, sports equipment, medical and dental

devices, dental fillings and sealants, household electronics and

eyeglass lenses [7]. Bisphenol A is an endocrine disruptor with

widespread exposure and multiple effects including impaired

reproductive capacity, promotion of obesity and metabolic disease

[8,9,10,11,12]. DEHP is widely used as a plasticizer in manufac-

turing of articles made of polyvinyl compounds [13] and it is

considered a reproductive and developmental toxicant in humans

and animals [14]. DBP is a phthalate used primarily as plasticizer

to add flexibility to plastics. DBP is used as a component in latex

adhesives, cosmetics, in cellulose plastics, and as a solvent for dyes.

Exposure of pregnant females to high doses of DBP (greater than

500,000 mg/kg BW/day) causes reduced fetal survival, reduced birth weights among surviving offspring, skeletal malformations

PLOS ONE | www.plosone.org 1 January 2013 | Volume 8 | Issue 1 | e55387

and reproductive abnormalities in both male and female offspring

associated with reduced fertility [15]. These three endocrine

disruptors (BPA, DEHP and DBP) have been shown to be derived

from various plastic bottles [16] and are common exposures in

humans [6,17].

Previous studies with bisphenol-A or phthalates have primarily

focused on F0 or F1 generation studies [18]. Actions on the F0 and

F1 generations involve direct effect of the exposure on the

gestating female or fetus, so is a multigenerational exposure [1].

Exposure of an F0 generation gestating female also exposes the

germline in the F1 generation fetus that will develop into the F2

generation. The F3 generation is required to eliminate the

possibility of direct exposure effects [1]. The current study focused

on transgenerational effects and analyzed F3 generation in

comparison with the direct exposure F1 generation. There has

been only one study that documented transgenerational effects of

bisphenol-A for three generations involving testis abnormalities

[19]. The current study used doses of a ,1% fraction of the oral

LD50 dose for bisphenol-A or phthalates DEHP and DBP through

intraperitoneal injection. Previous studies have suggested these

doses do not produce overt toxicity (changes in litter size, sex ratio,

or mean weights) in the F1 generation [20]. The doses selected are

considered low for previous rodent exposures

[11,21,22,23,24,25,26,27,28,29,30], but are high in relation to

common human exposures. Therefore, the study was designed to

examine the potential pharmacological actions of the compounds

to influence epigenetic transgenerational inheritance and not

designed to do risk assessment analysis. The observations of the

current study can now be used to more effectively design risk

assessment studies.

The current study examined the hypothesis that the exposure of a

gestating female during the fetal gonadal sex determination period

to the plastics mixture (BPA, DEHP and DBP) promotes epigenetic

transgenerational inheritance of adult onset disease. In the present

study diseases of the testis, prostate, kidney, ovary, tumor

development, and obesity were evaluated in 1-year old rats of F1

and F3 generations. Phenotypes observed in the F1 generation

animals are induced by a direct chemical exposure of the fetus and

somatic cells. However, effects observed in the F3 generation

animals are due to epigenetic transgenerational inheritance through

the germline and not due to any direct effect of the chemical

exposure [31]. Therefore, phenotypes or diseases observed in F1 and

F3 generation animals are not due to the same mechanism and are

often distinct. This study documents epigenetic transgenerational

inheritance of testis and ovary diseases, pubertal abnormalities, and

obesity in F3 generation offspring after the gestating ancestors

(great-grandmothers) were exposed to a mixture of plastic derived

compounds. This study further documents the ability of these

environmental exposures to induce epigenetic transgenerational

inheritance of sperm epimutations.

A recent study compared the actions of the plastic compound

mixture (BPA, DEHP, DBP) with a pesticide mixture, dioxin and a

hydrocarbon mixture on postnatal day 120 (P120) rats which

demonstrated all exposures induced F3 generation reproductive

abnormalities [20]. Observations demonstrated similar transge-

nerational disease phenotypes, but unique transgenerational sperm

epimutations [20]. The majority of adult onset disease develops

later in life (.6 mo age in rat) [32] and is not present at P120 in

rats. The current study extends these previous observations [20] to

examine the plastic compound mixture’s actions on F3 generation

animals. In addition, the transgenerational sperm epimutations

previously identified are more thoroughly investigated.

Results

Transgenerational Adult-Onset Disease Analysis The experimental design included exposure of outbred Harlan

Sprague Dawley gestating female rats to daily intraperitoneal

injections of DMSO vehicle (control) or a mixture of plastic

derived compounds (BPA, DEHP and DBP), designated as

‘‘plastics’’ and ‘‘lower dose plastics’’ (one half dose as plastics

group) during fetal days 8 to 14 of gestation. The F1 generation rat

offspring born to different exposed females were bred to obtain the

F2 generation. The F3 generation animals were obtained by

breeding non-littermate females and males of the F2 generation.

No sibling or cousin breeding was used to avoid any inbreeding

artifacts in generating the different lineages. Randomly selected

offspring from different litters of the F1 and F3 generations were

aged to one year and euthanized. Body and organ weights were

measured and examined for disease/abnormalities. The testis,

prostate, kidney and ovary were examined for histopathology as

outlined in Methods.

Potential overt toxicity from direct fetal exposure to plastics or

lower dose plastics in the F1 generation animals was determined

and comparisons were made to the F3 generation animals through

analysis of body weight and organ weights (Table S1A). Both

ovarian and uterine weights decreased in the F1 generation rats of

lower dose plastics lineage compared to control lineage. Only

uterine weights decreased in the F3 generation rats of plastics and

lower dose plastics lineage compared to control lineage. There

were no effects on body weight and weights of the testis, prostate,

seminal vesicle, epididymis and kidney of 1-year old male F1

generation rats. The seminal vesicle weights of the F3 generation

plastics and lower dose plastics lineage decreased compared to

control lineage. There was also a decline in epididymal weight in

lower dose plastics lineage (Table S1B). Hormone concentrations

were measured in the F3 generation control, plastics and lower

dose plastics lineages to assess any endocrine alteration in serum

sex steroid levels. Serum testosterone concentrations in the 1-year-

old F3 generation male rats from plastics or lower dose plastics

lineages did not differ from those of control lineage. Serum

estradiol concentrations in female rats during proestrus-estrus

phase or diestrus phase were also not altered in plastics and lower

dose plastics lineages compared to control lineage (Figure S2). No

statistical difference (p.0.05) was observed in litter size (average

12) or sex ratio (50:50) in the F1 or F3 generation control versus

plastics lineages. These combined observations suggest there is no

major endocrine or overt toxicity from the plastics or lower dose

plastics exposures at the doses administered.

One of the major disease/abnormality phenotypes observed in

the F1 and F3 generation males of plastics lineage was testicular

disease. There was a significant increase in the incidence of

transgenerational testis disease in the F3 generation males of lower

dose plastics lineage (Figure 1A). Testis histopathological abnor-

malities include the azoospermic and atretic seminiferous tubules,

the presence of vacuoles in basal regions of the seminiferous

tubules, the sloughed spermatogenic cells in the center of

seminiferous tubules and the lack of seminiferous tubule lumen

(Figures 1D, and 1E). Further analysis of testis abnormalities

determined the number of apoptotic spermatogenic cells within

the testis of male rats in plastics and lower dose plastic lineages.

Significantly higher spermatogenic cell apoptosis in males of the

F3 generation lower dose plastics lineage was observed (Figure S1).

Interestingly, reduced germ cell apoptosis was observed in males of

the F1 generation plastics and lower dose plastics lineages and of

the F3 generation plastics lineage. Therefore spermatogenic

defects that were previously observed in vinclozolin lineage F3

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 2 January 2013 | Volume 8 | Issue 1 | e55387

generation rats (2) were also present in the F3 generation rats from

the lower dose plastics lineage. The F1 generation males of lower

dose plastics lineage had increased incidence of prostate disease/

abnormalities. The prostate histopathological abnormalities in-

cluded hyperplastic or atretic ductular epithelium (Figure 1B).

Likewise, the F1 generation males of plastics and lower dose

plastics lineages showed an increased incidence of kidney disease.

The kidney histopathological abnormalities included Bowman’s

capsule abnormalities and proteinaceous fluid filled cysts

(Figure 2B). As previously reported [20] a significant increase in

pubertal abnormalities (comprising early or delayed onset of

puberty) was documented in the F1 generation male rats of the

lower dose plastics lineage compared to the control lineage

(Figure 3B). The incidences of pubertal abnormalities in the F1

generation males from plastics or lower dose plastics lineages were

43% and 51% respectively, with the majority of these having a

delayed pubertal onset. The incidence of pubertal abnormalities in

the F1 generation males of the control lineage was only 18% with

the majority of these animals having a delayed pubertal onset. No

changes were observed in the incidence of pubertal abnormalities

in the F3 generation males from plastics or lower dose plastics

lineages when compared to the control F3 generation lineage

males (Figure 3B). The F3 generation males from plastics lineage

did not show any significant change in transgenerational prostate

disease (Figure 1B) or kidney disease (Figure 2B). Tumor

development in the F1 and F3 generation males was also

investigated and no significant difference in tumor development

between the control and plastics lineages were observed

(Figure 3F). The predominant tumor observed were mammary

gland tumors, with some isolated tumors in the skin, spleen,

urinary bladder, cerebellum, lung and liver detected. Obesity was

assessed with an increase in body weight and dramatic increase in

abdominal adiposity, as shown in Figure 4D. No obesity was

detected in the male F1 generation control or plastic lineage

animals. Obese males were observed in the F3 generation and the

body weight of the non-obese (509632) and obese (555632) males

were statistically different (p,0.008). The abdominal adipose

tissue was present on most organs and dramatically increased in

the obese animals (Figure 4D) compared to the non-obese animals

(Figure 4C). The F3 generation males of lower dose plastics lineage

had a tendency to have an increased incidence of obesity

(p = 0.0697). Therefore, ancestral exposure to lower dose plastics

promoted transgenerational testis disease and obesity, but not

prostate or kidney disease, to their unexposed F3 generation male

descendants.

There were a greater number of transgenerational diseases in

the F3 generation female rats from plastics and lower dose plastics

lineages. These included pubertal abnormalities (Figure 3A), and

ovarian disease. Ovarian disease involved both primordial follicle

loss (Figure 3C), as shown by a severe reduction in the number of

primordial follicles per ovary section [20], and polycystic ovarian

disease (Figure 3D), as characterized by an increase in the number

of cysts. The increase in the proportion of the F3 females of

plastics and lower dose plastics lineages with ovarian disease was

dramatic. In the control lineage F1 and F3 generation females only

one out of 9 had primordial follicle loss. In contrast, the majority

of the F1 generation plastics lineage (78%, 7/9), all of the lower

dose plastics lineage F1 generation females (100%, 9/9), all of the

F3 generation plastics lineage (100%, 9/9), and majority of the

lower dose plastics lineage F3 generation females (78%, 7/9)

examined had a significant loss of primordial follicles with a

reduced ovarian follicular reserve (Figure 3C). This condition is

associated with potential future development of primary ovarian

insufficiency. In the control lineage none of the females in either

the F1 or F3 generations examined developed polycystic ovaries.

In contrast, the majority of the F1 generation plastics lineage

(56%, 5/9), all of the lower dose plastics lineage F1 generation

females (100%, 9/9), and all of the plastics and lower dose plastics

lineage F3 generation females (100%, 9/9) examined had a

significant increase in number of cysts within the ovary (Figure 3D).

