HW DUE IN 1 hour 20 min. questions and answers
mge_a4_study_q4.pdf
ORIGINAL RESEARCH published: 12 October 2015
doi: 10.3389/fmicb.2015.01063
Edited by: Miklos Fuzi,
Semmelweis University, Hungary
Reviewed by: Atte Von Wright,
University of Eastern Finland, Finland Dmitri Debabov,
NovaBay Pharmaceuticals, USA
*Correspondence: Anne-Brit Kolstø,
Laboratory for Microbial Dynamics, Department of Pharmaceutical
Biosciences, School of Pharmacy, University of Oslo, Postbox 1068
Blindern, 0316 Oslo, Norway a.b.kolsto@farmasi.uio.no
†Present address: Roger Simm,
Norwegian Veterinary Institute, Oslo, Norway;
Massoud Saidijam, Research Centre for Molecular
Medicine, Department of Molecular Medicine and Genetics, School
of Medicine, Hamadan University of Medical Sciences, Hamadan, Iran
Specialty section: This article was submitted to
Antimicrobials, Resistance and Chemotherapy,
a section of the journal Frontiers in Microbiology
Received: 17 August 2015 Accepted: 15 September 2015
Published: 12 October 2015
Citation: Kroeger JK, Hassan K, Vörös A,
Simm R, Saidijam M, Bettaney KE, Bechthold A, Paulsen IT,
Henderson PJF and Kolstø A-B (2015) Bacillus cereus efflux protein
BC3310 – a multidrug transporter of the unknown major facilitator family,
UMF-2. Front. Microbiol. 6:1063. doi: 10.3389/fmicb.2015.01063
Bacillus cereus efflux protein BC3310 – a multidrug transporter of the unknown major facilitator family, UMF-2 Jasmin K. Kroeger1,2, Karl Hassan3, Aniko Vörös1, Roger Simm1†, Massoud Saidijam4†, Kim E. Bettaney4, Andreas Bechthold2, Ian T. Paulsen3, Peter J. F. Henderson4 and Anne-Brit Kolstø1*
1 Laboratory for Microbial Dynamics, Department of Pharmaceutical Biosciences, School of Pharmacy, University of Oslo, Oslo, Norway, 2 Institut für Pharmazeutische Biologie und Biotechnologie, Albert-Ludwigs Universität, Freiburg, Germany, 3 Department of Chemistry and Biomolecular Sciences, Macquarie University, Sydney, NSW, Australia, 4 School of BioMedical Sciences and Astbury Centre for Structural Molecular Biology, University of Leeds, Leeds, UK
Phylogenetic classification divides the major facilitator superfamily (MFS) into 82 families, including 25 families that are comprised of transporters with no characterized functions. This study describes functional data for BC3310 from Bacillus cereus ATCC 14579, a member of the “unknown major facilitator family-2” (UMF-2). BC3310 was shown to be a multidrug efflux pump conferring resistance to ethidium bromide, SDS and silver nitrate when heterologously expressed in Escherichia coli DH5α �acrAB. A conserved aspartate residue (D105) in putative transmembrane helix 4 was identified, which was essential for the energy dependent ethidium bromide efflux by BC3310. Transport proteins of the MFS comprise specific sequence motifs. Sequence analysis of UMF- 2 proteins revealed that they carry a variant of the MFS motif A, which may be used as a marker to distinguish easily between this family and other MFS proteins. Genes orthologous to bc3310 are highly conserved within the B. cereus group of organisms and thus belong to the core genome, suggesting an important conserved functional role in the normal physiology of these bacteria.
Keywords: MFS, drug resistance, efflux protein, Bacillus cereus, UMF-2
Introduction
Bacillus cereus sensu stricto (B. cereus) is a Gram-positive, endospore forming organism known to cause foodborne illness in humans. It is a member of the B. cereus group of bacteria (Bacillus cereus sensu lato) that, in addition to B. cereus encompasses the species B. anthracis, B. thuringiensis, B. mycoides, B. pseudomycoides, B. weihenstephanensis, and B. cytotoxicus (Kolsto et al., 2009; Guinebretiere et al., 2013). The B. cereus group members are genetically closely related with high level of syntheny (conserved gene order). The high similarity results in an intertwinement of the B. cereus, B. thuringiensis, and B. weihenstephanensis branches in the phylogenetic tree (Ash et al., 1991). However, the B. cereus group organisms exhibit different phenotypes, inhabit diverse ecological niches and are pathogenic against different hosts. The three species B. mycoides, B. pseudomycoides, and B. weihenstephanansis are regarded as non-pathogenic. B. anthracis is the causative agent of anthrax in humans and animals (Mock and Fouet, 2001). B. thuringiensis is
Frontiers in Microbiology | www.frontiersin.org 1 October 2015 | Volume 6 | Article 1063
Kroeger et al. Bacillus cereus efflux protein BC3310
an insect pathogen that is commercially used as a biopesticide (Melo et al., 2014). B. cytotoxicus causes enteritis in humans and is thermotolerant and highly cytotoxic (Guinebretiere et al., 2013). In the natural environment B. cereus is found as a saprophyte in soil, associated with the rizosphere of plants and in the gut of invertebrates (Jensen et al., 2003; Berg et al., 2005). Even though B. cereus is most frequently associated with food- borne enteric infections in humans, it is able to cause other local or systemic infections such as endophthalmitis, cutaneous infections, endocarditis, central nervous system infection, or bacteremia (Steen et al., 1992; Callegan et al., 1999; Centers for Disease Control and Prevention, 2005; Callegan et al., 2006; Martinez et al., 2007; Kim et al., 2010; Sasahara et al., 2011; Stevens et al., 2012). Clinically serious infections of B. cereus are treated with antibiotics such as carbapenems, clindamycin, ciprofloxacin, and vancomycin (Kervick et al., 1990; Bottone, 2010; Uchino et al., 2012; Matsuda et al., 2014). However, resistance against carbapenem and clindamycin has been reported, which eventually led to failed treatments including cases with fatal outcomes (Kervick et al., 1990; Kiyomizu et al., 2008; Savini et al., 2009; Uchino et al., 2012).
According to the transportdb database, the B. cereus group strains constitute between 390 and 455 transporters per strain (Ren et al., 2007; Ren and Paulsen, 2007). The unusually high number of transporters per B. cereus group strain may reflect the different lifestyles of these bacteria. Importantly, each group member contains approximately 100 transporters, predicted to efflux drugs.
Drug efflux systems are part of the resistance machinery to counteract antibiotics (Sun et al., 2014). They are divided into six different transporter superfamilies: (i) MFS (major facilitator superfamily); (ii) ABC (ATP binding cassette) transporter superfamily; (iii) MATE (multidrug and toxic compound extrusion) family; (iv) RND (resistance nodulation division) family; (v) DMT (drug/metabolite transporter) superfamily, and (vi) PACE (proteobacterial antimicrobial compound efflux) (Poole, 2007; Hassan et al., 2015). Of these, MFS pumps constitute the majority of efflux transporters encoded in B. cereus group strains, typically more than 50 per strain. The MFS comprises secondary transporters that use the electrochemical gradient of protons or sodium ions across the cell membrane to energize substrate transport, including drug efflux (Pao et al., 1998; Saier et al., 1999; Reddy et al., 2012). The ‘transporter classification system’ (see http://www.tcdb.org/) classifies the MFS into 82 families. With respect to drug efflux pumps, the drug:H+ antiporter families (DHA)1 to 3 are the largest and best investigated drug exporter families in the MFS (Saier et al., 2014).
In this study, we characterize the phylogenetic and some functional properties of the putative multidrug transporter BC3310 from B. cereus ATCC 14579. BC3310 was classified by in silico analysis as a member of the major facilitator superfamily and the phylogenetic relationship within this group was determined. A deletion mutant of bc3310 was constructed and overexpression of BC3310 allowed for functional characterization in a heterogenous host as well as purification and partial biochemical characterization in vitro.
Materials and Methods
Bioinformatics Analyses Bacterial sequence information was collected using the IMG homepage from the Joint Genome Institute (Markowitz et al., 2012). Sequence alignments were performed using MEGA MUSCLE alignment with default settings (Tamura et al., 2013) and the phylogenetic tree was constructed using MrBayes (Ronquist et al., 2012). Prediction of the transmembrane helices was done by submitting the primary protein sequence of BC3310 (UniProt Q81B77) to HMMTOP (Tusnady and Simon, 2001).
Construction of B. cereus bc3310 Deletion Mutant A markerless mutant of bc3310 was constructed as described (Simm et al., 2012) in the B. cereus ATCC 14579 wild type according to the method of Janes and Stibitz (2006) and using the primers listed in Table 1. The B. cereus plasmid pBClin15 was lost during the process of making the markerless mutant and therefore a plasmid cured strain was used for phenotypic comparison as in previous investigations (Voros et al., 2013). The presence of the deletion was confirmed by sequencing. B. cereus was grown in LB medium at 30◦C, unless otherwise stated.
Escherichia coli BC3310 Expression Constructs The expression levels of genes cloned into pTTQ18-based plasmids are inducible by isopropyl β-D-thiogalactopyranoside (IPTG). Furthermore, the genes are fused with a sequence coding for a C-terminal (His)6 tag for identification and
TABLE 1 | Primers used in this study.
Primer for Sequence (5′→3′)
Overexpression in pTTQ18
pTTQ18-bc3310F CATGGATCCATGCGTTTTACTTTTTGGATTATGG
pTTQ18-bc3310R CCGCCTGCAGCGGTTGTTTTGTCATGCCC
D105 mutants
bc3310_D105N_f GATTTCTAGTTGGAGTTGGAAATCATATGCTTCATGTC GGAAC
bc3310_D105N_r GTTCCGACATGAAGCATATGATTTCCAACTCCAACTAG AAATC
bc3310_D105A_f GATTTCTAGTTGGAGTTGGAGCTCATATGCTTCATGTC GGAAC
bc3310_D105A_r GTTCCGACATGAAGCATATGAGCTCCAACTCCAACTAG AAATC
bc3310_D105E_f GATTTCTAGTTGGAGTTGGAGAACATATGCTTCATGTC GGAAC
bc3310_D105E_r GTTCCGACATGAAGCATATGTTCTCCAACTCCAACTAG AAATC
Deletion mutant
dbc3310_5′ _f CGCGGATCCATGAACAAACTATATTAC dbc3310_5′ _r CAATTTCCCTTCCCAAAAAGTAAAACGCAT dbc3310_3′ _f GTTTTACTTTTTGGGAAGGGAAATTGAAGTAA dbc3310_3′ _r ACGCGTCGACTAGTTTGATATACCTGTTC
Frontiers in Microbiology | www.frontiersin.org 2 October 2015 | Volume 6 | Article 1063
Kroeger et al. Bacillus cereus efflux protein BC3310
purification of the expressed protein. The plasmid construct pTTQ18-bc3310 (pbc3310) was made by general molecular biology techniques according to Sambrook and Russell (2001) by amplifying the gene bc3310 from genomic DNA of B. cereus ATCC 14579 using the primers listed in Table 1. The plasmids for expressing BC3310 D105 mutants pbc3310D105A, pbc3310D105N, and pbc3310D105E were made using sequence and ligation-independent cloning (Li and Elledge, 2007). The presence of each mutation was confirmed by sequencing. The E. coli strain DH5α �acrAB (Simm et al., 2012) carrying pTTQ18 empty vector or the overexpression plasmids was made for minimal inhibition concentration (MIC) testing. For protein purification the E. coli strain BL21 was transformed with pbc3310.
Escherichia coli strains harboring plasmids were grown in 50 or 250 ml LBmedium with ampicillin (100 μg ml−1) at 37◦C and 180 rpm in 250 ml or 1 l baffled flasks or on LB agar plates at 37◦C, unless otherwise stated.
MIC Tests Overnight cultures of B. cereus ATCC 14579 (without pBClin) and B. cereus �3310 or E. coli DH5α �acrAB (Simm et al., 2012) with relevant plasmid were inoculated 1:100 and grown to an OD600 between 0.8 and 1.0 at 37◦C and 180 rpm. These pre-cultures were diluted to a final OD600 of 0.02. The test was performed at least three times in duplicate in microtiter plates and antibiotics were added in a 2-fold serial dilution. For susceptibility assay using E. coli strains 100 μg ml−1 ampicillin and 0.01 mM IPTG were added to all cultures. The cultures were incubated at 37◦C for 20–24 h and visually inspected for growth. The lowest concentration, at which no growth was observed, was determined as the MIC.
Ethidium Bromide Accumulation Assay Escherichia coli strains DH5α �acrABwith the plasmids pTTQ18 and pbc3310 were grown on LB agar plates supplemented with 100 μg ml−1 ampicillin and 0.01 mM IPTG at 37◦C over night. Cells were collected with a loop and resuspended in PBS supplemented with 0.4% glucose (pH 7-7.4) to an OD600 of 1.000 (±0.005). These cells were applied on a microtiter plate and, where appropriate, carbonyl cyanide m-chlorophenylhydrazone (CCCP) was added to achieve an end concentration of 200 μM. Thereafter, ethidium bromide was added to an end concentration of 25 μM and the fluorescence change was measured over 60 min in a Safire spectrophotometer (Tecan, Crailsheim, Germany) with excitation and emission wavelength of 518 and 605 nm, respectively. Duplicate measurements were recorded on at least two cultures.
Heterologous Expression of BC3310 and Its Mutants with (His)6-tag and Western Blot Overnight cultures of E. coli DH5α �acrAB carrying pbc3310, the empty vector (pTTQ18) or plasmids encoding the bc3310 mutants (pbc3310D105A, pbc3310D105N, or pbc3310D105E) were transferred to fresh LB (amp) medium and grown to
an OD680 between 0.4 and 0.6. Expression was induced with 0.75 mM IPTG and the cultures were grown for another 3 h. For quantification of expression, Western blot assays were performed. One milliliter of the overexpression cultures was harvested by centrifugation at 15000 g, 4◦C for 5 min. The pellet was washed (20 mM Tris-HCl pH 7.6, 100 mM NaCl, 5% glycerol, 1 mM phenylmethanesulfonylfluoride (PMSF)) and resuspended depending on cell mass in ice- cold lysis buffer (50 mM Tris-HCl pH 7.6, 100 mM NaCl, 5% glycerol, 5 mM β-mercaptoethanol, 1 mM PMSF, 1 μg ml−1 DNase). Cells were lysed by continuous sonication for 25 min in a cold water bath. SDS-PAGE and Western blots were performed as described in Sambrook and Russell (2001). (His)6-tag detection was done using a mouse anti-(His)6 antibody (Qiagen, Hilden, Germany) and a horse anti-mouse horseradish peroxidase-labeled secondary antibody (New England Biolabs. ECL advanced chemiluminescence detection reagent (Amersham Pharmacia Biotech, Pittsburgh, PA, USA) was used and chemiluminescence was measured by using the Analyzer Universal hood (Bio Rad, München) and the Quantity one 4.6.6 Software. Quantification was performed by pixel counting of five biological replicates on five different Western blots.
Purification of the BC3310 Protein by Affinity Chromatography For protein expression and purification, the method described by Ward et al. (2000) was used. In short, E. coli strain BL21 pbc3310 was grown in 2TYmedium (1.6% tryptone, 1% yeast extract, 0.5% sodium chloride, pH 7) and expression was induced at an OD680 between 0.4 and 0.6 with 0.75 mM IPTG. The culture was grown for another 3 h and cells were harvested. For inner membrane preparation, E. coli cells were resuspended in 20 mM Tris-HCl (pH 8.0), 0.5 mMEDTA and kept frozen at –80◦C. After thawing, cells were disrupted with a Continuous Flow Disruptor (Constant Systems, UK) and inner membranes isolated by sucrose gradient centrifugation. Samples were kept at –80◦C in Tris-HCl (pH 7.5) and EDTA.
