Data Structure and Algorithms

Siper
ProjectDirection.txt

Here is some directions for the project. The fungi data we have composed of ">1111883" Code, and its combination of sequences. The length of sequence would be range of 1000 - 1500 bytes. With the given Key if you have a key as 100 bytes taken from the any of sequence from the sample data. ( You can determine your key length). For example, if we use following sequence as a key ( 100 byte)"GTTGATCCTGCCAGAGGCGACCGCTTTTGGAGTTCGATTAAGCCATGCGAGTAGAATGAATTAGATCATTGCGAACTGCTCAGTAACACGTGGATAACC" Find all codes which includes key patterns we specified. if possible you can find % of similarity. Key "GTTGATCCTGCCAGAGGCGACCGCTTTTGGAGTTCGATTAAGCCATGCGAGTAGAATGAATTAGATCATTGCGAACTGCTCAGTAACACGTGGATAACC" fungi Code List similarity Values >4473052 100% match "GTTGATCCTGCCAGAGGCGACCGCTTTTGGAGTTCGATTAAGCCATGCGAGTAGAATGAATTAGATCATTGCGAACTGCTCAGTAACACGTGGATAACC" >4465919 90% match "TTTTTTCCTGCCAGAGGCGACCGCTTTTGGAGTTCGATTAAGCCATGCGAGTAGAATGAATTAGATCATTGCGAACTGCTCAGTAACACGTGGATAACC" >4457490 ...