Polycystic ovarian disease is the most common ovarian disease in

women of reproductive age. Therefore, the observations demon-

strate epigenetic transgenerational inheritance of ovarian disease

following ancestral exposure to the plastic compounds.

The incidences of pubertal abnormalities in the F1 generation

females of plastics and lower dose plastics lineages were 67% and

30% respectively with the majority of these animals having

delayed pubertal onset (Figure 3A). The incidences of pubertal

abnormalities in the F3 generation females of plastics and lower

dose lineages were 29% and 23% respectively with the majority of

these animals having an early onset of puberty. The F1 and F3

generation females from plastics or lower dose plastics lineages did

not have an increased incidence of adult onset kidney disease

(Figure 2A) or tumor development (Figure 4A). The tumors

observed were primarily mammary gland tumors, with skin and

small intestine isolated tumors also indicated. The lower dose

plastics lineage F3 generation females did have a significant

increase in obesity (Figure 4C). The obesity phenotype involved an

increase in female body weight (332610 obese and 283648 non-

obese) and significant increase in abdominal fat deposition and

adiposity of most organs, Figure 4D. These combined observations

indicate ancestral exposure to plastics and low dose plastics

promotes transgenerational inheritance of pubertal abnormalities,

ovarian disease and obesity in the F3 generation female

descendants.

Other less frequent diseases were observed in the plastics and

low dose plastics lineages. These included constipation, swollen

intestinal lymph nodes, small seminal vesicles, sinus histiocytosis

and stomach abnormalities in the F1 generation animals of the

plastic lineage. Small seminal vesicles may be a developmental

defect. Histiocytosis and swelling of intestinal lymph nodes and

stomach abnormality are related to inflammatory processes. Low

frequency diseases in the F3 generation animals of plastic lineage

included blindness, cataract of the eye, focal fat necrosis,

histiocytosis, interstitial pneumonia, liver degeneration, sinusitis,

seizures and tremors. The F3 generation animals from the lower

dose plastics lineage also developed unique low frequency

diseases/abnormalities including liver disease (cirrhosis), swollen

epididymis and vulvar abscess. Focal fat necrosis is usually a sign of

inflammation due to contusions or constant sitting. Lack of activity

from constant sitting may predispose the rat to obesity as well.

Histiocytosis, pneumonia, sinusitis, swollen epididymis and vulvar

abscess indicate inflammatory abnormalities. Seizures and tremors

indicate neural dysfunction. Liver degeneration and cataract may

indicate premature aging. Blindness may be due to retinopathy or

abnormal blood vessel growth in the eye. These various diseases

were infrequent but more predominant in animals of the plastics

and low dose plastics lineages.

The incidence of disease/abnormality in individual rats in

control, plastics and low dose plastics lineages is presented in

Tables S2A (F1 generation females), Table S2B (F1 generation

males), Table S3A (F3 generation females) and Table S3B (F3

generation males). These tables list the occurrence of diseases for

each rat and clarify the number of animals for each specific

disease/abnormality assessment. The incidence of total disease/

abnormality increased significantly in the F3 generation females of

both plastics and lower dose plastics lineages (Figure 5A). The

incidence of total disease/abnormality increased in the F1

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 3 January 2013 | Volume 8 | Issue 1 | e55387

generation females of plastics lineage only (Figure 5A). The

incidence of multiple disease/abnormalities increased significantly

in the F1 and F3 generation females of plastics and lower dose

plastics lineages (Figure 5C). The incidence of total disease/

abnormality increased significantly in the F3 generation males of

plastics and lower dose plastic lineages (Figure 5B). The F1

generation males of plastics lineage, but not lower dose plastics

lineage, showed a significant increase in the incidence of total

disease/abnormalities (Figure 5B) and in the incidence of multiple

disease/abnormalities. Ancestral exposure to plastics and lower

dose plastics increased the overall incidence of transgenerational

adult onset diseases in both females and males.

Transgenerational Effects on the Sperm Epigenome Environmentally induced epigenetic transgenerational inheri-

tance of adult onset disease involves an altered germline

epigenome transmission between generations. The transgenera-

tional F3 generation control and plastics lineage sperm epigen-

omes were previously analyzed [20] and compared using a methyl

cytosine antibody chromatin immunoprecipitation (MeDIP) fol-

lowed by a genome-wide promoter tiling array chip (MeDIP-Chip)

Figure 1. Adult-onset testis disease and prostate disease in males from control, plastics and lower dose (LD) plastics (BPA, DEHP and DBP) lineages. Percentages of males with testis (panel A) or prostate disease (panel B) in F1 and F3 generations are presented. The actual number of diseased rats/total number of rats in each group are shown above the respective bar graphs (* P,0.05; *** P,0.001). Representative micrographs (Scale bar = 200 mm) showing histopathology images of adult-onset transgenerational testis and prostate disease in plastics (panels D, and G) and lower dose (LD) plastics lineages (panels E and H) compared to F3 control lineage (panels C and F). Testis sections from F3 generation animals in plastics and lower dose (LD) plastics lineages showed histopathology including azoospermic and atretic seminiferous tubules, presence of vacuoles in basal regions of seminiferous tubules, sloughed cells in center of seminiferous tubule and lack of seminiferous tubule lumen (arrows). Prostate sections showed epithelial atrophy and hyperplastic ductular epithelium (arrows). doi:10.1371/journal.pone.0055387.g001

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 4 January 2013 | Volume 8 | Issue 1 | e55387

assay [4]. The sperm DNA samples from rats of the F3 generation

control and plastics lineages were analyzed and previously

reported [20]. Three different experimental pools of F3 generation

control and plastics lineage MeDIP were generated and each pool

contained sperm DNA from three different animals each from a

different litter. A comparative hybridization with the MeDIP-Chip

assay was performed as described in the Methods to identify

differential DNA methylation regions between the control and

plastics lineage sperm pools. This analysis identified statistically

significant differential DNA methylation regions (DMR) in 197

different promoters [20] with an average 500 bp in size, Table S4.

The DMR previously identified [20] were more thoroughly

analyzed in the current study. The gene network described below

identified a highly interconnected DMR associated gene that was

selected for confirmation with an MeDIP-quantitative (Q) PCR

analysis. This DMR associated gene was Gdnf and had a 38.1 fold

increase (p,0.05) in the plastic lineage MeDIP compared to

control using the MeDIP-QPCR analysis. Therefore, the MeDIP-

QPCR analysis for this gene confirmed the previously reported

MeDIP-Chip analysis [20] for this DMR in postnatal 120 day old

males. Future studies are needed to assess the DMR in 1 year old

animals. The chromosomal locations of all the differentially

methylated regions (DMR) are presented in Figure 6. The sperm

DMR (termed epimutations) were present throughout the genome

Figure 2. Adult-onset kidney disease in males or females from control, plastics and lower dose (LD) plastics (BPA, DEHP and DBP) lineages. Percentages of females (panel A) and males (panel B) with kidney disease in F1 and F3 generations are presented. The actual number of diseased rats/total number of rats in each group are shown above the respective bar graphs (** P,0.01; *** P,0.001). Representative micrographs (Scale bar = 200 mm) showing histopathology images of adult-onset transgenerational kidney disease in F3 generation plastics (panels D and G) and lower dose (LD) plastics lineages (panels E and H) compared to F3 control lineage (panels C and F). Kidney sections showed Bowman’s capsule abnormality and proteinaceous fluid filled cysts (arrows). doi:10.1371/journal.pone.0055387.g002

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 5 January 2013 | Volume 8 | Issue 1 | e55387

Figure 3. Pubertal abnormalities, primordial follicle loss, polycystic ovary disease and tumor development from control, plastics, or lower dose (LD) plastics (BPA, DEHP and DBP) lineages. Percentages of females (panel A) and males (panel B) with pubertal abnormalities, or those females with primordial follicle loss (panel C) or polycystic ovary disease (panel D), and tumor development in females (panel E) and males (panel F) in F1 and F3 generations are presented. The actual number of diseased rats/total number of rats in each group are shown above the respective bar graphs (* P,0.05; ** P,0.01; *** P,0.001). doi:10.1371/journal.pone.0055387.g003

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 6 January 2013 | Volume 8 | Issue 1 | e55387

on all chromosomes examined. The functional gene categories of

the genes associated with the DMR are shown in Figure 7 and

Table S4. Therefore, the exposure to a plastic compound mixture

induced a transgenerational sperm epigenome alteration. Analysis

of the genes associated with the 197 DMR for potential correlated

cellular pathways and processes did not identify pathways with a

predominance of DMR associated genes, Table S5. A further

analysis was performed to identify a potential direct connection

(functional and/or binding connections) gene network associated

with the DMR, Figure 8. The network contained a number of

extracellular, membrane, cytoplasmic and nuclear localized genes

associated with the DMR identified. The glial derived neuro-

trophic factor (Gdnf) and neurotrophin 3 (Ntf3) cellular signaling

pathways and processes appear to be involved in the gene network

identified. Therefore, plastics derived compounds induced a

transgenerational alteration in the sperm epigenome and the

Figure 4. Obesity developed in control, plastics, or lower dose (LD) plastics (BPA, DEHP and DBP) lineages. Percentages of females (panel A) and males (panel B) with obesity in F1 and F3 generations are presented. The actual number of diseased rats/total number of rats in each group are shown above the respective bar graphs (* P,0.05). Abdominal fat deposition in F3 generation 1yr old rats from non-obese (C) and obese (D) animals. Pink colored fat deposition over most organs noted in panel B (arrows). doi:10.1371/journal.pone.0055387.g004

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 7 January 2013 | Volume 8 | Issue 1 | e55387

DMR epimutations potentially influence a gene network of specific

cellular pathways.

A final analysis of the genes associated with the DMR previously

identified [20] examined genes previously shown to be correlated

to the pathologies observed. A number (five) of the DMR

associated genes correlated to known obesity related genes as

shown in Figure 9. Other DMR associated genes (six) had indirect

connections through the five direct connection genes Tnfrsf12a,

Esrra, Fgf19, Wnt10b and Gdnf. No genes were found associated

with ovarian or testis diseases with direct connections. Interest-

ingly, the Gdnf was also observed in the gene network identified,

Figure 8. Therefore, previously identified genes that appear to be

involved in obesity correlated to a number of the genes associated

with the DMR epimutations.

Discussion

The current study was designed to investigate the actions of a

plastic compound mixture to promote epigenetic transgenerational

inheritance of adult onset disease. Gestating female rats, desig-

nated F0 generation, were exposed to a plastics or lower dose (one-

half dose) plastics mixture (BPA, DEHP and DBP) or DMSO

vehicle control daily during embryonic days 8–14 of development.

The F1 generation progeny were bred to produce the F2

generation, which were bred to obtain the F3 generation. Only

the F0 generation females and not the F1, F2 and F3 generation

individuals were treated. The F1 and F3 generation animals were

aged to one year and then euthanized. Tissues were collected,

fixed, sectioned and stained for histopathological examination.

Tissues examined included testis, prostate, kidney and ovary.

Previously, epididymal sperm were collected from P120 day old

males, DNA isolated, and transgenerational F3 generation sperm

epigenomes (DNA methylation) were examined with an MeDIP-

Chip analysis [20]. The current study more thoroughly investi-

gated these epimutations. The chromosomal locations, a gene

network and associated gene functions of the differential methyl-

ation regions (DMR) associated genes were identified.

