Lab report genetics

studnt95

Objective:

A brief (one or two sentence) statement of the objective or goals of the experiment.

Introduction:

A concise introduction to the problem being investigated. Provide background and references relevant to the experimental system. Should be no longer than one to two pages.

Materials & Methods:

A complete and detailed listing of both materials used and methods employed to complete these experiments.  The idea of this section is to permit anyone who is knowledgeable in science to understand what was done, why it was done, and have sufficient information to reproduce the experiment.

And please put this in your own words.

Results:

In this section you present the results of your experiment. This includes both raw and manipulated data, tables, charts, or graphs. The idea of this section is to present what was observed in the experiment, but not to interpret or discuss the data. Any difficulties that were noted in the course of data collection might be relevant here.

Discussion:

In this section you get your chance to interpret and explain the data that was collected. Does it make sense? Is it what you expected or predicted? If not, why not? List possible sources of errors. You may want to compare your data to that collected by other groups for the same experiment. What kinds of changes  or  suggestions  can  you  make  for  improving  or  changing  this experiment? This is an important part of the lab report. 

References:

A minimum of 5 sources for each report. Encyclopedias do not count. You can use a maximum of two web sources (URL’s) but I also want real references to actual primary scientific literature. Find and cite (in proper form at) sources that were helpful in the writing of this report. 

  1. 1.1 Forward sequence: 

AATAAATCAACTATTCTCTGTTCTTTCATGGGGAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCATCTTTAACAGCACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCAACCATCCTCCAAATAAATCAACTATTCTCTGTTCTTTCATGGGGAGCAGATTTGGGTACCACCCAAGTATTGACTCACCCATCAACAACCGCTATGTATTTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTGACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACTAGGATACCAACAAACCTACCCATCTTTAACAGCACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGGGTCCCTTGACCAACCATCCTCCA

1.2 Reverse sequence:

GCTAGGGAGGGGCAACATGGGAGAGAGGGATTGACTGTATGTGCTATGTACGGTAAATGGCTTTATGTACTATGTGCTGTTAAGATGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGGGGTGGCTTTGGAGTTGCAGTTGATGTGTGATAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGGAGGGGGTTTTGATGTGGATTGGGTTTTTATGTACTACAGGTGGTCAAGTATTTATGGTACCGTGCAATATTCATGGTGGCTGGCAGTAATGTACGAATACATAGCGGTTGTTGATGGGTGAGTCAATACTTGGGTGGTACCAAATCTGCTTCCCCATGAAAGAACAGAGAATAGTTTAAATTACAAAAATTAAGCTTGGGTGCTAATGGTGGGAGTTAAACAA

2. Compare forward and reverse sequences. Open both your forward and reverse sequence files. These should be complements of each other. A fast way to compare these two is to use the BLAST feature of NCBI (GenBank) to BLAST2sequences. This will rapidly align these and show you where they do and do not match. Where they do not match is something you should pay attention two. The base callings routines are not infallible and if there is a discrepancy it is likely because the base was called incorrectly by the software on one strand. You have to step in and make a call as to which strand is correct. Once you have done this for all mismatches the two strands should be perfectly complementary to each other. You will notice that the ends of the two molecules are not matching – each will have 20 bases or so that are not in the other strand. You should be able to explain why that is.
3. Determine your haplogroup by doing a BLAST search. Once you have opened and viewed your DNA sequence, copy and paste your sequence and follow my previous instructions on searching this sequence against all known genetic sequence data on GenBank using the BLAST protocol. (BLAST stands for Basic Local Alignment Search Tool). This will help you to determine your haplogroup. This is an important piece of information and will give you quite a bit to write about. Once you have your haplogroup determined you can research this on the web and find out what it means. I have posted a few articles that discuss the concept of haplogroups. I suggest starting with the Wikipedia entry – it gives a nice short introduction to mitochondrial haplogroups and their distribution worldwide. Also use the URL link I provided on Canvas for determining your haplogroup. 

