Ethics reflection paper

Q123
Wuetal2017_2.pdf

Article

Interspecies ChimerismwithMammalian Pluripotent

Stem Cells

Graphical Abstract

Highlights

d Naive rat PSCs robustly contribute to live rat-mouse

chimeras

d A versatile CRISPR-Cas9 mediated interspecies blastocyst

complementation system

d Naive rodent PSCs show no chimeric contribution to post-

implantation pig embryos

d Chimerism is observed with some human iPSCs in post-

implantation pig embryos

Wu et al., 2017, Cell 168, 473–486 January 26, 2017 ª 2017 Elsevier Inc. http://dx.doi.org/10.1016/j.cell.2016.12.036

Authors

Jun Wu, Aida Platero-Luengo,

Masahiro Sakurai, ..., Emilio A. Martinez,

Pablo Juan Ross,

Juan Carlos Izpisua Belmonte

Correspondence belmonte@salk.edu

In Brief

Human pluripotent stem cells robustly

engraft into both cattle and pig pre-

implantation blastocysts, but show

limited chimeric contribution to post-

implantation pig embryos.

Article

Interspecies Chimerism with Mammalian Pluripotent Stem Cells Jun Wu,1 Aida Platero-Luengo,1 Masahiro Sakurai,1 Atsushi Sugawara,1 Maria Antonia Gil,2 Takayoshi Yamauchi,1

Keiichiro Suzuki,1 Yanina Soledad Bogliotti,3 Cristina Cuello,2 Mariana Morales Valencia,1 Daiji Okumura,1,7

Jingping Luo,1 Marcela Vilariño,3 Inmaculada Parrilla,2 Delia Alba Soto,3 Cristina A. Martinez,2 Tomoaki Hishida,1

Sonia Sánchez-Bautista,4 M. Llanos Martinez-Martinez,4 Huili Wang,3 Alicia Nohalez,2 Emi Aizawa,1

Paloma Martinez-Redondo,1 Alejandro Ocampo,1 Pradeep Reddy,1 Jordi Roca,2 Elizabeth A. Maga,3

Concepcion Rodriguez Esteban,1 W. Travis Berggren,1 Estrella Nuñez Delicado,4 Jeronimo Lajara,4 Isabel Guillen,5

Pedro Guillen,4,5 Josep M. Campistol,6 Emilio A. Martinez,2 Pablo Juan Ross,3 and Juan Carlos Izpisua Belmonte1,8,* 1Salk Institute for Biological Studies, 10010 N. Torrey Pines Road, La Jolla, CA 92037, USA 2Department of Animal Medicine and Surgery, University of Murcia Campus de Espinardo, 30100 Murcia, Spain 3Department of Animal Science, University of California Davis, One Shields Avenue, Davis, CA 95616, USA 4Universidad Católica San Antonio de Murcia (UCAM) Campus de los Jerónimos, N� 135 Guadalupe 30107 Murcia, Spain 5Clinica Centro Fundación Pedro Guillén, Clı́nica CEMTRO, Avenida Ventisquero de la Condesa 42, 28035 Madrid, Spain 6Hospital Clı́nico de Barcelona-IDIBAPS, Universitat de Barcelona, 08007 Barcelona, Spain 7Present address: Graduate School of Agriculture, Department of Advanced Bioscience, Kinki University, 3327-204 Nakamachi,

Nara 631-8505, Japan 8Lead Contact

*Correspondence: belmonte@salk.edu

http://dx.doi.org/10.1016/j.cell.2016.12.036

SUMMARY

Interspecies blastocyst complementation enables organ-specific enrichment of xenogenic pluripotent stem cell (PSC) derivatives. Here, we establish a ver- satile blastocyst complementation platform based on CRISPR-Cas9-mediated zygote genome editing and show enrichment of rat PSC-derivatives in several tissues of gene-edited organogenesis- disabled mice. Besides gaining insights into species evolution, embryogenesis, and human disease, inter- species blastocyst complementationmight allow hu- man organ generation in animals whose organ size, anatomy, and physiology are closer to humans. To date, however, whether human PSCs (hPSCs) can contribute to chimera formation in non-rodent spe- cies remains unknown. We systematically evaluate the chimeric competency of several types of hPSCs using a more diversified clade of mammals, the un- gulates. We find that naı̈ve hPSCs robustly engraft in both pig and cattle pre-implantation blastocysts but show limited contribution to post-implantation pig embryos. Instead, an intermediate hPSC type ex- hibits higher degree of chimerism and is able to generate differentiated progenies in post-implanta- tion pig embryos.

INTRODUCTION

Embryonic pluripotency has been captured in vitro at a spectrum

of different states, ranging from the naive state, which reflects

unbiased developmental potential, to the primed state, in which

cells are poised for lineage differentiation (Weinberger et al.,

2016; Wu and Izpisua Belmonte, 2016). When attempting to

introduce cultured pluripotent stem cells (PSCs) into a devel-

oping embryo of the same species, recent studies demonstrated

that matching developmental timing is critical for successful

chimera formation. For example, naive mouse embryonic stem

cells (mESCs) contribute to chimera formation when injected

into a blastocyst, whereas primed mouse epiblast stem cells

(mEpiSCs) efficiently engraft into mouse gastrula-stage em-

bryos, but not vice versa (Huang et al., 2012; Wu et al., 2015).

Live rodent interspecies chimeras have also been generated us-

ing naive PSCs (Isotani et al., 2011; Kobayashi et al., 2010; Xiang

et al., 2008). However, it remains unclear whether naive PSCs

can be used to generate chimeras between more distantly

related species.

The successful derivation of human PSCs (hPSCs), including

ESCs from pre-implantation human embryos (Reubinoff et al.,

2000; Thomson et al., 1998), as well as the generation of induced

pluripotent stem cells (iPSCs) from somatic cells through cellular

reprograming (Takahashi et al., 2007; Park et al., 2008; Wernig et

al., 2007; Yu et al., 2007; Aasen et al., 2008), has revolutionized

the way we study human development and is heralding a new

age of regenerative medicine. Several lines of evidence indicate

that conventional hPSCs are in the primed pluripotent state,

similar to mEpiSCs (Tesar et al., 2007; Wu et al., 2015). A number

of recent studies have also reported the generation of putative

naive hPSCs that molecularly resemble mESCs (Gafni et al.,

2013; Takashima et al., 2014; Theunissen et al., 2014). These

naive hPSCs have already provided practical and experimental

advantages, including high single-cell cloning efficiency and

facile genome editing (Gafni et al., 2013). Despite these

advances, it remains unclear how the putative higher develop-

mental potential of naive hPSCs can be used to better

Cell 168, 473–486, January 26, 2017 ª 2017 Elsevier Inc. 473

A B

C D

E F

Figure 1. Interspecies Rat-MouseChimeras

Derived from Rat PSCs

(A) Rat-mouse chimeras generated by rat ESCs

(DAC2). Left, anE18.5 rat-mouse chimeric fetus.Red,

hKO-labeled rat cells. Right, a 12-month-old (top) and

24-month-old (bottom) rat-mouse chimera.

(B) Chimera forming efficiencies with rat ESC lines

(DAC2 and DAC8) and rat iPSC lines (SDFE and

SDFF). n, number of embryo transfers.

(C) Representative fluorescence images showing

hKO-labeled rat ESCs (DAC2) contributed to

different tissues in the 24-month-old rat-mouse

chimera. Red, hKO-labeled rat cells. Blue, DAPI.

Scale bar, 100 mm.

(D) Representative immunofluorescence images

showing the expression of aging-related histone

marks, including H3K9me3 and H4K20me3, in the

kidney tissue of neonatal and 24-month-old chi-

meras. Scale bar, 10 mm.

(E) Levels of chimerism of rat ESCs (DAC2) in

different tissues of the 24-month-old rat-mouse

chimera. Error bars indicate SD.

(F) Rat iPSCs (SDFE) contributed to the neonatal

mouse gall bladder. Left, bright-field (top) and

fluorescence (bottom) images showing a neonatal

mouse gallbladder contained cells derived from rat

iPSCs. White arrowheads indicate the gallbladder.

Right, representative immunofluorescence images

showing the expression of a gallbladder epithelium

marker (EpCAM) by rat cells. Red, hKO-labeled rat

cells; blue, DAPI. Scale bar, 50 mm.

See also Figure S1 and Table S2.

understand human embryogenesis and to develop regenerative

therapies for treating patients.

Like naive rodent PSCs, naive hPSCs can potentially be used to

generate interspecies chimeras for studying human development

and disease, and producing functional human tissues via interspe-

cies blastocyst complementation. To date, however, all reported

attempts on generating hPSC-derived interspecies chimeras

have used the mouse as the host animal, and the results obtained

suggest that this process is rather inefficient (Gafni et al., 2013;

Theunissen et al., 2014, 2016). Although the mouse is one of the

most important experimental models for stem cell research, there

are considerable differences between humans andmice (e.g., early

post-implantation development, embryo size, gestational length,

and developmental speed), which may hinder not only the effi-

ciency but also the usefulness of human-mouse chimeric studies.

Thus, expanding the repertoire of host species may complement

this incipient but promising area of research in the field of regener-

ative medicine. In particular, interspecies chimera research of

474 Cell 168, 473–486, January 26, 2017

hPSCs using ungulates, e.g., pigs, cattle,

and sheep, could lead to improved

research models, as well as novel in vivo

strategies for (1) generating human organs

and tissues, (2) designing new drug

screening methodologies, and (3) devel-

oping new human disease models (Wu

and Izpisua Belmonte, 2015). Experiments

to empirically test and evaluate the

chimeric contribution of various types of hPSCs in the ungulates

are thus imperative, but currently lacking. To start filling this void,

we tested different types of hPSCs for their chimeric contribution

potential in two ungulate species, pigs and cattle.

RESULTS

Naive Rat PSCs Robustly Contribute to Rat-Mouse Interspecies Chimera Formation We first used rodentmodels to gain a better understanding of the

factors and caveats underlying interspecies chimerism with

PSCs. To this end, we used two chimeric-competent rat ESC

lines, DAC2 and DAC8 (Li et al., 2008). We labeled both lines

with a fluorescent marker, humanized kusabira orange (hKO),

for cell tracking and injected them into mouse blastocysts.

Following embryo transfer (ET) into surrogate mouse mothers,

both DAC2 and DAC8 lines gave rise to live rat-mouse chimeras

(Figures 1A and S1A). Many of the chimeras developed into

adulthood, and one chimera reached 2 years of age (Figure 1A),

indicating that the xenogeneic rat cells sustained the physiolog-

ical requirements of themouse host without compromising its life

span. We also generated two rat iPSC lines (SDFE and SDFF)

from tail tip fibroblasts (TTFs) isolated from a neonatal

Sprague-Dawley rat and used them to generate rat-mouse chi-

meras. Similar to rat ESCs, rat iPSCs could also robustly

contribute to chimera formation in mice (Figure S1B). Overall,

the chimera forming efficiencies of all rat PSC lines tested

were �20%, consistent with a previous report (Figure 1B) (Ko- bayashi et al., 2010).

We observed contribution of rat cells to a wide range of tissues

and organs in both neonatal and aged rat-mouse chimeras (Fig-

ures 1C, S1A, and S1B). We examined aging-related histone

marks in both neonatal and aged chimeras and found that the

2-year-old chimera exhibited histone signatures characteristic

of aging (Figure 1D). We quantified the degree of chimerism in

different organs of the aged chimera via quantitative qPCR anal-

ysis of genomic DNA using a rat-specific primer (Table S2). We

found that different tissues contained different percentages of

rat cells, with the highest contribution observed in the heart

(�10%) (Figure 1E). One anatomical difference between mice and rats is that rats

lack a gallbladder. In agreement with a previous report (Kobaya-

shi et al., 2010), we also observed the presence of gallbladders in

rat-mouse chimeras (chimeras derived from injecting rat PSCs

into a mouse blastocyst). Interestingly, rat cells contributed to

the chimeric gallbladder and expressed the gallbladder epithe-

lium marker EpCAM (Figures 1F and S1C), which suggests that

the mouse embryonic microenvironment was able to unlock a

gallbladder developmental program in rat PSCs that is normally

suppressed during rat development.

A Versatile CRISPR-Cas9-Mediated Interspecies Blastocyst Complementation System Chimeric contribution of PSCs is random and varies among

different host blastocysts and donor cell lines used. To selec-

tively enrich chimerism in a specific organ, a strategy called

blastocyst complementation has been developed where the

host blastocysts are obtained from a mutant mouse strain in

which a gene critical for the development of a particular lineage

is disabled (Chen et al., 1993; Kobayashi et al., 2010; Wu and

Izpisua Belmonte, 2015). Mutant blastocysts used for comple-

mentation experiments were previously obtained from existing

lines of knockout mice, which were generated by gene targeting

in germ-line-competent mouse ESCs—a time-consuming pro-

cess. To relieve the dependence on existing mutant strains,

we developed a blastocyst complementation platform based

on targeted genome editing in zygotes. We chose to use the

CRISPR-Cas9 system, which has been harnessed for the effi-

cient generation of knockout mouse models (Wang et al.,

2013) (Figure 2A).

For proof-of-concept, we knocked out the Pdx1 gene in

mouse by co-injecting Cas9 mRNA and Pdx1 single-guide

RNA (sgRNA) into mouse zygotes. During mouse development,

Pdx1 expression is restricted to the developing pancreatic

anlagen and is a key player in pancreatic development. Mice ho-

mozygous for a targeted mutation in Pdx1 lack a pancreas and

die within a few days after birth (Jonsson et al., 1994; Offield

et al., 1996). Similarly, Pdx1�/� mice generated by the zygotic co-injection of Cas9 mRNA and Pdx1 sgRNA were apancreatic,

whereas other internal organs appeared normal (Figure S2A).

These mice survived only a few days after birth. We observed

the efficiency for obtaining Pdx1�/� mouse via CRISPR-Cas9 zygote genome editing was �60% (Figure S2F). Next, we com- bined zygotic co-injection of Cas9/sgRNA with blastocyst injec-

tion of rat PSCs, and found that rat PSC-derivatives were

enriched in the neonatal pancreas of Pdx1�/� mice and ex- pressed a-AMYLAYSE, a pancreatic enzyme that helps digest

carbohydrates (Figures 2B and S2B). Of note is that in these an-

imals the pancreatic endothelial cells were still mostly of mouse

origin, as revealed by staining with an anti-CD31 antibody (Fig-

ure 2B). Importantly, pancreas enriched with rat cells supported

the successful development of Pdx1�/� mouse host into adult- hood (>7 months), and maintained normal serum glucose levels

in response to glucose loading, as determined using the glucose

tolerance test (GTT) (Figure S2C).