The actions of plastic derived endocrine disruptor compounds

have been documented in previous studies primarily using direct

exposure studies. The documented actions of bisphenol A (BPA)

include altered pubertal onset [33,34], disruption of estrous cycles

[35,36], prostate disease [37,38,39], prostate neoplasia [37,40],

abnormal mammary gland development and presence of intra-

ductal hyperplasia and preneoplastic lesions in adults

Figure 5. Adult-onset disease/abnormalities in rats from control, plastics, or lower dose (LD) plastics (BPA, DEHP and DBP) lineages. Incidences of total female disease (panel A), total male disease (panel B), female multiple disease (panel C) and male multiple disease (panel D) in F1 and F3 generations are presented. The actual number of diseased rats/total number of rats in each group are shown above the respective bar graphs (* P,0.05; ** P,0.01; *** P,0.001). doi:10.1371/journal.pone.0055387.g005

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 8 January 2013 | Volume 8 | Issue 1 | e55387

[41,42,43,44], alterations in the uterus (cystic endometrial

hyperplasia) and ovary (cystic ovaries) abnormalities [41,45].

BPA induced brain and behavioral changes include abnormal

development of sexually dimorphic hypothalamic regions

[46,47,48,49], abnormal steroid receptor levels [50,51,52], aber-

rant behavior including hyperactivity [53,54], heightened aggres-

siveness [55], distorted sociosexual behavior [56], changed

cognitive and anxiolytic behaviors [57], and enhanced suscepti-

Figure 6. Gene network analysis for differential DNA methylation regions (DMR) associated genes in the F3 generation plastics lineage sperm. Chromosomal locations for transgenerational DMR detected with MeDIP-Chip are indicated with arrowheads. The chromosomal size and number are presented. There were 197 DMR in sperm DNA from F3 generation plastics lineage compared to control lineage. doi:10.1371/journal.pone.0055387.g006

Figure 7. The F3 generation plastics lineage sperm DMR associated gene functional categories. The number of DMR associated genes correlating to a specific gene functional category is presented including those with unknown function and expressed sequence tags (EST). doi:10.1371/journal.pone.0055387.g007

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 9 January 2013 | Volume 8 | Issue 1 | e55387

bility of addiction [54,58]. BPA alters body weight and body

composition [10,33,35,59,60,61] and abnormal glucose homeo-

stasis [62]. Therefore, early life BPA direct exposure promotes a

variety of adult onset disease states.

Phthalates DEHP and DBP are known reproductive and

developmental toxicants [14,15,63]. Toxicity of these phthalate

esters on male reproductive function include testicular seminifer-

ous tubule atrophy and germ cell degeneration [64,65,66,67], and

Figure 8. Gene network analysis for differential DNA methylation regions (DMR) associated genes in the F3 generation plastics lineage sperm. Direct connection (functional or binding) genes are shown according to their location in the cell. Genes not shown are not connected. Node shapes code: oval and circle – protein; diamond – ligand; circle/oval on tripod platform – transcription factor; ice cream cone – receptor. Arrows with plus sign show positive regulation/activation, arrows with minus sign – negative regulation/inhibition; gray arrows represent regulation, lilac – expression, purple – binding, green – promoter binding, and yellow – protein modification. doi:10.1371/journal.pone.0055387.g008

Figure 9. Genes with known links with obesity that correlate with F3 generation plastic lineage sperm DMR associated genes. The correlated DMR associated genes with associations with obesity are presented. The DMR associated genes with indirect connections to the direct connection genes are also presented. doi:10.1371/journal.pone.0055387.g009

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 10 January 2013 | Volume 8 | Issue 1 | e55387

male reproductive tract abnormalities consistent with androgen

dependent development and impaired testicular function

[68,69,70,71,72,73]. The phenotypic alterations included cryp-

torchidsm, hypospadias, agenesis of sex accessory organs, testicular

injury, reduced daily sperm production, delayed preputial

separation, permanent retention of nipples and decreased (femi-

nized) anogenital distance. Fetal exposure effects of DEHP and

DBP include reduction in testosterone secretion [74,75] and

increase in the diameter of seminiferous cords and induction of

gonocyte multinucleation in rat fetal testis [76]. The female

reproductive effects of phthalates include prolonged estrous cycles,

reduced serum estradiol levels and absence of ovulation in adult

rats [77]. Decrease in fertility [78,79], disruption of pregnancy

[27], abortions, fetal teratogenic abnormalities, skeletal and

visceral malformations, delay in the age of pubertal onset

[80,81] and altered number of ovarian follicles [81] are other

observed direct exposure effects of phthalates in females.

The current study was designed to examine the actions of

pharmacological doses of the plastic compound mixture on

epigenetic transgenerational inheritance of adult onset disease.

The in vivo doses used in previous studies that did not promote

overt toxicity (litter size, sex ratio or weight changes) were selected

[11,21,22,23,24,25,26,27,28,29,30]. The doses used were based on

a ,1% fraction of the oral LD50 dose for bisphenol-A (1%,

50 mg/kg/day), DEHP (0.025%, 750 mg/kg/day) and DBP

(0.8%, 66 mg/kg/day) [11,21,22,23,24,25,26,27,28,29,30]. A

lower dose of half this was also used, which should not be

considered ‘‘low dose’’ as previously described [12], but simply a

lower dose. The human exposure is estimated for BPA is 1 mg/kg/ day, for DEHP is 52 mg/kg/day, and for DBP is approximately 5 mg/kg/day. Although no overt toxicity was observed in the F1 generation animals, the mode of administration and dose used are

higher than anticipated environmental exposures so does not allow

risk assessment of these compounds from the current study.

However, the potential that these chemicals can have biphasic

dose curves with lower doses having greater effects needs to be

considered and impacts this dose discussion. The objective of the

study was to investigate if exposure to the plastics mixture could

potentially promote epigenetic transgenerational inheritance of a

disease phenotype and not to assess risk of the exposure to these

compounds. Future studies with more appropriate mode of

administration and dose curves will be required for risk

assessment. Observations from the current study will now allow

more effective risk assessment studies to be designed.

Transgenerational disease phenotypes are unique in the sense

that they are not caused by direct exposure to the environmental

chemical. As discussed above, effects of these compounds are

primarily assessed in direct exposure studies. When the exposure

occurs to a gestating female during the critical period of gonad sex

determination, not only the F0 generation female, but also the

developing fetus and the fetal germ cells are directly exposed.

Therefore, any pathology observed in F0, F1 (via fetal exposure)

and F2 (via fetal germ cell exposure) can be caused by the direct

exposure. Therefore, the F3 generation animals derived from the

exposed F0 generation female are the first generation to clearly

demonstrate epigenetic transgenerational inheritance of disease

phenotypes [31]. In the current study we examined the pathology

in F1 generation animals to observe any direct epigenetic effects

on somatic tissues and in the F3 generation animals to observe

germline mediated epigenetic transgenerational effects. Although

similarities in phenotype can occur, the distinct mechanisms

involved suggest differences in phenotype are anticipated.

The primary transgenerational disease/abnormality phenotypes

observed include testis disease, ovary disease, obesity and pubertal

abnormalities. The testicular disease incidence was significantly

higher in the F3 generation in the lower dose plastics lineage males

at one year of age. The spermatogenic cell apoptosis was also

significantly increased in these males which further supports the

development of testis disease. In recent years there is a trend of a

gradual decline in sperm concentration in most human popula-

tions [82] and human male infertility is approaching 10% [83].

The etiology of testicular disease and rise in infertility are

suspected to be at least in part due to exposure to environmental

chemicals, including endocrine disruptor toxicants [84]. The

potential role of epigenetic transgenerational inheritance of male

infertility needs to be considered [1]. The testicular disease

observed in the F3 generation lower dose plastics lineage males

provides support for a role of environmental epigenetics and

ancestral exposures in male infertility.

Ovarian disease in the form of primordial follicle loss and

polycystic ovarian disease was significantly increased in F3

generation plastics and lower dose plastics lineage females at one

year of age. Currently the world’s population of women are facing

increased ovarian diseases of primary ovarian insufficiency

characterized by primordial follicle loss, and polycystic ovarian

disease characterized by the presence of anovulatory cystic

structures [85,86]. Polycystic ovarian disease is now one of the

most common reproductive diseases in the human female

population [87]. Similar to the testicular disease/abnormality,

the ovary disease phenotypes in the current study may also be the

outcome of epigenetic transgenerational inheritance following

ancestral environmental exposures. It is important to note that the

ovarian disease observed had an increased frequency both in the

directly exposed offspring (F1) and transgenerationally (F3). All

females examined in the F3 generation plastics and lower dose

plastics lineages had polycystic ovarian disease. In a previous

study, observations demonstrated a significant transgenerational

alteration in both the transcriptome and the epigenome of the

ovarian granulosa cells from rats of the F3 generation vinclozolin

lineage [88]. Epigenetic mechanisms have been suggested to

underlie the development of polycystic ovary syndrome pheno-

types in women [89] and prenatally androgenized rhesus monkeys

[90]. In addition to considering the effects of direct exposure, the

current study suggests epigenetic mechanisms allow the transmis-

sion of the disease to future generation offspring following

ancestral exposure to abnormal environmental toxicants. There-

fore, ancestral exposure to plastics may contribute to the

development of these ovarian diseases. Observations suggest an

additional paradigm be considered for the etiology of primary

ovarian insufficiency and polycystic ovarian disease in women.

Pubertal abnormalities were significantly increased in the

females of the F3 generation plastics and lower dose plastics

lineages. Puberty is a milestone in developmental physiology and

the axis of hypothalamus-pituitary-gonad shows progressive

changes during fetal development and matures in adolescence

[91]. In rats there are clear external genital changes that indicate

pubertal onset (vaginal opening and balano-preputial separation)

[92]. Puberty checks were performed from postnatal day 30 in

females and day 35 in males in this study. In an earlier report [20]

it was shown that the F3 generation plastics and lower dose plastics

lineage females had a significant alteration of the pubertal onset

(number of days to pubertal onset) compared to control females.

The current study assessed the pubertal abnormalities incidence

using a puberty cutoff of mean of controls 6 2 standard deviations.

Observations demonstrate F1 generation females and males of

plastics and lower dose plastics lineages had increased incidence of

delayed pubertal onset. The F3 generation females of plastics and

lower dose plastics lineages had increased proportion of early onset

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 11 January 2013 | Volume 8 | Issue 1 | e55387

of puberty, while males of plastics and lower dose plastics lineages

had an increased incidence of delayed onset of puberty. The F1

generation phenotypes are due to direct somatic tissue actions,

while the F3 generation is due to germ line mediated transgenera-

tion mechanisms. Pubertal abnormalities, have increased over the

past several decades in human populations [91]. The early versus

delayed onset of puberty has influences on different adult onset

clinical conditions. Early onset of puberty leads to accelerated

bone mineralization and short adult height in girls and predisposes

them to breast cancers. Delayed onset of puberty leads to

decreased bone mineralization, psychological stress and metabolic

disease [93]. Previous studies have suggested early onset of puberty

in girls is suspected to be caused by environmental exposure to an

endocrine disruptor [94]. Early onset of puberty in girls disrupts

health by affecting brain development, endocrine organ systems

and growth, leading to later increase in susceptibility to disease.

Observations of the current study suggest abnormal pubertal onset

(an early developmental milestone) is associated with epigenetic

transgenerational adult onset ovary disease, primordial follicle loss

and polycystic ovaries in the F3 generation females of both plastics

and lower dose plastics lineages.

