BIOLOGY 8B
Your assigned reading over the past two weeks has introduced you to the structure and function of DNA.
- Write a brief outline of the mechanisms in which DNA is used to generate protein. You do not need to provide a fine level of detail, but ensure you reflect on the key points in the process and mention any major differences between the mechanism in prokaryotic and eukaryotic cells
- Although the DNA in our genes is considered to be the heritable genetic material, other factors, including the environment are considered to play an important role in the activity and expression of those genes. Summarize the role that epigenetics & developmental epigenetics play in health & disease.
- Finally - using the codon table found in Figure 15.4 in Chapter 15 of the textbook, translate these two almost identical RNA strands into peptide sequences, using the first base of each as the first triplet in a codon. You will notice that the second strand has a point deletion (the u in bold) with respect to the first strand – comment on how this has affected the resulting peptide chain.
- aguuguuaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
- aguuguaucgaaaacugcgaguaaauauccugagggcgcgaagcaacc
5 years ago 5
Answer(2)
Purchase the answer to view it
NOT RATED
- structureandfunctionofDNA.edited.docx
- TurnitinReport.pdf
Purchase the answer to view it
NOT RATED
other Questions(10)
- Dues
- HSM 230 Week 9 Capstone Checkpoint
- 8 - 10 Pages
- EDU 626 Week 6 Final Paper Research Proposal
- ECO 212 Week 1 Individual Assignment How People Make Economic Decisions Paper
- CJS 240 Week 7 Checkpoint Gang Development and Control Checkpoint (Appendix E)
- BUS 620 Starbuck's Coffee
- BUS 210 ENTIRE COURSE TUTORIAL
- Creative_Writer
- 600 wordAPA formatted referencesUnderstanding Risk Tolerance Levels...