Inner membranes were solubilized in 20 mM CAPSO (pH 10.0), 300 mM sodium chloride, 20% glycerol, 1% n-dodecyl β- D-maltoside (DDM), 20 mM imidazole (pH10.0). Immobilized metal affinity chromatography (IMAC) was performed using 20 mM CAPSO (pH 10.0), 10% glycerol, 0.05% DDM, 20 mM imidazole (pH 10.0) as wash buffer and 20 mM CAPSO (pH 10.0), 200mM imidazole, 5% glycerol, and 0.05%DDM as elution buffer.
Circular Dichroism Measurement Purified protein was washed using a spin concentrator with 20 mM CAPSO (pH 10.0), 5% glycerol and 0.05% DDM until imidazole-free. CD spectral analysis was performed from 270 to 195 nm in a 1 nm step resolution using a spectropolarimeter (Jasco J-715) with constant nitrogen flushing and a scan rate of 10 nm min−1. Response time was set at 1 s with a sensitivity of 100 mdeg and 10 nm bandwidth. The data comprised an accumulation of 20 scans, from which the buffer contribution was subtracted.
Frontiers in Microbiology | www.frontiersin.org 3 October 2015 | Volume 6 | Article 1063
Kroeger et al. Bacillus cereus efflux protein BC3310
FIGURE 1 | Dendrogram comparing BC3310 from Bacillus cereus ATCC 14579 with orthologous proteins and other multidrug transporters from the DHA1 and DHA3 families. BC3310 from B. cereus ATCC 14579 (UniProt accession number: Q81B77; bold font) and orthologous proteins from B. cereus ATCC 10987 (Q734U9), B. cereus ATCC 10876 (C2N377), B. anthracis str. Ames (Q81N75), B. cereus ssp. cytotoxis (A7GQF7), B. weihenstephanensis (A9VLS6), B. mycoides (C3AET4), B. pseudomycoides (C3BM93), Geobacillus sp. Y4.1MC1 (E3IFM2), Halobacillus halophilus (I0JJA0), B. subtilis (O34929), Listeria innocua (Q92AX8), Listeria monocytogenes (S5JWD1), Geobacillus kaustophilus (Q5L2X3), Lysinibacillus sphaericus (B1HUQ2), Exiguobacterium sibiricum (B1YK36), Anoxybacillus flavithermus (B7GFW5), M. caseolyticus (B9E839), Brevibacillus brevis (C0ZL32), Escherichia coli (P21503), and DHA1 proteins from Lactococcus lactis (Q48658), B. subtilis (Q797E3, O34546, P39843, P33449), Pseudomonas aeruginosa (P32482) and DHA3 proteins from Streptococcus pyrogenes (P95827), B. subtilis (P39642, O31600, P42112), B. clausii (Q5WAS7), Pseudomonas syringae (Q887F7), Clostridium perfringens (Q46305) and the sugar transporter AraE from B. subtilis (P96710) as an outgroup were used to build the tree. Posterior probability values are shown at each node and the bar represents the expected number of amino acid substitutions per site. The seven protein sequences marked with ∗ were aligned in Figure 5.
Frontiers in Microbiology | www.frontiersin.org 4 October 2015 | Volume 6 | Article 1063
Kroeger et al. Bacillus cereus efflux protein BC3310
Results
BC3310 is Conserved in the B. cereus Group To date, 228 strains of the B. cereus group of bacteria have been sequenced (Markowitz et al., 2012). A BLASTP search showed that the protein BC3310 is highly conserved within this group. In 225 strains BC3310 orthologs with >91% amino acid identity were identified. The predicted ortholog from the reduced genome sized B. cereus cytotoxis NVH 391-98 displayed 88% identity. The two strains (B. anthracis 3154 and B. anthracis A2012) in which no BC3310 ortholog was found are draft genomes which display a gap at the relevant genomic position (data not shown). Orthologs of the BC3310 protein are also found in other bacteria of the order Bacillales including B. subtilis (51% amino acid identity), Listeria innocua (47% amino acid identity), Geobacillus kaustophilus (47% amino acid identity), Lysinibacillus sphaericus (50% amino acid identity), Exiguobacterium sibiricum (39% amino acid identity), Anoxybacillus flavithermus (49% amino acid identity), Macrococcus caseolyticus (42% amino acid identity), Brevibacillus brevis (41% amino acid identity). The phylogenetic relationship of BC3310 to a selection of orthologs is depicted in a dendrogram (Figure 1). BC3310 clusters very closely with orthologous proteins from other B. cereus group members, thus forming a distinct cluster separate from the orthologs of other Bacillales species.
B. cereus �bc3310 is More Susceptible to Ethidium Bromide Compared to the Wild Type To examine the role of BC3310 in conferring drug tolerance in B. cereus ATCC 14579 a microbroth dilution test was conducted comparing the B. cereus wild type to its isogenic markerless knock-out mutant. Growth of the strains in twofold serial dilutions of ten compounds, including antibiotics from different
classes, was tested. The susceptibility of the �bc3310 mutant only differed from the susceptibility of the wild type strain for one of the 10 tested compounds. B. cereus �bc3310 was two times more susceptible to ethidium bromide compared to the wild type (Table 2). It is possible that redundancy among efflux transporters masks the substrate range of the BC3310 transporter or that the transporter is not expressed under the conditions studied. Hence, a heterologous E. coli expression system with a hypersensitive E. coli strain and IPTG-inducible BC3310 expression was used to further investigate possible substrates.
Expression of BC3310 Protein in E. coli The ability of E. coli to heterologously express intact BC3310 protein was investigated. The bc3310 gene was cloned into the expression vector pTTQ18 as described (Saidijam et al., 2006, 2011; Szakonyi et al., 2007). BC3310 was expressed with a C-terminal RGSHis6 tag and detected by Western blotting using an antibody against the RGSHis6 tag (Figure 2). The protein was solubilized from the inner membrane fraction with DDMand purified by affinity chromatography (Figure 2). The major band on the Coomassie stained gel was subjected to Edman degradation and confirmed to contain the first eight predicted amino acids of BC3310. Topology analysis with HMMTOP predicted 12 transmembrane helices in the BC3310 transport protein. Circular dichroism measurements of the purified protein resulted in a spectrum with nodes at 210 and 222 nm (Figure 3), indicating a prevailing α-helical structure (Wallace et al., 2003) and thus confirming the integrity of the heterologously produced protein.
Thereafter the substrate range of heterologously expressed BC3310 was determined. A susceptibility assay was performed using E. coli DH5α �acrAB in which the major multidrug efflux
TABLE 2 | Minimal inhibition concentration (MIC) of E. coli DH5α �acrAB expressing BC3310 (pbc3310) compared to empty vector control (pTTQ18) and Bacillus cereus ATCC 14579 �bc3310 (�bc3310) compared to B. cereus ATCC 14579 (wild type).
MIC [μg ml−1]
E. coli DH5α �acrAB B. cereus ATCC 14579
Compound Empty vector pbc3310 § Wild type �bc3310 §
Apramycin n.d.∗ n.d. 12.5 12.5 1 Chloramphenicol 1.25 1.25 1 3.13 3.13 1
Erythromycin 12.5 12.5 1 0.25 0.25 1
Kanamycin 2.5 2.5 1 12.5 12.5 1
Lincomycin 400 400 1 n.d. n.d.
Nalidixic acid n.d. n.d. 5 5 1
Novobiocin 1.25 1.25 1 n.d. n.d.
Phleomycin n.d. n.d. 50 50 1
Tetracycline 1.25 1.25 1 1.25 1.25 1
Ethidium bromide 3.13 12.5 4 50 25 0.5
SDS 100 400 4 100 100 1
Silver nitrate 1.3 2.7 2 0.43 0.43 1
§represents fold difference between E. coli or B. cereus strains, experiments were conducted at least three times in duplicate. ∗ denotes not determined.
Frontiers in Microbiology | www.frontiersin.org 5 October 2015 | Volume 6 | Article 1063
Kroeger et al. Bacillus cereus efflux protein BC3310
FIGURE 2 | Purification of BC3310-RGSHis6 . BC3310 was expressed with RGS(His)6-tag in E. coli and inner and outer membranes were separated. BC3310-RGSHis6 was solubilized with DDM and purified by immobilized metal affinity chromatography (IMAC). The SDS-PAGE was loaded as follows and stained with Coomassie Blue: (1) molecular weight marker; (2) inner membrane fraction; (3) solubilized protein; (4) unsolubilized protein; (5) flow-through after IMAC binding; (6) eluted protein. (7) Western blot detection of eluted BC3310 protein after affinity chromatography using an antibody to the RGSHis6 epitope.
complex was disrupted. TheMICs of different compounds for the strain expressing BC3310 from pTTQ18 were compared to the MICs for the empty vector control. The E. coli strain expressing BC3310 showed a fourfold higher MIC for ethidium bromide and SDS and a twofold higher MIC for silver nitrate (Table 2).
FIGURE 3 | Circular dichroism analysis of purified BC3310-RGSHis6 protein. The analysis was performed at 1 nm intervals over 270–190 nm with a scan rate of 10 nm min−1. The spectrum represents an averaged accumulation of 20 scans, from which the buffer contribution was subtracted.
FIGURE 4 | Uncoupler-sensitive efflux of ethidium associated with expression of BC3310. Accumulation of ethidium bromide after 30 min was measured in IPTG-induced E. coli DH5α �acrAB host cells either expressing bc3310 (pBC3310, dark gray) or not using an empty vector control (pTTQ18, light gray) without (-CCCP) and with addition of CCCP (+ CCCP). Values are means of four independent experiments and error bars indicate standard deviations, ∗p < 0.01, unpaired Student’s t-test.
Ethidium Bromide Efflux of BC3310 is Disrupted by CCCP Major facilitator superfamily efflux proteins are secondary active transporters that utilize the electrochemical gradient across the cell membrane to extrude compounds. The BC3310 protein sequence displays motifs characteristic of an MFS transporter (see below) and so the ability of BC3310 to confer resistance to ethidium bromide by means of drug efflux was investigated further. A whole cell ethidium bromide accumulation assay with the E. coli DH5α �acrAB strain expressing BC3310 was performed. Ethidium bromide fluoresces upon binding to double-stranded DNA, and the fluorescence intensity correlates with the accumulation of ethidium bromide. The E. coli strain expressing bc3310 (pbc3310) showed less fluorescence compared to the empty vector control (pTTQ18), thereby implying that BC3310 exports ethidium bromide (Figure 4). Addition of the protonophore CCCP led to an increase in fluorescence intensity in the strain expressing bc3310 to approximately the control level (pTTQ18) (Figure 4, dark gray bars). This increase indicates the inability of BC3310 to export ethidium bromide due to the disruption of the electrochemical gradient.
Mutation of the Conserved Aspartic Acid Residue (D105) Abolishes Ethidium Bromide Efflux Proton or substrate translocations by transport proteins often require acidic residues within transmembrane helices (Paulsen et al., 1996a; Edgar and Bibi, 1997; Sanderson et al., 1998;
Frontiers in Microbiology | www.frontiersin.org 6 October 2015 | Volume 6 | Article 1063
Kroeger et al. Bacillus cereus efflux protein BC3310
FIGURE 5 | Multiple sequence alignment of BC3310 and its homologs. BC3310 from B. cereus ATCC 14579 (UniProt accession number: Q81B77) was aligned using MUSCLE with orthologs from Brevibacillus brevis (C0ZL32), Exiguobacterium sibiricum (B1YK36), Listeria innocua (Q92AX8), B. subtilis (O34929), Geobacillus kaustophilus (Q5L2X3) and Halobacillus halophilus (I0JJA0). Shading corresponds to >80% (dark blue), >60% (blue), >40% (light blue), and ≤40% (white) amino acid identity, respectively. The conserved acidic residue in transmembrane region 4 is displayed in red. Transmembrane regions have gray bars under and conserved MFS motifs are depicted above the sequence.
Dang et al., 2010). Sequence alignment of BC3310 with orthologous proteins revealed a conserved acidic residue in putative TMS 4 (Figure 5). In order to investigate the importance of this conserved aspartate residue (D105) for efflux activity, mutational analyses were conducted. Three constructs were made in which the aspartate residue was mutated to glutamate (D105E), asparagine (D105N), or alanine (D105A). The expression of the mutant proteins was detected and quantified by Western blot (Figure 6). This showed that the expression of all mutant proteins was three to four times higher compared to the expression of wild type protein. MIC determination of ethidium bromide and silver nitrate was performed to investigate the functionality of the mutant BC3310 proteins (Table 3). Even though more mutant protein was expressed, the susceptibility of strains expressing mutant BC3310 was reduced to levels approximating those of the empty vector control-strain. Thus, mutational change of the
aspartate residue to another acidic or a structurally similar residue abolished the efflux ability of BC3310 for ethidium bromide and silver nitrate, indicating that both the size and charge of the side chain at position 105 are important for protein function.
BC3310 Belongs to the UMF-2 Family of the MFS BC3310 showed prevailing α-helical structure in our CD analysis and is predicted to be a 12-TMS multidrug transporter belonging to the MFS. Most of the 12 TMS-containing MFS proteins that efflux several drugs are members of the drug:H+ antiporter families DHA1 and DHA3. To determine if BC3310 belongs to one of these families within the MFS, a multiple alignment of sequences orthologous to BC3310 and sequences from the well described DHA1 and DHA3 families was performed. From this alignment a dendrogram was built
Frontiers in Microbiology | www.frontiersin.org 7 October 2015 | Volume 6 | Article 1063
Kroeger et al. Bacillus cereus efflux protein BC3310
FIGURE 6 | Western blot detection of the BC3310 protein and its mutants in Escherichia coli. E. coli DH5α �acrAB was transformed with empty pTTQ18 vector plasmid or pTTQ18 with the indicated insert; wild type BC3310 with his-tag and mutants D105N, D105A, and D105E under an IPTG inducible promoter. The cells were grown and prepared for SDS-PAGE as described in Section “Materials and Methods”. Numbers indicate: (1) empty pTTQ18 vector; (2) BC3310 wild type; (3) D105N mutant; (4) D105A mutant; (5) molecular weight marker; (6) D105E mutant. BC3310 and its mutants migrate at ∼30 kDa.
which showed clustering of BC3310 and orthologs in a distinct clade separate from the DHA1 and DHA3 family proteins included in the analysis (Figure 1). This analysis supported the transporter classification database (TCDB) division of YfkF, the BC3310 ortholog in B. subtilis, into a separate family,
TABLE 3 | Relative expression rate and relative MIC of E. coli strains producing no BC3310, BC3310 wild type, D105N, D105A, or D105E mutant protein.
E. coli DH5α �acrAB producing
Relative expressionb [%]
Relative resistance to [%]a
Ethidium bromide
Silver nitrate
BC3310 wild-type 100 100 100
No BC3310 NAc 20 60
D105N 440 20 50
D105A 330 25 50
D105E 380 30 60
aMICs were determined in E. coli DH5α �acrAB pTTQ18 expressing bc3310 in LB media or LB media without NaCl (for silver nitrate) supplemented with 0,04 mM IPTG and 75 μg ml-1 carbenicillin. baverage of five different Western blots of five different cultures. cNA, not applicable.
the unknown major facilitator family-2 (UMF-2) (Saier et al., 2014).
Transport Proteins within the UMF-2 Family Contain a Variant of the MFS Signature Motif A Sequence alignment revealed that amino acid sequence motifs characteristic for MFS transporters, namely motif A, B, C, and G were conserved in BC3310 and orthologous proteins (Figure 5) (Henderson and Maiden, 1987; Griffith et al., 1992; Paulsen et al., 1996b). Motif A is conserved in the loop region between transmembrane segments (TMS) 2 and 3, and has been called the MFS signature motif due to its conservation across the superfamily. In the majority of MFS transporters, including the DHA1 family proteins, the motif A consensus sequence is G-x-L-a-D-r/k-x-G-r/k-r/k-x- x-I (x indicating any amino acid; capital and lower case letters representing amino acid frequency of >70% and 40– 70%, respectively; Henderson and Maiden, 1987; Griffith et al., 1992; Paulsen et al., 1996b). However, a functional variant of this motif has been described in the Clostridium perfringens DHA3 family tetracycline efflux protein TetA(P): E-x-P-x-x-x- x-x-D-x-x-x-R-K (bold letters overlap with D, r/k,r/k of the canonical motif A) (Bannam et al., 2004). In BC3310 and its orthologs a modified motif A (motif A′) was identified, which represents a hybrid of the canonical motif A and the TetA(P) motif A (Table 4) (Paulsen et al., 1996b; Bannam et al., 2004). The N-terminal sequence of motif A′ in BC3310 orthologs resembles the TetA(P) (DHA3) motif A, with E and P conserved in both motifs, whereas the C-terminal sequence corresponds to the DHA1 motif A. This results in the BC3310 modified motif A′ sequence E-r/k-P-L-x-r/k-x-G-x-r/k-P-x-I (bold letters correspond to sequences of the previously described motif A sequences).
