BIOLOGY 8B

babababat

 

Your assigned reading over the past two weeks has introduced you to the structure and function of DNA.

  • Write a brief outline of the mechanisms in which DNA is used to generate protein. You  do not need to provide a fine level of detail, but ensure you reflect  on the key points in the process and mention any major differences  between the mechanism in prokaryotic and eukaryotic cells
  •  Although the DNA in our genes is considered to be the heritable  genetic material, other factors, including the environment are  considered to play an important role in the activity and expression of  those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease. 
  • Finally - using the codon table found in Figure 15.4 in  Chapter 15 of the textbook, translate these two almost identical RNA  strands into peptide sequences, using the first base of each as the  first triplet in a codon.  You will notice that the second  strand has a point deletion  (the u in bold) with respect to the first  strand – comment on how this has affected the resulting peptide chain.
    • aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
    • aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
    • 5 years ago
    • 5
    Answer(2)

    Purchase the answer to view it

    NOT RATED
    • structureandfunctionofDNA.edited.docx
    • TurnitinReport.pdf

    Purchase the answer to view it

    NOT RATED