Taking advantage of the flexibility of the CRISPR-Cas9 zy-

gotic genome editing, we next sought to enrich xenogenic rat

cells toward other lineages. Nkx2.5 plays a critical role in early

stages of cardiogenesis, and its deficiency leads to severe

growth retardation with abnormal cardiac looping morphogen-

esis, an important process that leads to chamber and valve for-

mation (Lyons et al., 1995; Tanaka et al., 1999). Mice lacking

Nkx2.5 typically die around E10.5 (Lyons et al., 1995; Tanaka

et al., 1999). Consistent with previous observations, CRISPR-

Cas9 mediated inactivation of Nkx2.5 resulted in marked

growth-retardation and severe malformation of the heart at

E10.5 (Figure S2D). In contrast, when complemented with rat

PSCs, the resultant Nkx2.5�/� mouse hearts were enriched with rat cells and displayed a normal morphology, and the em-

bryo size was restored to normal (Figures 2C and S2D). Of note

is that although rat PSCs rescued embryo growth and cardiac

formation in E10.5 Nkx2.5�/� mouse embryos, to date we still have not obtained a live rescued chimera (n = 12, where n is

the number of ETs). Pax6 is a transcription factor that plays

key roles in development of the eye, nose and brain. Mice ho-

mozygous for a Pax6 loss-of-function mutation lack eyes, nasal

cavities, and olfactory bulbs, and exhibit abnormal cortical

plate formation, among other phenotypes (Gehring and Ikeo,

1999). Pax6 is best known for its conserved function in eye

development across all species examined (Gehring and Ikeo,

1999). In agreement with the published work, CRISPR-Cas9

mediated Pax6 inactivation disrupted eye formation in the

E15.5 mouse embryo (Figure S2E). When complemented with

rat PSCs, we observed the formation of chimeric eyes enriched

with rat cells in Pax6�/� mouse neonate (Figures 2D and S2E). Similar to Pdx1�/�, we observed efficient generation of homo- zygous Nkx2.5�/� and Pax6�/� mouse embryos via zygotic co-injection of Cas9 mRNA and sgRNAs (Figure S2F). All DNA

sequencing results of CRISPR-Cas9 mediated gene knockouts

and gRNA sequences are summarized in Tables S1 and S2,

respectively.

In sum, for the pancreas, heart, and eye, as well as several

other organs (data not shown), we successfully generated chi-

merized organs that were enriched with rat cells, demonstrating

Cell 168, 473–486, January 26, 2017 475

A

B

C D

Figure 2. Interspecies Blastocyst Complementation via CRISPR-Cas9-Mediated Zygote Genome Editing

(A) Schematic of the CRISPR-Cas9 mediated rat-mouse blastocyst complementation strategy.

(B) Left, bright-field (top) and fluorescence (bottom) images showing the enrichment of rat cells in the pancreas of an E18.5 Pdx1�/�mouse. Li, liver; St, stomach; Sp, spleen. Yellow-dotted line encircles the pancreas. Red, hKO-labeled rat cells. Middle and right (top), representative immunofluorescence images showing rat

cells expressed a-amylase in the Pdx1�/� mouse pancreas. Blue, DAPI. Right (bottom), a representative immunofluorescence image showing that some pancreatic endothelial cells, as marked by a CD31 antibody, were not derived from rat PSCs. Scale bar, 100 mm.

(C) Bright field (left) and fluorescence (right) images showing the enrichment of rat cells in the heart of an E10.5 Nkx2.5�/� mouse. Red, hKO-labeled rat cells. (D) Bright field (top) and fluorescence (bottom) images showing the enrichment of rat cells in the eye of a neonatal Pax6�/�mouse. Red, hKO-labeled rat cells. WT, mouse control; WT+rPSCs, control rat-mouse chimera without Cas9/sgRNA injection.

See also Figure S2 and Tables S1 and S2.

476 Cell 168, 473–486, January 26, 2017

A

B C

Figure 3. Naive Rodent PSCs Fail to Contribute to Chimera Formation in Pigs

(A) Schematic of the generation and analyses of post-implantation pig embryos derived from blastocyst injection of naive rodent PSCs.

(B) Summary of the pig embryos recovered between day 21–28 of pregnancy.

(C) Genomic PCR analyses of pig embryos derived from blastocyst injection of mouse iPSCs or rat ESCs. Mouse- and rat- specific mtDNA primers were used for

the detection of chimeric contribution from mouse iPSCs and rat ESCs, respectively. Pig-specific mtDNA primers were used for the control.

See also Tables S2 and S3.

the efficacy and versatility of the CRISPR-Cas9 mediated inter-

species blastocyst complementation platform.

Naive Rodent PSCs Do Not Contribute to Chimera Formation in Pigs It is commonly accepted that the key functional feature of naive

PSCs is their ability to generate intraspecies germline chimeras

(Nichols and Smith, 2009). Studies in rodents also support the

notion that attaining the naive pluripotent state is the key step

in enabling chimera formation across species boundaries (Xiang

et al., 2008; Isotani et al., 2011; Kobayashi et al., 2010). However,

it has not yet been tested whether naive rodent PSCs can

contribute to chimera formation when using a non-rodent host.

To further examine the relationship between naive PSCs and

interspecies chimerism, we injected rat ESCs into pig blasto-

cysts followed by ET to recipient sows. In addition to rat ESCs,

we also used a germline competent mouse iPSC line (Okita

et al., 2007). Several criteria were used to determine the chimeric

contribution of rodent cells in pig embryos, namely, (1) detection

of fluorescence (hKO) signal, (2) immunohistochemical (IHC) la-

beling of embryo sections with an anti-hKO antibody, and (3)

genomic PCRwithmouse- or rat-specific primers targetingmito-

chondrial DNA (mtDNA) (Figure 3A). We terminated the preg-

nancy between day 21–28 of pig development and collected

embryos derived from the injection of mouse iPSCs or rat

ESCs into pig blastocyst (26 and 19 embryos, respectively) (Fig-

ure 3B; Table S3). We failed to detect any hKO signal in both

normal size and growth retarded embryos (Figure 3B). We next

sectioned the pig embryos and stained them with an antibody

against hKO. Similarly, we did not detect any hKO-positive cells

in the embryonic sections examined (data not shown). Finally, we

employed a more sensitive test, using genomic PCR to amplify

rat- or mouse-specific mtDNA sequences (pig-specific mtDNA

primers served as the loading control) (Table S2). Consistently,

genomic PCR analyses did not detect any rodent contribution

to the pig embryos (Figure 3C). Taken together, although naive

rodent PSCs can robustly contribute to rodent-specific interspe-

cies chimeras, our results show that these cells are incapable of

contributing to normal embryonic development in pigs.

Generation of Naive, Intermediate, and Primed hiPSCs Next, we sought to systematically evaluate the chimeric compe-

tency of hPSCs in ungulate embryos. We generated hiPSCs

using several reported naive PSC culture methods, a culture

protocol supporting a putative intermediate pluripotent state

between naive mESCs and primed mEpiSCs (Tsukiyama and

Ohinata, 2014), and a primed culture condition (Figure 4A).

Mouse ground state culture condition (2iL) induces the differen-

tiation of primed hPSCs. However, when combined with the

forced expression of NANOG and KLF2 (NK2), transcription fac-

tors that help to maintain murine naive pluripotency, 2iL culture

can stabilize hPSCs in an immature state (Takashima et al.,

2014; Theunissen et al., 2014). We generated doxycycline

(DOX)-inducible NK2-expressing naive hiPSCs cultured in 2iL

medium from primed hiPSCs (2iLD-hiPSCs). Transgene-free

primed hiPSCs were reprogramed from human foreskin fibro-

blasts (HFFs) using episomal vectors (Okita et al., 2011). For

comparison, we also generated naive hiPSCs from HFFs

using the NHSM culture condition (Gafni et al., 2013) (NHSM-

hiPSCs). It has been shown that cells grown in 4i medium, a

Cell 168, 473–486, January 26, 2017 477

A

B

C

D

Figure 4. Generation and Interspecies ICM

Incorporation of Different Types of hiPSCs

(A) Schematic of the strategy for generating naive,

intermediate, and primed hiPSCs.

(B) (Top) Representative bright-field images

showing the colony morphologies of naive (2iLD-,

4i-, and NHSM-hiPSCs) and intermediate (FAC-

hiPSCs) hiPSCs. Bottom, representative immu-

nofluorescence images of naive and intermediate

hiPSCs stained with an anti-OCT4 antibody. Red,

OCT4; blue, DAPI. Scale bar, 100 mm.

(C) Schematic of the experimental procedures for

producing cattle and pig blastocysts obtained

from in vitro fertilization (IVF) and parthenoactiva-

tion, respectively. Blastocysts were subsequently

used for laser-assisted blastocyst injection of

hiPSCs. After hiPSC injection, blastocysts were

cultured in vitro for 2 days before fixation and

analyzed by immunostaining with an anti-HuNu

and an anti-SOX2 antibodies. Criteria to evaluate

the survival of human cells, as well as the degree

and efficiency of ICM incorporation are shown in

the blue box.

(D) Number of hiPSCs that integrated into the

cattle (left) and pig (right) ICMs after ten hiPSCs

were injected into the blastocyst followed by

2 days of in vitro culture. Red line, the average

number of ICM-incorporated hiPSCs. Blue dot,

the number of ICM-incorporated hiPSCs in each

blastocyst.

See also Figure S3 and Table S4.

478 Cell 168, 473–486, January 26, 2017

simplified version of NHSM, have a significant potential for germ

cell induction, a distinguishing feature between naive mESCs

and primed mEpiSCs (Irie et al., 2015). Thus, we also culture-

adapted NHSM-hiPSCs in 4i medium (4i-hiPSCs), resulting in

stable 4i-hiPSCs with similar morphological and molecular char-

acteristics to parental NHSM-hiPSCs (Figure 4B). In addition, we

generated another type of hiPSC by direct reprogramming of

HFFs in a modified mEpiSC medium containing bFGF, Activin-

A, and CHIR99021 (FAC; Figure 4A). mEpiSCs cultured in FAC

medium exhibited features characteristic of both naive mESCs

and primed mEpiSCs, supporting an intermediate pluripotent

state (Tsukiyama and Ohinata, 2014). hiPSCs generated and

cultured in FAC medium (FAC-hiPSCs) displayed a colony

morphology intermediate between that of 2iLD- and primed

hiPSCs, with less defined borders (Figure 4B). 2iLD-hiPSCs,

NHSM-hiPSCs, 4i-hiPSCs, and FAC-hiPSCs could all be stably

maintained long term in culture, preserving normal karyotypes

and the homogeneous, nuclear localization of OCT4 protein

(Figure 4B; data not shown). Notably, similar to hiPSCs grown

in naive cultures (2iLD-hiPSCs, NHSM-hiPSCs, 4i-hiPSCs),

FAC-hiPSCs could also be efficiently propagated by single-cell

dissociation without using a ROCK kinase inhibitor. After inject-

ing cells into the kidney capsule of immunodeficient NSG mice,

all of these hiPSCs formed teratomas that consisted of tissues

from all three germ layers: endoderm, mesoderm, and ectoderm

(Figure S3A). To facilitate the identification of human cells in sub-

sequent chimera experiments, we labeled hiPSCs with either

green fluorescence protein (GFP) or hKO fluorescence markers.

Chimeric Contribution of hiPSCs to Pig and Cattle Blastocysts The ability to integrate into the inner cell mass (ICM) of a blasto-

cyst is informative for evaluating whether hiPSCs are compatible

with pre-implantation epiblasts of the ungulate species. This is

also one of the earliest indicators of chimeric capability. We

therefore evaluated interspecies chimeric ICM formation by in-

jecting hiPSCs into blastocysts from two ungulate species, pig

and cattle.

Cattle-assisted reproductive technologies, such as in vitro

embryo production, are well established given the commercial

benefits of improving the genetics of these animals. Cattle also

serve as a research model because of several similarities to hu-

man pre-implantation development (Hansen, 2014; Hasler,

2014). Using techniques for producing cattle embryos in vitro,

we developed a system for testing the ability and efficiency of

hiPSCs to survive in the blastocyst environment and to integrate

into the cattle ICM (Figure 4C). Cattle embryos were obtained by

in vitro fertilization (IVF) using in vitro matured oocytes collected

from ovaries obtained from a local slaughterhouse. The tightly

connected cells of the blastocyst trophectoderm from large live-

stock species, such as pig and cattle, form a barrier that compli-

cates cell microinjection into the blastocoel. Thus, microinjection

often results in embryo collapse and the inability to deposit the

cells into the embryo. To facilitate cell injection we employed a

laser-assisted approach, using the laser to perforate the zona

pellucida and to induce damage to a limited number of trophec-

toderm cells. This allowed for easy access into the blastocyst

cavity for transferring the human cells (Figure S3B). Furthermore,

the zona ablation and trophectoderm access allowed use a

blunt-end pipette for cell transfer, thus minimizing further em-

bryo damage. This method resulted in a nearly 100% injection

effectiveness and >90% embryo survival.

To determine whether hiPSCs could engraft into the cattle

ICM, we injected ten cells from each condition into cattle blasto-

cysts collected 7 days after fertilization. After injection, we

cultured these blastocysts for additional 2 days before analysis.

We used several criteria to evaluate the chimeric contribution of

hiPSCs to cattle blastocysts: (1) average number of human cells

in each blastocyst, (2) average number of human cells in each

ICM, (3) percentage of blastocysts with the presence of human

cells in the ICM, (4) percentage of SOX2+ human cells in the

ICM, and (5) percentage of human cells in the ICM that are

SOX2+ (Figure 4C). Our results indicated that both naive and in-

termediate (but not primed) hiPSCs could survive and integrate

into cattle ICMs, albeit with variable efficiencies (Figures 4D

and S3C–S3E; Table S4). Compared with other cell types,

4i-hiPSCs exhibited the best survival (22/23 blastocysts con-

tained human cells), but the majority of these cells lost SOX2

expression (only 13.6% of human cells remained SOX2+). On

average, 3.64 4i-hiPSCs were incorporated into the ICM.

NHSM-hiPSCs were detected in 46 of 59 injected blastocysts,

with 14.41 cells per ICM. Of these, 89.7% remained SOX2+.

For 2iLD-hiPSCs, 40 of 52 injected blastocysts contained human

cells, with 5.11 cells per ICM, and 69.9% of the ICM-incorpo-

rated human cells remained SOX2+. FAC-hiPSCs exhibited

moderate survival rate (65/101) and ICM incorporation efficiency

(39/101), with an average of 2.31 cells incorporated into the ICM,

and 89.3% remaining SOX2+.