As in other MFS transporters, a second motif A-like sequence is present between TMS 8 and TMS 9 in BC3310 (consensus sequence: G-x-L-S-D-r/k-x-G-R-r/k-x-x-i/l). This sequence coincides more with the signature motif A compared to the motif A′ sequence between TMS 2 and TMS 3 (Henderson and Maiden, 1987; Griffith et al., 1992).
Discussion
Heterologous expression of BC3310 in a drug hypersusceptible E. coli strain increased the tolerance of the bacteria to AgNO3, SDS, and ethidium bromide, indicating that it has a role in resistance to multiple drugs. Whole cell accumulation assays of ethidium bromide in E. coli expressing bc3310 demonstrated CCCP-sensitive efflux of ethidium in the drug hypersusceptible E. coli strain confirming a function as a drug efflux protein. Hence, BC3310 is an energy-dependent multidrug efflux pump. Inactivation of bc3310 in B. cereus ATCC 14579, also resulted in increased susceptibility to ethidium bromide, but not to SDS or AgNO3, suggesting, low basal expression of bc3310 under the conditions used in our experiments. It has, however, previously been reported that addition of 1 mM AgNO3 to exponentially growing cultures of B. cereus ATCC 14579
Frontiers in Microbiology | www.frontiersin.org 8 October 2015 | Volume 6 | Article 1063
Kroeger et al. Bacillus cereus efflux protein BC3310
TABLE 4 | Consensus sequences of motif A variants found in MFS drug export families.
MFS family Consensus sequence of motif A variants
DHA1 G x L a D r/k x G r/k r/k x x I
TetA(P) (DHA3) E x P x x x x x D x x x R K
BC3310 (UMF-2) E r/k P – – – – L x r/k x G x r/k P x I
x indicates any amino acid; capital, and lower case letters represent an amino acid frequency occurrence of >70 and 40–70%, respectively; bold letters indicate an overlap with conserved amino acids of the DHA1 or DHA3 family.
induced expression of bc3310 (Babu et al., 2011) and we detected AgNO3-induced temporal expression of bc3310 by qRT-PCR under our experimental settings (data not shown). Therefore, although BC3310 seems to have a role in transport of Ag+ and/or NO−3 it is not essential in conferring AgNO3 resistance under the conditions tested, but may be important under specific circumstances. B. cereus ATCC 14579 contains 93 genes annotated as drug transporter which corresponds to 1.7% of the protein coding genes in the genome (Saidijam et al., 2006, 2011; Ren et al., 2007). In comparison, B. subtilis and E. coli display 32 and 37 genes encoding drug transport proteins, respectively, which correspond to 0.8 and 0.9% of the protein coding genes (Nishino and Yamaguchi, 2001; Ren et al., 2004). Considering the high number of annotated drug transporter genes in the genome of B. cereus, it is possible that one or more transporters compensate for the loss of BC3310, thereby concealing a potential effect of a gene disruption.
The efflux of ethidium bromide by BC3310 is dependent on a conserved aspartate residue, which could not be replaced by another acidic or hydrophobic amino acid. This indicates an important role of the aspartate residue at position 105 (D105) in the putative TMS 4. This residue is also conserved in BC3310 orthologs. Even though this aspartate residue is not reported to be one of the conserved residues, it falls into the boundaries of motif B. The motif B sequence of BC3310 and orthologs is W-x-x-L-R-x-x-x-G-x-G-D-x which overlaps to a large degree with canonical motif B L-x-x- x-R-x-x-q-G-x-g-a-a (bold letters indicate matching amino acids, underlined letter is D105 in BC3310). Motif B contains an absolutely conserved basic amino acid residue which is proposed to play a role in proton transfer (Paulsen and Skurray, 1993). This residue is also conserved in BC3310 (R98).
Sequence analyses classified BC3310 into the UMF-2 family of the MFS which is distinct from the well characterized drug efflux families DHA1 and DHA3 and consists of previously uncharacterized proteins. We have thus described the first functional data for a member of the UMF-2 family and showed that it includes multidrug efflux proteins. Previously transporters belonging to (at least) five of the 82 different families have been implicated in multidrug efflux. Besides the mentioned DHA1 and DHA3 families with 12 TMS-containing transporters, multidrug efflux proteins have been described for the Organic Cation Transporter family (2.A.1.19) (Koepsell, 2013). In addition, the DHA2 family is known to contain multidrug efflux proteins with 14 TMS (Paulsen et al., 1996b)
and the gene encoding MdrA in Streptomyces coelicolor, classified into the Acriflavin Sensitivity family (2.A.1.36), is regulated by a TetR repressor that recognizes multiple drugs (Hayashi et al., 2013).
Interestingly, BC3310 and its orthologs contain an alternative motif A′ consensus sequence E-r/k-P-L-x-r/k-x-G-x-r/k-P-x-I between putative TMS 2 and 3. We propose that this consensus sequence can be used as a marker to distinguish the UMF- 2 family from other MFS families. The presence of a second motif A in BC3310 is likely due to the duplication of 6 TMS during the evolution of the 12-TMS MFS transporters (Paulsen and Skurray, 1993). Similarly, motif G relates to a duplication of motif C (antiporter motif) (Paulsen et al., 1996b). Motif C is only conserved in exporters and not in importers (Paulsen and Skurray, 1993). This motif is also found with a high similarity (including the functionally important GP dipeptide; De Jesus et al., 2005) in BC3310 and orthologs which is in line with the efflux function of BC3310. Little similarity to MFS motif D2 is observed in the sequence alignment of BC3310 orthologs. As reported previously, motif D2 does not appear to be highly conserved in recently investigated 12-TMS MFS transporters and a function has not yet been assigned (Paulsen et al., 1996b; Kapoor et al., 2009).
The gene encoding the BC3310 transporter is highly conserved in the genomes of the B. cereus group members indicating that bc3310 belongs to the core genome of the B. cereus group. Comparison of the bc3310 genomic region of B. cereus ATCC 14579 with the equivalent regions of selected B. cereus group members, B. cereus ATCC 10987, B. cereus ATCC 10876, B. anthracis Ames Ancestor A2084, B. thuringiensis sv. kurstaki YBT-1520, and B. mycoides ATCC 6462 showed the same gene organization. The different species of the B. cereus group inhabit many different niches and display a high number of efflux transporter genes in the genome compared to other bacteria which could account for the different lifestyles (Saidijam et al., 2006, 2011). Thus, genes conserved in the genomes of the B. cereus group might play a role in the fundamental maintenance of physiological functions. Preliminary phenotypic microarray data using BIOLOG, however, did not reveal significant differences between B. cereus ATCC 14579 wild type and �bc3310 mutant. Condition-dependent transcriptome analyses of the bc3310 ortholog, yfkF, in B. subtilis revealed relatively constant transcriptional activity across the conditions investigated (Nicolas et al., 2012). The highest level of gene expression was observed in cells within stationary (OD600 ∼2)
Frontiers in Microbiology | www.frontiersin.org 9 October 2015 | Volume 6 | Article 1063
Kroeger et al. Bacillus cereus efflux protein BC3310
or transition (OD600 ∼1.4) growth phases in LB medium or LB medium supplemented with glucose as well as on LB agar. Ethanol stress conditions revealed the lowest expression of this gene. Furthermore yfkF is predicted to be under the control of the housekeeping sigma factor SigA (Nicolas et al., 2012). Transcription of genes encoding multidrug transporters with a major role in protecting the cell against toxic compounds is generally activated by transcription factors that recognize toxic compounds or stress signals, such as AcrR, SoxS, MarR, and Rob in the case of AcrAB of E. coli (Ma et al., 1996; Sulavik et al., 2001; Randall and Woodward, 2002; Rosenberg et al., 2003). This fact and the minor intrinsic susceptibility against toxic compounds in the B. cereus �bc3310 deletion mutant indicate that BC3310 is not a potent multidrug transporter with a main role in protecting the cell against toxic xenobiotics. It rather hints to an ancient and maybe general function in the normal physiology of the B. cereus group of bacteria. To further elucidate the role of this transporter the inactivation of other efflux proteins might be required.
Taken together, we have performed the first phylogenetic and functional characterization of a member of the UMF-2. The amino acid sequence of BC3310 comprises known motifs of the 12-TMS MFS transporters with a modified motif A′ between TMS 2 and TMS 3. BC3310 is a multidrug transporter with confirmed predominant α-helical structure. It confers resistance to ethidium bromide, SDS, and silver nitrate when expressed in E. coli. The export of ethidium bromide is energy dependent and requires a conserved aspartate residue in TMS 4. The
deletion of bc3310 in B. cereus resulted in increased susceptibility to ethidium bromide under the conditions tested. The high conservation of bc3310 within the B. cereus group genomes indicates that it is part of the core genome. We hypothesize that the intrinsic role of BC3310 is not as a typical multidrug transporter, but rather as an important component in the normal physiology of the bacteria, under conditions that still remain to be identified.
Acknowledgments
This research was funded by the Norwegian Research Council (FUGE II Program, Project ID 183421). Collaborations between AK, JK, and AB are funded by the Deutscher Akademischer Austauschdienst Project ID 54564495 (DAAD) and the Norwegian Research Council. Financial support for this research in the PJFH laboratory was provided by grant agreement N◦ HEALTH-F4-2007-201924, European Drug Initiative for Channels and Transporters (EDICT) and by European Membrane Protein Consortium contract LSGH-CT- 2004-504601 (EMeP). Consortium Collaborations between the three laboratories (AK, PH, IP) are funded by the EU BacMT, EDICT, and ATENS initiatives. We thank Ewa Jaroszewicz for valuable technical assistance, as well as Prof. Kern and Sabine Schuster for providing the opportunity and help during fluorescence measurements.
References
Ash, C., Farrow, J. A., Dorsch, M., Stackebrandt, E., and Collins, M. D. (1991). Comparative analysis of Bacillus anthracis, Bacillus cereus, and related species on the basis of reverse transcriptase sequencing of 16S rRNA. Int. J. Syst. Bacteriol. 41, 343–346.
Babu, M. M., Sridhar, J., and Gunasekaran, P. (2011). Global transcriptome analysis of Bacillus cereus ATCC 14579 in response to silver nitrate stress. J. Nanobiotechnol. 9, 49. doi: 10.1186/1477-3155-9-49
Bannam, T. L., Johanesen, P. A., Salvado, C. L., Pidot, S. J., Farrow, K. A., and Rood, J. I. (2004). The Clostridium perfringens TetA(P) efflux protein contains a functional variant of the Motif A region found in major facilitator superfamily transport proteins.Microbiology 150, 127–134. doi: 10.1099/mic.0.2 6614-0
Berg, G., Eberl, L., and Hartmann, A. (2005). The rhizosphere as a reservoir for opportunistic human pathogenic bacteria. Environ. Microbiol. 7, 1673–1685. doi: 10.1111/j.1462-2920.2005.00891.x
Bottone, E. J. (2010). Bacillus cereus, a volatile human pathogen. Clin. Microbiol. Rev. 23, 382–398. doi: 10.1128/CMR.00073-09
Callegan, M. C., Booth, M. C., Jett, B. D., and Gilmore, M. S. (1999). Pathogenesis of gram-positive bacterial endophthalmitis. Infect. Immun. 67, 3348–3356.
Callegan, M. C., Cochran, D. C., Kane, S. T., Ramadan, R. T., Chodosh, J., Mclean, C., et al. (2006). Virulence factor profiles and antimicrobial susceptibilities of ocular Bacillus isolates. Curr. Eye Res. 31, 693–702. doi: 10.1080/02713680600850963
Centers for Disease Control and Prevention (2005) Outbreak of cutaneous Bacillus cereus infections among cadets in a university military program–Georgia, August 2004.MMWRMorb. Mortal. Wkly. Rep. 54, 1233–1235.
Dang, S., Sun, L., Huang, Y., Lu, F., Liu, Y., Gong, H., et al. (2010). Structure of a fucose transporter in an outward-open conformation. Nature 467, 734–738. doi: 10.1038/nature09406
De Jesus, M., Jin, J., Guffanti, A. A., and Krulwich, T. A. (2005). Importance of the GP dipeptide of the antiporter motif and other membrane-embedded
proline and glycine residues in tetracycline efflux protein Tet(L). Biochemistry 44, 12896–12904. doi: 10.1021/bi050762c
Edgar, R., and Bibi, E. (1997). MdfA, an Escherichia coli multidrug resistance protein with an extraordinarily broad spectrum of drug recognition. J. Bacteriol. 179, 2274–2280.
Griffith, J. K., Baker, M. E., Rouch, D. A., Page, M. G., Skurray, R. A., Paulsen, I. T., et al. (1992). Membrane transport proteins: implications of sequence comparisons. Curr. Opin. Cell Biol. 4, 684–695. doi: 10.1016/0955- 0674(92)90090-Y
Guinebretiere, M. H., Auger, S., Galleron, N., Contzen, M., De Sarrau, B., De Buyser, M. L., et al. (2013). Bacillus cytotoxicus sp. nov. is a novel thermotolerant species of the Bacillus cereusGroup occasionally associated with food poisoning. Int. J. Syst. Evol. Microbiol. 63, 31–40. doi: 10.1099/ijs.0.03 0627-0
Hassan, K. A., Liu, Q., Henderson, P. J., and Paulsen, I. T. (2015). Homologs of the Acinetobacter baumannii AceI transporter represent a new family of bacterial multidrug efflux systems. MBio 6:e01982-14. doi: 10.1128/mBio.0 1982-14
Hayashi, T., Tanaka, Y., Sakai, N., Okada, U., Yao, M., Watanabe, N., et al. (2013). SCO4008, a putative TetR transcriptional repressor from Streptomyces coelicolor A3(2), regulates transcription of sco4007 by multidrug recognition. J. Mol. Biol. 425, 3289–3300. doi: 10.1016/j.jmb.2013.06.013
Henderson, P. J. F., and Maiden, M. C. J. (1987). Sugars, antibiotics, microbes and men. Trends Genet. 3, 62–64. doi: 10.1016/0168-9525(87)90174-0
Janes, B. K., and Stibitz, S. (2006). Routine markerless gene replacement in Bacillus anthracis. Infect. Immun. 74, 1949–1953. doi: 10.1128/IAI.74.3.1949-1953.2006
Jensen, G. B., Hansen, B. M., Eilenberg, J., and Mahillon, J. (2003). The hidden lifestyles of Bacillus cereus and relatives. Environ. Microbiol. 5, 631–640. doi: 10.1046/j.1462-2920.2003.00461.x
Kapoor, K., Rehan, M., Kaushiki, A., Pasrija, R., Lynn, A. M., and Prasad, R. (2009). Rational mutational analysis of a multidrug MFS transporter CaMdr1p of Candida albicans by employing amembrane environment based computational approach. PLoS Comput. Biol. 5:e1000624. doi: 10.1371/journal.pcbi.1000624
Frontiers in Microbiology | www.frontiersin.org 10 October 2015 | Volume 6 | Article 1063
Kroeger et al. Bacillus cereus efflux protein BC3310
Kervick, G. N., Flynn, H. W. Jr., Alfonso, E., and Miller, D. (1990). Antibiotic therapy for Bacillus species infections. Am. J. Ophthalmol. 110, 683–687. doi: 10.1016/S0002-9394(14)77068-0
Kim, J. B., Jeong, H. R., Park, Y. B., Kim, J. M., and Oh, D. H. (2010). Food poisoning associated with emetic-type of Bacillus cereus in Korea. Foodborne Pathog. Dis. 7, 555–563. doi: 10.1089/fpd.2009.0443
Kiyomizu, K., Yagi, T., Yoshida, H., Minami, R., Tanimura, A., Karasuno, T., et al. (2008). Fulminant septicemia of Bacillus cereus resistant to carbapenem in a patient with biphenotypic acute leukemia. J. Infect. Chemother. 14, 361–367. doi: 10.1007/s10156-008-0627-y
Koepsell, H. (2013). The SLC22 family with transporters of organic cations, anions and zwitterions. Mol. Aspects Med. 34, 413–435. doi: 10.1016/j.mam.2012.10.010
Kolsto, A. B., Tourasse, N. J., and Okstad, O. A. (2009).What sets Bacillus anthracis apart from other Bacillus species? Annu. Rev. Microbiol. 63, 451–476. doi: 10.1146/annurev.micro.091208.073255
Li, M. Z., and Elledge, S. J. (2007). Harnessing homologous recombination in vitro to generate recombinant DNA via SLIC. Nat. Methods 4, 251–256. doi: 10.1038/nmeth1010
Ma, D., Alberti, M., Lynch, C., Nikaido, H., and Hearst, J. E. (1996). The local repressor AcrR plays a modulating role in the regulation of acrAB genes of Escherichia coli by global stress signals. Mol. Microbiol. 19, 101–112. doi: 10.1046/j.1365-2958.1996.357881.x
Markowitz, V. M., Chen, I. M., Palaniappan, K., Chu, K., Szeto, E., Grechkin, Y., et al. (2012). IMG: the integrated microbial genomes database and comparative analysis system. Nucleic Acids Res. 40, D115–D122. doi: 10.1093/nar/gk r1044
Martinez, M. F., Haines, T., Waller, M., Tingey, D., and Gomez, W. (2007). Probable occupational endophthalmitis from Bacillus cereus. Arch. Environ. Occup. Health 62, 157–160. doi: 10.3200/AEOH.62.3.1 57-160
Matsuda, S., Kirishima, T., Okamoto, N., Hisano, Y., Takai, K., Motoyoshi, T., et al. (2014). Bacillus cereus septicemia and necrotizing fasciitis in a patient with liver cirrhosis: a case report. Nihon Shokakibyo Gakkai Zasshi 111, 2013–2020.
