a scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene...
carinea scientist has discovered a human gene from cancer cells. the nucleotide sequence of the template strand of the gene was determined as written below: 3'gacacgtacgagcctggacaccttaagagcgggctcggaacactggccccgattgacac5' (a) study the nucleotide sequence of the template strand and write sense strand (showing direction) of the gene. (b) write down the mrna produces from this gene. (c) how many amino acids will be present in the protein product of this gene. (d) write amino acid sequence of the polypeptide
14 years ago
999999.99
Answer(0)
Bids(0)
other Questions(10)
- 50-(6times7)=
- compare romeo and Juliet play to modern movie. write in the style of an online review.
- who is the deputy current prim minister of new zealand
- 4n squared - 8n + 3
- face north.do a 1/4 turn clockwise.mark the direction you are facing with the letter B
- An accident insurance company has reserves to cover claims on no more than 3 accidents. If all accidents have a...
- 4 on the square root of 6 divided by 3 on the square root of 5
- Why are air masses that form over water more moist than air masses that form over land
- What reasons does Roosevelt give for his proposed Court restrictions?
- find differential equation of straight line with a fixed point (h,k)