Obesity was significantly increased in the F3 generation females

and there was a tendency to be increased in the F3 generation

males of the lower dose plastics lineage. Interestingly, the obesity

was not observed in the direct exposure F1 generation, but only in

the F3 generation suggesting a transgenerational mechanism is

involved. Bisphenol-A and phthalates are suspected obesogens

[95] and direct exposures have been shown to promote obesity

[96]. Obesity is associated with other diseases and clinical

conditions including cardiovascular disease, type 2 diabetes, and

a diminished average life expectancy [97]. Obesity is a component

of a complex disease condition termed metabolic disease syndrome

[98]. Obese women have a higher prevalence of amenorrhea and

infertility. A major associated disease with obesity is polycystic

ovarian disease. The majority of the females with obesity have

polycystic ovarian disease [99,100]. Interestingly, the current study

demonstrated the F3 generation plastic lineage females developed

both obesity and polycystic ovarian disease. Therefore, the ability

of a BPA and phthalates mixture to promote the transgenerational

inheritance of obesity and polycystic ovarian disease supports an

association of these diseases. Maternal obesity can have a negative

effect on children’s health [101]. Experimental studies in rats

indicate that obese dams are responsible for the appearance of

obesity in the subsequent generation [102]. Waterland et al.,

(2008) [103] suggested that epigenetic mechanisms are involved in

this generational transmission of maternal obesity. The current

study extends this concept that epigenetic transgenerational

inheritance in the absence of any direct exposure may promote

obesity. Therefore, ancestral exposure to environmental plastic

compounds such as BPA and phthalates may influence adult-onset

obesity. Future studies will need to evaluate the adult status of

obesity associated conditions such as adiposity, bone mineraliza-

tion, adult height and metabolic disease in the F3 generation

plastics and lower dose plastics lineages. Observations suggest the

different disease phenotypes observed (testis disease, ovary disease,

pubertal abnormality and obesity) may be linked in a complex

disease syndrome that involves an epigenetic transgenerational

inheritance etiology.

The molecular mechanism involved in epigenetic transgenera-

tional inheritance of adult-onset disease phenotypes involves

reprogramming of the germline (sperm) epigenome during sex

determination [1,5]. The modified sperm epigenome (DNA

methylation) appears to become permanently reprogrammed in

an imprinted-like manner and is protected from DNA de-

methylation and reprogramming after fertilization. This allows

transgenerational transmission of the modified sperm epigenome

and subsequent modification of somatic cell and tissue epigenomes

and transcriptomes [104]. All tissues and cells will have a

transgenerational transcriptome [105] and those tissues sensitive

to this modified transcriptome will develop disease. Therefore, the

current study further examined the altered sperm epigenome and

epimutations induced by the plastic compound mixture previously

identified [20].

A transgenerational alteration in sperm DNA methylation has

been shown to be induced by vinclozolin [2,4]. A transgenera-

tional change in the fetal testis transcriptome has also shown to be

induced by vinclozolin [106]. More recently, all tissues examined

in the F3 generation vinclozolin lineage had a tissue specific

transgenerational transcriptome [105]. A previous study used F3

generation rat sperm from plastics and control lineages were used

for genome wide promoter DNA methylation analysis using an

MeDIP-Chip protocol [20]. Differential DNA methylated regions

(DMR) defined as epimutations and epigenetic biomarkers were

identified for the plastics lineage F3 generation sperm in

comparison with control lineage F3 generation sperm [20]. The

current study more thoroughly examined these DMR that are

presented in Table S4. A DMR was selected and used in a

MeDIP-QPCR analysis to confirm the MeDIP-Chip analysis

previously reported [20]. The Gdnf gene associated DMR selected

had a change that confirmed the MeDIP-Chip analysis when the

sperm from 120 day old males was investigated. Future analysis

will require analysis of age affects and more genome-wide analysis.

The DMR chromosomal locations were identified and the gene

functional categories for the 197 genes associated with the DMR.

A gene network analysis identified a direct connection network

between the genes associated with the DMR (Figure 8). These

interconnected genes have previously been shown to have direct

functional and/or binding associations. Several cellular signaling

pathways and processes were identified within the gene network

that will be of interest for future investigations. Therefore, the

epigenetic analysis confirmed the development of epimutations in

the sperm and a role in epigenetic transgenerational inheritance of

the disease phenotypes observed.

The altered sperm epigenome will generate altered epigenomes

in all the cells generated from the sperm which will be distinct

between cell types [104,105]. The cascade of epigenetic and

genetic (transcriptome) changes involved in generating an adult

cell type will likely have negligible correlations with the specific

original sperm epigenome and associated genes. However, the

sperm DMR associated gene regulation may influence develop-

mental events promoting the adult onset disease. The correlation

of the DMR associated genes with genes previously shown to be

linked to one of the major transgenerational disease phenotypes

observed was accomplished. The DMR list had 5 genes previously

shown to be associated with the onset of obesity (Figure 9). These

included Tnfrsf12a [107], Esrra [108], Fgf19 [109], Wnt10b [110],

and Gdnf [111]. Therefore, a number of the epimutation associated

genes identified in the F3 generation plastic lineage sperm were

found to be linked to the adult onset of obesity. Two DMR

associated genes found in both the gene network analysis and

obesity associated gene list were Gdnf and Esrra. Future studies on

the various cell types associated with the disease/abnormality

phenotypes will be required to determine potential correlations

with the sperm DMR identified.

Epigenetic transgenerational inheritance of disease has been

shown to be promoted by several environmental compounds

[20,112]. Vinclozolin exposure resulted in F3 generation testis

disease, prostate disease, kidney disease, immune system abnor-

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 12 January 2013 | Volume 8 | Issue 1 | e55387

malities, tumors, uterine hemorrhage during pregnancy and

polycystic ovary disease [2,3,20,32,113]. Alterations in methyla-

tion patterns of sperm of F3 generation rats and mice have been

reported following exposure of F0 generation females to

vinclozolin [2,3,4,114]. Exposure of F0 generation gestating rats

to bisphenol-A caused decreased fertility in F3 generation males

[19]. Transgenerational decline in fertility in F3 generation mice

was also documented following exposure to dioxin of gestating F0

generation females [20,112,115]. Other environmental factors

such as nutrition [103] also can promote epigenetic transgenera-

tional inheritance of disease phenotypes. Demonstration of

epigenetic transgenerational inheritance in worms [116], flies

[117], plants [118] and mammals [119,120,121] suggest this

phenomena will likely be critical in biology and disease etiology

[1]. Combined observations demonstrate exposure of gestating

females during the critical development period of gonadal sex

determination to a plastics endocrine disruptor mixture consisting

of bisphenol-A, DEHP and DBP promotes epigenetic transgenera-

tional inheritance of adult-onset disease including testis disease,

ovarian disease, pubertal abnormalities and obesity. All these

disease phenotypes have an impact on fertility and reproduction.

The overall increase in total disease and multiple diseases in F3

generation plastics and lower dose plastics lineages is considerable.

Associated with the occurrence of these transgenerational diseases

are the epigenetic changes in rat sperm DNA. These epimutations

may be useful as early stage biomarkers of compound exposure

and adult onset disease. Although not designed for risk assessment,

these findings have implications for the human population that is

exposed to these compounds and is experiencing significant

decline in fertility and incidence of adult onset disease.

Materials and Methods

Animal Studies All experimental protocols for the procedures with rats were

approved by the Washington State University Animal Care and

Use Committee (IACUC) (approval # 02568-026). Washington State University Department of Environmental Health and Safety

approved the protocols for the use of environmental chemicals.

Female and male rats of an outbred strain Sprague Dawley SD

(Harlan) of about 70 and 100 days of age were maintained in

ventilated isolator cages containing Aspen Sani-chips. Rats were

fed ad libitum with a standard rat diet and ad libitum tap water for

drinking. During the injection, vaginal smear collection, weaning

and puberty checking procedures rats were held in an animal

transfer station. To obtain time-pregnant females the female rats

in proestrus were pair-mated with male rats. The sperm-positive

(day 0) rats were considered pregnant and monitored for diestrus

and body weight. On embryonic day 8 (E8) through E14 of

gestation [113], the gestating females were administered daily

intraperitoneal injections of the plastic compound mixture (BPA

50 mg/kg BW/day, DEHP 750 mg/kg BW/day and DBP

66 mg/kg/BW/day) or dimethyl sulfoxide (DMSO) (vehicle) with

an equal volume of sesame oil (Sigma) to prevent irritation at the

injection site. The gestating females rats treated with vehicle or

plastic compound mixture were designated as the F0 generation.

When selected litters from the plastics lineage F1 generation litter

size and sex ratio were reduced, another treatment lineage with

exactly half of the original dose for each compound was generated

and it was designated ‘‘lower dose plastics.’’ These treatment

lineages are designated ‘‘control’’, ‘‘plastics’’ (bisphenol-A, DEHP

and DBP mixture) or ‘‘lower dose plastics’’ lineages throughout the

manuscript. The number of animals used for each generation and

exposure lineage are outlined in Tables S2 and S3. For female F1

generation total were control (20 animals), plastics (17 animals),

lower dose plastics (35 animals), and for male F1 generation the

total were control (22 animals), plastics (14 animals), lower dose

plastics (46 animals), and for female F3 generation totals were

control (69 animals), plastics (43 animals), lower dose plastics (52

animals), and for male F3 generation totals were control (56

animals), plastics (40 animals), and lower dose plastics (58 animals).

The animals per litter (litter representation) mean 6 SEM for each

specific disease/abnormality assessment between the control and

plastic or lower dose plastic lineages was not found to be

statistically different (p.0.05), so no litter bias was identified.

Breeding The offspring of the F0 generation rats were the F1 generation.

Non-littermate females and males aged 70–90 days from F1

generation control or plastics or low dose plastics lineages were

bred to obtain F2 generation offspring. The F2 generation rats were

bred to obtain F3 generation offspring. No sibling or cousin breeding

was used to avoid any inbreeding artifacts. Suckling rats were

weaned from their mothers at 21 days of age. It is important to note

that only the F0 generation gestating female was exposed directly to

the control vehicle or plastics or low dose plastics treatment, and the

F1–F3 generations were not subjected to any treatment.

Tissue Harvest and Histology Processing One-year old rats were euthanized by CO2 inhalation for tissue

harvest. Body and organ weights were measured at dissection time.

Testis, epididymis, prostate, seminal vesicle, ovaries, uterus and

kidney were collected and fixed in Bouin’s solution (Sigma) and

70% ethanol, then processed for paraffin embedding by standard

procedures for histopathology examination. Five-micrometer

tissue sections were made and were either unstained and used

for TUNEL analysis or stained with H & E stain and examined for

histopathology. Blood samples were collected at the time of

dissection, allowed to clot, centrifuged and serum samples stored at

220uC for steroid hormone assays.

Testicular Apoptotic Cell Analysis Testis sections were examined by a terminal deoxynucleotidyl

transferase-mediated dUTP nick end labeling (TUNEL) assay (In

situ cell death detection kit, Fluorescein, Roche Diagnostics,

Mannheim, Germany) as per the manufacturer’s protocols. Sections

were deparaffinized and rehydrated. They were deproteinized by

Proteinase K (20 mg/ml; Invitrogen, Carlsbad, CA) and then

washed with PBS and then 25 ml of the enzyme-label solution mix was applied on the testis sections and incubated at 37uC for 90 min. After PBS washes slides were mounted and kept at 4uC until examination in a fluorescent microscope in dark field. Both testis

sections of each slide were microscopically examined to identify and

to count apoptotic germ cells by their bright fluorescence.