Melo, A. L., Soccol, V. T., and Soccol, C. R. (2014). Bacillus thuringiensis: mechanism of action, resistance, and new applications: a review. Crit. Rev. Biotechnol. 1–10. doi: 10.3109/07388551.2014.960793 [Epub ahead of print].
Mock, M., and Fouet, A. (2001). Anthrax. Annu. Rev. Microbiol. 55, 647–671. doi: 10.1146/annurev.micro.55.1.647
Nicolas, P., Mader, U., Dervyn, E., Rochat, T., Leduc, A., Pigeonneau, N., et al. (2012). Condition-dependent transcriptome reveals high-level regulatory architecture in Bacillus subtilis. Science 335, 1103–1106. doi: 10.1126/science.1206848
Nishino, K., and Yamaguchi, A. (2001). Analysis of a complete library of putative drug transporter genes in Escherichia coli. J. Bacteriol. 183, 5803–5812. doi: 10.1128/JB.183.20.5803-5812.2001
Pao, S. S., Paulsen, I. T., and Saier, M. H. Jr. (1998). Major facilitator superfamily. Microbiol. Mol. Biol. Rev. 62, 1–34.
Paulsen, I. T., Brown, M. H., Littlejohn, T. G., Mitchell, B. A., and Skurray, R. A. (1996a). Multidrug resistance proteins QacA and QacB from Staphylococcus aureus: membrane topology and identification of residues involved in substrate specificity. Proc. Natl. Acad. Sci. U.S.A. 93, 3630–3635. doi: 10.1073/pnas.93.8.3630
Paulsen, I. T., Brown, M. H., and Skurray, R. A. (1996b). Proton-dependent multidrug efflux systems.Microbiol. Rev. 60, 575–608.
Paulsen, I. T., and Skurray, R. A. (1993). Topology, structure and evolution of two families of proteins involved in antibiotic and antiseptic resistance in eukaryotes and prokaryotes–an analysis. Gene 124, 1–11. doi: 10.1016/0378- 1119(93)90755-R
Poole, K. (2007). Efflux pumps as antimicrobial resistance mechanisms. Ann. Med. 39, 162–176. doi: 10.1080/07853890701195262
Randall, L. P., and Woodward, M. J. (2002). The multiple antibiotic resistance (mar) locus and its significance. Res. Vet. Sci. 72, 87–93. doi: 10.1053/rvsc.2001.0537
Reddy, V. S., Shlykov, M. A., Castillo, R., Sun, E. I., and Saier, M. H. Jr. (2012). The major facilitator superfamily (MFS) revisited. FEBS J. 279, 2022–2035. doi: 10.1111/j.1742-4658.2012.08588.x
Ren, Q., Chen, K., and Paulsen, I. T. (2007). TransportDB: a comprehensive database resource for cytoplasmic membrane transport systems and outer membrane channels. Nucleic Acids Res. 35, D274–D279. doi: 10.1093/nar/gkl925
Ren, Q., Kang, K. H., and Paulsen, I. T. (2004). TransportDB: a relational database of cellular membrane transport systems.Nucleic Acids Res. 32, D284–D288. doi: 10.1093/nar/gkh016
Ren, Q., and Paulsen, I. T. (2007). Large-scale comparative genomic analyses of cytoplasmic membrane transport systems in prokaryotes. J. Mol. Microbiol. Biotechnol. 12, 165–179. doi: 10.1159/000099639
Ronquist, F., Teslenko, M., Van Der Mark, P., Ayres, D. L., Darling, A., Hohna, S., et al. (2012). MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across a large model space. Syst. Biol. 61, 539–542. doi: 10.1093/sysbio/sys029
Rosenberg, E. Y., Bertenthal, D., Nilles, M. L., Bertrand, K. P., and Nikaido, H. (2003). Bile salts and fatty acids induce the expression of Escherichia coli AcrAB multidrug efflux pump through their interaction with Rob regulatory protein. Mol. Microbiol. 48, 1609–1619. doi: 10.1046/j.1365-2958.2003.0 3531.x
Saidijam, M., Benedetti, G., Ren, Q., Xu, Z., Hoyle, C. J., Palmer, S. L., et al. (2006). Microbial drug efflux proteins of the major facilitator superfamily. Curr. Drug Targets 7, 793–811. doi: 10.2174/138945006777709575
Saidijam, M., Bettaney, K. E., Leng, D., Ma, P., Xu, Z., Keen, J. N., et al. (2011). The MFS efflux proteins of gram-positive and gram-negative bacteria. Adv. Enzymol. Relat. Areas Mol. Biol. 77, 147–166.
Saier, M. H. Jr., Beatty, J. T., Goffeau, A., Harley, K. T., Heijne,W. H., Huang, S. C., et al. (1999). The major facilitator superfamily. J. Mol. Microbiol. Biotechnol. 1, 257–279.
Saier, M. H. Jr., Reddy, V. S., Tamang, D. G., and Vastermark, A. (2014). The transporter classification database. Nucleic Acids Res. 42, D251–D258. doi: 10.1093/nar/gkt1097
Sambrook, J., and Russell, D. W. (2001).Molecular Cloning: A Laboratory Manual. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory Press.
Sanderson, N. M., Qi, D., Steel, A., and Henderson, P. J. (1998). Effect of the D32N and N300F mutations on the activity of the bacterial sugar transport protein, GalP. Biochem. Soc. Trans. 26, S306. doi: 10.1042/bst026s306
Sasahara, T., Hayashi, S., Morisawa, Y., Sakihama, T., Yoshimura, A., and Hirai, Y. (2011). Bacillus cereus bacteremia outbreak due to contaminated hospital linens. Eur. J. Clin. Microbiol. Infect. Dis. 30, 219–226. doi: 10.1007/s10096-010- 1072-2
Savini, V., Favaro, M., Fontana, C., Catavitello, C., Balbinot, A., Talia, M., et al. (2009). Bacillus cereus heteroresistance to carbapenems in a cancer patient. J. Hosp. Infect. 71, 288–290. doi: 10.1016/j.jhin.2008.11.002
Simm, R., Voros, A., Ekman, J. V., Sodring, M., Nes, I., Kroeger, J. K., et al. (2012). BC4707 is a major facilitator superfamily multidrug resistance transport protein from Bacillus cereus implicated in fluoroquinolone tolerance. PLoS ONE 7:e36720. doi: 10.1371/journal.pone.0036720
Steen, M. K., Bruno-Murtha, L. A., Chaux, G., Lazar, H., Bernard, S., and Sulis, C. (1992).Bacillus cereus endocarditis: report of a case and review.Clin. Infect. Dis. 14, 945–946. doi: 10.1093/clinids/14.4.945
Stevens,M. P., Elam, K., and Bearman, G. (2012). Meningitis due to Bacillus cereus: a case report and review of the literature. Can. J. Infect. Dis. Med. Microbiol. 23, e16–e19.
Sulavik, M. C., Houseweart, C., Cramer, C., Jiwani, N., Murgolo, N., Greene, J., et al. (2001). Antibiotic susceptibility profiles of Escherichia coli strains lacking multidrug efflux pump genes. Antimicrob. Agents Chemother. 45, 1126–1136. doi: 10.1128/AAC.45.4.1126-1136.2001
Sun, J., Deng, Z., and Yan, A. (2014). Bacterial multidrug efflux pumps: mechanisms, physiology and pharmacological exploitations. Biochem. Biophys. Res. Commun. 453, 254–267. doi: 10.1016/j.bbrc.201 4.05.090
Szakonyi, G., Leng, D., Ma, P., Bettaney, K. E., Saidijam, M., Ward, A., et al. (2007). A genomic strategy for cloning, expressing and purifying efflux proteins of the major facilitator superfamily. J. Antimicrob. Chemother. 59, 1265–1270. doi: 10.1093/jac/dkm036
Tamura, K., Stecher, G., Peterson, D., Filipski, A., and Kumar, S. (2013). MEGA6: molecular evolutionary genetics analysis version 6.0. Mol. Biol. Evol. 30, 2725– 2729. doi: 10.1093/molbev/mst197
Frontiers in Microbiology | www.frontiersin.org 11 October 2015 | Volume 6 | Article 1063
Kroeger et al. Bacillus cereus efflux protein BC3310
Tusnady, G. E., and Simon, I. (2001). The HMMTOP transmembrane topology prediction server. Bioinformatics 17, 849–850. doi: 10.1093/bioinformatics/17.9.849
Uchino, Y., Iriyama, N., Matsumoto, K., Hirabayashi, Y., Miura, K., Kurita, D., et al. (2012). A case series of Bacillus cereus septicemia in patients with hematological disease. Intern. Med. 51, 2733–2738. doi: 10.2169/internalmedicine.51.7258
Voros, A., Simm, R., Kroeger, J. K., and Kolsto, A. B. (2013). Gene transcription from the linear plasmid pBClin15 leads to cell lysis and extracellular DNA- dependent aggregation ofBacillus cereusATCC14579 in response to quinolone- induced stress.Microbiology 159, 2283–2293. doi: 10.1099/mic.0.069674-0
Wallace, B. A., Lees, J. G., Orry, A. J., Lobley, A., and Janes, R. W. (2003). Analyses of circular dichroism spectra of membrane proteins. Protein Sci. 12, 875–884. doi: 10.1110/ps.0229603
Ward, A., Sanderson, N. M., O’reilly, J., Rutherford, N. G., Poolman, B., and Henderson, P. J. F. (2000). “The amplified expression, identification,
purification, assay and properties of histidine-tagged bacterial membrane transport proteins,” in Membrane Transport – A Practical Approach, ed. S. A. Baldwin (Oxford: Blackwell Press), 141–166.
Conflict of Interest Statement: The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Copyright © 2015 Kroeger, Hassan, Vörös, Simm, Saidijam, Bettaney, Bechthold, Paulsen, Henderson and Kolstø. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.
Frontiers in Microbiology | www.frontiersin.org 12 October 2015 | Volume 6 | Article 1063
- Bacillus cereus efflux protein BC3310 – a multidrug transporter of the unknown major facilitator family, UMF-2
- Introduction
- Materials and Methods
- Bioinformatics Analyses
- Construction of B. cereus bc3310 Deletion Mutant
- Escherichia coli BC3310 Expression Constructs
- MIC Tests
- Ethidium Bromide Accumulation Assay
- Heterologous Expression of BC3310 and Its Mutants with (His)6-tag and Western Blot
- Purification of the BC3310 Protein by Affinity Chromatography
- Circular Dichroism Measurement
- Results
- BC3310 is Conserved in the B. cereus Group
- B. cereus bc3310 is More Susceptible to Ethidium Bromide Compared to the Wild Type
- Expression of BC3310 Protein in E. coli
- Ethidium Bromide Efflux of BC3310 is Disrupted by CCCP
- Mutation of the Conserved Aspartic Acid Residue (D105) Abolishes Ethidium Bromide Efflux
- BC3310 Belongs to the UMF-2 Family of the MFS
- Transport Proteins within the UMF-2 Family Contain a Variant of the MFS Signature Motif A
- Discussion
- Acknowledgments
- References
mge_a4_study_q1.pdf
Geophys. Res. Lett. 16, 703 (1989). 71. D. Kley et al., in Global and Regional Environmen-
tal Atmospheric Chemistry: Proceedings of the International Conference on Global and Regional Environmental Atmospheric Chemistry (Depart- ment of Energy Conference 890525, 1989, avail- able from the National Technical Information Ser- vice, Springfield, VA), p. 9.
72. D. Rind, R. Suozzo, N. K. Balanchandran, M. J. Prather, J. Atmos. Sci. 47, 475 (1990).
73. K. B. Hogan, J. S. Hoffman, A. M. Thompson, Nature 354, 181 (1991); A. M. Thompson, K. B. Hogan, J. S. Hoffman, Atmos. Environ., in press.
74. C. S. Atherton and J. E. Penner, J. Geophys. Res. 95,14027 (1990).
75. I. S. A. lsaksen, T. Bemtsen, S. Solberg, in Ozone in the Atmosphere, R. D. Bojkov and P. Fabian, Eds. (A. Deepak, Hampton, VA, 1989), pp. 576-579.
76. M. J. Prather, Ed., "An assessment model for
atmospheric composition" (NASA Conf. Publ. 3023, NASA, Washington, DC, 1989).
77. S. Madronich and C. Granier, Geophys. Res. Lett. 19, 465 (1992).
78. A. M. Thompson, J. Geophys. Res. 89, 1341 (1984); S. Madronich, ibid. 92, 9740 (1987).
79. S. A. Penkett and K. A. Brice, ibid. 319, 655 (1986).
80. J. A. Logan, J. Geophys. Res. 90,10463 (1985). An update for the North American data is in J. A. Logan, in Tropospheric Ozone, I. S. A. lsaksen, Ed. (North Atlantic Treaty Organization Advanced Study Institutes, Reidel, Dordrecht, Holland, 1988), pp. 327-344.
81. Locations of sites: Barrow (710N, 157W; Mauna Loa (19.5°N, 156W); Samoa (140S, 171°W); South Pole (90°S, 0). See (36); S. J. Oltmans and W. D. Komhyr, J. Geophys. Res. 91, 5229 (1986).
