This lab has two parts – please answer all parts. Lab 7: Biotechnology A. Gene Finder Activity Lab Materials Materials found in your lab...
This lab has two parts – please answer all parts.
Lab 7: Biotechnology
A. Gene Finder Activity
Lab Materials
Materials found in your lab kit:
• none
Additional materials needed:
• access to the Internet
Activity
1. Connect to the Internet.
2. Go to the National Center for Biotechnology Information (NCBI) at http://blast.ncbi.nlm.nih.gov/Blast.cgi?PROGRAM=blastn&BLAST_PROGRAMS=megaBlast&PAGE_TYPE=BlastSearch&SHOW_DEFAULTS=on&LINK_LOC=blasthome
3. You will see the following screen:
4. Copy the exact nucleotide sequence given below and then paste it into the Enter Query Sequence box on the Nucleotide-nucleotide BLAST search page. Accuracy is extremely important. The sequence should be one long string of letters with no spaces. Record the sequence number you are given (you may have a different sequence than your classmates).
DNA sequences (When copying and pasting, please don't include the dashes!)
For the men:
----------------------------------------------------------------
cccgaattcgacaatgcaatcatatgcttctgctatgttaagcgtattcaacagcgatgattacagtccagctgtgcaagagaatattcccgctctccggagaagctcttccttcctttgcactgaaagctgtaactctaagtatcagtgtgaaacgggagaaaacagtaaaggcaacgtccaggatggagtgaagcgacccatgaacgcattcatcgtgtggtctcgcgatcagaggcgcaagatggctctagagaatcccagaatgcgaaactcagagatcagcaagcagctgggataccagtggaaaatgcttactgaagccgaaaaatggccattcttccaggaggcacagaaattacaggccatgcacagagagaaatacccgaattataagtatcgacctcgtcggaaggcgaagatgctgccgaagaattgcagtttgcttcccgcagatcccgcttcggtactctgcagcgaagtgcaactggacaacaggttgtacagggatgactgtacgaaagccacacactcaagaatggagcaccagctaggccacttaccgcccatcaacgcagccagctcaccgcagcaacgggaccgctacag
----------------------------------------------------------------
For the women:
----------------------------------------------------------------
cagtggaattctagagtcacacttcctaaaatatgcatttttgttttcacttttagatatgatacggaaattgatagaagcagaagatcggctataaaaaagataatggaaagggatgacacagctgcaaaaacacttgttctctgtgtttctgacataatttcattgagcgcaaatatatctgaaacttctagcagtaaaactagtagtgcagatacccaaaaagtggc
---------------------------------------------------------------
5. Scroll down and Press BLAST:
Once you have pasted the sequence in the Search box, click on BLAST! A screen should appear that says to wait a period of time (usually 30 seconds or less) for the search to be completed. Be patient while formatting takes place.
After the search has ended, scroll down the screen until you find a list introduced by the words DESCRIPTIONS – look below it and find Sequences producing significant alignments. Listed in order are the closest matches with the pasted DNA sequence.
6. Find the first listing (the closest match) that has both a blue square containing a 'G' and the term Human or Homo sapiens in the description. Click on the blue G. Clicking on the G will take you to a new screen that gives the gene name, symbol, and identifier. Write down or electronically copy the name of the gene. (Copy and paste the information in a separate MSWord file for your records).
7. Read the information on the gene and disease and then answer the following questions:
1. Find and record the name of the corresponding gene you were assigned.
SRY
2. Record the gene locus [LOCATION].
Yp11.31 .
3. Report the chromosome this gene is located on.
?
8. Find at the right hand side the word LINKS and click on the link labeled OMIM (Online Mendelian Inheritance in Man).
9. Scroll down for information about the gene and disorder/ disease associated with it – you will get several links.
Because a gene may be associated with more than one disease/ disorder, different reference numbers may provide information on other diseases/ disorders that are associated with the gene you’re researching. You may use more than one for the next question.