Histopathology Examination and Disease/Abnormality Classification

Three different observers examined each unmarked tissue slide

and identical criteria were applied to identify diseased tissue. A

cut-off was established to declare a tissue ‘diseased’ based on the

mean number of histopathological abnormalities plus two

standard deviations from the mean number of abnormalities in

control tissues by each of the three individual observers. This

number was used to classify rats into those with and without

disease in testis, prostate or kidney in each lineage. A rat tissue

section was declared ‘diseased’ only when at least two of the three

observers marked the same tissue section as such. Necropsy and

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 13 January 2013 | Volume 8 | Issue 1 | e55387

histopathology examinations on rats that died prior to 1 year of

age and also pathology analysis of tissues sent with unknown or

suspected diseases were performed by the WSU Washington

Disease Diagnostic Laboratory and these results were also

included in the study. The proportion of rats with obesity or

tumor development was obtained by counting those that had these

conditions out of all the animals evaluated.

A marked central portion of each prostate, kidney and testis

section was microscopically examined under 200x magnification.

An additional peripheral portion of each testis section was also

examined. Testis histopathology criteria included the presence of a

vacuole, azoospermic atretic seminiferous tubule and ‘other’

abnormalities including sloughed spermatogenic cells in center of

the tubule and a lack of a tubule lumen. Prostate histopathology

criteria included the presence of vacuoles, atrophic epithelial layer

of ducts and hyperplasia of prostatic duct epithelium. Kidney

histopathology criteria included reduced size of glomerulus,

thickened Bowman’s capsule and the presence of proteinaceous

fluid-filled cysts.

Ovary sections were stained with hematoxylin and eosin and

three stained sections (150 mm apart) through the central portion of the ovary with several of the largest cross sections evaluated.

Ovary sections were assessed for two diseases, primordial follicle

loss and polycystic ovary disease. Primordial follicle loss was

determined by microscopically counting the number of primordial

follicles per ovary section. Primordial follicle loss was considered

present in the ovary when the primordial follicle number was less

than the control mean minus two standard deviations. Polycystic

ovaries were determined by microscopically counting the number

of small cystic structures. The mean number of primordial follicles

and small cysts was calculated from three sections. Polycystic ovary

disease was considered present when the number of cysts per

section was more than the control mean plus two standard

deviations. Follicles had to be non-atretic and showing an oocyte

nucleus in order to be counted. Primordial follicles had an oocyte

surrounded by a single layer of either squamous or both squamous

and cuboidal granulosa cells [122,123]. Cysts were defined as

fluid-filled structures of a specified size that were not filled with red

blood cells, had no oocyte and negligible granulosa cells. A single

layer of cells may line cysts. Small cysts were 50 to 250 mm in diameter measured from the inner cellular boundary across the

longest axis. Percentages of females with primordial follicle loss or

polycystic ovarian disease were computed.

Onset of puberty was assessed in females by daily examination

for vaginal opening from 30 days of age and in males by balano-

preputial separation from 35 days of age. For identifying a rat with

a pubertal abnormality (either an early or delayed onset of

puberty) a mean from all the rats from the control lineage

evaluated for pubertal onset was computed and its standard

deviation calculated. A range of normal pubertal onset was chosen

based on mean 6 2 standard deviations. Any rat with a pubertal

onset below this range was considered to have had an early

pubertal onset and any rat with a pubertal onset above this range

was considered to have had a delayed pubertal onset and the

proportion of rats with pubertal abnormality was computed from

the total number of rats evaluated for puberty onset.

Obesity was assessed with an analysis of body weight and gross

evaluation of abdominal adiposity. The increased fat deposition in

an obese animal required presence on most organs (Figure 4D)

compared to an absence in non-obese animals. The designation of

obesity required the increased body weight and increased abdom-

inal adiposity to be designated obese. Subsequently the correlation

to the presence of polycystic ovarian disease was made.

A table of the incidence of individual diseases/abnormalities in

rats from each group was created and the proportions of individual

disease, Tables S2 and S3, total disease and multiple disease

incidences were computed from this table. For the individual

disease/abnormality, only those rats that showed a plus (presence

of disease) or minus (absence of disease) in the table are included in

the computation. Those without a (+) or (2) were not analyzed for that disease. For the total diseases, a column with total disease is

presented and the number of plus signs (indicating the presence of

disease) were added up for each of the rats and the proportion was

computed as the number of rats with one or more diseases (total

disease) out of all listed rats. For the multiple diseases, the

proportion was computed as the number of rats with more than

one disease/abnormality out of all of the listed rats. Not all the rats

were evaluated for all diseases/abnormalities due to technical

limitations. The computation of the percent incidence of disease

data is limiting in this respect and the data presented represent

only the minimal incidence of total or multiple disease. For

example, if more animals in the current set had been evaluated for

ovarian disease, there could have been a higher incidence of either

total disease or multiple disease.

Epididymal Sperm collection The epididymis was dissected free of connective tissue, the fat

pad, the muscles and the vas deferens. A small cut was made to the

cauda epididymis and the tissue was placed in 5 ml F12 culture

medium containing 0.1% bovine serum albumin for 10 minutes at

37uC and then kept at 4uC to immobilize the sperm. The epididymal tissue in the buffer was put on a petri dish and minced

with a blade to release the sperm into the medium, the sperm

released into the buffer was aspirated with a pipette into a 1.5 ml

centrifuge tube and then centrifuged at 13,0006 g to pellet the sperm. Sperm were stored in fresh NIM buffer (Nucleus Isolation

Medium: 123.0 mmol/l KCl, 2.6 mmol/l NaCl, 7.8 mmol/l

NaH2PO4, 1.4 mmol/l KH2PO4 and 3 mmol/l EDTA (disodium

salt) at 220uC until processed further.

Sperm methylated DNA immunoprecipitation (MeDIP) Sperm heads were separated from tails through sonication

following a previously described protocol (without protease

inhibitors) [124] and then purified using a series of washes and

centrifugations [125] from a total of nine F3 generation rats per

lineage (control or plastics) that were 120 days of age. DNA

extraction on the purified sperm heads was performed as

previously described [4]. The same concentrations of DNA from

individual sperm samples were then used to produce pools of DNA

material. Three DNA pools were produced in total per treatment,

each one containing the same amount of sperm DNA from three

different animals. Therefore a total of 18 animals were used for

building three DNA pools per treatment (control or plastics)

making the following groups: C1–C3 and P1–P3. These DNA

pools were then used for chromatin immunoprecipitation of

methylated DNA fragments (MeDIP). MeDIP was performed as

follows: 6 mg of genomic DNA was subjected to series of three 20 pulse sonications at 20% amplitude and the appropriate fragment

size (200–1000 ng) was verified through 2% agarose gels; the

sonicated genomic DNA was resuspended in 350 ml TE buffer and denatured for 10 min at 95uC and then immediately placed on ice for 5 min; 100 ml of 5X IP buffer (50 mM Na-phosphate pH 7, 700 mM NaCl, 0.25% Triton X-100) was added to the sonicated

and denatured DNA. An overnight incubation of the DNA was

performed with 5 mg of antibody anti-5-methylCytidine monoclo- nal from Diagenode (Denville, NJ) at 4uC on a rotating platform. Protein A/G beads from Santa Cruz were prewashed on PBS-BSA

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 14 January 2013 | Volume 8 | Issue 1 | e55387

0.1% and resuspended in 40 ml 1X IP buffer. Beads were then added to the DNA-antibody complex and incubated 2 h at 4uC on a rotating platform. Beads bound to DNA-antibody complex were

washed 3 times with 1 ml 1X IP buffer; washes included

incubation for 5 min at 4uC on a rotating platform and then centrifugation at 6000 rpm for 2 min. Beads-DNA-antibody

complex were then resuspended in 250 ml digestion buffer (50 mM Tris HCl pH 8, 10 mM EDTA, 0.5% SDS) and 3.5 ml of proteinase K (20 mg/ml) was added to each sample and then

incubated overnight at 55uC on a rotating platform. DNA purification was performed first with phenol and then with

chloroform:isoamyl alcohol. Two washes were then performed

with 70% ethanol, 1 M NaCl and glycogen. MeDIP selected DNA

was then resuspended in 30 ml TE buffer.

Tiling Array MeDIP-Chip Analysis and MeDIP-QPCR Analysis

The MeDIP-Chip analysis was previously performed and

reported [20] and the data used in the current study. Roche

Nimblegen’s Rat DNA Methylation 36720 K CpG Island Plus RefSeq Promoter Array was used, which contains three identical

sub-arrays, with 720,000 probes per sub-array, scanning a total of

15,287 promoters (3,880 bp upstream and 970 bp downstream

from transcription start site). Probe sizes range from 50–75 mer in

length with the median probe spacing of 100 bp. Three different

comparative (MeDIP vs. MeDIP) hybridizations experiments were

performed (3 sub-arrays) for plastics lineage versus control, with

each subarray encompassing DNA samples from 6 animals (3 each

from plastics and control). MeDIP DNA samples from experi-

mental groups were labeled with Cy3 and MeDIP DNA samples

from the control lineage were labeled with Cy5 [20].

The MeDIP samples control and vinclozolin lineage F3

generation sperm were used in an MeDIP-QPCR analysis to

confirm the MeDIP-Chip data for a selected gene. A standard

RealTime PCR procedure was used to quantify the amount of

DNA for the DMR in the MeDIP samples, as previously shown

[112]. The PCR primers designed for the genomic DNA sites of

the DMR for Gdnf are: 59ATCCGAGCCTAACTTGCCTG,

39AGAGTGGAGACCTTTTGCGG. The Q-PCR used 30

cycles and PCR products were quantified and the fold change

determined between the F3 generation sperm for control versus

plastic lineage MeDIP samples. Statistical analysis of the data used

a U-Mann Whitney analysis.

Bioinformatic and Statistic Analyses of Chip Data For each comparative hybridization experiment raw data from

both the Cy3 and Cy5 channels were imported into R (R

Development Core Team (2010), R: A language for statistical

computing, R Foundation for Statistical Computing, Vienna,

Austria. ISBN 3-900051-07-0, URL http://www.R-project.org),

checked for quality and converted to MA values (M = Cy52Cy3;

A = (Cy5+Cy3)/2). The normalization procedure as previously described [20]. Following normalization each adjacent .3 probe

set value represents the median intensity difference between

plastics F3 generation lineage and control F3 generation lineage of

a 600 bp window. Significance was assigned to probe differences

between plastics F3 generation lineage samples and control F3

generation lineage samples by calculating the median value of the

intensity differences as compared to a normal distribution scaled to

the experimental mean and standard deviation of the normalized

data. A Z-score and P-value were computed for each probe from

that distribution. In order to assure the reproducibility of the

candidates obtained, only the candidates showing significant

changes in all of the single paired comparisons were chosen as a

having a significant change in DNA methylation between each

experimental group and controls. This is a very stringent approach

to select for changes because it only considers repeated changes in

all paired analysis. The statistically significant differential DNA

methylated regions (DMR) were identified and P-value associated

with each region presented, as previously described [20].

Associations between genes (gene networks) containing DMR

and particular physiologic cellular processes were determined by

an automated, unbiased survey of published literature using

Pathway Studio TM

software (Ariadne, Elsevier Inc., USA). The

specific disease associated genes were also assessed with the

Pathway Studio software. Signaling pathway enrichment with

genes containing DMR was determined by querying the library of

KEGG pathways (Kyto Encyclopedia of Genes and Genomes,

http://www.genome.jp/keff/pathway.html).