82. K. M. Valentin, thesis, Johannes-Gutenburg Uni-
versity, Mainz (1990). 83. P. J. Crutzen and P. H. Zimmermann, Tellus Ser. B
43, 136 (1991). 84. The following people have been generous with
reports of recent work: C. Bruhl, J. Fishman, I. S. A. lsaksen, M. Kanakidou, M. A. K. Khalil, K. Law, Y. Lu, A. Neftel, J. Pinto, M. Prather, and R. Prinn. M. Kanakidou, J. Logan, and W. Stockwell made helpful comments on the manuscript. Some of the model comparisons (Tables 1 and 2) grew out of the United Nations Environmental Programme- World Meteorological Organization Ozone Assess- ment Group Workshop (London, June 1991) and a North Atlantic Treaty Organization Advanced Re- search Workshop on Methane (Mt. Hood, Oregon, October 1991). My research on oxidizing changes is supported by NASA Programs in Earth Observ- ing Systems and Troposphenc Chemistry and by the U.S. Environmental Protection Agency.
Molecular Epidemiology of HIV Transmission in a Dental Practice
Chin-Yih Ou, Carol A. Ciesielski, Gerald Myers, Claudiu 1. Bandea, Chi-Cheng Luo, Bette T. M. Korber,
James 1. Mullins, Gerald Schochetman, Ruth L. Berkelman, A. Nikki Economou, John J. Witte, Lawrence J. Furman, Glen A. Satten, Kersti A. Macinnes, James W. Curran,
Harold W. Jaffe, Laboratory Investigation Group,* Epidemiologic Investigation Groupt
Human immunodeficiency virus type 1 (HIV-1) transmission from infected patients to health-care workers has been well documented, but transmission from an infected health- care worker to a patient has not been reported. After identification of an acquired immu- nodeficiency syndrome (AIDS) patient who had no known risk factors for HIV infection but who had undergone an invasive procedure performed by a dentist with AIDS, six other patients of this dentist were found to be HIV-infected. Molecular biologic studies were conducted to complement the epidemiologic investigation. Portions of the HIV proviral envelope gene from each of the seven patients, the dentist, and 35 HIV-infected persons from the local geographic area were amplified by polymerase chain reaction and se- quenced. Three separate comparative genetic analyses-genetic distance measure- ments, phylogenetic tree analysis, and amino acid signature pattern analysis-showed that the viruses from the dentist and five dental patients were closely related. These data, togetherwith the epidemiologic investigation, indicated thatthese patients became infected with HIV while receiving care from a dentist with AIDS.
Epidemiologic Investigation
In July 1990, we reported that a young woman with AIDS (patient A) had most likely acquired her HIV-1 infection while undergoing invasive dental procedures by a Florida dentist with AIDS (4). Following publication of the report, the dentist pub- licly requested that his former patients be tested for HIV infection. Among approxi- mately 1100 persons whose blood was tested by the Florida Department of Health and Rehabilitative Services (HRS), two pa- tients (patients B and C) were found to be HIV-positive. An additional infected pa- tient (patient D) was ascertained by HRS through cross matching a list of the dentist's former patients with the Florida AIDS case registry. Two other patients of the dentist (patients E and G) contacted the Centers for Disease Control (CDC) to report that they were HIV-infected. A former sex part- ner named by patient E was found to be HIV-infected and had also been a patient of the dentist (patient F). Characteristics of these seven infected patients and the den- tist are included in Table 1.
Patient D had previously been reported
Lcreasingly, molecular biologic tech- niques have been used to study the epide- miology of infectious diseases. For viral infections of humans, techniques to analyze viral genetic sequence information, such as oligonucleotide fingerprinting of RNA ge- nomes with ribonuclease, mapping ofDNA genomes with restriction endonucleases, and genomic sequencing, have been used to study viral transmissions from person to person, within communities, and between countries (1). Requisite to such studies is the existence of viral genetic variation; the greater the variation, the greater the power of the methods to distinguish strains of the virus. For a virus with substantial genomic variation, identification of strains with a
high degree of genetic relatedness may im- ply an epidemiologic linkage between per- sons infected with these strains.
The human immunodeficiency virus (HIV) has a high mutation rate (2, 3), such that HIVs from different individuals are found to be genetically distinct (3). In this article, we describe the use of genomic sequencing to investigate a cluster of HIV infections in a Florida dental practice. The high degree of genetic relatedness observed among the HIV strains from a dentist with acquired immuno- deficiency syndrome (AIDS) and five of his infected patients supports the epidemiologic investigation that indicated that these pa- tients became infected with HIV while receiv- ing dental care.
SCIENCE * VOL. 256 * 22 MAY 1992
C.-Y. Ou, C. A. Ciesielski, C. I. Bandea, C.-C. Luo, G. Schochetman, R. L. Berkelman, G. A. Satten, J. W. Curran, and H. W. Jaffe are in Division of HIV/AIDS, National Center for Infectious Diseases, Centers for Disease Control, Atlanta, GA 30333. G. Myers, B. T. M. Korber, and K. A. Maclnnes are in the Theoretical Division, Los Alamos National Laboratory, Los Alamos, NM 87545. J. I. Mullins is in the Department of Microbiology and Immunology, Stanford University School of Medicine, Stanford, CA 94305. A. N. Econ- omou and J. J. Wifte are in the Florida Department of Health and Rehabilitative Services, Tallahassee, FL 32399. L. J. Furman is in the Division of Oral Health, National Center for Prevention Services, Centers for Disease Control, Atlanta, GA 30333. *J. Moore, Y. Villamarzo, and C. Schable, Division of HIV/AIDS and E. G. Shpaer, Department of Microbiol- ogy and Immunology, Stanford University School of Medicine. tT. Liberti and S. Lieb, Florida Department of Health and Rehabilitative Services (HRS); R. Scott, J. Howell, R. Dumbaugh, A. Lasch, Florida HRS District 9; B. Kroesen and L. Ryan, Martin County Public Health Unit, Florida HRS; K. Bell, V. Munn, D. Marianos, and B. Gooch, Centers for Disease Control.
1165
mcmmcmoRmgmmmmmmgmRRQmmmmn ummnnmmmopmummRRmmqgommnmmcmomcmmmoomcgmmngmmcmm wwwwwwwwwwwl mmmomom
o n
O ct
ob er
2 0,
2 01
0 w
w w
.s ci
en ce
m ag
.o rg
D ow
nl oa
de d
fr om
to HRS as having behavioral risks for HIV infection. To establish any risk factors for exposure to HIV for the remaining six patients, follow-up investigations were con- ducted (5). These investigations included interviews with the patients and their fam- ilies and friends; review of medical, dental, and health department records; interviews with health-care providers; and testing of the patients' sex partners for HIV infection. Interviews and medical records established that patient F also had behavioral risk factors for HIV infection. The other five patients (patients A, B, C, E, and G) denied injecting drug use since 1978 and had no history of transfusion or receipt of blood products; the two male patients (pa- tients C and G) denied having had sex with men. The possibility that patient C had engaged in high-risk behaviors was raised during the epidemiologic investigation; however, behavioral exposures to HIV could not be documented.
Only one of the known sex partners of these five patients tested positive for HIV infection. This person (patient F) had been an infrequent sex partner of patient E from 1987 until the fall of 1988. Patient E was first tested for HIV infection in October 1988 and was seropositive; patient F had been tested in October and December 1988 and was seronegative. In September 1989, approximately 1 year after his last sexual contact with patient E and his last reported dental visit, patient F had an illness com- patible with an acute retroviral infection; he first tested positive for HIV in December 1990. Thus, patients E and F appeared to have contracted their HIV infections from different sources.
The dentist was diagnosed with symp- tomatic HIV infection in late 1986 and with AIDS in September 1987, when a biopsy of his palate showed Kaposi's sarco- ma and his CD4+ lymphocyte count was less than 200 per microliter. He continued to practice general dentistry for approxi- mately 2 years after he was diagnosed with AIDS. During this 2-year period, each of the five patients without confirmed expo- sures to HIV made multiple visits to the dental office for invasive procedures, in- cluding extractions or root canal therapy.
HIV Genetic Variafion
Because the epidemiologic findings suggest- ed that transmission may have occurred in the dental practice, we conducted a labora- tory investigation to determine whether there was evidence of genetic similarity among the viruses infecting the dentist and his patients. HIV is known to undergo genetic change or variation during its life cycle resulting in a myriad of related viral progenies (commonly called quasi-species)
1166
(6). Several factors, including duration of infection (7), host immune pressure (8), disease stage (9), and therapy (10), may contribute to the degree and rate of HIV genetic variation. HIV strains from persons with a known common infection link, for example, sex partners (1 1), mothers and their infants (11, 12), blood donors and recipients (13), and hemophilic men re- ceiving common lots of contaminated blood products (2, 14), have been shown to exhibit a closer genetic relatedness than HIV strains from persons without a direct transmission link. Thus, we used the degree of genetic similarity, in combination with epidemiologic information, to evaluate pos- sible HIV transmission linkage.
Analysis of HIV-1 genetic variation in- volves comparison of multiple sequences covering a region of the viral genome. Among the structural genes of HIV, the envelope gene (env) exhibits the highest degree of genetic diversity. The distribution of genetic diversity in env is not uniform as evidenced by the presence of interspersed conserved (C) and variable (V) domains in the extemal glycoprotein gp120. We fo- cused most of our analyses on the C2 and V3 domains because (i) these domains con- tain nucleotide sequences with sufficient variability to distinguish between strains, a feature essential for establishing HIV trans- mission linkage, (ii) C2-V3 sequences have been used in previous studies of epidemio- logically linked infections (2, 11, 12, 14), and (iii) the HIV Sequence Database (3) contains a relative abundance of C2-V3 sequences for comparative purposes.
Blood specimens from the dentist, pa- tients A through G, and 35 local HIV- seropositive persons (local controls or LCs)
were collected between March 1990 and April 1991. Local control specimens were collected from two HIV clinics located within 90 miles of the dental practice. Of the 35 LCs, 7 did not have symptoms related to their HIV infection, 11 were symptomatic but had not developed AIDS, and 17 had AIDS. DNA fiagments of approximately 680
base pairs containing the C2, V3, V4, C3, and V5 domains of the gpl20 gene were amplified by a two-step polymerase chain reaction (PCR) procedure (15, 16) on DNA from peripheral blood mononuclear cells (PBMCs) of the dentist and the seven pa- tients. The resulting amplified DNA prod- ucts were sequenced directly or cloned into an M13 vector and sequenced (15). Care was taken to prevent DNA carryover during the PCR procedure (15, 17), a problem that has been previously reported (18, 19). We also took measures to facilitate the manage- ment and identification of the source of specimens (15). The initial results were ver- ified by repeating the PCR amplification procedure with a second vial ofPBMCs from either the first blood collection (the dentist and patients D and E) or a second blood collection (patients A, B, C, F, and G); products from the second round of amplifi- cation were sequenced directly (15). In ad- dition, HIV sequences from patients A and B and one LC were independently verified by another laboratory (20).
The Dental Group
To assess the genetic relatedness between the HIV strains infecting the dentist and his seven patients, multiple C2-V3 se- quences (Table 1) as well as V4-C3-V5
Table 1. Dental cohort clinical information and HIV nucleotide variation in the C2-V3 domain of the envelope gene.
Known M13 Intraperson Interperson variationt (%) Person Sex risk Clinical status* clones variationt
factor (no.) (%) To dentist To 30 LCst
Dentist M Yes AIDS 6 3.3 (0.8-5.4) 11.0 (5.8-16.0) Patient A F No AIDS 6 2.0 (0.0-4.5) 3.4 (0.8-6.2) 10.9 (5.4-14.8) Patient B F No Asymptomatic 12 1.9 (0.4-3.7) 4.4 (2.1-7.0) 11.2 (6.2-16.5)
(CD4 = 222/LI) Patient C M No§ Asymptomatic 5 1.2 (0.4-1.6) 3.4 (2.1-4.9) 11.1 (7.0-15.6)
(CD4 = <50/il) Patient E F No Asymptomatic 6 2.1 (0.4-3.7) 3.4 (1.2-6.6) 10.8 (5.8-14.8)
(CD4 = 567/Jl) Patient G M No Asymptomatic 5 2.8 (1.6-3.7) 4.9 (2.9-7.0) 11.8 (6.2-16.9)
(CD4 = 400/4LI) Patient D M Yes AIDS 5 7.5 (0.0-9.9) 13.6 (11.5-15.6) 13.1 (7.8-17.3) Patient F M Yes Asymptomatic 6 3.0 (0.8-5.8) 10.7 (8.2-13.6) 11.9 (7.0-17.3)
(CD4 = 253/ul) *Clinical status at the time of specimen collection. CD4 is the CD4+ lymphocyte count tSequence alignment over 243 nucleotide positions in C2-V3 was obtained with the program PIMA (37) follwed by manual refinement with MASE (3). Subsequently, all M13 clone sequences were compared to each other and to direct sequences (15) of PCR-amplified products using the SIMILARITY function of MASE. Only single nucleotide differences are scored; gaps were not scored. The average percentages of differences are shown with the range of values in parentheses. tSequences from five of the LCs were shorter than 243 nucleotides and were not included in this analysis. §Possible risk factors for HIV infection were suggested but not documented.
SCIENCE * VOL. 256 * 22 MAY 1992
a
o n
O ct
ob er
2 0,
2 01
0 w
w w
.s ci
en ce
m ag
.o rg
D ow
nl oa
de d
fr om
sequences from the dentist and the seven dental patients were compared. Five to 12 C2-V3 sequences (containing a portion of the C2 and all of the V3 region) and several V4-C3-V5 sequences from independent M13 clones were obtained from each of the seven dental patients. We defined the av- erage or genetic distance between the virus- es of one individual and those of another individual or set of individuals as the aver- age percentage of sequence divergence (ex- cluding positions with gaps) of all available pairs of C2-V3 nucleotide sequences. Ge- netic distances between the viruses of the dentist and the patients (21), as well as the ranges of differences, are shown in Table 1. For the patients A, B, C, E, and G, the average distance to the dentist's viruses clustered in the range of 3.4 to 4.9%, distances comparable to those reported for known epidemiologically linked infections (2, 11, 12). In contrast, viruses present in patients D and F were more distantly relat- ed to those of the dentist, 13.6% and 10.7%, respectively. These latter distances are typical of equivalently measured dis- tances for viruses taken from epidemiologi- cally unlinked infections and are consistent with the epidemiologic finding that patients D and F engaged in high-risk behaviors that could have resulted in their HIV infections. These and other laboratory results (Fig. 1 and Table 2), in conjunction with the epidemiologic findings, led to the decision to exclude patients D and F from the cluster of linked infectiops in the statistical analy- ses presented belqw. When the percentages of sequence di-
vergence for viral sequences from the same person were calculated, the averages found in the viruses of the dentist and each of the patients A, B, C, E, and G were low (0.0 to 5.4%). These data are consistent with pre- vious reports of intraperson genetic varia- tion (2, 3, 6), indicating that none of the five patients was infected with HIV from more than one source.
Although no case of a stable form of HIV has been reported (3), the existence of a predominant HIV-1 variant in this part of Florida could not be presumptively ruled out. The existence of such a variant could potentially explain the finding of highly related HIV sequences among patients A, B, C, E, and G, independent of their contact with the dentist. Therefore, we determined the HIV C2-V3 sequences of the 35 HIV-seropositive LCs to examine the extent of genetic variation in the local geographic area. The sequences for 33 of the LCs were determined directly from the amplified products (15), which permitted the determination of the most common residue at each position (11, 22). In addi- tion, the C2-V3 sequences from 7 of the 35 LCs, including the two for which direct
sequences were not available, were deter- mined from their respective M13 clones. Thirty of the 35 C2-V3 sequences (both direct and clone) from the LCs were longer than 243 nucleotides and were included in the genetic distance comparison (Table 1). In calculating the genetic distances in Ta- ble 1, we used direct sequences only when clone sequences were not available. The five other LCs were not included because of their slightly shorter nucleotide sequence lengths.
As shown in Table 1, average distances between the viruses of dental patients A, B, C, E, and G and those of the LCs ranged from 10.8 to 11.8%. These distances are in accord with the average interpatient dis- tance found among the 30 LCs, namely 12.0%o. In addition, the average distances between the dentist's viruses and those of the 30 LCs is 11.0%, whereas the average distance between the dentist's viruses and those of patients A, B, C, E, and G is 4.0%.