We also performed ICM incorporation assays by injecting

hiPSCs into pig blastocysts. Because certain complications

are frequently associated with pig IVF (Abeydeera, 2002;

Grupen, 2014) (e.g., high levels of polyspermic fertilization), we

used a parthenogenetic activation model, which enabled us to

efficiently produce embryos that developed into blastocysts

(King et al., 2002). Pig oocytes were obtained from ovaries

collected at a local slaughterhouse. Once the oocytes were

matured in vitro, we removed the cumulus cells and artificially

activated the oocytes using electrical stimulation. They were

then cultured to blastocyst stage (Figure 4C). We injected ten

hiPSCs into each pig parthenogenetic blastocyst and evaluated

their chimeric contribution after 2 days of in vitro culture (Figures

4C and S3C–S3E; Table S4). Similar to the results in cattle, we

found that hiPSCs cultured in 4i and NHSM media survived bet-

ter and yielded a higher percentage of blastocysts harboring

human cells (28/35 and 37/44, respectively). Also, among all

blastocysts containing human cells, we observed an average

of 9.5 cells per blastocyst for 4i-hiPSCs and 9.97 cells for

NHSM-hiPSCs. For NHSM-hiPSCs, 19/44 blastocysts had

human cells incorporated into the ICM. In contrast, only 6/35

blastocysts had 4i-hiPSCs localized to the ICM. For 2iLD-

hiPSCs, we observed an average of 5.7 cells per blastocyst,

with 2.25 human cells localized to the ICM. For FAC-hiPSCs,

an average of 3.96 and 1.62 human cells were found in the blas-

tocyst and ICM, respectively. Once incorporated into the ICM,

82.2%, 72%, 60.9%, and 40% of 2iLD-, 4i-, NHSM-, and FAC-

hiPSCs, respectively, stained positive for the pluripotency

Cell 168, 473–486, January 26, 2017 479

marker SOX2. These results indicate that both naive and inter-

mediate hiPSCs seem to perform better when injected into cattle

than pig blastocysts. This suggests a different in vivo blastocyst

environment in pig and cattle, with the cattle blastocysts

providing an environment that is more permissive for hiPSC inte-

gration and survival.

Chimeric Contribution of hiPSCs to Post-implantation Pig Embryos Although ICM incorporation of hiPSCs is the necessary first step

to contribute to the embryo proper of host animals, it has limited

predictive value for post-implantation chimera formation, as

other factors are involved. Next, we investigated if any of the

naive and intermediate hiPSCs that we generated, which

showed robust ICM incorporation in pre-implantation blasto-

cysts, could contribute to post-implantation development

following ET. The pig has certain advantages over cattle for ex-

periments involving post-implantation embryos, as they are a

polytocus species, and are commonly used as a translational

model given their similarities to humans concerning organ phys-

iology, size, and anatomy. We thus chose the pig for these ex-

periments. Since there was little to no contribution of primed

hiPSCs, even at the pre-implantation blastocyst stage, we

excluded these cells from the ET experiments. Pig embryos

were derived in vivo or through parthenogenesis. A total of 167

embryo donors were used in this study, from which we collected

1,298 zygotes, 1,004 two-cell embryos and 91 morulae (Table

S5). Embryos were cultured in vitro until they reached the blasto-

cyst stage (Figures S4AA and S4B). Overall, 2,181 good quality

blastocysts with a well-defined ICM were selected for subse-

quent blastocyst injections, of which 1,052were derived from zy-

gotes, 897 from two-cell embryos, 91 from morulae, and 141

from parthenogenetic activation (Table S5). We injected 3-10

hiPSCs into the blastocoel of each of these blastocysts (Figures

5A, S4A, and S4C; Table S6). After in vitro embryo culture, a total

of 2,075 embryos (1,466 for hiPSCs; Table S6; 477 for rodent

PSCs; Table S3) that retained good quality were transferred to

surrogate sows. A total of 41 surrogate sows received 30–50 em-

bryos each, resulting in 18 pregnancies (Table S6). Collection of

embryos between day 21-28 of development resulted in the har-

vesting of 186 embryos: 43 from 2iLD-hiPSCs, 64 from FAC-

hiPSCs, 39 from 4i-hiPSCs, and 40 from NHSM-hiPSCs (Figures

5B, S4A, S4D, and S4F). In addition, 17 control embryos were

collected from an artificially inseminated sow (Figure 5B).

Following evaluating the developmental status of the obtained

embryos, more than half showed retarded growth and were

smaller than control embryos (Figures 5B and S4B), as was

seen when pig blastocysts were injected with rodent PSCs (Fig-

ure 3B). Among different hiPSCs, embryos injected with FAC-

hiPSCsweremore frequently found to be normal size (Figure 5C).

From the recovered embryos, and based on fluorescence imag-

ing (GFP for 2iLD-hiPSCs and FAC-hiPSCs; hKO for 4i-hiPSCs

and NHSM-hiPSCs), we observed positive fluorescence signal

(FO+) in 67 embryos among which 17 showed a normal size

and morphology, whereas the rest were morphologically under-

developed (Figures 5B). In contrast, among fluorescence nega-

tive embryos we found the majority (82/119) appeared normal

size (Figure 5E), suggesting contribution of hiPSCs might have

480 Cell 168, 473–486, January 26, 2017

interfered with normal pig development. Closer examination of

the underdeveloped embryos revealed that 50 out of 87 were

FO+ (Figures 5B). Among all the FO+ embryos the distribution

of normal size versus growth retarded embryos for each cell lines

was: 3:19 for 2iLD-hiPSCs, 7:14 for FAC-hiPSCs, 2:12 for 4i-

hiPSCs, and 5:5 for NHSM-hiPSCs (Figure 5D). Among normal

size embryos we found 3/13 from 2iLD-hiPSCs, 7/47 from

FAC-hiPSCs, 2/14 from 4i-hiPSCs, and 5/25 from NHSM-

hiPSCs that were FO+ (Figure 5B). All normal size FO+ embryos

derived from 2iLD-hiPSCs, 4i-hiPSCs, or NHSM-hiPSCs showed

a very limited fluorescence signal (Figure S5A). In contrast,

normal size FO+ FAC-hiPSC-derived embryos typically ex-

hibited a more robust fluorescence signal (Figures 6A and S5A).

Detecting fluorescence signal alone is insufficient to claim

chimeric contribution of donor hiPSCs to these embryos, as

auto-fluorescence from certain tissues and apoptotic cells can

yield false positives, especially when chimerism is low. We

thus sectioned all normal size embryos deemed positive based

on the presence of fluorescence signal and subjected them to

IHC analyses with antibodies detecting GFP or hKO. For 2iLD-

hiPSC-, 4i-hiPSC-, and NHSM-hiPSC-derived embryos, in

agreement with fluorescence signals observed in whole-embryo

analysis, we detected only a few hKO- or GFP-positive cells in

limited number of sections (Figure S5A). This precluded us

from conducting further IHC analysis using lineage markers.

For FAC-hiPSC-derived embryos, we confirmed via IHC analysis

(using an anti-GFP antibody) that they contained more human

cells (Figures 6A, S5A, and S5B).We then stained additional sec-

tions using antibodies against TUJ1, EPCAM, SMA, CK8, and

HNF3b (Figures 6B and S5C) and observed differentiation of

FAC-hiPSCs into different cell lineages. In addition, these cells

were found negative for OCT4, a pluripotency marker (data not

shown). Moreover, the presence of human cells was further veri-

fied with a human-specific HuNu antibody staining (Figure 6B)

and a sensitive genomic PCR assay using a human specific

Alu sequence primer (Figure 6C; Table S2). Together, these re-

sults indicate that naive hiPSCs injected into pig blastocysts inef-

ficiently contribute to chimera formation, and are only rarely

detected in post-implantation pig embryos. An intermediate

hPSC type (FAC-hiPSCs) showed better chimeric contribution

and differentiated to several cell types in post-implantation

human-pig chimeric embryos. It should be noted that the

levels of chimerism from all hiPSCs, including the FAC-hiPSCs,

in pig embryos were much lower when compare to rat-mouse

chimeras (Figures 1C, 1E, S1A, and 1B), which may reflect the

larger evolutionary distance between human-pig than between

rat-mouse.

DISCUSSION

Our study confirms that live rat-mouse chimeras with extensive

contribution from naive rat PSCs can be generated. This is in

contrast to earlier work in which rat ICMs were injected into

mouse blastocysts (Gardner and Johnson, 1973). One possible

explanation for this discrepancy is that cultured PSCs acquire

artificial features that make themmore proliferative and/or better

able to survive than embryonic ICM cells, which in turn leads to

their more robust xeno-engraftment capability in a mouse host.

A

B C

D

E

Figure 5. Generation of Post-implantation Human-Pig Chimeric Embryos

(A) Schematic of the experimental procedures for the generation and analyses of post-implantation pig embryos derived from blastocyst injection of naive and

intermediate hiPSCs.

(B) Summary of the pig embryos recovered between day 21–28 of pregnancy.

(C) Bar graph showing proportions of normal size and growth retarded embryos, as well as the proportion of fluorescence-positive and -negative embryos,

generated from different types of hiPSCs.

(D) Bar graph showing the proportion of normal size and growth-retarded embryos (among those exhibiting a fluorescence signal) generated from different types

of hiPSCs.

(E) Bar graph showing the proportion of normal-sized and growth-retarded embryos (among those without exhibiting a fluorescence signal) generated from

different types of hiPSCs.

See also Figure S4 and Tables S5 and S6.

Rat-mouse chimeras generated by injecting donor rat PSCs into

a mouse host were mouse-sized and developed into adulthood

with apparently normal appearance and physiology. We further

show in this study that a rat-mouse chimera could live a full

mouse lifespan (about 2 years) and exhibit molecular signatures

characteristic of aged cells. This demonstrates that cells from

two different species, which diverged �18 million years ago, can live in a symbiotic environment and are able to support

normal organismal aging. The fact that rat PSCs were able to

contribute to the mouse gallbladder, an organ that is absent in

the rat, highlights the importance of embryonic niches in orches-

trating the specification, proliferation, and morphogenesis of

tissues and organs during organismal development and evolu-

tionary speciation (Izpisúa-Belmonte et al., 1992).

Previous interspecies blastocyst complementation experi-

ments generated host embryos by crossing heterozygous

mutant mouse strains, which were themselves generated

through targeted gene disruption in germline competent ESCs.

Cell 168, 473–486, January 26, 2017 481

(legend on next page)

482 Cell 168, 473–486, January 26, 2017

These experiments are labor intensive and time consuming.

Moreover, only �25% of blastocysts derived from genetic crosses are homozygousmutants, posing a limitation for efficient

complementation. CRISPR-Cas9mediated zygote genome edit-

ing offers a faster andmore efficient one-step process for gener-

ating mice carrying homozygous mutations, thereby providing a

robust interspecies blastocyst complementation platform. Addi-

tionally, the multiplexing capability of CRISPR-Cas9 (Cong et al.,

2013; Yang et al., 2015) could potentially be harnessed for multi-

lineage complementation. For example, in the case of the

pancreas, one might hope to eliminate both the pancreatic pa-

renchyma and vasculature of the host to generate a more com-

plete xenogeneic pancreas. Despite the advantages, there are

several technical limitations of the CRISPR-Cas9 blastocyst

complementation system that need to be overcome before un-

locking its full potential. First, gene inactivation relies on the

error-prone, non-homologous end joining (NHEJ) pathway,

which is often unpredictable. In-frame mutations and mosaicism

are among the factors thatmay affect outcomes. Amore predict-

able targeted gene inactivation strategy that utilizes homologous

recombination (HR) is still inefficient in the zygote. Second, each

embryo must be injected twice when using this system and em-

bryosmust be cultured in vitro for several daysbefore ET, thereby

compromising embryo quality. Technical advancements that

include a more robust gene-disruption strategy (e.g., targeted

generation of frameshift mutations via homology independent

targeted integration [Suzuki et al., 2016]), alternative CRISPR/

Cas9 delivery methods, and improved culture conditions for

manipulated embryos will likely help improve and optimize the

generation of organogenesis-disabled hosts.

We observed a slower clearance of an intraperitoneally in-

jected glucose load for Pdx1�/� than Pdx1+/� rat-mouse chi- meras, while both were slower than wild-type mouse controls

(Figure S2C). While this result may seem to contradict a previ-

ous report (Kobayashi et al., 2010), the discrepancy is likely

due to the development of autoimmune type inflammation that

is often observed in adult rat-mouse (chimeras made by injec-

tion of rat PSCs into mouse blastocyst, data not shown)

(>7 months, this study) and mouse-rat chimeras (chimeras

made by injection of mouse PSCs into rat blastocyst; H. Nakau-

chi, personal communication), which is less evident in young

chimeras (�8 weeks; Kobayashi et al. 2010). Interestingly though, we did observe a similarly slower clearance of glucose

load in wild-type rats, although the initial spike was much lower

in rats compared to mice or chimeras (Figure S2C). Thus, the rat

cellular origin might also have played a role in the different GTT

responses observed.

Figure 6. Chimeric Contribution of hiPSCs to Post-implantation Pig Em

(A) Representative bright field (left top) fluorescence (left bottom andmiddle) and i

normal size day 28 pig embryo (FAC #1). Scale bar, 100 mm.

(B) Representative immunofluorescence images showing chimeric contribution a

FAC-hiPSC derivatives are visualized by antibodies against GFP (top), TUJ1, SMA

magnification images of boxed regions. Scale bar, 100 mm.

(C) Representative gel images showing genomic PCR analyses of pig embryos d

and FAC-hiPSCs (surrogates #9159 and #18771) using a human specific Alu prim

with no genomic DNA loaded. pc, positive controls with human cells. Pig 1D, 1G

See also Figure S5 and Table S2.

Rodent ESCs/iPSCs, considered as the gold standard cells for

defining naive pluripotency, can robustly contribute to intra- and

inter-species chimeras within rodent species. These and other

results have led to the assumption that naive PSCs are the cells

of choice when attempting to generate interspecies chimeras

involving more disparate species. Here, we show that rodent

PSCs fail to contribute to chimera formation when injected into

pig blastocysts. This highlights the importance of other contrib-

uting factors underlying interspecies chimerism that may

include, but not limited to, species-specific differences in

epiblast and trophectoderm development, developmental ki-

netics, and maternal microenvironment.

To date, and taking into consideration all published studies

that have used the mouse as the host species, it is probably

appropriate to conclude that interspecies chimera formation

involving hPSCs is inefficient (De Los Angeles et al., 2015). It

has been argued that this apparent inefficiency results from spe-

cies-specific differences between human and mouse embryo-

genesis. Therefore, studies utilizing other animal hosts would

help address this important question. Here we focused on two

species, pig and cattle, from a more diverse clade of mammals

and found that naive and intermediate, but not primed, hiPSCs

could robustly incorporate into pre-implantation host ICMs.

Following ET, we observed, in general and similar to the mouse

studies, low chimera forming efficiencies for all hiPSCs tested.

Interestingly, injected hiPSCs seemed to negatively affect

normal pig development as evidenced by the high proportion

of growth retarded embryos. Nonetheless, we observed that

FAC-hiPSCs, a putative intermediate PSC type between naive

and primed pluripotent states, displayed a higher level of chime-

rism in post-implantation pig embryos. IHC analyses revealed

that FAC-hiPSCs integrated and subsequently differentiated in

host pig embryos (as shown by the expression of different line-

age markers, and the lack of expression of the pluripotency

marker OCT4). Whether the degree of chimerism conferred by

FAC-hiPSCs could be sufficient for eliciting a successful inter-

species human-pig blastocyst complementation, as demon-

strated herein between rats and mice, remains to be demon-

strated. Studies and approaches to improve the efficiency and

level of hPSC interspecies chimerism (Wu et al., 2016), such as

matching developmental timing, providing a selective advantage

for donor hPSCs, generating diverse hPSCs with a higher

chimeric potential and selecting a species evolutionarily closer

to humans, among others parameters, will be needed.