Statistical Analysis of Rat Organ and Disease Data The number of animals or samples for different experiments are

presented in the appropriate legends and Tables S2 and S3. For

statistical analysis for all data on body and organ weights were

used as input in the program GraphPad� Prism 5 statistical analysis program and t-tests were used to determine if the data

from the plastics or lower dose plastics group differed from those of

control groups. For the number of rats with disease/abnormalities

(disease incidence) a logistic regression analysis was used to analyze

the data (control or plastics or lower dose plastics, and diseased or

unaffected). For the MeDIP-PCR analysis a Student’s t-test was

utilized. All treatment differences were considered significant if P-

value was less than 0.05.

Supporting Information

Figure S1 Testicular spermatogenic cell apoptosis. Assessed by

Terminal deoxynucleotidyl transferase dUTP nick end labeling

(TUNEL) in F1 and F3 generation control lineage (open bars),

plastics lineage (black bars) and lower dose (LD) plastics lineage

(gray bars) rats. Number of apoptotic germ cells were normalized

to control means. The mean 6 SEM for three different

experiments are presented with related difference from control

indicated (* P,0.05; *** P,0.001).

(PDF)

Figure S2 Steroid hormone analysis in F3 generation animals. A.

Serum estradiol concentrations in proestrus-estrus in F3 generation

control, plastics and lower dose (LD) plastics lineage females. B.

Serum estradiol concentrations in diestrus in F3 generation females

of control, plastics and lower dose (LD) plastics lineages. C. Serum

testosterone concentrations in F3 generation males of control,

plastics and lower dose (LD) plastics lineages. There were no

significant changes (p.0.05) in any of the hormone concentrations

of F3 generation rats of plastics and lower dose plastics lineages.

(PDF)

Table S1 S1A. Body weight and organ weights in control, plastics and lower dose plastics F1 and F3 generation female rats

(Mean 6 Standard Error). Asterisks (*, ***), if present, indicate

statistically significant differences between means of control and

plastics or low dose plastics groups’ rats (P,0.05, and P,0.001

respectively). S1B. Body weight (grams) and organ weights (% of body weight) in control, plastics and lower dose plastics F1 and F3

generation male rats (Mean 6 SE). Asterisks (*, **), if present,

indicate statistically significant differences between means of

control and plastics or low dose plastics groups’ rats (P,0.05,

P,0.01 respectively).

(PDF)

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 15 January 2013 | Volume 8 | Issue 1 | e55387

Table S2 S2A. Individual disease incidence in F1 generation control, plastics and lower dose plastics female rats. The ‘+’ indicates the presence; the ‘2’ indicates the absence of disease; the

blank cell ‘‘no mark’’ indicates not determined. Animal IDs with a

‘C’ belong to Control group, those with a ‘P’ belong to plastics

group and those with a ‘LP’ belong to lower dose plastics group.

PFL = Primordial follicle loss; PCO = Polycystic ovarian disease.

See ‘Materials and Methods’ section for disease assessment in rats.

S2B. Individual disease incidence in F1 generation control, plastics, and lower dose plastics male rats. The ‘+’ indicates the presence; the ‘2’ indicates the absence of disease; the blank cell

‘‘no marks’’ indicates not determined. Animal IDs with a ‘C’

belong to control group, those with a ‘P’ belong to plastics group

and those with a ‘LP’ belong to lower dose plastics group. See

‘Materials and Methods’ section for disease assessment in rats. The

number of animals per litter (litter representation) mean 6 SEM

used for each specific disease/abnormality assessment between the

control versus plastic or lower dose plastic lineages were not found

to be statistically different (p.0.05), so no litter bias detected.

(PDF)

Table S3 S3A. Individual disease incidence in F3 generation control, plastics and lower dose plastics female rats. The ‘+’ indicates the presence and the ‘2’ indicates the absence of disease;

and blank cell ‘‘no mark’’ indicates not determined. Animal IDs

with a ‘C’ belong to Control group, those with a ‘P’ belong to

Plastics group, and those with a ‘LP’ belong to lower dose plastics

group. See ‘Materials and Methods’ section for disease assessment

in rats. S3B. Individual disease incidence in F3 generation control, plastics and lower dose plastics male rats. The ‘+’ indicates the presence; the ‘2’ indicates the absence of disease; and blank cell

‘‘no mark’’ indicates not determined. Animal IDs with a ‘C’

belong to Control group, those with a ‘P’ belong to Plastics group,

and those with a ‘LP’ belong to Lower Dose Plastics group. See

‘Materials and Methods’ section for disease assessment in rats. The

number of animals per litter (litter representation) mean 6 SEM

used for each specific disease/abnormality assessment between the

control versus plastic or lower dose plastic lineages were not found

to be statistically different (p.0.05), so no litter bias detected.

(PDF)

Table S4 List of rat sperm differential DNA methylation regions

(DMR) found in F3-generation plastic lineage sperm. The

functional gene category is presented, chromosomal number, start

and stop genome nucleotide location, gene ID, statistical p-value

for identified DMR, and name of the gene are presented.

(PDF)

Table S5 The F3 generation plastic lineage sperm DMR

associated genes correlation to KEGG pathways. The pathway

name, the number of DMR genes, and total number of genes in

the pathway are listed.

(PDF)

Acknowledgments

We thank the expert technical assistance of Dr. Eric Nilsson, Dr. Marina

Savenkova, Ms. Tiffany Hylkema, Ms. Shelby Weeks, Ms. Renee Espinosa

Najera, Ms. Jessica Shiflett, Ms. Ginger Beiro, Ms. Chrystal Bailey, Ms.

Colleen Johns, Mr. Trevor Covert and Ms. Sean Leonard, as well as the

assistance of Ms. Heather Johnson in preparation of the manuscript. We

acknowledge the helpful advice of Dr. David Jackson and Dr. John Lewis,

US Army Center for Environmental Health Research, Department of

Defense (DOD), and the leadership, including Dr. Paul Nisson, at the

DOD TATRC.

Author Contributions

Edited the manuscript: MKS MM RT CGB. Conceived and designed the

experiments: MKS. Performed the experiments: MM RT CGB. Analyzed

the data: MKS MM RT CGB. Wrote the paper: MKS MM.

References

1. Skinner MK, Manikkam M, Guerrero-Bosagna C (2010) Epigenetic transge-

nerational actions of environmental factors in disease etiology. Trends

Endocrinol Metab 21: 214–222.

2. Anway MD, Cupp AS, Uzumcu M, Skinner MK (2005) Epigenetic

transgenerational actions of endocrine disruptors and male fertility. Science

308: 1466–1469.

3. Guerrero-Bosagna C, Covert T, Haque MM, Settles M, Nilsson EE, et al.

(2012) Epigenetic Transgenerational Inheritance of Vinclozolin Induced

Mouse Adult Onset Disease and Associated Sperm Epigenome Biomarkers.

Reproductive Toxicology 34: 694–707.

4. Guerrero-Bosagna C, Settles M, Lucker B, Skinner M (2010) Epigenetic

transgenerational actions of vinclozolin on promoter regions of the sperm

epigenome. PLoS ONE 5: e13100.

5. Jirtle RL, Skinner MK (2007) Environmental epigenomics and disease

susceptibility. Nat Rev Genet 8: 253–262.

6. Talsness CE, Andrade AJ, Kuriyama SN, Taylor JA, vom Saal FS (2009)

Components of plastic: experimental studies in animals and relevance for

human health. Philos Trans R Soc Lond B Biol Sci 364: 2079–2096.

7. Fiege H, Heinz-Werner V, Toshikazu H, Sumio U, Tadao I, et al. (2002)

Phenol Derivatives. In: Wiley-VCH, editor. Ullmann’s Encyclopedia of

Industrial Chemistry. Weinheim: Wiley-VCH.

8. Richter CA, Birnbaum LS, Farabollini F, Newbold RR, Rubin BS, et al. (2007)

In vivo effects of bisphenol A in laboratory rodent studies. Reprod Toxicol 24:

199–224.

9. Vandenberg LN, Maffini MV, Sonnenschein C, Rubin BS, Soto AM (2009)

Bisphenol-A and the great divide: a review of controversies in the field of

endocrine disruption. Endocr Rev 30: 75–95.

10. Rubin BS, Soto AM (2009) Bisphenol A: Perinatal exposure and body weight.

Mol Cell Endocrinol 304: 55–62.

11. Patisaul HB, Adewale HB (2009) Long-term effects of environmental endocrine

disruptors on reproductive physiology and behavior. Front Behav Neurosci 3:

10.

12. Rubin BS (2011) Bisphenol A: an endocrine disruptor with widespread

exposure and multiple effects. J Steroid Biochem Mol Biol 127: 27–34.

13. Lorz PM, Towae FK, Enke W, Jäckh R, Bhargava N, et al. (2002) Phthalic

Acid and Derivatives. Ullmann’s Encyclopedia of Industrial Chemistry: Wiley-

VCH: Weinheim.

14. Lyche JL, Gutleb AC, Bergman A, Eriksen GS, Murk AJ, et al. (2009)

Reproductive and developmental toxicity of phthalates. J Toxicol Environ

Health B Crit Rev 12: 225–249.

15. Heudorf U, Mersch-Sundermann V, Angerer J (2007) Phthalates: toxicology

and exposure. Int J Hyg Environ Health 210: 623–634.

16. Simoneau C, Van den Eede L, Valzacchi S (2012) Identification and

quantification of the migration of chemicals from plastic baby bottles used as

substitutes for polycarbonate. Food Addit Contam Part A Chem Anal Control

Expo Risk Assess 29: 469–480.

17. Maffini MV, Rubin BS, Sonnenschein C, Soto AM (2006) Endocrine

disruptors and reproductive health: the case of bisphenol-A. Mol Cell

Endocrinol 254–255: 179–186.

18. Vogel SA (2009) The politics of plastics: the making and unmaking of bisphenol

a ‘‘safety’’. Am J Public Health 99 Suppl 3: S559–566.

19. Salian S, Doshi T, Vanage G (2009) Perinatal exposure of rats to Bisphenol A

affects the fertility of male offspring. Life Sci 85: 742–752.

20. Manikkam M, Guerrero-Bosagna C, Tracey R, Haque MM, Skinner MK

(2012) Transgenerational Actions of Environmental Compounds on Repro-

ductive Disease and Epigenetic Biomarkers of Ancestral Exposures. PLoS ONE

7: e31901.

21. Laws SC, Carey SA, Ferrell JM, Bodman GJ, Cooper RL (2000) Estrogenic

activity of octylphenol, nonylphenol, bisphenol A and methoxychlor in rats.

Toxicol Sci 54: 154–167.

22. Ashby J, Tinwell H, Lefevre PA, Joiner R, Haseman J (2003) The effect on

sperm production in adult Sprague-Dawley rats exposed by gavage to

bisphenol A between postnatal days 91–97. Toxicol Sci 74: 129–138.

23. Koo HJ, Lee BM (2007) Toxicokinetic relationship between di(2-ethylhexyl)

phthalate (DEHP) and mono(2-ethylhexyl) phthalate in rats. J Toxicol Environ

Health A 70: 383–387.

24. Kessler W, Numtip W, Grote K, Csanady GA, Chahoud I, et al. (2004) Blood

burden of di(2-ethylhexyl) phthalate and its primary metabolite mono(2-

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 16 January 2013 | Volume 8 | Issue 1 | e55387

ethylhexyl) phthalate in pregnant and nonpregnant rats and marmosets.

Toxicol Appl Pharmacol 195: 142–153.

25. Astill BD, Gingell R, Guest D, Hellwig J, Hodgson JR, et al. (1996)

Oncogenicity testing of 2-ethylhexanol in Fischer 344 rats and B6C3F1 mice.