The possibility that the HIV sequences in patients A, B, C, E, and G were closer in their genetic distance to the dentist's virus- es than to the LC's viruses as a result of chance alone was tested using the Wil- coxon rank-sum statistic. The test statistic was significant (P = 6 x 10-6), suggesting
that this cluster of related viruses in the dentist and patients A, B, C, E, and G is not due to chance (23). This cluster cannot be explained by the existence of a stable viral variant within the geographic area. Other data from the V4-C3-V5 region are consistent with our analysis of the C2-V3 region sequence relationships.
Phylogenetic Tree Analysis The pairwise distance measurements report- ed in Table 1 do not provide information about either the relationship of the viruses from the infected dental patients to each other or the viral genetic distances from the patients to individual LCs. Furthermore, these measurements do not delineate the proximal source of the viruses infecting the individual dental patients. To more closely examine the full range of relationships be- tween the viruses of the dentist, the pa- tients, and the LCs, we subjected the C2- V3 nucleotide sequence data set to phylo- genetic tree analyses. These cluster analyses were intended to be both "exploratory" and, within the limitations of the sequence lengths, "statistical" (24). A representative tree comprising the
dental group and select LC sequences is
B Patient A-y
Patient C-x Patient C-y
Patient G-x Patient G-y
Patient A-x Patient B-x
Patient B-y
Patient E-x Patient E-y
- ratient -y FIg. 1. Phylogenetic tree analy- .................................... g .Pylg ntctreaay
LC2-x sis comparing HIV-1 envV3 re- LC3-x gion coding sequences fromLC3-x the dentist, the dental patients A
LC2-y through G, and select local con- Patient F-x trols LC2, LC3, LC9, and LC35. Patient F-y The two most divergent clone
LC Consensus Sequence sequences from each person LC9 (designated x and y for each
LC35 person), with the exception of LC3-y LC9 and LC35, for whom only
PatientD-x 4% I direct PCR sequencing prod-Patient D-x L....J ucts were available, have been
Patient D-y included. The LC sequences in- cluded were those found by
pairwise distance measurement (Table 1) and signature pattern analysis (Table 2) to be the closest control sequences to the dental group sequences, which are enclosed by a box in (A). An LC consensus sequence has also been included, and the tree was rooted upon the African sample ELI. The PAUP parsimony algorithm was used to analyze 279 aligned sites (25), of which 146 sites were varied. When the dentist's viral sequences were withdrawn from the analysis, or required to cluster with the LC consensus sequence (25), the dental clade remained otherwise unaffected, as shown in (B). Vertical distances are for clarity only; the lengths of the horizontal branches are proportional to the single base changes and can be read as percentage differences with the scale bar.
SCIENCE * VOL. 256 * 22 MAY 1992
.VMMLMMM
1167
o n
O ct
ob er
2 0,
2 01
0 w
w w
.s ci
en ce
m ag
.o rg
D ow
nl oa
de d
fr om
Table 2. Frequencies of amino acids that define a signature pattern in the dentist's viruses.
Frequencies
Reference set* E T E S T A I Q
Reference set 0.63 0.81 0.69 0.59 0.69 0.66 0.72 0.56 Florida LCs 0.67 0.67 0.63 0.75 0.42 0.60 0.84 0.45 Dentist's viruses 0 0 0 0 0 0 0 0 A, B, C, E, G viruses 0 0 0 0 0 0.20 0 0 D and F viruses 0.55 1.0 0.73 0.91 0 0.45 0.82 0.82
Dentist's signaturet A A G A E V H
Reference set 0.06 0.13 0.06 0.16 0.25 0.06 0.25 0.16 Florida LCs 0.15 0.23 0.04 0.15 0.58 0.06 0.14 0.28 Dentist's viruses 1.0 1.0 1.0 1.0 1.0 1.0 1.0 1.0 A, B, C, E, G viruses 1.0 0.94 0.97 1.0 1.0 0.69 1.0 1.0 D and Fviruses 0.36 0 0 0.09 1.0 0 0 0
*Thirty-two distinct V3 region sequences available from the HIV Sequence Database (3). Those positions at which the dentist's viruses differed from that amino acid found in 50% or more of the reference set sequences constitute the dentist's signature pattem. Eight noncontiguous amino acids were objectively identified (see Fig. 2 for positions involved). tThe dentist's signature pattern is found by definition in all six cloned sequences of the dentist's viruses. Signature pattems were also determined for patients A, B, C, E, and G. Signature similarity: dentist, 6 clones with 8/8 amino acids identical with signature pattern; patient A, 6 clones with 8/8; patient B, 11 clones with 8/8 and 1 clone with 7/8; patient C, 4 clones with 8/8 and 1 clone with 7/8; patient E, 4 clones with 8/8 and 2 clones with 7/8; patient G, 5 clones with 8/8; patient D, 4 clones with 2/8 and 1 clone with 1/8; and patient F, 1 clone with 2/8 and 5 clones with 1/8.
shown in Fig. 1. A parsimony algorithm was used to generate this tree (25). Due to the large number of LCs, not all clone sequences available in this study could be satisfactorily represented in a single tree. Therefore, we focused the analysis on trees constituted from the two most divergent sequences (when available) from each of the samples and included only those LC sequences that by distance measurement (Table 1) or signa- ture pattern analysis (Table 2) were found to be most closely related to the dental group sequences. In addition, a consensus se- quence derived from all of the LC sequences (LC consensus sequence) was included. Many equally parsimonious trees were found; however, the monophyletic nest containing the sequences of the dentist and of patients A, B, C, E, and G was common to all of the most parsimonious trees. This nest, indicat- ed by the boxed area in Fig. lA, will be referred to as the dental clade.
Other trees were constructed by (i) using consensus sequences; (ii) rearranging the order in which sequences were presented to the computer program; (iii) including all LC sequences, other U.S.-derived se- quences, and V4-C3-V5 sequences; (iv) using only nucleotides representing the first and second base positions in codons; (v) removing 64 noninformative sites (of the total 146 varied sites) (26); and (vi) succes- sively removing and reintroducing the pa- tient and LC sequences. All of the most parsimonious trees generated in these dif- ferent ways retained the dental clade shown in Fig. 1; the viral sequences from patients A, B, C, E, and G invariably nested with the dentist's viral sequences. When the dentist's viral sequences were removed from the analysis, or required to cluster with the
1168
LC consensus sequence in a 'user-defined" tree (25), the remaining portion of the dental clade remained intact (Fig. 1B). Thus, tree analyses were consistent with the genetic distance analysis summarized in Table 1, and the tree analyses defined a strong linkage among the sequences from patients A, B, C, E, and G, independent of the presence or absence of the dentist's viral sequences. However, tree analyses could not specify the order, that is, the direction, of transmission within the dental group.
It is prudent with cluster analyses in- volving a relatively small number of phylo- genetically informative sites to subject the cluster analyses to statistical bootstrap anal- ysis (27). In each of 100 iterations of the bootstrap analysis, nucleotide sites were randomly selected (with replacement) from the 146 sites that had been used as the basis for construction of the phylogenetic tree shown in Fig. lA. A new tree was then constructed for each iteration. By this pro- cedure, the monophyletic grouping of the dental sequences was observed in 79 of 100 replicates (26). The value 79 of 100 should not be construed as a P value for a statistical test of the hypothesis that the dental clade forms a monophyletic nest; results of such tests (for instance, the genetic distance analyses that use rank-sum statistics and the signature pattem analysis) are presented below. Instead, the results should be inter- preted as an indication of how often we would conclude, from randomly selected nucleotide sites, that the dental clade was a distinct cluster. This procedure provides some measure of the power of the tree analysis, although exact interpretation of results from bootstrap analysis of parsimony trees is a subject of controversy (28).
Signature Pattern Analyses
Early in the course of this investigation, we noted the shared occurrence of a unique amino acid pattem in some clones of the dentist's and patient A's viruses (4). Al- though this particular pattem was not ob- served in all of the clones from these two individuals, nor in sequences from the oth- er dental patients, it encouraged us to undertake a third measure of genetic simi- larity based upon phylogenetically informa- tive characters. This approach will be re- ferred to as amino acid signature pattem analysis. A unique signature pattem of eight res-
idues was detected within the 120-amino acid C2-V3 region of the dentist's viruses by comparing an alignment of his viral amino acid sequences to an alignment of a refer- ence set consisting of 26 North American, 5 Haitian, and 1 European HIV-1 se- quences (29). The resulting pattem consist- ed of all sites in which all six clones from the dentist differed from what is found in over 50% of sequences in the reference set (Table 2 and marked with asterisks in Fig. 2; although consensus sequences are shown for illustrative purposes, every available clone sequence was used in this analysis). The dentist's signature pattem consisted of the following eight noncontiguous amino acids: A, I, A, G, A, E, V, and H. In contrast, the most common amino acids at these sites in the reference set were E, T, E, S, T, A, I, and Q, which occurred with frequencies ranging from 0.56 to 0.81. No sequence in the reference set contained more than four of the dentist's signature amino acids; most contained two or fewer. We then inspected the viral sequences
of the dental patients and the LCs for the presence of the dentist's signature pattem. No clone sequence from patients A, B, C, E, and G possessed fewer than seven of the eight signature amino acids (Table 2). As with the reference set of 32 sequences, most LC sequences showed two or fewer of the signature amino acids. In computing the statistical significance of these findings, we used the sequences from those individual clones for each of the patients A, B, C, E, and G that agreed least with the dentist's signature. For the seven LC cases in which there were multiple clones, we used the clone sequence that agreed best with the dentist's signature. This biased the outcome toward the hypothesis that the viruses of the dental patients and the LCs were equal- ly similar to the dentist's viruses. Even so, the Wilcoxon rank-sum test (P = 8 x 10-6) shows the five patients' viruses have significantly better agreement with the den- tist's signature pattern than do the 28 LC viruses for which agreement at all eight signature amino acid sites could be assessed
SCIENCE * VOL. 256 * 22 MAY 1992
Group
c9MRmRmnNRQNRRgmmpQRR;QnnR unmRNnpngnumnmnunpvogmgoRgmgovNNMRNmovgnpmNRonEggggR
o n
O ct
ob er
2 0,
2 01
0 w
w w
.s ci
en ce
m ag
.o rg
D ow
nl oa
de d
fr om
(30). This finding corroborated the genetic distance analysis (Table 1) and phylogenet- ic tree analyses (Fig. 1). Furthermore, the viruses from patients D and F are again distinct from the viruses infecting the other five patients; they possessed no more than two signature amino acids.
Both the genetic distance and signature pattem analyses identified a few LCs that were close to, but distinct from, the dental cluster. LC35 and LC9 had C2-V3 nucleo- tide sequences that were closest to those of the dentist by genetic distance analysis, averaging 6.7% (range 5.8 to 7.8%) and 6.9% (range 5.8 to 8.2%), respectively. The sequences from these two LCs pos- sessed four of the eight amino acids in the dentist's signature pattem (Fig. 1). The maximum number of the dentist's signature amino acids, five, found in any of the LC sequences occurred in one clone sequence from LC3. However, this clone had an average distance of 9.8% from the dentist's clone sequences, and the other five clones from LC3 all contained only two signature amino acids. By phylogenetic analyses, these LC sequences did not appear to be part of the dental clade (Fig. 1). We next addressed the question of
whether two of the measures of genetic similarity (genetic distance and amino acid signature pattem analysis) were truly differ- ent measures or were merely restatements of the same measures. If the information con- tained in these two measures overlapped, we could expect to see a high degree of correlation between them. However, Ken- dall's Tb (31), a measure of correlation computed from the 28 LCs for which both measures were available, was -0.07 (95% confidence interval from -0.37 to 0.24; a value of 0 indicates a lack of correlation). Therefore, we conclude that the analyses of average distance and signature pattem are separate assessments of genetic similarity.
With the discovery that phylogenetic information is found in amino acid signa- ture patterns, we also examined the signa- ture patterns belonging to the dental pa- tients' viruses. With the same reference set and criteria employed in the definition of the dentist's signature, unique signatures for each of the dental patients' sets of viruses were determined with the following results: (i) patients A, B, and E have identical or nearly identical signatures to that of the dentist and (ii) patients C and G have larger signatures, 15 and 14 residues, re- spectively (A, I, G, V, A, D, R, E, V, V, I, T, H, P, and V and A, I, A, G, A, D, V, Y, E, V, V, I, H, and V). Nevertheless, the signature from patient C's viruses is closer to the dentist's viral sequences than to any other sequences. The signature from pa- tient G agrees best with a viral sequence from patient C but next best to a dentist
Conclusion
In summary, seven HIV-infected patients were identified in the practice of a dentist with AIDS. Of these seven patients, five had no identified risk for HIV infection and had invasive procedures performed by the dentist. These five patients were infected with HIV strains that had nucleotide se- quences and amino acid signature patterns that were closely related to those of the dentist's viruses. In addition, the HIV se- quences of the dentist and these five pa- tients were distinct from those found in the two dental patients with known behavioral risks for HIV infection and in 35 other HIV-infected persons residing in the same
viral sequence. No LC sequences or refer- ence set sequences were found to match as many as 50% of the amino acids in the signatures from patients A, B, C, E, and G.
Although the dentist was the most likely source of the infection for the five patients, all the patients were not necessarily infected with each of the dentist's HIV variants. This is evident upon inspection of the deduced amino acid sequences, which demonstrate two C2-V3 subtypes for the dentist (Dent-I and Dent-Il in Fig. 2). Both the dentist's subtypes are also present in patient A's viral sequences (Pt-A-I and Pt-A-II). However, sequences closer to Dent-I were found in patients B and E, and sequences closer to Dent-II were found in patients C and G.
Dent-I Dent-II Pt-A-I Pt-A-II Pt-B Pt-c
Pt-E Pt-6 Pt-D Pt-F LC1 LC2 LC3 LC4 LCS LC6 LC7 LC8 LC9 LC1O LCll LC12 LC3
LCM4 LC1S LC16 LC17 LC18 LC19 LC20 I C21 LC22 LC23
LC24 LC25 LC26 LC27 LC28 LC29 LC30 LC31 LU2 LC33 LC34 LC35
Fig. 2. Comparison among V3 region amino acid sequences from 43 HIV-infected persons from Florida. For the purpose of this figure only, consensus sequences are shown. Because two distinct sequence subtypes were present in the dentist and patient A, two consensus sequences are shown for the dentist (Dent-I and Dent-Il) and patient A (Pt-A-I and Pt-A-Il). Sequences from the C2-V3 clone (n = 72) and direct (n = 41) sequences have been deposited with GenBank (accession numbers M90847 to M90906; M90914 to M90966). Sequences from the V4-C3-V5 region have also been deposited with GenBank (accession numbers M91084 to M91 115; M91 121 to M91 149; and M91 153 to M91 156). The reference sequence is Dent-I from the dentist. Residues identical to Dent-I are shown as a dash. Regions not sequenced are left blank. The sequence stretch corresponding to the V3 loop is indicated. Other symbols are ?, no consensus amino acid at the position indicated; *, noncontiguous amino acids of the dentist's signature pattern (Table 2); *, a gap to maintain alignment of the amino acids; and $, a stop codon. Single-letter abbreviations for the amino acid residues are: A, Ala; C, Cys; D, Asp; E, Glu; F, Phe; G, Gly; H, His; I, lie; K, Lys; L, Leu; M, Met; N, Asn; P, Pro; Q, Gin; R, Arg; S, Ser; T, Thr; V, Val; W, Trp; and Y, Tyr.