The procedures and observations reported here on the capa-

bility of human pluripotent stem cells to integrate and differentiate

in a ungulate embryo, albeit at a low level and efficiency, when

bryos

mmunofluorescence (right) images of GFP-labeled FAC-hiPSCs derivatives in a

nd differentiation of FAC-hiPSCs in a normal size, day 28 pig embryo (FAC #1).

, CK8 and HuNu (middle). (Bottom) Merged images with DAPI. Insets are higher

erived from blastocyst injection of 2iLD-iPSCs (surrogates #8164 and #20749)

er. A pig specific primer Cyt b was used for loading control. nc, negative control

, and 1I, pig controls. ID, surrogate and pig embryos.

Cell 168, 473–486, January 26, 2017 483

optimized, may constitute a first step towards realizing the poten-

tial of interspecies blastocyst complementation with hPSCs. In

particular, they may provide a better understanding of human

embryogenesis, facilitate the development and implementation

of humanized animal drug test platforms, as well as offer new in-

sightson theonsetandprogressionofhumandiseases inan invivo

setting. Ultimately, these observations also raise the possibility of

xeno-generating transplantable human tissues and organs to-

wards addressing the worldwide shortage of organ donors.

STAR+METHODS

Detailed methods are provided in the online version of this paper

and include the following:

d KEY RESOURCES TABLE

d CONTACT FOR REAGENT AND RESOURCE SHARING

d EXPERIMENTAL MODEL AND SUBJECT DETAILS

B Rodents

B Pigs

B Human iPSC Culture Media

B Culture and maintenance of rat ESCs/iPSCs and

mouse iPSCs

d METHOD DETAILS

B Chemicals Unless Otherwise Indicated, Chemicals

Were Obtained from Sigma-Aldrich

B Rat iPSC Generation

B Human iPSC Generation

B Generation of Fluorescently Labeled Rat PSCs and

hiPSCs

B Mouse Embryo Collection

B sgRNA Design and In Vitro Transcription

B Microinjection of Cas9 mRNA and sgRNAs to Mouse

Zygotes

B Microinjection of Rat PSCs to Mouse Blastocysts

B Mouse Embryo Transfer

B Genomic PCR

B Quantitative Genomic PCR

B Genotyping and DNA Sequencing

B Glucose Tolerance Test

B Cattle In Vitro Embryo Production

B Pig Parthenogenetic Embryo Production

B Microinjection of PSCs to Cattle and Pig Blastocysts

and Embryo Culture

B Pig and Cattle Blastocyst Immunostaining

B Pig In Vivo Embryo Recovery and Transfer

B Pig Parthenogenetic Embryo Transfer

B Immunocytochemistry

d QUANTIFICATION AND STATISTICAL ANALYSIS

SUPPLEMENTAL INFORMATION

Supplemental Information includes five figures and six tables and can be found

with this article online at http://dx.doi.org/10.1016/j.cell.2016.12.036.

AUTHOR CONTRIBUTIONS

J.W. and J.C.I.B. conceived the study. J.W. generated and characterized all

naive and intermediate hiPSC lines. K.S. generated and characterized primed

484 Cell 168, 473–486, January 26, 2017

hiPSCs. J.W. and T.H. generated rat iPSCs. J.W., A.P.-L., T.Y., M.M.V., D.O.,

A.O., P.R., C.R.E., J.W., and P.M.R. performed immunohistochemistry ana-

lyses of mouse and pig embryos. K.S., T.Y., E.S., A.P.-L., and M.M.V. per-

formed genotyping, genomic PCR, and genomic qPCR analyses. A.S., M.S.,

and J.P.L. performed mouse Cas9/sgRNA injection, blastocyst injection,

and embryo transfer. Y.S.B., M.S., and M.V. prepared hiPSCs, performed

morulae and blastocyst injections, and analyzed hiPSC contribution to cattle

and ppig ICMs. H.W. produced parthenogenetic pig embryos. D.A.S.,

Y.S.B., and M.V. produced cattle embryos. Work at UC Davis and University

of Murcia was performed under the supervision of P.J.R. and E.A.M., respec-

tively. E.A.M., M.A.G., C.C., I.P., C.A.M., S.S.B., A.N., and J.R. designed,

coordinated, performed, and analyzed data related to pig embryo collection,

embryo culture, blastocyst injection, embryo transfer, and embryo recover.

E.N.D., J.L., I.G., P.G., T.B., M.L.M.-M., and J.M.C. coordinated work

between Salk, and University of Murcia. J.W., P.J.R., and J.C.I.B. wrote the

manuscript.

ACKNOWLEDGMENTS

J.C.I.B. dedicates this paper to Dr. Rafael Matesanz, Director of the Spain’s

National Organ Transplant Organization. Rafael’s work has helped save thou-

sands of patients in need of an organ. He constitutes a relentless inspiration for

those of us trying to understand and alleviate human disease. The authors are

grateful to Xiomara Lucas, Maria Dolores Ortega, Moises Gonzalvez, Jose An-

tonio Godinez, and Jesus Gomis for their assistance throughout this work. We

thank the staff of the Agropor S.A. and Porcisan S.A. piggeries (Murcia, Spain)

for the help and excellent management of animals. We thank Joan Rowe, Bret

McNabb, Aaron Prinz, and Kent Parker and their crews for excellent assistance

with embryo transfers and pig care at UCDavis.We thankMako Yamamoto for

help with mouse embryo dissection. We would like to thank Uri Manor of the

Salk Waitt Advanced Biophotonics Core for technical advice on imaging anal-

ysis. We would like to thank the Salk Stem Cell Core for providing cell culture

reagents. We would like to thank May Schwarz and Peter Schwarz for admin-

istrative help. We thank David O’Keefe for critical reading and editing of the

manuscript. This experimental studywas supported by The Fundación Séneca

(GERM 19892/GERM/15), Murcia, Spain. The MINECO is acknowledged for

their grant-based support (BES-2013-064087 and BES-2013-064069) (to

C.A.M and A.N.). P.J.R was supported by a UC Davis Academic Senate

New Research grant. Work in the laboratory of J.C.I.B. was supported by

the UCAM, Fundacion Dr. Pedro Guillen, G. Harold and Leila Y. Mathers Char-

itable Foundation, and The Moxie Foundation.

Received: February 2, 2016

Revised: October 30, 2016

Accepted: December 22, 2016

Published: January 26, 2017

REFERENCES

Aasen, T., Raya, A., Barrero, M.J., Garreta, E., Consiglio, A., González, F., Vas-

sena, R., Bili�c, J., Pekarik, V., Tiscornia, G., et al. (2008). Efficient and rapid

generation of induced pluripotent stem cells from human keratinocytes. Nat.

Biotechnol. 26, 1276–1284.

Abeydeera, L.R. (2002). In vitro production of embryos in swine. Theriogenol-

ogy 57, 256–273.

Chen, J., Lansford, R., Stewart, V., Young, F., and Alt, F.W. (1993). RAG-2-

deficient blastocyst complementation: an assay of gene function in lympho-

cyte development. Proc. Natl. Acad. Sci. USA 90, 4528–4532.

Cong, L., Ran, F.A., Cox, D., Lin, S., Barretto, R., Habib, N., Hsu, P.D., Wu, X.,

Jiang, W., Marraffini, L.A., and Zhang, F. (2013). Multiplex genome engineering

using CRISPR/Cas systems. Science 339, 819–823.

De Los Angeles, A., Ferrari, F., Xi, R., Fujiwara, Y., Benvenisty, N., Deng, H.,

Hochedlinger, K., Jaenisch, R., Lee, S., Leitch, H.G., et al. (2015). Hallmarks

of pluripotency. Nature 525, 469–478.

Dull, T., Zufferey, R., Kelly, M., Mandel, R.J., Nguyen, M., Trono, D., and Nal-

dini, L. (1998). A third-generation lentivirus vector with a conditional packaging

system. J. Virol. 72, 8463–8471.

Funahashi, H., Ekwall, H., and Rodriguez-Martinez, H. (2000). Zona reaction in

porcine oocytes fertilized in vivo and in vitro as seen with scanning electron

microscopy. Biol. Reprod. 63, 1437–1442.

Gafni, O., Weinberger, L., Mansour, A.A., Manor, Y.S., Chomsky, E., Ben-Yo-

sef, D., Kalma, Y., Viukov, S., Maza, I., Zviran, A., et al. (2013). Derivation of

novel human ground state naive pluripotent stem cells. Nature 504, 282–286.

Gardner, R.L., and Johnson, M.H. (1973). Investigation of early mammalian

development using interspecific chimaeras between rat and mouse. Nat.

New Biol. 246, 86–89.

Gehring, W.J., and Ikeo, K. (1999). Pax 6: mastering eye morphogenesis and

eye evolution. Trends Genet. 15, 371–377.

Grupen, C.G. (2014). The evolution of porcine embryo in vitro production. Ther-

iogenology 81, 24–37.

Hansen, P.J. (2014). Current and future assisted reproductive technologies for

mammalian farm animals. In Current and Future Reproductive Technologies

and World Food Production, G. Cliff Lamb and N. DiLorenzo, eds. (Springer

New York), pp. 1–22.

Hasler, J.F. (2014). Forty years of embryo transfer in cattle: a review focusing

on the journal Theriogenology, the growth of the industry in North America, and

personal reminisces. Theriogenology 81, 152–169.

Hishida, T., Nozaki, Y., Nakachi, Y., Mizuno, Y., Okazaki, Y., Ema, M., Takaha-

shi, S., Nishimoto, M., and Okuda, A. (2011). Indefinite self-renewal of ESCs

through Myc/Max transcriptional complex-independent mechanisms. Cell

Stem Cell 9, 37–49.

Hockemeyer, D., Soldner, F., Cook, E.G., Gao, Q., Mitalipova, M., and Jae-

nisch, R. (2008). A drug-inducible system for direct reprogramming of human

somatic cells to pluripotency. Cell Stem Cell 3, 346–353.

Holm, P., Booth, P.J., Schmidt, M.H., Greve, T., and Callesen, H. (1999). High

bovine blastocyst development in a static in vitro production system using

SOFaa medium supplemented with sodium citrate and myo-inositol with or

without serum-proteins. Theriogenology 52, 683–700.

Huang, Y., Osorno, R., Tsakiridis, A., and Wilson, V. (2012). In vivo differentia-

tion potential of epiblast stem cells revealed by chimeric embryo formation.

Cell Rep. 2, 1571–1578.

Irie, N., Weinberger, L., Tang, W.W.C., Kobayashi, T., Viukov, S., Manor, Y.S.,

Dietmann, S., Hanna, J.H., and Surani, M.A. (2015). SOX17 is a critical specifier

of human primordial germ cell fate. Cell 160, 253–268.

Isotani, A., Hatayama, H., Kaseda, K., Ikawa, M., and Okabe, M. (2011). For-

mation of a thymus from rat ES cells in xenogeneic nude mouse4rat ES chi-

meras. Genes Cells 16, 397–405.

Izpisúa-Belmonte, J.C., Brown, J.M., Crawley, A., Duboule, D., and Tickle, C.

(1992). Hox-4 gene expression in mouse/chicken heterospecific grafts of sig-

nalling regions to limb buds reveals similarities in patterning mechanisms.

Development 115, 553–560.

Jonsson, J., Carlsson, L., Edlund, T., and Edlund, H. (1994). Insulin-promoter-

factor 1 is required for pancreas development in mice. Nature 371, 606–609.

King, T.J., Dobrinsky, J.R., Zhu, J., Finlayson, H.A., Bosma, W., Harkness, L.,

Ritchie, W.A., Travers, A., McCorquodale, C., Day, B.N., et al. (2002). Embryo

development and establishment of pregnancy after embryo transfer in pigs:

coping with limitations in the availability of viable embryos. Reproduction

123, 507–515.

Kobayashi, T., Yamaguchi, T., Hamanaka, S., Kato-Itoh, M., Yamazaki, Y.,

Ibata, M., Sato, H., Lee, Y.-S., Usui, J., Knisely, A.S., et al. (2010). Generation

of rat pancreas in mouse by interspecific blastocyst injection of pluripotent

stem cells. Cell 142, 787–799.

Kutner, R.H., Zhang, X.-Y., and Reiser, J. (2009). Production, concentration

and titration of pseudotyped HIV-1-based lentiviral vectors. Nat. Protoc. 4,

495–505.

Li, P., Tong, C., Mehrian-Shai, R., Jia, L., Wu, N., Yan, Y., Maxson, R.E.,

Schulze, E.N., Song, H., Hsieh, C.-L., et al. (2008). Germline competent embry-

onic stem cells derived from rat blastocysts. Cell 135, 1299–1310.

Lyons, I., Parsons, L.M., Hartley, L., Li, R., Andrews, J.E., Robb, L., and Har-

vey, R.P. (1995). Myogenic and morphogenetic defects in the heart tubes of

murine embryos lacking the homeo box gene Nkx2-5. Genes Dev. 9,

1654–1666.

Martinez, E.A., Angel, M.A., Cuello, C., Sanchez-Osorio, J., Gomis, J., Parrilla,

I., Vila, J., Colina, I., Diaz, M., Reixach, J., et al. (2014). Successful non-surgical

deep uterine transfer of porcine morulae after 24 hour culture in a chemically

defined medium. PLoS ONE 9, e104696.

Nichols, J., and Smith, A. (2009). Naive and primed pluripotent states. Cell

Stem Cell 4, 487–492.

Offield, M.F., Jetton, T.L., Labosky, P.A., Ray, M., Stein, R.W., Magnuson,

M.A., Hogan, B.L., and Wright, C.V. (1996). PDX-1 is required for pancreatic

outgrowth and differentiation of the rostral duodenum. Development 122,

983–995.

Okita, K., Ichisaka, T., and Yamanaka, S. (2007). Generation of germline-

competent induced pluripotent stem cells. Nature 448, 313–317.

Okita, K., Matsumura, Y., Sato, Y., Okada, A., Morizane, A., Okamoto, S.,

Hong, H., Nakagawa, M., Tanabe, K., Tezuka, K., et al. (2011). A more efficient

method to generate integration-free human iPS cells. Nat. Methods 8,

409–412.

Park, I.H., Zhao, R., West, J.A., Yabuuchi, A., Huo, H., Ince, T.A., Lerou, P.H.,

Lensch, M.W., and Daley, G.Q. (2008). Reprogramming of human somatic

cells to pluripotency with defined factors. Nature 451, 141–146.

Parrish, J.J., Susko-Parrish, J.L., Leibfried-Rutledge, M.L., Critser, E.S., Eye-

stone, W.H., and First, N.L. (1986). Bovine in vitro fertilization with frozen-

thawed semen. Theriogenology 25, 591–600.