Fundam Appl Toxicol 31: 29–41.

26. Khaliq MA, Srivastava SP (1993) Induction of hepatic polyamines by di(2-

ethylhexyl)phthalate in rats. Toxicol Lett 66: 317–321.

27. Gray LE Jr, Laskey J, Ostby J (2006) Chronic di-n-butyl phthalate exposure in

rats reduces fertility and alters ovarian function during pregnancy in female

Long Evans hooded rats. Toxicol Sci 93: 189–195.

28. Foster PM, Cattley RC, Mylchreest E (2000) Effects of di-n-butyl phthalate

(DBP) on male reproductive development in the rat: implications for human

risk assessment. Food Chem Toxicol 38: S97–99.

29. Ryu JY, Lee BM, Kacew S, Kim HS (2007) Identification of differentially

expressed genes in the testis of Sprague-Dawley rats treated with di(n-butyl)

phthalate. Toxicology 234: 103–112.

30. Kostka G, Urbanek-Olejnik K, Wiadrowska B (2010) Di-butyl phthalate-

induced hypomethylation of the c-myc gene in rat liver. Toxicol Ind Health 26:

407–416.

31. Skinner MK (2008) What is an epigenetic transgenerational phenotype? F3 or

F2. Reprod Toxicol 25: 2–6.

32. Anway MD, Leathers C, Skinner MK (2006) Endocrine disruptor vinclozolin

induced epigenetic transgenerational adult-onset disease. Endocrinology 147:

5515–5523.

33. Howdeshell KL, Hotchkiss AK, Thayer KA, Vandenbergh JG, vom Saal FS

(1999) Exposure to bisphenol A advances puberty. Nature 401: 763–764.

34. Honma S, Suzuki A, Buchanan DL, Katsu Y, Watanabe H, et al. (2002) Low

dose effect of in utero exposure to bisphenol A and diethylstilbestrol on female

mouse reproduction. Reprod Toxicol 16: 117–122.

35. Rubin BS, Murray MK, Damassa DA, King JC, Soto AM (2001) Perinatal

exposure to low doses of bisphenol A affects body weight, patterns of estrous

cyclicity, and plasma LH levels. Environ Health Perspect 109: 675–680.

36. Monje L, Varayoud J, Munoz-de-Toro M, Luque EH, Ramos JG (2010)

Exposure of neonatal female rats to bisphenol A disrupts hypothalamic LHRH

pre-mRNA processing and estrogen receptor alpha expression in nuclei

controlling estrous cyclicity. Reprod Toxicol 30: 625–634.

37. Prins GS, Ye SH, Birch L, Ho SM, Kannan K (2011) Serum bisphenol A

pharmacokinetics and prostate neoplastic responses following oral and

subcutaneous exposures in neonatal Sprague-Dawley rats. Reprod Toxicol

31: 1–9.

38. Timms BG, Howdeshell KL, Barton L, Bradley S, Richter CA, et al. (2005)

Estrogenic chemicals in plastic and oral contraceptives disrupt development of

the fetal mouse prostate and urethra. Proc Natl Acad Sci U S A 102: 7014–

7019.

39. Gupta C (2000) Reproductive malformation of the male offspring following

maternal exposure to estrogenic chemicals. Proc Soc Exp Biol Med 224: 61–68.

40. Ho SM, Tang WY, Belmonte de Frausto J, Prins GS (2006) Developmental

exposure to estradiol and bisphenol A increases susceptibility to prostate

carcinogenesis and epigenetically regulates phosphodiesterase type 4 variant 4.

Cancer Res 66: 5624–5632.

41. Markey CM, Luque EH, Munoz De Toro M, Sonnenschein C, Soto AM

(2001) In utero exposure to bisphenol A alters the development and tissue

organization of the mouse mammary gland. Biol Reprod 65: 1215–1223.

42. Munoz-de-Toro M, Markey CM, Wadia PR, Luque EH, Rubin BS, et al.

(2005) Perinatal exposure to bisphenol-A alters peripubertal mammary gland

development in mice. Endocrinology 146: 4138–4147.

43. Vandenberg LN, Maffini MV, Schaeberle CM, Ucci AA, Sonnenschein C, et

al. (2008) Perinatal exposure to the xenoestrogen bisphenol-A induces

mammary intraductal hyperplasias in adult CD-1 mice. Reprod Toxicol 26:

210–219.

44. Murray TJ, Maffini MV, Ucci AA, Sonnenschein C, Soto AM (2007) Induction

of mammary gland ductal hyperplasias and carcinoma in situ following fetal

bisphenol A exposure. Reprod Toxicol 23: 383–390.

45. Newbold RR, Jefferson WN, Padilla-Banks E (2007) Long-term adverse effects

of neonatal exposure to bisphenol A on the murine female reproductive tract.

Reprod Toxicol 24: 253–258.

46. Kubo K, Arai O, Omura M, Watanabe R, Ogata R, et al. (2003) Low dose

effects of bisphenol A on sexual differentiation of the brain and behavior in rats.

Neurosci Res 45: 345–356.

47. Rubin BS, Lenkowski JR, Schaeberle CM, Vandenberg LN, Ronsheim PM, et

al. (2006) Evidence of altered brain sexual differentiation in mice exposed

perinatally to low, environmentally relevant levels of bisphenol A. Endocrinol-

ogy 147: 3681–3691.

48. Patisaul HB, Fortino AE, Polston EK (2006) Neonatal genistein or bisphenol-A

exposure alters sexual differentiation of the AVPV. Neurotoxicol Teratol 28:

111–118.

49. Adewale HB, Todd KL, Mickens JA, Patisaul HB (2011) The impact of

neonatal bisphenol-A exposure on sexually dimorphic hypothalamic nuclei in

the female rat. Neurotoxicology 32: 38–49.

50. Khurana S, Ranmal S, Ben-Jonathan N (2000) Exposure of newborn male and

female rats to environmental estrogens: delayed and sustained hyperprolactin-

emia and alterations in estrogen receptor expression. Endocrinology 141:

4512–4517.

51. Ramos JG, Varayoud J, Kass L, Rodriguez H, Costabel L, et al. (2003)

Bisphenol a induces both transient and permanent histofunctional alterations of

the hypothalamic-pituitary-gonadal axis in prenatally exposed male rats.

Endocrinology 144: 3206–3215.

52. Monje L, Varayoud J, Luque EH, Ramos JG (2007) Neonatal exposure to

bisphenol A modifies the abundance of estrogen receptor alpha transcripts with

alternative 59-untranslated regions in the female rat preoptic area. J Endocrinol

194: 201–212.

53. Ishido M, Masuo Y, Kunimoto M, Oka S, Morita M (2004) Bisphenol A causes

hyperactivity in the rat concomitantly with impairment of tyrosine hydroxylase

immunoreactivity. J Neurosci Res 76: 423–433.

54. Jones DC, Miller GW (2008) The effects of environmental neurotoxicants on

the dopaminergic system: A possible role in drug addiction. Biochem

Pharmacol 76: 569–581.

55. Kawai K, Nozaki T, Nishikata H, Aou S, Takii M, et al. (2003) Aggressive

behavior and serum testosterone concentration during the maturation process

of male mice: the effects of fetal exposure to bisphenol A. Environ Health

Perspect 111: 175–178.

56. Farabollini F, Porrini S, Della Seta D, Bianchi F, Dessi-Fulgheri F (2002)

Effects of perinatal exposure to bisphenol A on sociosexual behavior of female

and male rats. Environ Health Perspect 110 Suppl 3: 409–414.

57. Tian YH, Hwan Kim S, Lee SY, Jang CG (2011) Lactational and postnatal

exposure to polychlorinated biphenyls induces sex-specific anxiolytic behavior

and cognitive deficit in mice offspring. Synapse 65: 1032–1041.

58. Mizuo K, Narita M, Miyagawa K, Okuno E, Suzuki T (2004) Prenatal and

neonatal exposure to bisphenol-A affects the morphine-induced rewarding

effect and hyperlocomotion in mice. Neurosci Lett 356: 95–98.

59. Somm E, Schwitzgebel VM, Toulotte A, Cederroth CR, Combescure C, et al.

(2009) Perinatal exposure to bisphenol a alters early adipogenesis in the rat.

Environ Health Perspect 117: 1549–1555.

60. Ryan KK, Haller AM, Sorrell JE, Woods SC, Jandacek RJ, et al. (2010)

Perinatal exposure to bisphenol-a and the development of metabolic syndrome

in CD-1 mice. Endocrinology 151: 2603–2612.

61. Miyawaki J, Sakayama K, Kato H, Yamamoto H, Masuno H (2007) Perinatal

and postnatal exposure to bisphenol a increases adipose tissue mass and serum

cholesterol level in mice. J Atheroscler Thromb 14: 245–252.

62. Alonso-Magdalena P, Vieira E, Soriano S, Menes L, Burks D, et al. (2010)

Bisphenol A exposure during pregnancy disrupts glucose homeostasis in

mothers and adult male offspring. Environ Health Perspect 118: 1243–1250.

63. Martino-Andrade AJ, Chahoud I (2010) Reproductive toxicity of phthalate

esters. Mol Nutr Food Res 54: 148–157.

64. Gangolli SD (1982) Testicular effects of phthalate esters. Environ Health

Perspect 45: 77–84.

65. Gray TJ, Gangolli SD (1986) Aspects of the testicular toxicity of phthalate

esters. Environ Health Perspect 65: 229–235.

66. Dostal LA, Chapin RE, Stefanski SA, Harris MW, Schwetz BA (1988)

Testicular toxicity and reduced Sertoli cell numbers in neonatal rats by di(2-

ethylhexyl)phthalate and the recovery of fertility as adults. Toxicol Appl

Pharmacol 95: 104–121.

67. Richburg JH, Boekelheide K (1996) Mono-(2-ethylhexyl) phthalate rapidly

alters both Sertoli cell vimentin filaments and germ cell apoptosis in young rat

testes. Toxicol Appl Pharmacol 137: 42–50.

68. Gray LE Jr, Ostby J, Furr J, Price M, Veeramachaneni DN, et al. (2000)

Perinatal exposure to the phthalates DEHP, BBP, and DINP, but not DEP,

DMP, or DOTP, alters sexual differentiation of the male rat. Toxicol Sci 58:

350–365.

69. Andrade AJ, Grande SW, Talsness CE, Grote K, Golombiewski A, et al. (2006)

A dose-response study following in utero and lactational exposure to di-(2-

ethylhexyl) phthalate (DEHP): effects on androgenic status, developmental

landmarks and testicular histology in male offspring rats. Toxicology 225: 64–

74.

70. Andrade AJ, Grande SW, Talsness CE, Gericke C, Grote K, et al. (2006) A

dose response study following in utero and lactational exposure to di-(2-

ethylhexyl) phthalate (DEHP): reproductive effects on adult male offspring rats.

Toxicology 228: 85–97.

71. Mylchreest E, Cattley RC, Foster PM (1998) Male reproductive tract

malformations in rats following gestational and lactational exposure to Di(n-

butyl) phthalate: an antiandrogenic mechanism? Toxicol Sci 43: 47–60.

72. Nagao T, Ohta R, Marumo H, Shindo T, Yoshimura S, et al. (2000) Effect of

butyl benzyl phthalate in Sprague-Dawley rats after gavage administration: a

two-generation reproductive study. Reprod Toxicol 14: 513–532.