SCIENCE * VOL. 256 * 22 MAY 1992
V3 loop ------------
LAEEMISAYTNIIIINAVI QIRPNFMHSPRFArEIIGDIR_AI KHIPTZI II.NxTGGDEIVGNGEFFYC -------- ---- ---- Y---R--- -Y--V----E----------KL-A-----V-.--.T -----V--
______ ____________ --_-- ---- -_~~~~--K -?.-----------
------------------K--?-?-?--S------ ---K--------- -.----Q------ -.---------------------------------------------dU---E--K----- -.---- ----
-E----------------------------------------Y-DR------------ ---------------------- ---- -P----K----------K----L-U?--D--K-I-6--K---?-.--V--EQHF
-----E------T---KE---I--------I------T---D----- - ----L-S---- ---------S------N------K--N-T---- ---- -TS-P----K----------T-N-----K--F---?-.--V------
------S------T----E-+---------- S-V-T--Q-- ---------L-S-K-----K---.--V-KP---K- ------E--E---T--F-T-------S---K-D-------L-E----I-K-----.--Y--
-------------N---T----K------------- ??------------T------N-A-S-E--K-IAF--.---YKV-- -----K----ES---T--- KE--T-- ------S-N-V-T-V-Q-VR------ GV-?K^---K--R.--VKP---- --Ef
-------E--N---TT-----------------S----------T--D------------TL--D---K-I-R----K.S--V-K---------TT--------T-- ----------T--- ---------- D--------Y--- K----------I.TV-Y-------PV--L ------E----T---IKE -----S------ D----- --K-1---K-E-.-Y----------
-T----1- --- S---A--- -- ----------I-S- 1F -.T-TYAFQ- -I-L------T---E--V------------------ K-RI-K--.N-----R-----T-------- G6--- D----T--T----K--------S----S-T-----T---YV-----------T--DK-1-RK--G-ETK---EP----TT------ -TI -----D----V-T------E^-V----------R-----------T----------A--KIVV-.Y-------- ------E------T------E-I-----------S-P-----------D------L-AT----K-I---------- --T---E-L-----T------I[EP- -- ---- ---- -- - 0------ ----Y-STF-----E-A---EL---.
ET--------------I---- -v N------VE----- ----------T------E------K-E--6-IS----K-TT-TLV
D------T-----V-----------RS-T- D----- ----------E- -----E--N---T-L-----LS-K--RS---------- D---------0---K-I-I--_---TT--A--K-------- ------E-IS----T-----E--V------ ---PS--A ----------T-1-----E-----.T--V- R---- -----D--S---RT----E--V--------SRR-S------T-REG -------------fE-ES--ICaI-E-G-K- .--V--------------- - ----E--T ----- S-----K-------------L--TA----KLI-D------.--V---------T--T-----
----T-----T-- -----T--D--------T--E-K-IA----V--NT--V------------------ ----E--T--T---KDP--------------S-----------D- -A-----I-DIC-V---.---V------------T--------- --K------T------EP--------------S-------T- -----------L--A----K-I-V--- ---.---V------------T---------
------D--------------E--V-----S-----S--- T--D---H-------L--A---K-1-1-----E-.R--V-w-------T----------- -I-----E---N-RT----E-IV----------6-S--LA----H ----N------L-A-E-D--EKIA--G-R-P-.---N-IK-- --------
N_L---K-Pl-----------A----TV--R-------------L-ST--D----IAI-----.--T--Q-----K------ ---------6---E----L--V--E-E-IAI--K-.-V---------
-E---T- -E-A----------------T--- -L--AD -----.E--- -------E---------TE-------S--A---D----------IAI--S---.11-
------K-------T-----E--A--S---- ---------D----- L--AD-----KLI-EN-6--L-MQ --I----E----L-N----E--------G ----RS-- T--T-----N --- A-----K-IAD----E-.--V--------F-T-- ------E---N---T---E--V---------S-P----------D----------L---A----K--A---------------------T
. on .IMMLMMM
,.R--V--Q-------------
..T-VA--Q------D--l----
1169
o n
O ct
ob er
2 0,
2 01
0 w
w w
.s ci
en ce
m ag
.o rg
D ow
nl oa
de d
fr om
geographic area. Therefore, both the epide- miologic and laboratory data indicate that these five patients were infected during their dental care.
The precise mode ofHIV transmission to these patients could not, however, be iden- tified. Patients could have been directly exposed to the dentist's blood as a result of percutaneous injuries sustained by the den- tist while performing invasive procedures on these patients. Although none of the pa- tients reported that the dentist injured him- self while caring for them, they would not necessarily have been aware if such injuries had occurred. Transmission might also have occurred by contamination of instruments or other dental equipment with blood from the dentist or, less likely, a patient or patients already infected by the dentist. All five patients had invasive procedures performed by the dentist after he was diagnosed with AIDS. At this late stage of disease, higher virus titers may have been present in the dentist's blood and he may have been more likely to transmit virus than earlier in the course of his HIV disease (32).
The theoretical possibility of HIV trans- mission from infected health-care workers to patients during invasive procedures has been previously acknowledged (33), and there are well-documented reports of HIV transmis- sion from patients to health-care workers after percutaneous exposure to HIV-infected blood (34). In addition, transmission of hepatitis B virus, which has epidemiologic transmission patterns similar to HIV, from health-care workers to patients during inva- sive medical and dental procedures has been reported (35). For most of these outbreaks, the precise mode of hepatitis B virus trans- mission from the worker to patient could not be identified, as was true for the HIV trans- missions reported here.
Analysis of viral nucleotide sequence distances, inferred phylogenetic relation- ships, and signature pattems of deduced amino acid sequences played a central role in the investigation of this cluster of HIV- infected patients. Similar analyses may prove to be useful in other investigations of HIV transmission, such as those seeking to determine the source of HIV infection in persons with multiple risk factors (for ex- ample, a health-care worker who has sus- tained an occupational exposure to HIV and reports male-to-male sexual contact). Genetic analysis is also proving to be valu- able in tracking the spread of HIV in countries, such as Thailand, where the epidemic is of recent onset (36).
In the current investigation, the diver- gence of HIV sequences within the Florida background population was sufficient to identify strain variation. However, in coun- tries where the virus has been recently introduced, there may be limited HIV ge-
netic variation and analysis of greater se- quence lengths may be necessary to identify strain variation and to determine possible epidemiologic linkage. Nonetheless, this investigation demonstrates that detailed analysis of HIV genetic variation is a new and powerful tool for understanding the epidemiology of HIV transmission.
Note added in proof: Subsequent to the preparation of this report, the Centers for Disease Control became aware of another HIV-infected dental patient (patient H). This patient has acknowledged behavioral risk factors for HIV infection; his HIV clone sequences (GenBank accession numbers M90907 through M90912) are not closely related to the dentist's viruses, differing by more than 10.7% in the C2-V3 region.
REFERENCES AND NOTES
1. J. S. Smith etal., N. Engi. J. Med. 324, 205 (1991); H. J. Un etal., J. Infect. Dis. 164, 284 (1991); G. P. Holmes et al., Ann. Intem. Med. 112, 833 (1990); R. Rico-Hesse, M. A. Pallansch, B. K. Nottay, 0. M. Kew, Virology 160, 311 (1987).
2. P. Balfe et al., J. Wrol. 64, 6221 (1990). 3. G. Myers et al., Eds., "Human retroviruses and
AIDS 1991: A compilation and analysis of nucleic acid and amino acid sequences," (Theoretical Division, T10, Los Alamos National Laboratory, Los Alamos, NM, 1991).
4. Morbid. Mortal. Wkly. Rep. 39, 489 (1990). 5. Ibid. 40,21 (1991); ibid., p. 377; C. A. Ciesielski et
al., Ann. Int. Med. 116, 798 (1992). 6. J. P. Vartanian, A. Meyerhans, B. Asjo, S. Wain-
Hobson, J. Virol. 65, 1779 (1991); S. Delassus, R. Cheynier, S. Wain-Hobson, ibid., p. 225; A. Myer- hans et al., Cell 58, 901 (1989); M. Goodenow et al., J. Acquired Immune Defic. Syndrome 2, 344 (1989); M. Alizon et al., Cell 46, 63 (1986); B. R. Starcich et al., ibid. 45, 637 (1986).
7. B. H. Hahn etal., Science 232, 1548 (1986); M. S. Saag et al., Nature 334, 440 (1988).
8. J. A. McKeating et al., AIDS 3, 777 (1989); P. Nara, in Retroviruses of Human AIDS and Related Animal Diseases, M. Girard and L. Valette, Eds. (Pasteur Vaccins, Paris, 1989), pp. 203-215.
9. T. Shioda, J. A. Levy, C. Cheng-Mayer, Nature 349,167 (1991).
10. C. A. B. Boucher etal., Lancet336,585 (1990); B. A. Larder, G. Darby, D. D. Richman, Science 243, 1731 (1989); D. D. Richman, J. M. Grimes, S. W. Lagakos, J. Acquired Immune Defic. Syndrome 3, 743 (1990).
11. H. Burger et al., Lancet 336, 134 (1990); H. Burger et al., Proc. Natl. Acad. Sci. U.S.A. 88, 11236 (1991).
12. S. M. Wolinsky et al., Science 255, 1134 (1992). 13. A. Srinivasan et al., Blood 232, 1548 (1986). 14. K. Cichutek et al., AIDS 5, 1185 (1991). 15. Peripheral blood mononuclear cells (PBMCs)
were isolated, divided, and processed in a labo- ratory where no PCR work had been performed. To avoid potential cross-contamination or mix-up of specimens, only one frozen PBMC aliquot of the dentist or his patients was processed at a time. Amplification of HIV env DNA was per- formed by a two-step PCR procedure. The primer pair used in the first amplification step was CL207 (5'-GTATGAATTCAACTGCTGTTAAATGGCAGT- 3') and C072 (5'-TATAGAATTCACTTCTCCAAT- TGTCCCTCAT-3'). Approximately 1 p.g of PBMC DNA was used in a standard 100-1d reaction (16) and the PCR profile was 96WC, 1 min, 65°C, 2.5 min, temperature ramping time 30 s and the cycle was repeated 40 times. Five microliters of the amplified product was diluted 50-fold and 5 p.l of the diluted DNA was reamplified 30 cycles with a new primer pair C072 and derivatives of CL207
containing a 9-base extension (5'-CTAGCAGAA- 3') at the 3' end of CL207. Both the CL207 and its extended derivatives have an Eco RI restriction endonuclease recognition sequence (GAATTC). Amplified DNA from the secondary PCR was purified by NACS columns (Bethesda Research Laboratory, Gaithersburg, MD), sequenced di- rectly or digested with Eco RI, and cloned into M13 vectors. To assist the tracking of recombi- nant phages generated from the dentist and the patients A through G, a specific dinucleotide sequence was added 3' to the Eco RI site of each of the CL207 derivatives to serve as person- specific dinucleotides or "bar codes." When pos- sible, a different Ml 3 vector was used to generate clones from different persons in the dental cohort. These two additional measures facilitated the management and identification of the source of HIV-containing phage. M13 clones containing HIV inserts were screened by plaque hybridization using 32P-labeled C0249 (5'-CAAATATTACA- GGGCTGCATTAACAAGAGATGGTGGTAA-3') or its complementary sequence C0250 (5'-TTAC- CACCATCTCTTGTTAATAGCAGCCCTGTAA- TATTTG-3') as probes derived from the con- served C3 domain. The Taq Dye Primer Sequenc- ing Kit and the 373A DNA sequencer (Applied Biosystem, Foster City, CA) were used. Fluores- cence-tagged Ml 3 universal primers were used for sequencing M13-derived clones, whereas a fluorescence-tagged derivative of CL207 primer was used for direct sequencing of amplified DNA.
16. M. Rogers et al., N. EngI. J. Med. 320, 1649 (1989).
17. Precautions included (i) ultraviolet irradiation of vials and laboratory benches (18), (ii) apportion- ing reagents for single use, (iii) use of positive displacement pipetting devices, and (iv) use of a room dedicated specifically for PCR (19).
18. G. Sarkar and S. S. Sommer, Nature 343, 27 (1990); C.-Y. Ou, J. L. Moore, G. Schochetman, BioTechniques 10, 442 (1991).
19. S. Kwok, Amplifications 2, 4 (1989); and R. Higuchi, Nature 339, 237 (1989).
20. The V3, V4, and V5 sequences of patients A and B and a local control (GenBank accession num- bers M92100 to M92150) were also determined by A. J. L. Brown and his colleagues at the University of Edinburgh. PBMC DNA from patient A and an LC were prepared in a CDC laboratory in which no work had been done with HIV. PBMCs from patient B were sent directly from CDC's Epidemic Response Laboratory to Edinburgh. None of the three specimens were handled by CDC personnel involved in the PCR and sequenc- ing of the Florida specimens.
21. For the nucleotide sequence comparisons shown in Table 1, a total of 94 sequences, derived from both M13 clones and from direct sequencing of amplified products, were analyzed over 243 shared positions in the C2-V3 region, for a total of 4371 pairwise comparisons. In keeping with cur- rent practice, averages and ranges of sequence differences are reported as percentages rather than as number of nucleotide differences. The robustness of this analysis, although involving small differences in nucleotide counts, is support- ed by (i) the outcome of the Wilcoxon rank-sum analysis; (ii) the consistency observed for the ranges, which do not show marked variation (Ta- ble 1); and (iii) the agreement of the intrapatient differences with what has been reported (2, 3, 6).
22. H. Steuler, B. Storch-Hagenlocher, B. Wildemann, AIDS Res. Hum. Retroviruses 8, 53 (1992); R. Gibbs et al., in PCR Technology: Principles and Applications for DNA Amplification (Stockton, New York, 1989), pp. 171-191.
23. The Wilcoxon rank-sum statistic was calculated from the average distance between the dentist and each of patients A, B, C, E, and G and the 30 LCs for whom genetic distance measurements were available. When clone sequences were available, these were used in preference to direct sequences. In all Wilcoxon statistics reported here, average ranks were used in case of ties. All P values for the Wilcoxon statistics given in this
SCIENCE * VOL. 256 * 22 MAY 19921170
o n
O ct
ob er
2 0,
2 01
0 w
w w
.s ci
en ce
m ag
.o rg
D ow
nl oa
de d
fr om
paper were obtained from the exact distribution of the rank-sum statistic [for example, see T. P. Hettmansperger Statistical Inference Based on Ranks (Wiley, New York, 1984)]. Since the Pvalue for-the Wilcoxon statistic may depend on the mix of direct and clone sequences, we also conduct- ed a bootstrap hypothesis test [P. Hall and S. R. Wilson, Biometrics 47, 757 (1991)]. This analysis also took into account the varying number of clone sequences available per individual. We found a 95% confidence interval for the Pvalue to be between 2.7 x 10-6 and 4.4 x 10-6. We also computed a Wilcoxon rank-sum statistic from av- erage distances between the cloned viral se- quences of the dentist and the direct sequences of the five dental patients and those 28 LCs for whom direct sequences of sufficient length were available (P = 8 x 10-6). Finally, we computed a Wilcoxon rank-sum statistic from distances from the direct sequence of the dentist to the direct sequences from the patient group and the 28 LCs (P= 2 x 10-5).
24. J. Felsenstein, Evolution 39, 783 (1985); Annu. Rev. Genet. 22, 521 (1988).
25. Tree analyses were principally conducted with the use of the MULPARS and branch and bound programs of PAUP (Phylogenetic Analysis Using Parsimony, version 2.4.2, written and distributed by D. L. Swofford, Illinois Natural History Survey, Urbana). The LC consensus sequence was the designated hypothetical ancestor (Hypanc). Trees were rooted upon the African sample se- quence ELI or upon the midpoint of the greatest patrisitic distance with the same outcome. In a "user-defined" tree, the dentist's sequences were required to cluster with the LC consensus se- quence. To examine the consequences of rear- ranging the order of input of sequences, trees were constructed using the JUMBLE option of DNAPARS program of PHYLIP (version 3.2, writ- ten and distributed by J. Felsenstein, University of Washington, Seattle).
26. Of the 146 varied sites, 64 sites manifested nu- cleotide changes in no more than one of the sequences included in the analysis; for the pur- poses of some bootstrapping evaluations, these sites were deemed noninformative [W.-M. Li and D. Graur, in Fundamentals of Molecular Evolution (Sinauer, Sunderland, MA, 1991), pp. 111-113] and were accordingly excluded. The effect upon
the bootstrapping turned out to be negligible (80% versus 79%).