Parrish, J.J., Susko-Parrish, J., Winer, M.A., and First, N.L. (1988). Capacita-

tion of bovine sperm by heparin. Biol. Reprod. 38, 1171–1180.

Petters, R.M., andWells, K.D. (1993). Culture of pig embryos. J. Reprod. Fertil.

Suppl. 48, 61–73.

Pursel, V.G., and Johnson, L.A. (1975). Freezing of boar spermatozoa: fertil-

izing capacity with concentrated semen and a new thawing procedure.

J. Anim. Sci. 40, 99–102.

Reubinoff, B.E., Pera, M.F., Fong, C.Y., Trounson, A., and Bongso, A. (2000).

Embryonic stem cell lines from human blastocysts: somatic differentiation

in vitro. Nat. Biotechnol. 18, 399–404.

Ross, P.J., Ragina, N.P., Rodriguez, R.M., Iager, A.E., Siripattarapravat, K.,

Lopez-Corrales, N., and Cibelli, J.B. (2008). Polycomb gene expression and

histone H3 lysine 27 trimethylation changes during bovine preimplantation

development. Reproduction 136, 777–785.

Suzuki, K., Tsunekawa, Y., Hernandez-Benitez, R., Wu, J., Zhu, J., Kim, E.J.,

Hatanaka, F., Yamamoto, M., Araoka, T., Li, Z., et al. (2016). In vivo genome

editing via CRISPR/Cas9 mediated homology-independent targeted integra-

tion. Nature 540, 144–149.

Takahashi, K., Tanabe, K., Ohnuki, M., Narita, M., Ichisaka, T., Tomoda, K.,

and Yamanaka, S. (2007). Induction of pluripotent stem cells from adult human

fibroblasts by defined factors. Cell 131, 861–872.

Takashima, Y., Guo, G., Loos, R., Nichols, J., Ficz, G., Krueger, F., Oxley, D.,

Santos, F., Clarke, J., Mansfield,W., et al. (2014). Resetting transcription factor

control circuitry toward ground-state pluripotency in human. Cell 158,

1254–1269.

Tanaka, M., Chen, Z., Bartunkova, S., Yamasaki, N., and Izumo, S. (1999). The

cardiac homeobox gene Csx/Nkx2.5 lies genetically upstream of multiple

genes essential for heart development. Development 126, 1269–1280.

Tesar, P.J., Chenoweth, J.G., Brook, F.A., Davies, T.J., Evans, E.P., Mack,

D.L., Gardner, R.L., and McKay, R.D.G. (2007). New cell lines from mouse

epiblast share defining features with human embryonic stem cells. Nature

448, 196–199.

Theunissen, T.W., Powell, B.E., Wang, H., Mitalipova, M., Faddah, D.A.,

Reddy, J., Fan, Z.P., Maetzel, D., Ganz, K., Shi, L., et al. (2014). Systematic

Cell 168, 473–486, January 26, 2017 485

identification of culture conditions for induction and maintenance of naive hu-

man pluripotency. Cell Stem Cell 15, 471–487.

Theunissen, T.W., Friedli, M., He, Y., Planet, E., O’Neil, R.C., Markoulaki, S.,

Pontis, J., Wang, H., Iouranova, A., Imbeault, M., et al. (2016). Molecular

criteria for defining the naive human pluripotent state. Cell Stem Cell 19,

502–515.

Thomson, J.A., Itskovitz-Eldor, J., Shapiro, S.S., Waknitz, M.A., Swiergiel, J.J.,

Marshall, V.S., and Jones, J.M. (1998). Embryonic stem cell lines derived from

human blastocysts. Science 282, 1145–1147.

Tsukiyama, T., andOhinata, Y. (2014). Amodified EpiSC culture condition con-

taining aGSK3 inhibitor can support germline-competent pluripotency inmice.

PLoS ONE 9, e95329.

Wang, H., Yang, H., Shivalila, C.S., Dawlaty, M.M., Cheng, A.W., Zhang, F.,

and Jaenisch, R. (2013). One-step generation of mice carrying mutations in

multiple genes by CRISPR/Cas-mediated genome engineering. Cell 153,

910–918.

Weinberger, L., Ayyash, M., Novershtern, N., and Hanna, J.H. (2016). Dynamic

stem cell states: naive to primed pluripotency in rodents and humans. Nat.

Rev. Mol. Cell Biol. 17, 155–169.

Wernig, M., Meissner, A., Foreman, R., Brambrink, T., Ku, M., Hochedlinger,

K., Bernstein, B.E., and Jaenisch, R. (2007). In vitro reprogramming of fibro-

blasts into a pluripotent ES-cell-like state. Nature 448, 318–324.

Wu, J., and Izpisua Belmonte, J.C. (2015). Dynamic pluripotent stem cell states

and their applications. Cell Stem Cell 17, 509–525.

486 Cell 168, 473–486, January 26, 2017

Wu, J., and Izpisua Belmonte, J.C. (2016). Stem cells: a renaissance in human

biology research. Cell 165, 1572–1585.

Wu, J., Okamura, D., Li, M., Suzuki, K., Luo, C., Ma, L., He, Y., Li, Z., Benner,

C., Tamura, I., et al. (2015). An alternative pluripotent state confers interspecies

chimaeric competency. Nature 521, 316–321.

Wu, J., Greely, H.T., Jaenisch, R., Nakauchi, H., Rossant, J., and Belmonte,

J.C. (2016). Stem cells and interspecies chimaeras. Nature 540, 51–59.

Xiang, A.P., Mao, F.F., Li, W.-Q., Park, D., Ma, B.-F., Wang, T., Vallender, T.W.,

Vallender, E.J., Zhang, L., Lee, J., et al. (2008). Extensive contribution of em-

bryonic stem cells to the development of an evolutionarily divergent host.

Hum. Mol. Genet. 17, 27–37.

Yang, L., Güell, M., Niu, D., George, H., Lesha, E., Grishin, D., Aach, J., Shrock,

E., Xu, W., Poci, J., et al. (2015). Genome-wide inactivation of porcine endog-

enous retroviruses (PERVs). Science 350, 1101–1104.

Yoshioka, K., Noguchi, M., and Suzuki, C. (2012). Production of piglets from

in vitro-produced embryos following non-surgical transfer. Anim. Reprod.

Sci. 131, 23–29.

Yu, J., Vodyanik, M.A., Smuga-Otto, K., Antosiewicz-Bourget, J., Frane, J.L.,

Tian, S., Nie, J., Jonsdottir, G.A., Ruotti, V., Stewart, R., et al. (2007). Induced

pluripotent stem cell lines derived from human somatic cells. Science 318,

1917–1920.

Zou, J., Maeder, M.L., Mali, P., Pruett-Miller, S.M., Thibodeau-Beganny, S.,

Chou, B.-K., Chen, G., Ye, Z., Park, I.H., Daley, G.Q., et al. (2009). Gene target-

ing of a disease-related gene in human induced pluripotent stem and embry-

onic stem cells. Cell Stem Cell 5, 97–110.

STAR+METHODS

KEY RESOURCES TABLE

REAGENT or RESOURCE SOURCE IDENTIFIER

Antibodies

Rabbit monoclonal anti-SOX2 BioGenex Cat# NU579-UC

Mouse anti-HuNu (Clone 235-1) Millipore Cat# MAB1281; RRID: AB_11212527

Rabbit anti-monomeric Kusabira-Orange 2 MBL Code# PM051M

Rabbit anti-GFP MBL Code# 598

Rat monoclonal anti-cytokeratin 8/18 (TROMA-I) DSHB RRID: AB_531826

Mouse monoclonal anti-epithelial antigen DAKO Cat# M0804; RRID: AB_2335685

Mouse monoclonal anti-Ep-CAM Santa Cruz Cat# sc-25308; RRID: AB_627531

Mouse monoclonal anti-actin a-smooth muscle

(Clone 1A4)

Sigma-Aldrich Cat# A5228; RRID: AB_262054

Rabbit polyclonal anti-Histone H3 (tri methyl K9) Abcam Cat# ab8898; RRID: AB_306848

Rabbit polyclonal anti-Histone H4 (tri methyl K20) Abcam Cat# ab9053; RRID: AB_306969

Rat anti-Mouse CD31 (Clone MEC13.3) BD PharMingen Cat# 553370; RRID: AB_394816

Mouse monoclonal anti-Oct3/4 (C-10) Santa Cruz Cat# sc-5279; RRID: AB_628051

Mouse anti-Tubulin b3 (Clone TUJ1) BioLegend Cat# 801202; RRID: AB_10063408

Chemicals, Peptides, and Recombinant Proteins

Y-27632 dihydrochloride Torcris Cat# 1254

Recombinant human FGF-basic (FGF2) Peprotech Cat# 100-18B

Recombinant human LIF Peprotech Cat# 300-05

CHIR99021 Selleckchem Cat# S2924

PD035901 Selleckchem Cat# S1036

L-ascorbic acid 2-phosphate Sigma-Aldrich Cat# A8960

Recombinant human IGF-I LR3 Peprotech Cat# 100-11R3

Recombinant human TGF-b1 Peprotech Cat# 100-21C

SB203580 Selleckchem Cat# S1076

SP600125 Selleckchem Cat# S1460

LDN193189 Selleckchem Cat# S2618

Recombinant human/murine/rat Activin A Peprotech Cat# 120-14P

Doxycycline hyclate (dox) Stemgent Cat# 04-0016

Critical Commercial Assays

MEGAshortscript T7 Transcription Kit Invitrogen Cat# AM1354

MEGAclear Transcription Clean-up Kit Ambion Cat# AM1908

Cas9 mRNA Sigma-Aldrich Cat# CAS9MRNA-1EA

P2 Primary Cell 4D-Nucleofector kit Lonza Cat# V4XP-2024

NucleoSpin Gel and PCR Clean-up MACHEREY-NAGEL Cat# 740609

DNeasy Blood and Tissue kit QIAGEN Cat# 69506

PicoPure DNA Extraction Kit Thermo Fisher Scientific Cat# KIT0103

SYBR Green PCR Master Mix Thermo Fisher Scientific SKU# 4309155

Experimental Models: Cell Lines

DAC2 Li et al., 2008 N/A

DAC8 Li et al., 2008 N/A

SDFE This paper N/A

SDFF This paper N/A

iPS-MEF-Ng-20D-17 RIKEN BRC Cat# APS001

(Continued on next page)

Cell 168, 473–486.e1–e8, January 26, 2017 e1

Continued

REAGENT or RESOURCE SOURCE IDENTIFIER

HFF hiPSCs This paper N/A

NHSM-hiPSCs This paper N/A

2iLD-hiPSCs This paper N/A

4i-hiPSCs This paper N/A

FAC-hiPSCs This paper N/A

Human foreskin fibroblast (HFF) ATCC CRL-2429

Experimental Models: Organisms/Strains

Mouse: C57BL/6J The Jackson Laboratory Stock No: 000664

Mouse: B6D2F1/J The Jackson Laboratory Stock No: 100006

Mouse: ICR (CD1) Envigo Order code: 030

Mouse: NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ The Jackson Laboratory Stock No: 005557

Rat: Sprague Dawley Envigo Order code: 002

Pig: Large-White 3 Landrace Murcia, Spain N/A

Pig: Pietrain Murcia, Spain N/A

Pig: Yorkshire University of California Davis N/A

Pig: Yorkshire cross University of California Davis N/A

Recombinant DNA

pCXLE-hOCT3.4-shp53-F Okita et al., 2011 Addgene Plasmid #27077

pCXLE-EGFP Okita et al., 2011 Addgene Plasmid #27082

pCXLE-hSK Okita et al., 2011 Addgene Plasmid #27078

pCXLE-hUL Okita et al., 2011 Addgene Plasmid #27080

pFUW-tetO-hKlf2 This paper N/A

pFUW-tetO-hNanog This paper N/A

pCAG-IP-humanized Kusabira Orange This paper N/A

pmKO1-MC1 MBL Code No. AM-V0052M

LV-tetO-FU-Oct3/4 Hockemeyer et al., 2008 Addgene Plasmid #20726

LV-tetO-FU-Sox2 Hockemeyer et al., 2008 Addgene Plasmid #20724

LV-tetO-FU-KLF4 Hockemeyer et al., 2008 Addgene Plasmid #20725

LV-tetO-FU-Myc Hockemeyer et al., 2008 Addgene Plasmid #20723

LV-FUW-M2rtTA Hockemeyer et al., 2008 Addgene Plasmid #20342

pEGIP Zou et al., 2009 Addgene Plasmid#26777

pMDLg/pRRE Dull et al., 1998 Addgene Plasmid #12251

pRSV-Rev Dull et al., 1998 Addgene Plasmid #12253

pMD2.G pMD2.G was a gift from Didler Trono Addgene Plasmid #12259

Sequence-Based Reagents

sgRNA sequences, see Table S2 This paper N/A

Genomic PCR primers, see Table S2 This paper N/A

DNA sequencing primers, see Table S2 This paper N/A

Genomic qPCR primers, see Table S2 This paper N/A

Software and Algorithms

CRISPR Design MIT http://crispr.mit.edu

CONTACT FOR REAGENT AND RESOURCE SHARING

Further information and requests for reagents may be directed to and will be fulfilled by Lead Contact Juan Carlos Izpisua Belmonte

(belmonte@salk.edu).

e2 Cell 168, 473–486.e1–e8, January 26, 2017

EXPERIMENTAL MODEL AND SUBJECT DETAILS

Rodents All the rodent experiments were performed under the ethical guidelines of the Salk Institute, and animal protocols were reviewed and

approved by the Salk Institute Institutional Animal Care and Use Committee (Protocol #12-00021). All mice (C57BL/6J, B6D2F1/J,

ICR and NOD.Cg-Prkdcscid Il2rgtm1Wjl/SzJ) and rats (Sprague Dawley) used in this study were purchased from Envigo (Harlan) or

The Jackson Laboratory, and bred in the animal facility of the Salk Institute.

Pigs The pig experiments at University of Murcia, Spain, were performed in accordance with Directive 2010/63/EU EEC for animal exper-

iments and were reviewed and approved by the Ethical Committee for Experimentation with Animals (code: 69/2014), the Research

Ethics Committee (code: 1086/2015), and the Biosafety Committee (code:) of the University of Murcia, Spain; and by the Murcia

Regional Ministry of Agriculture and Water (code: 273.705), and the Murcia Regional Ministry of Health (code: 061015), Spain.

Day 21-28 gestation stages were selected to analyze the chimeric contribution of hiPSC to the pig post implantation embryo. Stop-

ping development at this stage will also prevent that embryos with potentially high hiPSC contribution develop a mature central ner-

vous system. The pig experiments in Spain were conducted in two commercial pig farms located in Southeastern Spain (Murcia,

Spain) and in the pig experimental unit of the University ofMurcia (Murcia, Spain). Weaned crossbred sows (Landrace3 Large-White)

from the same genetic line (2-6 parity) were used as embryo donors and recipients. The sows were kept individually in crates in a

mechanically ventilated confinement facility. The semen donors were sexually mature Pietrain boars (2-3 years of age) housed in

climate- controlled individual pens (20-25�C) at a commercial insemination station in Murcia (Spain). Animals had ad libitum access to water and were fed commercial diets according to their nutritional requirements.