4. Compare your DNA sequence to others. You can open up any of your colleagues data sets (using the same software you used to open and view your sequence data) and compare the D-loop regions. What you will most likely find is that your sequence is different from any other randomly picked sample. Over 400 bp of D-loop sequence you likely see at least a few SNP’s (single nucleotide polymorphisms). This is what allows scientists to use this region to fingerprint individuals using their DNA. 

pastedGraphic.png
pastedGraphic_1.png
pastedGraphic.png
pastedGraphic_2.png
pastedGraphic_3.png
 

An easy way to align and compare D-loop sequences is to use a program called Clustal. One of the easiest Clustal alignments can be done on the Dolan DNA Learning Center’s site maintained by the Cold Spring Harbor Laboratories. You can access this BioServer Site by clicking here. Use the Sequence Server (you can enter as a guest or create a free login by registering). Click on Create Sequence and this will allow you to cut and paste sequences into your workspace. You can enter up to 10 sequences to compare. After they are entered you just click on the boxes of the sequences you want to align and then click on “Compare” (with the box reading Align: Clustal W). You will then get a computer alignment of your sequences showing where they are identical and where they are different (colored yellow). This can be printed out and used in your report. 

Another useful feature of this site is that you can download and use hundreds of different D-loop sequences to compare to your own. These include ancient DNA samples, modern groups of humans, non-human primates, and even Neanderthal mtDNA D-loop sequences. To access these just click on “Manage Groups” and drop down the window that reads classes. I have included the help file in a separate .pdf file. 

5. Phylogenetic Tree. Once your data has been entered and you perform a Clustal Alignment you can easily create a tree diagram that will show visually how you are related to others based on your D-loop sequence. This is called a phylogenetic tree and can be created by clicking on the drop down box that reads Align: Clustal W (next to compare). Select Phylogenetic Tree and hit “Compare.” A tree diagram will be drawn to compare your selected sequences. 

Compare to this DNA sequence:

1. Forward sequence: 

GAATAATTTAACTATTCTCTGTTCTACATGGGGAGCAGATTGGGTACCACCCAAGTATTGACTTACCCATCAACAACCGCTATGTATCTCGTACATTACTGCCAGCCACCATGAATATTGCACGGTACCATAAATACTTAACCACCTGTAGTACATAAAAACCCAATCCACATCAAAACCCCCTCCCCATGCTTACAAGCAAGTACAGCAATCAACCCTCAACTACCACACATCAACTGCAACTCCAAAGCCACCTCTCACCCACTAGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACATAGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGAAAACCCTTGACCAACCATCCTCCAGGGCCGAGGGTAATTTCTTTTGGTTTCATTCTAAAGGCACCATTGTGCGACTTTCTATTTGAACTCAAGGGCAGTTTCTTTATTCCTCTCCCTTTACTCTCGCATCCTTAAAGGAAAAGGAGGTTTCGAATTCCCCCCTGTCTAATTGTTAGAGCACACATAGGCGATCGTTCTATAACTCAGCACAAACCGGGGGGAAAAACATTTCATAGGGGCACTAAGTCTCGGATTCCCCATCTTCCCCCGGGGGCTGGGCGGGTAGCCCCTTGAAAACACTAGACCCTTCGGTGGTAAAAATTGCCTACAACCGAATTAAAAAATGAGAGCCGTTTTTCCTGGC

Reverse sequence:

ATTTTGAGGGGGCTTCTTGGGGGGCGAGTAGGATTGACTCGTGATGTGCTATGTACGGTAATGGCTTTATGTACTATGTACTGTTAAGGGTGGGTAGGTTTGTTGGTATCCTAGTGGGTGAGAGGTGGCTTTGGAGTTGCAGTTGATGTGTGGTAGTTGAGGGTTGATTGCTGTACTTGCTTGTAAGCATGGGGAGGGGGGTTTTGATGTTGGATTGGGTTTTTTATGTACTACAGGTGGTTAAGTATTTTATGGTACCGTGCAATTATTTCATGGGTGGCTGGGCAGTATTGTACGGAGATACCATAGCGGGTTGGTTGGATGGGGTAAAGTCATTAATTTGGGGTGGGTACCCCAAATCTGCTTCCCCCATGAAAAGAAACAGAGAATAAGTTTTAATTTTGGTTTCTTTAGCTTTGGGGTGCTTAATGGGGGGGAGGTTAAAAAACCCCCCCGCCGTTTCCCGGGGGGGGGGGGGGGGGCAACCTTCCCCGGGCCCGGGGGGAAAACTAACCCGTATGGACAGTCTTCCAATCACGTCAAAGTTTAGGTCTTTTTATATTACTTCAATGGGGCTGGGGGACGTTCGGGAAAACGGGTGACCCATTGGGGGGTTAATCACCTTGGGGGATAGTCCGGTGGGGGAGCTGGCCCAAGTGCCCAATATCAACGTGGTGACGGGGGGGTGGGGGGGGGGCGGTGGGGTCTCGAAA

    • 6 years ago
    • 30
    Answer(1)

    Purchase the answer to view it

    NOT RATED
    • AnswerDocument.docx