73. Moore RW, Rudy TA, Lin TM, Ko K, Peterson RE (2001) Abnormalities of

sexual development in male rats with in utero and lactational exposure to the

antiandrogenic plasticizer Di(2-ethylhexyl) phthalate. Environ Health Perspect

109: 229–237.

74. Howdeshell KL, Furr J, Lambright CR, Rider CV, Wilson VS, et al. (2007)

Cumulative effects of dibutyl phthalate and diethylhexyl phthalate on male rat

reproductive tract development: altered fetal steroid hormones and genes.

Toxicol Sci 99: 190–202.

75. Howdeshell KL, Wilson VS, Furr J, Lambright CR, Rider CV, et al. (2008) A

mixture of five phthalate esters inhibits fetal testicular testosterone production

in the sprague-dawley rat in a cumulative, dose-additive manner. Toxicol Sci

105: 153–165.

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 17 January 2013 | Volume 8 | Issue 1 | e55387

76. Martino-Andrade AJ, Morais RN, Botelho GG, Muller G, Grande SW, et al.

(2009) Coadministration of active phthalates results in disruption of foetal testicular function in rats. Int J Androl 32: 704–712.

77. Davis BJ, Maronpot RR, Heindel JJ (1994) Di-(2-ethylhexyl) phthalate

suppresses estradiol and ovulation in cycling rats. Toxicol Appl Pharmacol 128: 216–223.

78. Lamb JCt, Chapin RE, Teague J, Lawton AD, Reel JR (1987) Reproductive effects of four phthalic acid esters in the mouse. Toxicol Appl Pharmacol 88:

255–269.

79. Gray LE Jr, Wolf C, Lambright C, Mann P, Price M, et al. (1999) Administration of potentially antiandrogenic pesticides (procymidone, linuron,

iprodione, chlozolinate, p, p’-DDE, and ketoconazole) and toxic substances (dibutyl- and diethylhexyl phthalate, PCB 169, and ethane dimethane

sulphonate) during sexual differentiation produces diverse profiles of repro- ductive malformations in the male rat. Toxicol Ind Health 15: 94–118.

80. Grande SW, Andrade AJ, Talsness CE, Grote K, Chahoud I (2006) A dose-

response study following in utero and lactational exposure to di(2-ethylhex- yl)phthalate: effects on female rat reproductive development. Toxicol Sci 91:

247–254. 81. Grande SW, Andrade AJ, Talsness CE, Grote K, Golombiewski A, et al. (2007)

A dose-response study following in utero and lactational exposure to di-(2-

ethylhexyl) phthalate (DEHP): reproductive effects on adult female offspring rats. Toxicology 229: 114–122.

82. Fisher JS (2004) Environmental anti-androgens and male reproductive health: focus on phthalates and testicular dysgenesis syndrome. Reproduction 127:

305–315. 83. Hauser R, Sokol R (2008) Science linking environmental contaminant

exposures with fertility and reproductive health impacts in the adult male.

Fertil Steril 89: e59–65. 84. Kumar S (2004) Occupational exposure associated with reproductive

dysfunction. J Occup Health 46: 1–19. 85. Vujovic S (2009) Aetiology of premature ovarian failure. Menopause Int 15:

72–75.

86. Hart R, Hickey M, Franks S (2004) Definitions, prevalence and symptoms of polycystic ovaries and polycystic ovary syndrome. Best Pract Res Clin Obstet

Gynaecol 18: 671–683. 87. Dunaif A (2012) Polycystic ovary syndrome in 2011: Genes, aging and sleep

apnea in polycystic ovary syndrome. Nat Rev Endocrinol 8: 72–74. 88. Nilsson E, Larsen G, Manikkam M, Guerrero-Bosagna C, Savenkova M, et al.

(2012) Environmentally Induced Epigenetic Transgenerational Inheritance of

Ovarian Disease. PLoS ONE 7: e36129. 89. Xu N, Azziz R, Goodarzi MO (2010) Epigenetics in polycystic ovary

syndrome: a pilot study of global DNA methylation. Fertil Steril 94: 781–783 e781.

90. Xu N, Kwon S, Abbott DH, Geller DH, Dumesic DA, et al. (2011) Epigenetic

mechanism underlying the development of polycystic ovary syndrome (PCOS)- like phenotypes in prenatally androgenized rhesus monkeys. PLoS ONE 6:

e27286. 91. DiVall SA, Radovick S (2009) Endocrinology of female puberty. Curr Opin

Endocrinol Diabetes Obes 16: 1–4. 92. Engelbregt MJ, Houdijk ME, Popp-Snijders C, Delemarre-van de Waal HA

(2000) The effects of intra-uterine growth retardation and postnatal

undernutrition on onset of puberty in male and female rats. Pediatr Res 48: 803–807.

93. Jacobson-Dickman E, Lee MM (2009) The influence of endocrine disruptors on pubertal timing. Curr Opin Endocrinol Diabetes Obes 16: 25–30.

94. Traggiai C, Stanhope R (2003) Disorders of pubertal development. Best Pract

Res Clin Obstet Gynaecol 17: 41–56. 95. Newbold RR, Padilla-Banks E, Jefferson WN, Heindel JJ (2008) Effects of

endocrine disruptors on obesity. Int J Androl 31: 201–208. 96. Grun F, Blumberg B (2007) Perturbed nuclear receptor signaling by

environmental obesogens as emerging factors in the obesity crisis. Rev Endocr

Metab Disord 8: 161–171. 97. McMillen IC, Rattanatray L, Duffield JA, Morrison JL, MacLaughlin SM, et

al. (2009) The early origins of later obesity: pathways and mechanisms. Adv Exp Med Biol 646: 71–81.

98. Bremer AA, Mietus-Snyder M, Lustig RH (2012) Toward a unifying hypothesis of metabolic syndrome. Pediatrics 129: 557–570.

99. Lim SS, Davies MJ, Norman RJ, Moran LJ (2012) Overweight, obesity and

central obesity in women with polycystic ovary syndrome: a systematic review and meta-analysis. Hum Reprod Update 18: 618–637.

100. Motta AB (2012) The role of obesity in the development of polycystic ovary syndrome. Curr Pharm Des 18: 2482–2491.

101. Linne Y (2004) Effects of obesity on women’s reproduction and complications

during pregnancy. Obes Rev 5: 137–143.

102. Campos KE, Volpato GT, Calderon IM, Rudge MV, Damasceno DC (2008)

Effect of obesity on rat reproduction and on the development of their adult offspring. Braz J Med Biol Res 41: 122–125.

103. Waterland RA, Travisano M, Tahiliani KG, Rached MT, Mirza S (2008)

Methyl donor supplementation prevents transgenerational amplification of

obesity. Int J Obes (Lond) 32: 1373–1379.

104. Skinner MK (2011) Environmental epigenetic transgenerational inheritance

and somatic epigenetic mitotic stability. Epigenetics 6: 838–842.

105. Skinner MK, Manikkam M, Haque MM, Zhang B, Savenkova M (2012) Epigenetic Transgenerational Inheritance of Somatic Transcriptomes and

Epigenetic Control Regions. Genome Biol 13: R91.

106. Anway MD, Rekow SS, Skinner MK (2008) Transgenerational epigenetic

programming of the embryonic testis transcriptome. Genomics 91: 30–40.

107. Zanni MV, Stanley TL, Makimura H, Chen CY, Grinspoon SK (2010) Effects

of TNF-alpha antagonism on E-selectin in obese subjects with metabolic dysregulation. Clin Endocrinol (Oxf) 73: 48–54.

108. Slocum N, Durrant JR, Bailey D, Yoon L, Jordan H, et al. (2012) Responses of brown adipose tissue to diet-induced obesity, exercise, dietary restriction and

ephedrine treatment. Exp Toxicol Pathol.

109. Fu T, Choi SE, Kim DH, Seok S, Suino-Powell KM, et al. (2012) Aberrantly

elevated microRNA-34a in obesity attenuates hepatic responses to FGF19 by targeting a membrane coreceptor beta-Klotho. Proc Natl Acad Sci U S A 109:

16137–16142.

110. Van Camp JK, Beckers S, Zegers D, Verrijken A, Van Gaal LF, et al. (2012)

Genetic association between WNT10B polymorphisms and obesity in a Belgian case-control population is restricted to males. Mol Genet Metab 105: 489–493.

111. Baudry C, Reichardt F, Marchix J, Bado A, Schemann M, et al. (2012) Diet- induced obesity has neuroprotective effects in murine gastric enteric nervous

system: involvement of leptin and glial cell line-derived neurotrophic factor.

J Physiol 590: 533–544.

112. Manikkam M, Tracey R, Guerrero-Bosagna C, Skinner M (2012) Pesticide and Insect Repellent Mixture (Permethrin and DEET) Induces Epigenetic

Transgenerational Inheritance of Disease and Sperm Epimutations. Repro-

ductive Toxicology 34: 708–719.

113. Nilsson EE, Anway MD, Stanfield J, Skinner MK (2008) Transgenerational

epigenetic effects of the endocrine disruptor vinclozolin on pregnancies and female adult onset disease. Reproduction 135: 713–721.

114. Stouder C, Paoloni-Giacobino A (2010) Transgenerational effects of the

endocrine disruptor vinclozolin on the methylation pattern of imprinted genes

in the mouse sperm. Reproduction 139: 373–379.

115. Bruner-Tran KL, Osteen KG (2011) Developmental exposure to TCDD reduces fertility and negatively affects pregnancy outcomes across multiple

generations. Reprod Toxicol 31: 344–350.

116. Greer EL, Maures TJ, Ucar D, Hauswirth AG, Mancini E, et al. (2011)

Transgenerational epigenetic inheritance of longevity in Caenorhabditis

elegans. Nature 479: 365–371.

117. Ruden DM, Lu X (2008) Hsp90 affecting chromatin remodeling might explain transgenerational epigenetic inheritance in Drosophila. Curr Genomics 9: 500–

508.

118. Hauser MT, Aufsatz W, Jonak C, Luschnig C (2011) Transgenerational

epigenetic inheritance in plants. Biochim Biophys Acta 1809: 459–468.

119. Rassoulzadegan M, Grandjean V, Gounon P, Vincent S, Gillot I, et al. (2006)

RNA-mediated non-mendelian inheritance of an epigenetic change in the mouse. Nature 441: 469–474.

120. Wagner KD, Wagner N, Ghanbarian H, Grandjean V, Gounon P, et al. (2008) RNA induction and inheritance of epigenetic cardiac hypertrophy in the

mouse. Dev Cell 14: 962–969.

121. Pembrey ME (2010) Male-line transgenerational responses in humans. Hum

Fertil (Camb) 13: 268–271.

122. Nilsson EE, Schindler R, Savenkova MI, Skinner MK (2011) Inhibitory actions

of Anti-Mullerian Hormone (AMH) on ovarian primordial follicle assembly. PLoS ONE 6: e20087.

123. Meredith S, Dudenhoeffer G, Jackson K (2000) Classification of small type B/ C follicles as primordial follicles in mature rats. J Reprod Fertil 119: 43–48.

124. Tateno H, Kimura Y, Yanagimachi R (2000) Sonication per se is not as deleterious to sperm chromosomes as previously inferred. Biol Reprod 63: 341–

346.

125. Ward WS, Kimura Y, Yanagimachi R (1999) An intact sperm nuclear matrix

may be necessary for the mouse paternal genome to participate in embryonic development. Biol Reprod 60: 702–706.

Epigenetic Transgenerational Disease Inheritance

PLOS ONE | www.plosone.org 18 January 2013 | Volume 8 | Issue 1 | e55387