Pig experiments performed at the University of California Davis, were reviewed and approved by the Institutional Animal Care and

Use Committee (IACUC# 18158) at the University of California, Davis. Experiments involving hiPSCs at the University of California

Davis were reviewed and approved by the StemCell Research Oversight Committee (SCRO# 1127) and Biological Use Authorization

(BUA# R1627). Day 28 or earlier gestation stages were selected to analyze the contribution of hiPSC to the pig post implantation em-

bryo. Stopping development at this stage will also prevent that embryos with potentially high hiPSC contribution develop a mature

central nervous system. For pig experiments performed at the University of California Davis, Yorkshire or Yorkshire cross females at

6-8months of agewere used as embryo recipients. The animals were kept in group penswith ad libitum access to water andwere fed

commercial diets according to their nutritional requirements.

Human iPSC Culture Media Conventional primed hiPSCs were either cultured on Matrigel (BD Biosciences) coated plates in mTeSR1 medium (StemCell Tech-

nologies) or on MEFs in CDF12 medium: DMEM/F12 (Life Technologies, 11330-032), 20% Knockout Serum Replacement (KSR,

Life Technologies, 10828), 2mM Glutamax (Life Technolgies, 35050-061), 0.1mM NEAA (Life Technologies, 11140-050), 0.1mM

b-mercaptoethanol (GIBCO, 21985) and 4ng/ml FGF2 (Peprotech). 2iL medium contains: N2B27 medium supplemented with hu-

man LIF (10ng/ml, Peprotech), 3 mM CHIR99021 (Selleckchem) and 1 mM PD035901 (Selleckchem). To prepare 500ml of NHSM

medium we added 500ml KnockOut DMEM (Invitrogen), 5ml Pen-strep (GIBCO), 5ml GlutaMax (GIBCO), 5ml NEAA (GIBCO), 5g

AlbumaxI (Invitrogen), 5ml N2 supplement (Invitrogen; 17502048), L-ascorbic acid 2-phosphate (Sigma), 20ng/ml human LIF (Pe-

protech), 20ng/ml human LR3-IGF1 (Peprotech), 8g/ml FGF2 (Peprotech), 2ng/ml TGFb1 (Peprotech), 3 mM CHIR99021 (Selleck-

chem), 1 mM PD0325901 (Selleckchem), 5 mM SB203580 (Selleckchem), 5 mM SP600125 (Selleckchem), 5 mM Y27632 (Torcris)

and 0.4 mM LDN193189 (Selleckchem). 4i medium is based on NHSM medium with only the following differences: L-ascorbic

acid 2-phosphate, Human LR3-IGF1 and LDN193189 were excluded from 4i medium. TGFb1 was used at 1 ng/ml and Y27632

at 5 mM. FAC medium contains: DMEM/F12 (Invitrogen, 11320) and Neurobasal medium (Invitrogen; 21103) were mixed at 1:1

ratio; N2 supplement (Invitrogen; 17502048); 1 3 B27 supplement (Invitrogen; 17504044); 2 mM GlutaMax; 1% NEAA; 0.1mM

b-mercaptoethanol (Sigma); 1 3 Pen-Strep; 50 mg/ml BSA (Sigma); 12 ng/ml FGF2, 10 ng/ml Activin-A (Peprotech) and 3 mM

CHIR99021.

Culture and maintenance of rat ESCs/iPSCs and mouse iPSCs Dr. Qilong Ying, University of Southern California, provided rat ESC lines DAC2 and DAC8. Rat iPSCs, SDFE and SDFF, were

generated in house with tail tip fibroblasts derived from Sprague Dawley rat (Envigo). Rat ESCs/iPSCs were cultured either on

MEFs or FBS-coated plates in rat ESC medium: N2B27 basal medium supplemented with human LIF (10ng/ml, Peprotech),

1.5uM or 3uM CHIR99021 (Selleckchem) and 1uM PD035901 (Selleckchem). Rat ESCs/iPSCs were passaged every 4-5 days

at a split ratio of 1:10. The male mouse iPSCs (MEF-Ng-20D-17) were obtained from RIKEN BRC and were cultured either on

MEFs or Matrigel-coated plates in mouse ESC medium: N2B27 basal medium supplemented with human LIF (10ng/ml, Pepro-

tech), 3uM CHIR99021 (Selleckchem) and 1uM PD035901 (Selleckchem). Mouse iPSCs were passaged every 3-4 days at a split

ratio of 1:20.

Cell 168, 473–486.e1–e8, January 26, 2017 e3

METHOD DETAILS

Chemicals Unless Otherwise Indicated, Chemicals Were Obtained from Sigma-Aldrich Plasmids Construction

For pFUW-tetO-hNanog and pFUW-tetO-hKlf2, PCR-amplified ORF of human NANOG and KLF2 from human H9 ESCs was

sequenced and subcloned into the EcoRI site of pFUW-tetO inducible lentivirus vector. To generate pCAG-IP-humanized Kusabira

Orange (hKO), as described previously (Hishida et al., 2011), the ORF was amplified from pmKO1-MC1 (MBL) by PCR, sequenced

and subcloned into the XhoI/NotI sites of the pCAG-IP.

Rat iPSC Generation Rat iPSC reprograming was performed as descried previously. Briefly, LV-tetO-FU-Oct3/4 (addgene#20726), LV-tetO-FU-Sox2

(addgene#20724), LV-tetO-FU-KLF4 (addgene#20725), LV-tetO-FU-Myc (addgene#20723) or LV-FUW-M2rtTA (addgene#20342)

was transfected into 293FT cells with packaging plasmids. Forty-eight hours after transfection, virus-containing supernatant was

collected from transfected 293FT cells and filtered through a 0.45 mm filer. Rat tail-tip fibroblasts were infected with a mixture of

collected viruses in the presence of 8 mg/ml of polybrene. One day after infection, culture medium was switched to 2 mg/ml Dox-con-

tainingmedium to induce the expression of reprogramming factors. The cells were passaged ontomitotically inactivatedMEFs at day

4 after infection, and, on the following day, the cells were cultured with Dox-containing rat ESC culture medium. Colonies started to

appear at day 9 after infection. Dox was withdrawn at day 13 and individual colonies were picked and transferred to newly prepared

MEF plates and further expanded into stable rat iPSC lines.

Human iPSC Generation Primed hiPSCs, NHSM-hiPSCs and FAC-hiPSCswere generated by reprogramming of human foreskin fibroblasts (HFF, ATCC, CRL-

2429) with episomal vectors. Episomal plasmids pCXLE-EGFP (addgene#27082), pCXLE-hOCT3.4-shp53-F (addgene#27077),

pCXLE-hSK (addgene#27078), pCXLE-hUL (addgene#27080) were obtained from Addgene. HFFs (2x106) were nucleofected with

the episomal vectors using a 4D-Nucleofector (Program EN150, Lonza) with the P2 Primary Cell 4D-Nucleofector kit (Lonza,

V4XP-2024). Five days post-nucleofection, HFFs were re-plated onto mitotically inactivated MEFs. The next day the medium was

changed to conventional hPSC culture medium (CDF12), NHSM medium or FAC medium. Putative iPSC colonies were picked be-

tween day 20 and 30 and transferred to newly prepared MEFs for further cultivation. For the generation of 2iLD-hiPSCs, primed

hiPSCs grown on Matrigel in mTeSR1 medium were pre-treated with 10 mM Y-27632 (Torcris) for 24 hr and then dissociated using

TrypLE (Invitrogen). Lentivirus was prepared as follows: pFUW-tetO-hNanog and pFUW-tetO-hKlf2 were transfected into 293FT cells

with packaging plasmids: pMDLg/pRRE (addgene#12251), pRSV-Rev (addgene#12253) and pMD2.G (addgene#12259). Forty-eight

hours after transfection, virus-containing supernatant was collected from transfected 293FT cells and filtered through a 0.45 mmfiler.

Primed hiPSCs were transduced in suspension with lentivirus in the presence of 10 mMY-27632 and 6 mg/ml polybrene for 1 hr. After

brief centrifugation, the cells were plated on irradiated DR4 MEF feeders (ATCC) in 2iL media containing 10 mMY-27632 and 2 mg/ml

DOX (Stemgent). Three days after transduction, puromycin (1 mg/ml; Invitrogen) was added to the medium. After 7–14 days, dome

shaped colonies were manually picked onto fresh MEF feeders and expanded as 2ILD-hiPSCs. Conversion of NHSM-hiPSCs to 4i-

hiPSCs was done by simply changing culture medium fromNHSM to 4i. Converted cells were passaged for more than 8 times before

further analysis and used for subsequent experiments.

Generation of Fluorescently Labeled Rat PSCs and hiPSCs We used pCAG-IP-humanized Kusabira Orange (hKO) for labeling rat PSCs, mouse iPSCs and hiPSCs (NHSM-hiPSCs), Briefly,

1-2 mg of pCAG-IP-hKO were transfected into 1-2 million of dissociated PSCs using an Amaxia 4D-nucleofector following the pro-

tocol recommended by the manufacture. 0.5-1 mg/ml of puromycin (Invitrogen) was added to the culture 2-3 days post-transfection.

Drug-resistant colonies were manually picked between 7-14 days and further expanded clonally. To label 2iLD-hiPSCs and FAC-

hiPSCs, briefly, pEGIP (addgene#26777) was co-transfected with pMDLg/pRRE, pRSV-Rev and pMD2.G, and packaged and puri-

fied as lentiviral vectors according to a published protocol (Kutner et al., 2009). hiPSCs were individualized with Accumax (Innovative

Cell Technologies). Cells were transduced in suspension with lentiviral pEGIP vector in the presence of 4 ug/ml polybrene for 1 hr.

After brief centrifugation to remove any residual lentiviral vector, the cells were seeded on irradiated DR4MEF feeders (ATCC) in 2iLD

and FACmedia. Three days after transduction, 1 ug/ml puromycin (Invitrogen) was added to the medium. After 2 weeks, Drug-resis-

tant colonies were manually picked onto fresh MEF feeders and expanded as EGFP-labeled hiPSC lines.

Mouse Embryo Collection C57BL/6 female mice (8-10 weeks old) were superovulated by intraperitoneal injection with 5 IU of PMSG (Millipore), followed by in-

jection of 5 IU of hCG (Millipore) 48 hr later. After mating with BDF1 male mice, zygotes were collected the next day at E0.5 in

mKSOM-HEPES medium from oviduct and cultured in the mKSOMaa until Cas9/sgRNA microinjection. mKSOMaa medium: NaCl

(95 mM), KCl (2.5 mM), KH2PO4 (0.35 mM), MgSO4 (0.2 mM), NaHCO3 (25 mM), CaCl2 (1.71 mM), Na2-EDTA (0.01 mM), L-glutamine

(1.0 mM), Na lactate (10 mM), Na pyruvate (0.2 mM), glucose (5.56 mM), essential amino acid (EAA; 10.0 ml/l), non-essential

amino acid (NEAA; 5.0ml/l), penicillin (0.06 g/l), streptomycin (0.05 g/l), and BSA (4 g/l). mKSOM-HEPES medium: same amount

e4 Cell 168, 473–486.e1–e8, January 26, 2017

of chemicals as KSOMaa, but include decreased amount of NaHCO3 (5 mM), HEPES-Na (20 mM), does not include EAA, NEAA, and

BSA substituted by PVA (0.1 g/l).

sgRNA Design and In Vitro Transcription Weused the online software (MIT CRISPRDesign Tool: http://crispr.mit.edu) to design sgRNAs. The sgRNAs containing T7 promoter

were amplified by PCR with the following primers (50-TAATACGACTCACTATA-G-[19bp sgRNA target sequence]-GTTTTAGAGCTA GAAATAGC-30 and 50-AAAGCACCGACTCGGTGCCACTTTTTCAAGTTGATAACGGACTAGCCTTATTTTAACTTGCTATTTCTAGCT CTAAAAC-30) using Q5 High-Fidelity DNA Polymerase (NEB). The PCR product was purified using NucleoSpin Gel and PCR Clean-up (MACHEREY-NAGEL). To prepare sgRNA mRNA, the purified PCR product was in vitro transcribed by MEGAshortscript

T7 Transcription Kit (Invitrogen) following the manufacturer’s instruction. Prepared RNAs were purified using MEGAclearTM Kit

Purification for Large Scale Transcription Reactions (Ambion) and dissolved in water for embryo transfer (Sigma).

Microinjection of Cas9 mRNA and sgRNAs to Mouse Zygotes The zygotes show clear two pronuclei were selected and transferred into a 40 mL drop of KSOM-HEPES and placed on an inverted

microscope (Olympus, Tokyo, Japan) fittedwithmicromanipulators (Narishige, Tokyo, Japan).Mixture ofCas9mRNA (Sigma-Aldrich,

25-100u/g/ml) and sgRNA (25-50 ug/ml) was loaded to a blunt-end micropipette (Sutter Instrument, CA) of 2-3 mm internal diameter

(ID) connected to amanual hydraulic oil microinjector (Eppendorf, Hamburg, Germany). Then, the zygotes were secured by a holding

pipette and PiezoMicro Manipulator (Prime Tech Ltd, Japan) was used to create a hole in the zona pellucida. The zygote membranes

were broken with a single piezo pulse in the lowest intensity and the injection of themixture RNAwas confirmed by the bulge of mem-

brane. Groups of 10-12 zygotes were manipulated simultaneously and each session was limited to 10 min. After microinjection, the

zygotes were cultured in the 40 mL droplet of mKSOMaa for 3days in a humidified atmosphere of 5% CO2 in air at 37.0�C.

Microinjection of Rat PSCs to Mouse Blastocysts The embryos that have obvious blastocoel at E3.5were defined as blastocysts. Single cell suspensions were added to a 40 mL drop of

KSOM-HEPES containing the blastocysts to be injected. Individual cells were collected into a 20 mm ID ofmicropipette. Six cells were

introduced into the blastocoel near the ICM. Groups of 10-12 blastocysts were manipulated simultaneously and each session was

limited to 30 min. After microinjection, the blastocysts were cultured in mKSOMaa for at least 1 hr until the embryo transfer.

Mouse Embryo Transfer ICR female mice as surrogates (8 weeks old) in the estrus were mated with vasectomized ICRmale mice to induce pseudopregnancy

Embryo transfer to the surrogate at E2.5 was performed surgically under the anesthesia with ketamine (Putney) and xylazine (Akorn).

Injected blastocysts at E3.5 were loaded to the pipette with air bubble and transferred to the uterine horn, which were previously

punctured with a 27G needle connected to a 1.5 mL syringe. 14-22 blastocysts were transferred and performed within 20-30 min

per surrogate.