10. Prepare a summary describing the genetic disease that is a result of the mutated gene. Provide the name of the normal protein that is encoded by the normal gene and describe the role of this protein. Then, describe the structural and functional alteration that has occurred as a result of the mutation. Include in the description the effects on the phenotype of an individual with the genetic disease.
Type in here. This expands as you type.
Critical Thinking Questions and Summary
Please answer these comprehensively (i.e., at least 2 well–thought-out sentences each).
1. Explain how DNA determines the traits of an organism. Discuss the roles of nucleotides, genes, genotypes, proteins, and phenotypes in your answer.
Type in here. This expands as you type.
2. How do genetic mutations affect the traits of an organism? Explain how mutations may cause genetic diseases. Provide an example of a genetic disease caused by a mutation.
Type in here. This expands as you type.
3. What are some possible ramifications if the DNA information of individuals were made available to employers and insurance companies?
Type in here. This expands as you type.
4. Summarize in your own words what you have learned from the Gene Finder Activity. (At least five (5) well-thought-out sentences.)
Type in here. This expands as you type.
[removed]
Lab 7: Biotechnology
B. DNA Fingerprints Activity
Lab Materials
Materials found in your lab kit:
• none
Additional materials needed:
• access to the Internet
Activity
Quick Guide to Forensic DNA
Just like fingerprints, DNA is unique to each person. Also like fingerprints, DNA can be used to identify a person when biological material containing DNA is left at a crime scene. Several techniques are available to generate DNA fingerprints from biological samples. Here we will illustrate the use of restriction enzymes and gel electrophoresis.
Restriction enzymes are naturally occurring proteins produced by bacteria. These enzymes function like DNA scissors; they look for specific sequences within a piece of DNA, and where those sequences occur, they cut the DNA through both strands. For example, one restriction enzyme recognizes the sequence -GGATCC-, and will cut a piece of DNA containing that sequence between the A and the T. If this enzyme were applied to the piece of DNA below, it would cut it into three pieces, as shown in figure 11.1.
Notice the enzyme cut the DNA only where the sequence -GGATCC- occurred. This cut the original piece of DNA that was 25 nucleotide pairs long into three fragments that were 7, 8, and 10 nucleotide pairs long. The sizes of the fragments produced will vary depending on the source of the DNA; thus, the fragmentation pattern can be used to identify the source of a particular DNA sample.
To visualize the fragment pattern produced from restriction enzyme digestion of a DNA sample, forensic scientists use a process called gel electrophoresis (visit http://gslc.genetics.utah.edu/units/biotech/gel/ for additional information and an interactive virtual experiment). In this procedure, a dense, gelatin-like material is poured between two closely spaced glass plates. Once the material has solidified, DNA samples are loaded into slots cut in the top of the gel, and a strong electric field is applied to it for a certain period of time (60 minutes, for example), with the negative pole at the top and the positive pole at the bottom.
Because DNA is negatively charged, it will migrate through the gel toward the positive pole. The smaller the fragment of DNA, the faster it can travel through the gel, so fragments of different sizes will separate from each other, with the smaller, faster-moving fragments finishing near the bottom, and larger, slower-moving fragments staying closer to the top. This will produce a banding pattern, like a DNA bar code, that can show the unique differences between individuals.
The animation in figure 11.2 summarizes the procedure we have just described:
1. DNA fragments migrate on the gel as electrical current is applied (smaller fragments migrate faster).
2. After a certain time period, the current is shut off and the gel is stained to view the various patterns of the DNA samples.
Note that in figure 11.2, lane 2 represents the banding pattern that would be produced from the restriction enzyme activity illustrated in figure 11.1 above (yielding fragments of 7, 8, and 10 nucleotide pairs).
The Crime Scene
In this activity, you will be given DNA isolated from two samples left at a crime scene. A victim has been found murdered. The forensics team has gathered DNA evidence from blood on a power strip and from material found under the victim's fingernails. Your job is to compare the DNA from the samples with the DNA of six known subjects and determine if there is a match.
