DNA homicide fingerprinting case

LAB:  INTRODUCTION TO DNA FINGERPRINTING

Half of your 46 chromosomes were inherited from your mother and the other half from your father. Consequently, everyone has a unique DNA pattern (except for identical twins). Tissue samples containing DNA can be used for identification in criminal cases, paternity suits, and in cases where visual identification is not possible. The technique used to make these genetic comparisons is referred to as DNA fingerprinting.

DNA for examination is isolated with a process similar to the method you used in the DNA spooling laboratory. As you know, DNA is located in the nucleus of all body cells. Therefore, DNA can be extracted from any tissue. Common sources include white blood cells, hair roots, semen, saliva (which contains epithelial cells), and other body tissues.

Not all of a person's DNA codes for synthesis of proteins. A substantial percentage has no known function and is referred to as "junk" DNA (see Figure 1). Junk DNA can be found wedged in between the coding regions of all DNA molecules.

FIGURE 1.  Position Coding and "junk" DNA

The pattern of junk DNA between any given two genes is unique and has the same repeating pattern of nucleotides (for example C A T). The number of times these nucleotides are repeated, however, is highly variable among people.

As you can see in Figure 2, Person A has nine repeating C A T segments, while person B has only five. Some people have dozens of repeats of the same pattern.

CATCATCATCATCATCATCATCATCAT      Person A

CATCATCATCATCAT     Person B

FIGURE 2. Repeating junk DNA Segments

Each person has a distinct DNA profile (or "fingerprint").  The process used to create a DNA profile is called RFLP Analysis. RFLP stands for restriction fragment length polymorphism. DNA extracted from a blood or tissue sample is cut into small pieces- at specific locations using special chemicals called restriction enzymes.

Fragment length polymorphism refers to the fact that the pieces (fragments) of repeating junk DNA are different lengths for different people.  To make a reliable "RFLP match," molecular geneticists use several different areas of junk DNA. When several different regions are compared, the odds against a mistaken match can be more than a billion to one.

RFLP FINGERPRINTS

Fragments of DNA are separated using a process called gel electrophoresis. The gel is a thin sheet of gelatin supported by a glass plate with electrodes attached at both ends. One end of the gel has a positive charge and the other end has a nega­tive charge.

The DNA fragments are attracted to the positive end of the gel plate. Smaller, lighter fragments migrate more easily through the gel and therefore travel farther in a given time period than larger, heavier fragments. The light and heavy fragments form bands across the gel laver.

The DNA bands of interest are marked with special molecular probes. Probes are small pieces of DNA that use the base pairing rule to locate and bind only to the frag­ments that will be used to form the DNA profile.

The sheet of DNA bands is "photographed" with x-ray film. The only bands visible on the developed film are those that have been labeled with molecular probes. The x-ray pattern of bands is the final DNA profile.

Figure 3 shows four DNA profiles. Two profiles match and two do not match.  Matching profiles must have exactly the same banding patterns. The bands have been numbered for reference.

Figure 3.  Examples of DNA Profiles

SOLVING A CRIME ACTIVITY  

On January 1 at about 2:00 A.M. the police responded to a report of gunshots at the 600­block of Knorr Street, Arriving at the scene, the officers found a parked Dodge pickup. In the front seat was a deceased male with several gunshot wounds.

Shoe marks were visible in a large pool of blood outside the truck, but not clearly enough to identify the type of footwear. Homicide detectives have narrowed the field to three suspects.

Suspect A was arrested near the scene wearing black work boots that appear to have dried blood on the soles.

At the home of Suspect B, investigators recovered a pair of tennis shoes that also appear to have dried blood on the soles. Suspect B says she had a severe nosebleed, which might have resulted in blood on her shoes.

Suspect C was the roommate of the deceased. When officers went to the apartment to notify him of the death, Suspect C was packing a suitcase. He was wearing high­top sneakers that appeared to have dried blood on the soles and sides. When ques­tioned about the blood and murder, Suspect C had no comment.

All the samples were tested and identified as human blood. The Homicide detec­tives have asked the Central Police DNA Laboratory to analyze the blood evidence using RFLP analysis. You are the forensic scientist assigned to the case.  Figure 4 shows the DNA profiles from all the blood samples.

1.      In the box under the first column in Figure 4 (blood of victim) enter the number 1. This is the first unique DNA profile found.

2.      Moving from left to right, examine each column. If the DNA profile does not match any previously examined, enter a new number in the box under the column (2, 3, 4, etc.).

Label matching columns with the number of the profile they match until all the columns have a number beneath them.

 Figure 4.  DNA Profiles Knorr Street Homicide

I’ve added the first number for you