Genomic PCR Genomic PCR was carried out for the detection of rat, mouse or human cells in pig fetuses. Genomic DNAs were extracted using

DNeasy Blood and Tissue kit (QIAGEN) or PicoPure DNA Extraction Kit (Thermo Fisher Scientific). Genomic PCRs were performed

using PrimeSTAR GXL DNA polymerase (Takara). Primer sequences are provided in Table S2.

Quantitative Genomic PCR Quantitative PCR (qPCR) for quantifying rat contribution in rat-mouse chimera was performed using SYBR Green PCR Master Mix

(Applied Biosystems) and total genomic DNAs isolated from different tissues of the chimera, mouse tail tip and DAC2 rat ESCs. The

data were analyzed using the DDCT method, which were first normalized to the values of the mouse specific primers. A rat specific

primer was used for detecting rat cells. The levels of chimerism were determined based on the values generated from serial dilutions

of rat:mouse genomic DNA. The primers used for genomic qPCR are listed in Table S2.

Genotyping and DNA Sequencing To determine genotypes of gene modified mouse fetuses or neonates, yolk sac (fetus) or tail tip (neonates) were used for genomic

DNA extraction using DNeasy Blood and Tissue kit (QIAGEN) or PicoPure DNA Extraction Kit (Thermo Fisher Scientific). The genomic

DNA sequences including target site were amplified with PrimeSTAR GXL DNA Polymerase. Amplicons were sequenced using an

ABI 3730xl sequencer (Applied Biosystems). Primer sequences are provided in Table S2.

Glucose Tolerance Test Mice andRatswere fasted overnight for approximately 16 hr before the test. Fasted blood glucose levels weremeasured and used as

the baseline glucose levels. A solution of glucose is administered by intra-peritoneal (IP) injection (2g of glucose/kg body weight).

Subsequently, the blood glucose levels were measured at 15, 30, 60 and 120 min after glucose injection, by placing a small drop

of blood on a on the test strip of the blood glucose meter.

Cell 168, 473–486.e1–e8, January 26, 2017 e5

Cattle In Vitro Embryo Production Oocyte Recovery and In Vitro Maturation

Ovaries were collected from a slaughterhouse (Cargill Meat Solutions, Fresno, CA, USA) and transported to the laboratory in insu-

lated container filled with pre-warmed saline solution at �32�C. The ovaries were washed several times and placed in a water bath at (37�C) in saline solution for oocyte aspiration. Oocytes were aspirated from 2 to 6 mm antral follicles using a 21 G butterfly needle connected to a vacuum pump. Cumulus-oocyte complexes (COCs) containing compact and complete cumulus cell layers

were selected andmatured in groups of 50COCs in 400 ml ofM199medium supplementedwith ALA-glutamine (0.1mM), Na pyruvate

(0.2 mM), gentamicin (5 mg/ml), EGF (50 ng/ml), oFSH (50 ng/ml; National Hormone and Peptide Program), bLH (1 ug/ml; National

Hormone and Peptide Program), cysteamine (0.1 mM), and 10% fetal bovine serum (FBS; Hyclone, South Logan, UT, USA).

In vitro maturation (IVM) was performed for 22-24 hr in a humidified atmosphere of 5% CO2 in air at 38.5 �C.

In Vitro Fertilization

Fertilization (Day 0) was carried out using frozen-thawed semen. Straws were thawed at 37�C for 45 s and then semen layered onto a 90%/45%Percoll discontinuous density gradient for centrifugation (7003 g for 15min) at room temperature. A second centrifugation

(3003 g for 5 min) was performed after discarding the supernatant and re-suspending the spermatozoa pellet in TALP-Sperm (pH =

7.4, 295 mOsm) (Parrish et al., 1988; Parrish et al., 1986). Matured groups of 15-20 COCs were washed twice and placed in 50 mL of

fertilizationmedium. The final sperm concentration was adjusted to 1x106 sperm/ml using a hemocytometer. The fertilizationmedium

was supplemented with BSA (essentially fatty acid free, 6 mg/ml), fructose (90 mg/ml), penicillamine (3 mg/ml), hypotaurine (11 mg/ml)

and heparin (20 mg/ml). Oocytes were co-incubated with spermatozoa at 38.5�C in humidified atmosphere of 5%CO2 in air. Embryo culture (IVC): Presumptive zygotes were mechanically denuded by vortexing for 3-5 min in a 1.5mL tube and 100 uL of SOF-HEPES

medium (Holm et al., 1999) and cultured in groups of 15-20 in 50 mL drops of potassium simplex optimized medium supplemented

with amino acids and 4 mg/mL of BSA (KSOMaa, pH = 7.4, 275 mOsm) (Evolve ZEBV-100, Zenith Biotech, Guilford, CT, USA) for

7 days. On Day 3, 5% FBS was added. Culture conditions were 38.5�C in a humidified atmosphere of 5% CO2, 5% O2, and 90% N2. On Days 4 and 7 mourlae and blastocysts, respectively, were selected for cell injection.

Pig Parthenogenetic Embryo Production Oocyte Collection and IVM

Oocytes were aspirated from antral follicles (2–4 diameters) of ovaries from prepubertal gilt ovaries collected at a local slaughter-

house (Olson Meat Company, Orland, CA, USA). COCs were washed in TCM-199 (GIBCO) containing 0.1% polyvinyl alcohol

(PVA), and incubated at 38�C and 5% CO2 for 48 hr in TCM-199 containing 0.1% PVA, 3.05 mM D-glucose, 0.91 mM sodium pyru- vate, 0.5 mg/ml oFSH, 0.5 mg/ml bLH, 10 ng/ml EGF, 10 mg/ml gentamicin (GIBCO) and 10% porcine follicle fluid.

Parthenogenetic Activation

After IVM, maturated oocytes were stripped of their cumulus cells by incubation in 1 mg/ml hyaluronidase and gentle pipetting.

Denuded oocytes were washed with MEM containing 25 mM HEPES (GIBCO) and electrically activated with two pulses of

120 V/mm for 40 ms, delivered by a BTX Electro Cell Manipulator 2001 (BTX, San Diego, CA, USA) in a 0.5 mm chamber containing

0.3 M mannitol, 0.05 mM CaCl2, 0.1 mMMgSO4 and 0.1% bovine serum albumin (BSA). After washing with PZM-5 (Yoshioka et al.,

2012), the oocytes were incubated in the presence of 5 mg/ml cytochalasin B in PZM-5 for 3 hr to prevent second polar body extrusion

and thus generate diploid parthenogenetic embryos.

Embryo Culture

After activation, pig zygotes were cultured in the 500 mL of PZM-5 (Yoshioka et al., 2012) containing 0.3% BSA for 3-5 days. After

4 days of culture, the culture medium was supplemented with 10% FBS (Gemini Bio-Product, CA, USA) at 38.5�C in a humidified atmosphere of 5% CO2, 5% O2, and 90% N2.

Microinjection of PSCs to Cattle and Pig Blastocysts and Embryo Culture For morula injections, embryos withmore than eight blastomeres and before compaction were selected on days 3-4 for pig and day 4

for cattle embryos. For blastocyst injections, embryos with an obvious blastocoel on days 5-6 for the pig and 6-7 for cattle were used.

Single cell suspensions were added to a 50 mL drop of cell culture medium containing the embryos to be injected, and placed on an

inverted microscope fitted with micromanipulators. Individual cells were collected into a blunt-end micropipette of 20-30 mm internal

diameter (ID) connected to a manual hydraulic oil microinjector. Then, the embryo was secured by a holding pipette and a laser sys-

tem (Saturn 5 Active, Research Instruments, UK) was used to create a whole in the zona pellucida of the embryo. For blastocysts,

another laser pulse was applied to the trophectoderm in order to allow access to the blastocele. Then, the micropipette containing

the cells was advanced into the embryo and 10 cells deposited in the blastocoel or periviteline space, for blastocysts and morulae,

respectively. Groups of 10-20 embryos were manipulated simultaneously and each session was limited to 40 min. Following cell in-

jection, morulae and blastocysts were cultured in the respective cell culture medium for 4 hr, followed by culture for 20 hr in mix me-

dium (1:1) of each cell culturemedium and PZM-5 containing 10%FBS (for the porcine embryos) or KSOMaa containing 4mg/ml BSA

(for the cattle embryos). Then, embryoswere cultured in PZM-5 containing 10%FBSor KSOMaa containing 4mg/ml BSA, for pig and

cattle embryos respectively, for another 24 hr, except injected cattle morulae that were cultured for 96 hr. At the end of the culture

period, GFP or hKO signals were observed using an inverted fluorescencemicroscope (Nikon, Tokyo, Japan) and then embryos were

fixed for immunostaining.

e6 Cell 168, 473–486.e1–e8, January 26, 2017

Pig and Cattle Blastocyst Immunostaining Only blastocyst stage embryos at time of collection were processed for immunostaining as previously described (Ross et al., 2008).

Embryos were washed with phosphate buffered saline (PBS; GIBCO) containing 1 mg/mL PVA (PBS-PVA) three times and then fixed

in 4% paraformaldehyde containing 1 ml/mL PVA for 15 min at room temperature. After washing three times with PBS-PBA, blas-

tocysts were permeabilized with PBS-PVA containing 1% Triton X-100 for 30 min, washed in PBS-PVA containing 0.1% Triton

X-100 (washing buffer; WB), and blocked in PBS-PVA supplemented with 10% normal donkey serum. Embryos were incubated

with primary antibodies (rabbit anti-SOX2 antibody, BioGenex Cat# NU579-UC and mouse anti-human nuclei antibody, Millipore

Cat# MAB1281) overnight at 4�C. After repeated washes in WB, the embryos were incubated with secondary antibodies (Alexa Fluor 568 anti-rabbit IgG and Alexa Fluor 488 anti-mouse IgG, Invitrogen) at room temperature for 1 hr. Then, blastocysts were counter-

stained with 10 mg/ml Hoechst 33342 at room temperature for 20 min. Stained blastocysts were mounted on a glass slide containing

ProLong Gold antifade solution (Invitrogen), covered by a coverslip, and imaged using an inverted fluorescence microscope.

Pig In Vivo Embryo Recovery and Transfer This work was conducted in two commercial pig farms located in Southeastern Spain (Murcia, Spain), and in the pig experimental unit

of the University of Murcia (Murcia, Spain).

Superovulation and Detection of Estrus

Weaning was used to synchronize the estrus in donors and recipients. Only sows with a weaning-to-estrus interval of 3–4 days were

selected as donors and recipients. The superovulation of donors was induced by the intramuscular administration of 1000 IU equine

chorionic gonadotropin (eCG; Foligon, Intervet, Boxmeer, the Netherlands) 24 hr after weaning. Estrus was checked twice per day by

exposing sows to a mature boar (nose-to-nose contact) and applying manual back pressure. Females that exhibited a standing

estrous reflex were considered to be in estrus. Only sows with clear signs of estrus at 48–72 hr post-eCG administration were further

intramuscularly administered with 750 IU of human chorionic gonadotropin (Veterin Corion, Divasa, Farmavic S.A., Barcelona, Spain)

at the onset of estrus.

Insemination of Donors

The donors were post-cervically inseminated at 6 and 24 hr after the onset of estrus. The insemination doses (1.53 109 spermatozoa

in 45 mL) were prepared from sperm-rich fractions of the ejaculates extended in Beltsville thawing solution extender (Pursel and

Johnson, 1975) and were stored for a maximum of 72 hr at 18�C. Embryo Recovery and Evaluation

The collection of embryos was performed in a specifically designed surgical room located on the farm. The donors were subjected to

a mid-ventral laparotomy on Day 2 of the estrous cycle (Day 0: onset of estrus). The donors were sedated with azaperone (2 mg/kg

body weight, intramuscular; Stresnil, Lab. Dr. Esteve, Barcelona, Spain). General anesthesia was induced using sodium thiopental

(7 mg/kg body weight, intravenous; Tiobarbital 1g, B. Braun VetCare SA, Barcelona, Spain) and was maintained with isoflurane

(3.5%–5%; Isoflo; Lab. Abbot, Madrid, Spain). After exposure of the genital tract, the corpora lutea on the ovaries were counted. Zy-

goteswere collected by flushing each oviduct with 20mL of protein-free embryo recoverymedium consisting of Tyrode’s lactate (TL)-

HEPES-polyvinyl alcohol (PVA)- medium (TL-HEPES-PVA)(Funahashi et al., 2000) with some modifications (Martinez et al., 2014).

Collected embryos were washed three times in TL-HEPES-PVA, placed in sterile Eppendorf tubes containing 1.5 mL of the same

medium and transported in a thermostatically controlled incubator at 39�C to our laboratory at the University of Murcia within 1 hr after collection. Embryos were then evaluated for morphology under a stereomicroscope at a magnification of 60 x. In vivo collected

embryos used in this study include zygotes with a single cell and two visible polar bodies, 2-4 cell embryos, morulae, and blastocysts.

In Vitro Embryo Culture and Assessment of In Vitro Embryo Development

Zygotes were transferred (40 zygotes per well) to a 4-well multidish (Nunc) containing 500 mL of glucose-free NCSU-23 medium

(Petters and Wells, 1993) that was supplemented with 0.3 mM pyruvate and 4.5 mM lactate for 24 hr and then changed to fresh

NCSU-23 medium containing 5.5 mM glucose for an additional 5 days. Cultures were performed at 39�C, 5% CO2 in air and 95%–97% relative humidity. At Day 5, embryo culture wells were supplemented with 10% (v/v) fetal calf serum (FCS, Sigma-Aldrich

Quimica S.A.,Madrid, Spain; cat. no. F7524; lot no. 120M3395). In vitro embryo development was evaluated under a stereomicro-

scope at 24 hr and 6 days of culture to determine cleavage and blastocyst formation rates, respectively. An embryo that had cleaved

to the 2- to 4-cell stage was defined as cleaved, and an embryo with a well-defined blastocoel and an inner cell mass and trophoblast

totally discernible was defined as a blastocyst. Blastocysts were injected as described above.

Culture of hiPSC-Injected Blastocysts

Immediately after hiPSC injection, the blastocysts were incubated in 500 mL of medium used for the culture of hiPSCs for 3-4 hr and

then changed to NCSU-23 medium and hiPSC medium (1:1) for an additional 20-22 hr.