To process these samples you will perform the following steps:
1. First, examine the DNA sequences for the presence of the restriction enzyme recognition sequence -GGATCC-, and wherever it occurs, "cut" the DNA through both strands between the A and the T.
2. Then, determine the fragment sizes that will be produced from cutting the DNA at these sites by counting the number of nucleotide pairs in each fragment - e.g., if the fragments are as follows, with * indicating the cut point,
then the fragment sizes are (counting from the first A = ) 10 nucleotide pairs, and (counting from the C in the next fragment) = 4 nucleotide pairs.
Note: For a long DNA sequence such as in forensic analyses, there are several GGATTC cut points, varying per individual. Thus, you would expect several fragments which will differ among different individuals. So, look for all the GGATCC sites on the stretch of DNA given and “cut them up”. (In real life, many different enzymes are used to cut up the DNA at different recognition sequences).
3. Next, if you have access to a printer, print the page that includes figure 11.3 and draw the appropriate line markings into lanes 1 and 2.
Note: A barcode-like pattern will emerge and would be different per given individual. Match those which are identical, and form your own conclusions (e.g., Who did it? Who was the possible perpetrator or the “perp”?).
4. Finally, compare the fragment patterns from the two samples to the known patterns of the suspects to determine the source of the two biological samples. (If you can’t print the figure, list your fragment lengths in increasing order and find the lane whose markings match those for samples 1 and 2.)
DNA Samples
The DNA sequences from the two samples found at the crime scene are given below. Recall the restriction enzyme recognition site: -GGATCC-. The enzyme cuts between each occurrence of A and T in both samples.
Sample 1: Blood from power strip
Sample 2: Biological material under victim's fingernails
"Cut" the strands and enter the resulting fragment sizes into the boxes below.
Analysis and Results
1. Fragment sizes for sample 1:
Type in here. This expands as you type.
2. Fragment sizes for sample 2:
Type in here. This expands as you type.
Figure 11.3
DNA Fingerprinting Gel
Lane 1: Blood sample from power strip
Lane 2: Material from under victim's fingernails
Lane 3: Subject A's (Victim's) DNA
Lane 4: Subject B's DNA
Lane 5: Subject C's DNA
Lane 6: Subject D's DNA
Lane 7: Subject E's DNA
Lane 8: Subject F's DNA
3. Sample found on power strip came from:
Type in here. This expands as you type.
4. Sample found under victim's fingernails came from:
Type in here. This expands as you type.
Critical Thinking Questions & Summary
1. What conclusions can or cannot be drawn from the DNA analysis you conducted in the DNA Fingerprints Activity?
Type in here. This expands as you type.
2. Both conventional fingerprints (from your fingers) and DNA fingerprints are ways to identify individuals present at a crime scene. Why is DNA fingerprinting a more reliable way to positively identify those present at a crime scene than using conventional fingerprints?
Type in here. This expands as you type.
3. In some cases, juries have failed to find suspects guilty of a crime despite DNA fingerprint evidence showing their presence at the crime scene. Describe two ways DNA evidence can be compromised, leading to uncertainty.
Type in here. This expands as you type.
4. Besides forensic applications, what are some other ways in which DNA fingerprinting may be useful? Describe three other ways DNA fingerprinting might be useful in providing positive identification.
Type in here. This expands as you type.
5. Summarize, in your own words, what you have learned from the DNA Fingerprints Activity.
Type in here. This expands as you type.
[removed]
13 years ago
999999.99
Answer(0)
Bids(0)
other Questions(10)
- What did Andrew Jackson say? How did Andrew Jackson rationalize, justify removal of Native Americans from their historical and pre-historical...
- bio hw help
- what are the functions of the cytoskeleton?
- write the equations of the lines through the given point (a)parallel to the given line and (b)perpendicular to th given...
- help for free? adjusting entry
- The Time Capsule Paper communications The International Committee on Interpersonal Communication wants to prepare a time capsule to educate future...
- help me with math problem 11+[(4+7)x3)]
- How would utilitarianism decide whether abortion is ethically permissible or not?
- what is a champion? And how does success/failure effect champions?
- Statistics