Unit 8 Seminar

profileaesing

In your paper, address the following points:

  • You will get to simulate transcription and translation by building a sentence “polypeptide” from words “amino acids”. You need review the genetic code and the roles of the mRNA, tRNA and the ribosome in the process of translation. Using this knowledge be prepared to discuss the following scenario:
  • Here is the gene of interest:
    • GTAACCGTATTGCAGCTATTAGCAGCCATG

      CATTGGCATAACGTCGATAATCGTCGGTAC

    • Which DNA strand is used in the production of mRNA and why?
    • Why does the gene need a promoter and a “start”?
    • Analyze how the ribosome, tRNA and mRNA work together to fit all of the pieces of this puzzle together to make a protein.
    • Translate the sequence about to make a protein.
    • What would happen if a frame shift mutation happened in the sequence above? Specifically, what occurs if you were to add a G after the third nucleotide in the sequence? How does this impact the function of the protein in the cell?
    • Explain why an insertion of three nucleotides is less likely to result in a deleterious effect than an insertion of a single nucleotide.
    • 11 years ago
    • 5
    Answer(0)
    Bids(0)