Surgical Embryo Transfer

Injected blastocysts were loaded into a Gynétics embryo transfer catheter (Gynétics Medical Products N.V., Lomel, Belgium) con-

nected to a 1mL syringe for transfer into the recipients. The embryo transfer medium was NCSU-23 supplemented with 10 mM

HEPES, 0.4% (v/v) BSA and 10% (v/v) FCS. The embryo transfer catheter was loaded with air bubbles that separated the 30 mL

drop of medium that contained the embryo from two drops of medium before and after the embryo. All transfers were conducted

in asynchronous (�24 hr to embryo collection) recipients. One hour before the transfer, each recipient received a single intramuscular injection of a long-acting amoxicillin suspension (Clamoxyl LA; Pfizer, Madrid, Spain) at a dose of 15 mg/kg. The transfers were

Cell 168, 473–486.e1–e8, January 26, 2017 e7

conducted using the same procedure described previously for embryo collection. The embryoswere transferred to the tip of a uterine

horn (15 to 20 cm from the uterotubal junction) with the embryo transfer catheter inserted through the uterine wall, which was pre-

viously punctured with a blunt Adson forcep. Post transfer, all recipients were evaluated daily for behavioral changes, including signs

of estrus beginning at 12 days post transfer. Pregnancy was diagnosed by transabdominal ultrasonography (Logiq Book XP, General

Electric, Solingen, Germany) onDays 20 to 22 post-transfer. All pregnant sowswere deeply anesthetized on days 23 to 25 post-trans-

fer and subsequently euthanized by using a captive bolt pistol. Immediately, a midline longitudinal incision was made between the

posterior pair of nipples and the ovaries and uterus were located. The cervix and the ovarian stalks were occluded with transfixing

ligatures and the reproductive tract removed. The genital tract was then placed in water tight plastic bags kept on ice and transported

to the laboratory within 20 min. Once in the laboratory the uterus was opened and fetuses removed from the placenta tissues and

numbered in sequential order. Fetuseswere individuallymeasured andweighed. Afterward, each fetuswas checked for fluorescence

emission using an epifluorescence stereomicroscope (Nikon SMZ 18, Japan).

Pig Parthenogenetic Embryo Transfer This work was conducted at the University of California Davis animal facilities.

Estrus Induction and Synchronization

Estrus and ovulation was induced by intramuscular administration of 400 I.U equine chorionic gonadotropin and 800 I.U. of human

chorionic gonadotropin. (PG600; Merck Animal Heath, Summit, NJ, USA) followed 72 hr later by an intramuscular administration of

750 I.U. of hCG (Choluron, Merck Animal Health, Summit, NJ, USA). Estrus was checked twice per day by exposing sows to amature

boar (nose-to-nose contact) and applying manual back pressure. Females that exhibited a standing estrous reflex were used as re-

cipients of surgical embryo transfer 5 to 6 days after hCG administration. Prior to surgical procedure the animals were fasted (food

andwater) for 24 hr. Anesthesia was induced by intramuscular administration of 2mg/kg of Telazol (Zoetis, Kalamazoo,MI, USA) prior

to intubation and thenmaintained at a surgical plane by inhalation of Isoflurane (0.5%–5%as need tomaintain anesthesia). TheOvary

and uterus was exposed by a ventral medial laparotomy. The embryos were transferred to the tip of a uterine horn (15 to 20 cm from

the uterotubal junction) with the embryo transfer catheter inserted through the uterine wall, which was previously punctured with a

blunt needle. Pregnancy was diagnosed by transabdominal ultrasonography (WED-2000AV, Welld, Shenzhen, China) 17 to 20 days

after embryo transfer. On days 23 to 28 of gestation all pregnant gilts were deeply anesthetized by intramuscular administration of

2 mg/kg of Telazol (Zoetis, Kalamazoo, MI, USA) and subsequently euthanized by intracardiac administration of 2.25 mL/kg eutha-

nasia solution (Fatal Plus Solution, Vortex Pharmaceutical Ltd, Dearborn, MI, USA). Then, the reproductive tract was removed and

transported to the laboratory within 20 min. Once in the laboratory the uterus was opened and fetuses removed from the placenta

tissues and numbered in sequential order. Fetuses were individually measured and weighed. Afterward, each fetus was checked for

fluorescence emission using an epifluorescence stereomicroscope (Zeiss, Germany).

Immunocytochemistry Between day 21-28 of gestation, surrogates were euthanized and embryos were dissected and immerse in paraformaldehyde and

incubated at 4�C during 4 hr for small-sized embryos and overnight for normal-sized embryos. After overnight cryoprotection in 30% sucrose solution (Sigma), the embryos were embedded in OCT compound (Sakura Finetek) and frozen in dry ice. Sections (10 mm

thick for small-sized embryos and 20 mm for normal-sized embryos) of the different embryos were cut on a Leica cryostat. For immu-

nohistochemistry, we used standard staining procedures and antigen retrieval solution (HistoVT one, Nacali Tesque, INC) according

to manufacturer’s instructions. The primary antibodies used were rabbit anti-monomeric Kusabira-Orange 2 (MBL Code # PM051M,

1:500), rabbit anti-GFP (MBL Code# 598, 1:500), rat anti-cytokeratin 8 (TROMA-I, DSHB Antibody Registry ID: AB_531826, 1:20),

mouse anti-epithelial antigen (Dako Cat# M0804, 1:200), Mouse monoclonal anti-Ep-CAM (Santa Cruz Cat# sc-25308, 1:50), mouse

anti-actin a-smoothmuscle (Sigma Cat# A5228, 1:200), Rabbit polyclonal anti-Histone H3 (tri methyl K9) (AbcamCat# ab8898, 1:50),

Rabbit polyclonal anti-Histone H4 (tri methyl K20) (Abcam Cat# ab9053, 1:50), Mouse monoclonal anti-Oct3/4 (C-10) (Santa Cruz

Cat# sc-5279, 1:200), Rat anti-Mouse CD31(Clone MEC13.3) (BD PharMingen Cat# 553370, 1:200), Mouse anti-Tubulin b3 (Clone

TUJ1) (Biolegend Cat# 801202, 1:500).

QUANTIFICATION AND STATISTICAL ANALYSIS

For Figure 1E, qPCR for quantifying rat contribution in rat-mouse chimera was performed using SYBR Green PCR Master Mix

(Applied Biosystems) and total genomic DNAs isolated from different tissues of the chimera, mouse tail tip and DAC2 rat ESCs.

The data were analyzed using the DDCT method, which were first normalized to the values of the mouse specific primers. A rat spe-

cific primer was used for detecting rat cells. The levels of chimerism were determined based on the values generated from serial di-

lutions of rat:mouse genomic DNA. The primers used for genomic qPCR are listed in Table S2. For Figures 1E, S2C, and S3E data are

presented as mean (SD). For Figure 1B, n represents number of embryo transfers.

e8 Cell 168, 473–486.e1–e8, January 26, 2017

Supplemental Figures

(legend on next page)

Figure S1. Chimeric Contribution of Rat PSCs to Different Organs of Rat-Mouse Chimeras, Related to Figure 1

(A) Bright field (top) and fluorescence (bottom) images showing hKO-labeled rat ESCs (DAC8) contributed to different organs of a neonatal rat-mouse chimera.

Control organs from a wild-type neonatal mouse were showing on the left.

(B) Representative fluorescence images showing hKO-labeled rat iPSCs (SDFF) contributed to different tissues in a 3-week-old rat-mouse chimera. Red, hKO-

labeled rat cells; blue, DAPI. Scale bar is 100 mm.

(C) Bright field (left) and fluorescence (right) images showing an isolated neonatal mouse gallbladder contributed by hKO-labeled rat iPSCs (SDFE), as shown in

Figure 1F.

Figure S2. CRISPR-Cas9-Mediated Rat-Mouse Blastocyst Complementation, Related to Figure 2

(A) Bright field images showing a wild type (P0, left) mouse and a Pdx1-/- (E18.5, right) mouse fetus generated by zygotic co-injection of Cas9 mRNA and Pdx1

sgRNA. Li, liver; St, stomach; Sp, spleen. Yellow-dotted line encircles the pancreas in the wild type, and indicates the lack of a pancreas in the Pdx1-/- fetus.

(B) Bright field (top) and fluorescence (bottom) images showing more chimeric contribution of rat cells in a Pdx1-/- mouse pancreas than a wild type mouse

pancreas. Li, liver; St, stomach; Sp, spleen. Yellow-dotted line encircles the pancreases. Red, hKO-labeled rat cells.

(C) Glucose tolerance test results of adult (>7 months) Pdx1-/- and Pdx1+/- mice complemented with rat PSCs. Age-matched wild type mice and rats were

included as controls. Error bars indicate s.d.

(D) Top, a representative bright field image showing a wild type (left) and Nkx2.5-/- (right) E10.5 mouse embryos Middle, rat ESC-derivatives rescued retarded

growth of E10.5Nkx2.5-/-mouse embryo and were enriched in the heart. H, heart. Bottom, an E10.5Nkx2.5-/- embryo showing retarded growth with little to no rat

cells contribution to the heart. Yellow-dotted line encircles the heart. Scale bar is 100mm.

(E) Top, a representative bright field image showing a wild type (left) and a Pax6-/- (right) E15.5 mouse fetuses. Bottom, fluorescence images showing more

chimeric contribution of rat cells in the eye of Pax6-/- (right) than wild type (left) chimeras. WT+rPSCs, control rat-mouse chimera without Cas9/sgRNA injection.

Red, hKO-labeled rat cells. Blue, DAPI. Scale bar is 100mm.

(F) Frequencies of wild type, homozygous, heterozygous mutants and mosaic mutant mice generated by zygotic co-injection of Cas9 mRNA and sgRNAs for

Pdx1, Nkx2.5, or Pax6.

Figure S3. Teratoma Assay and Interspecies ICM Incorporation of Different Types of hiPSCs to Cattle and Pig Blastocysts, Related to

Figure 4

(A) Representative images showing hematoxylin and eosin staining of histological sections derived from teratomas generated by 2iLD-hiPSCs, 4i-hiPSCs,

NHSM-hiPSCs and FAC-hiPSCs. hiPSC-derived teratomas contained tissues from all three germlineages: endoderm (top), mesoderm (middle) and ectoderm

(bottom). Scale bar is 100 mm.

(legend continued on next page)

(B) Laser-assisted microinjection of hiPSCs into a bovine blastocyst. Left, before injection laser beamwas used to perforate the zona pellucida. Right, a blunt end

pipette was used to transfer hiPSCs to the blastocoel. Red color indicates hKO-labeled hiPSCs (bottom).

(C) Representative immunofluorescence images showing ICM incorporation of naive and intermediate hiPSCs. Top, SOX2; Middle, HuNu, Bottom, merged

images. Blue, DAPI. Scale bar is 100 mm.

(D) Number of hiPSCs remained in the cattle (left) and pig (right) blastocysts after injection of 10 hiPSCs followed by 2 days in vitro culture. Red line, average

number of cells. Blue dot, number of ICM-incorporated hiPSCs in each blastocyst. BL, blastocyst.

(E) Comparison of several parameters of ICM incorporation for each type of hiPSCs between pig and cattle. Error bars indicate s.d.

Figure S4. Generation of Post-implantation Pig Embryos Derived from Blastocyst Injection of hiPSCs, Related to Figure 5

(A) Representative bright field images showing: a) freshly collected pig zygotes; b) in vitro derived pig blastocysts; c) hiPSCs are being injected into a pig

blastocyst; d) Pig female reproductive tract at day-28 of pregnancy; e) a day 28 pig conceptus displaying the embryo proper and the amniotic and allantoic

membranes; f) a magnified image of the day-28 pig embryo showing in e.

(B) Representative bright field images showing a normal size day-28 pig embryo (left) and growth retarded day-28 embryos (middle and right).

A

B

NHSM NHSM

!"!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!!""""""""""""""""""""""""""""""""""""""""""

2iLD 2iLD

FAC FAC

C

FAC #2 FAC #3 FAC #4

FAC #5 FAC #6 FAC #6

FAC #7

2nd only

GFP

GFP

GFP

GFP

EpCAM

CK8 Merge

Merge

Merge

Merge

SMA

HNF3

Figure S5. Chimeric Contribution of hiPSCs to Post-implantation Pig Embryos, Related to Figure 6

(A) Representative bright field (left), fluorescence (middle) and immunofluorescence (right) images showing the contribution of hKO-labeled NHSM-hiSPCs, GFP-

labeled 2iLD-hiPSCs and FAC-hiPSCs to normal size day 28 pig embryos. Scale bar is 200 mm.

(B) Representative immunofluorescence images showing the contribution of FAC-hiPSCs to six additional normal size day 21-28 pig embryos (FAC #2-#7). Scale

bar is 200 mm.

(C) Representative immunofluorescence images showing the chimeric contribution and differentiation of FAC-hiPSCs within a normal size, day 28 pig embryo

(FAC #3). Embryo sections were stained with antibodies against GFP (green, left), EpiCAM, HNF3b, CK8 and SMA (red, middle). Right, merged images. Insets are

higher magnification images of boxed regions. Scale bar is 100 mm.

  • Interspecies Chimerism with Mammalian Pluripotent Stem Cells
    • Introduction
    • Results
      • Naive Rat PSCs Robustly Contribute to Rat-Mouse Interspecies Chimera Formation
      • A Versatile CRISPR-Cas9-Mediated Interspecies Blastocyst Complementation System
      • Naive Rodent PSCs Do Not Contribute to Chimera Formation in Pigs
      • Generation of Naive, Intermediate, and Primed hiPSCs
      • Chimeric Contribution of hiPSCs to Pig and Cattle Blastocysts
      • Chimeric Contribution of hiPSCs to Post-implantation Pig Embryos
    • Discussion
    • Supplemental Information
    • Author Contributions
    • Acknowledgments
    • References
    • STAR★Methods
      • Key Resources Table
      • Contact for Reagent and Resource Sharing
      • Experimental Model and Subject Details
        • Rodents
        • Pigs
        • Human iPSC Culture Media
        • Culture and maintenance of rat ESCs/iPSCs and mouse iPSCs
      • Method Details
        • Chemicals Unless Otherwise Indicated, Chemicals Were Obtained from Sigma-Aldrich
          • Plasmids Construction
        • Rat iPSC Generation
        • Human iPSC Generation
        • Generation of Fluorescently Labeled Rat PSCs and hiPSCs
        • Mouse Embryo Collection
        • sgRNA Design and In Vitro Transcription
        • Microinjection of Cas9 mRNA and sgRNAs to Mouse Zygotes
        • Microinjection of Rat PSCs to Mouse Blastocysts
        • Mouse Embryo Transfer
        • Genomic PCR
        • Quantitative Genomic PCR
        • Genotyping and DNA Sequencing
        • Glucose Tolerance Test
        • Cattle In Vitro Embryo Production
          • Oocyte Recovery and In Vitro Maturation
          • In Vitro Fertilization
        • Pig Parthenogenetic Embryo Production
          • Oocyte Collection and IVM
          • Parthenogenetic Activation
          • Embryo Culture
        • Microinjection of PSCs to Cattle and Pig Blastocysts and Embryo Culture
        • Pig and Cattle Blastocyst Immunostaining
        • Pig In Vivo Embryo Recovery and Transfer
          • Superovulation and Detection of Estrus
          • Insemination of Donors
          • Embryo Recovery and Evaluation
          • In Vitro Embryo Culture and Assessment of In Vitro Embryo Development
          • Culture of hiPSC-Injected Blastocysts
          • Surgical Embryo Transfer
        • Pig Parthenogenetic Embryo Transfer
          • Estrus Induction and Synchronization
        • Immunocytochemistry
      • Quantification and Statistical Analysis