27. Bootstrap analysis utilized the DNABOOT pro- gram of PHYLIP (24). Increasing the number of iterations, or replicates, from 100 to 400 yielded the same proportion of trees in which the dental clade could be identified. There is no consensus about the interpretation of bootstrap results; on the one hand, confidence intervals may be larger than the set of equally parsimonious trees (24) but, on the other hand, bootstrap intervals can be underestimates of confidence intervals (28).
28. D. Hillis and J. Bull, University of Texas, Austin, unpublished observations.
29. The choice of 32 reference sequences was dic- tated solely by what was available for analysis in the HIV Sequence Database, with the following qualifications: (i) sibling sequences (sets of viral sequences from the same patient) were not in- cluded; (ii) only non-African, "MN-like" se- quences [G. J. LaRosa et al., Science 251, 811 (1991)] were included in light of the fact that none of the dental or Florida control sequences mani- fested "African-like" V3 region sequences; and (iii) whereas over 1000 "V3 loop" sequences (33 to 35 amino acids) are present in the HIV data- base, the current analysis required complete V3 region sequences. The HIV-1 reference set com- prises MN, LAI, JRCSF, ALA1, ADA, RF, WMJ2, JH3, SC, BRVA, BAL1, JFL, OYI, NY5, SF162, SF2, SF33, HAN, CDC451, SBA, MA221, JB02, FJS, WM, ACH9, JM, ACP1, 6008ar, 5986ar, 6000ar, 5998ar, and 6002ar (3). Signature amino acids in the dentist's viruses are those that differ from what is found in 50% or more of these sequences. Reduction of the reference set by exclusion of the last five sequences in the set (the Haitian samples, kindly provided by N. Halsey and his colleagues and sequenced at CDC) made no difference in the determination of this signature. Signature analysis utilizing nucleotide sequences rather than amino acid sequences confirmed without exception the results reported here. A fuller description of the computer appli- cation (VESPA, or viral epidemiology signature pattem analysis) and the results with nucleotide signature patterns is being prepared (B. T. M. Korber and G. Myers, unpublished observations).
30. The Wilcoxon rank-sum statistic was calculated from a mix of clone and direct sequences. Hence
the P value, which here is simply twice the recip- rocal of the binomial coefficient (33), may be questioned. Thus, we also conducted an analysis with only direct sequences from the dental pa- tients and the 33 LCs for whom direct sequences were available. Because the direct sequences of two of the dental patients were too short to assess agreement at all eight sites, we tested the hypoth- esis that the probability of agreement at i sites, given that j were available, was equal among the dental patients and the LC by Fisher's exact test (P= 1.1 X 10-4) [G. H. Freeman and J. H. Halton, Biometrika 38, 141 (1951)].
31. Because agreement in the signature pattern anal- ysis is measured on a scale from 0 to 8, we have used a form of Kendall's r, denoted Tb, which is adjusted for ties [A. Stuart, in Encyclopedia of Statistical Sciences (Wiley, New York, 1983), vol. 4, p. 367]. A less familiar measure, which uses only the untied data and hence may be a better estimator when data have extensive ties, is Kruskal and Goodman's y. We find that -y = 0.08, with asymptotic confidence interval (-0.42,0.27).
32. D. D. Ho, T. Moudgil, M. Alam, N. Engi. J. Med. 321, 1625 (1989); R. W. Coombs et al., ibid., p 1626.
33. Morbid. Mortal. Wkfly. Rep. 36, 2S (1987); ibid. 35, 221 (1986).
34. R. Marcus and the CDC Cooperative Needlestick Surveillance Group, N. Engi. J. Med. 319, 1118 (1988).
35. J. Welch et al., Lancet i, 205 (1989); F. E. Shaw, Jr. etal., J. Am. Med. Assoc. 255,3260 (1988); M. A. Kane and L. A. Lettau, J. Am. Dent. Assoc. 110, 834 (1985); J. Ahtone and R. A. Goodman, ibid. 106, 219 (1983).
36. C-Y. Ou et al., AIDS Res. Hum. Retroviruses, in press.
37. R. F. Smith and T. F. Smith, Protein Eng. 5, 35 (1992).
38. We thank A. Gifford and R. Lenroot for providing excellent assistance in computer analysis; A. L. Brown and his colleagues for independently con- firming the HIV sequences in patients A and B and an LC; D. K. Hillis for his assistance with the phylogenetic tree analysis; B. Holloway, E. George, and N. de la Torre for synthesis and purification of DNA oligomers; D. Hammerlein for handling blood specimens; and R. Moseley for excellent editorial assistance.
SCIENCE * VOL. 256 * 22 MAY 1992
.................-..... -.-- ....... -1-1,11 -00
1171
o n
O ct
ob er
2 0,
2 01
0 w
w w
.s ci
en ce
m ag
.o rg
D ow
nl oa
de d
fr om
mge_a4_study_q2.pdf
Lack of HIV Transmission in the Practice of a Dentist with AIDS Harold W. Jaffe, MD; Joyce M. McCurdy, MSA; Marcia L. Kalish, PhD; Thomas Liberti, BS; Georges Metellus, MD, MMH; Barbara H. Bowman, PhD; Sonia B. Richards, MD; Annie R. Neasman, RN, MS; and John J. Witte, MD, MPH
• Objective: To determine whether dentist-to-patient or patient-to-patient transmission of human immuno- deficiency virus (HIV) occurred in the practice of a dentist who had the acquired immunodeficiency syn- drome (AIDS). • Design: Retrospective epidemiologic investigation supported by molecular virology studies. • Setting: The practice of a dentist with AIDS in an area with a high AIDS prevalence. • Participants: A dentist with AIDS, his former employ- ees, and his former patients, including 28 patients with HIV infection. • Measurements: Identification of potential risks for acquisition of HIV infection, genetic relatedness among HIV strains, and infection-control practices. • Results: A dentist with known behavioral risks for HIV infection, who was practicing in an area of Miami, Florida, that had a high rate of reported AIDS cases, disclosed that he frequently did invasive procedures and did not always follow recommended infection- control procedures. Of 6474 patients who had records of receiving care from the dentist during his last 5 years of practice, 1279 (19.8%) were known to have been tested for HIV infection and 24 of those (1.9%) were seropositive. Four other patients with HIV infection were identified through additional case-finding activi- ties. Of these 28 patients with HIV infection, all but 4 had potential behavioral risk factors for infection. Phy- logenetic tree analysis of HIV genetic sequences from the dentist and 24 of the patients with HIV infection showed an absence of strong bootstrap support for any grouping and therefore did not indicate that the virus strains were linked. • Conclusions: Despite identifying numerous patients with HIV infection, we found no evidence of dentist-to- patient or patient-to-patient transmission of HIV during dental care. Our findings are consistent with those of all previous studies in this area, with the exception of one that did identify such transmission.
I h e Florida Department of Health and Rehabilitative Services (HRS) and the Centers for Disease Control and Prevention (CDC) have previously described six patients who acquired human immunodeficiency virus (HIV) in- fection while receiving care from a dentist with HIV infection (1-6). To date, this dentist's practice is the only practice of a health care worker with HIV infection in which HIV transmission to patients has occurred and has been reported. The events that resulted in the infection of these patients remain unknown; however, the available evidence suggests that HIV was transmitted from dentist to patient rather than from patient to patient (7).
In July 1991, Miami newspapers published the name of another dentist who had been diagnosed with the ac- quired immunodeficiency syndrome (AIDS). This dentist had closed his practice 2 months earlier because of ill health. To determine whether HIV had been transmitted to patients during receipt of care in this practice, we investigated the dentist's medical history, his dental prac- tice, and his former patients.
Methods
Epidemiologic Investigation
Information about the dentist's health was obtained from his available medical records. Because the dentist was too ill to be interviewed, information about his practice was obtained by in- terviewing his two former employees, a dental assistant and an office manager.
The dentist's spouse provided HRS with the names and ad- dresses of those persons who had been patients of the dentist during the last 5 years of his practice; HRS sent a letter to each of these patients telling them that they had received care from a dentist with HIV infection and providing them with information about HIV counseling and testing services. We reviewed the available dental and medical records of all patients with HIV infection, and we interviewed all living patients infected with HIV to determine whether they had behavioral or transfusion risk factors for HIV infection.
Laboratory Investigation
We obtained a blood sample from the dentist with his consent. Blood samples were also collected from all consenting patients with HIV infection and from those of the patient's sexual part- ners who were known to be infected with HIV. Mononuclear cells were separated from the samples and DNA was extracted as previously described (8).
The primers MK603 and CO602 were used in a polymerase chain reaction for primary amplification of approximately 1500 nucleotides of the CI to gp41 domain of the HIV-1 envelope gene (9). The primary amplified DNA was then diluted 50-fold and used in a nested polymerase chain reaction with the primers CL207 and C072 to reamplify approximately 700 nucleotides of the C2 to C5 region (4). The reamplified DNA was purified by the Qiagen PCR Purification Spin Kit (Qiagen Inc., Chatsworth, California), and approximately 300 nucleotides of the V3 and
Ann Intern Med. 1994;121:855-859.
From the Centers for Disease Control and Prevention, Atlanta, Georgia; the Florida Department of Health and Rehabilitative Services, Tallahassee, Florida, and Miami, Florida; and Roche Molecular Systems, Alameda, California.
© 1994 American College of Physicians 855
Figure 1. Unrooted phylogenetic tree illustrating the relations among HIV sequences obtained from the dentist, 24 of his former dental patients, and 2 sexual partners of patients. Ge- netic distance bootstrap results support only one pairing of se- quences, that of O and O-l, so the other branches are shown as a "star phylogeny." Branch lengths are arbitrary.
flanking regions were sequenced in an automated DNA se- quencer (Applied Biosystems Inc., Foster City, California), either directly or after being cloned into an M13 vector (4, 9).
Genetic analysis was done on direct sequences from the den- tist, 21 patients, and 2 sexual partners of patients. Direct se- quencing of DNA from its polymerase chain reaction product identifies the most common nucleotide at each position from all the variants present within a person. Only cloned sequences could be obtained from patients R, L, and P. A consensus sequence was generated for patients L (10 clones) and R (5 clones) based on the nucleotide present at each position in at least 50% of the clones. Because patient P had only three clones, it was difficult to generate a consensus sequence; thus, the long- est, most representative clone sequence was chosen for analysis.
Sequences were aligned by hand using ESEE2.00B (10); se- quence positions that could not be aligned, as well as those in which one sequence had an undetermined base, were eliminated from the analysis. Two hundred fifteen alignable positions were used in phylogenetic analysis. We calculated the number of base substitutions between each of the sequences being compared to obtain a measure of the pairwise genetic distances between the viruses of the persons studied. These distances were used to construct a phylogenetic tree. Programs from the PHYLIP suite, version 3.4, for Unix were used to construct the neighbor-joining bootstrap tree shown in Figure 1 (11). SEQBOOT was used to create 1000 subreplicate sequence files; DNADIST returned a distance matrix from each file, using a maximum-likelihood mul- tiple-hit correction; NEIGHBOR was used to construct a neigh- bor-joining distance tree from each distance matrix; and CON- SENSE determined the percentage of replicate trees in which each internal branch was present. This percentage, or bootstrap proportion, shows how strongly phylogenetic analysis supports a particular grouping of sequences.
Results
The dentist was a man in his 60s who had known behavioral risk factors for HIV infection and had had a positive HIV antibody test in June 1988. The reason for testing at that time is not known; the dentist had no record of an earlier negative test. In November 1989, he
was asymptomatic and had a CD4+ T-lymphocyte count of 206 cells/juiL. By May 1990, his CD4+ lymphocyte count had dropped to 69 cells/jaL and therapy with zidovudine and aerosol pentamidine was started. In March 1991, he was hospitalized with pneumonia of un- known cause that responded to therapy with dapsone and trimethoprim. Human immunodeficiency virus encepha- lopathy was also diagnosed, although a magnetic reso- nance imaging scan was normal. In May 1991, the dentist was hospitalized after a syncopal episode in his office. At admission, he stated that he had retired 3 months earlier, but he apparently continued to provide care for a small number of patients. According to his medical records, his recent memory was impaired; a magnetic resonance im- aging scan done at this time was normal. After he was discharged from the hospital, he closed the remainder of his practice. A month later, he was hospitalized with diagnoses of staphylococcal sepsis, anemia, and HIV en- cephalopathy. He died in a hospice in August 1991.
The dentist had practiced in the Liberty City area of Miami, Florida, for almost 30 years and primarily served an indigent patient population. According to his staff, he saw approximately 15 to 20 patients on a typical day and did extractions for about 5 patients per day. Since 1986 or 1987, he had routinely worn gloves, a mask, and eye protection. He recapped needles using a two-handed tech- nique. Surgical instruments were autoclaved and other instruments, such as curettes and instruments used in restorative dentistry, were immersed in a liquid chemical germicide called Cetylcide, which is a quaternary ammo- nium compound (use of trade names is for identification only and does not imply endorsement by the Public Health Service or the U.S. Department of Health and Human Services). Dental handpieces were wiped with alcohol but were not autoclaved.
Single-use, disposable pieces of equipment, such as pro- phylaxis cups, were occasionally reused after being im- mersed in Cetylcide. Handpiece and dental unit water lines were not flushed. Both staff members reported that they had tested negative for HIV infection.
Of the 6474 letters sent to former patients of the den- tist, 5469 (84.5%) were delivered. As a result of these letters and of newspaper articles and other media cover- age about the dentist, 1279 patients were found to have been tested for HIV infection. Of these patients, 24 (1.9%) were seropositive. Additional case-finding activi- ties identified another 4 former patients who were in- fected with HIV or who had AIDS. Thus, a total of 28 former dental patients with HIV infection (designated A, B, D, E, F, G, H, I, J, K, L, M, N, O, P, Q, R, S, T, U, V, W, X, Y, Z, BB, CC, and DD) were identified.
Sixteen of the 28 infected patients (57%) were female. The patients ranged in age from 17 to 69 years (median, 35 years); 26 were African-American, 1 was Hispanic, and 1 was Caucasian. Five patients (H, U, X, CC, and DD) died of AIDS before or during the investigation.
Based on interviews with the patients and review of their medical records, we placed patients in a mutually exclusive hierarchy of potential risk categories for HIV infection (Table 1). Although none of the men acknowl- edged having practiced homosexual or bisexual behaviors, 19 patients had engaged in drug use or in sexual behav- iors that could have resulted in HIV infection. An addi-
856 1 December 1994 • Annals of Internal Medicine • Volume 121 • Number 11
Table 1. Potential Risk Factors among Patients with HIV Infection in a Florida Dental Practice
Risk Factor* Number of Patientst
Injecting drug use 3 (I, Q, R) Heterosexual transmission^ 8 (D, H, J, O, P, S, X, CC) Sex for drugs or money 2 (B, T) Multiple sexual partners 6 (K, L, N, V, Y, Z) History of sexually transmitted diseases 5 (A, E, F, M, BB) None of above 4 (G, U W, DD)
* Mutually exclusive hierarchy. t Identifiers are given in parentheses. $ Includes patients reporting sexual partners with HIV infection and
patients born in countries where most HIV transmission occurs through heterosexual contact.
tional 5 patients had had one or more sexually transmit- ted diseases. Only 4 patients could not be placed in a potential risk category.
According to dental records, which were available for 22 patients, or self-report, all but 4 of the 28 patients infected with HIV had received care from the dentist in 1988 or later, years during which the dentist was known to have had HIV infection. During this time, 18 of the patients infected with HIV had a total of 24 invasive procedures documented in their dental records (Table 2). In most cases, the invasive procedure was extraction or alveoplasty; none of the documented procedures required the intraoral use of a dental handpiece. In March 1988, patients Z and BB had extractions done on the same day; this was the only common visit day recorded.
Blood samples were obtained from the dentist and 24 of his former patients. One of these patients, patient H, died during the investigation, after a blood sample was collected. Three other patients (X, CC, and DD) died before their blood samples could be collected. The blood sample from patient U was broken in transit and this patient died before another sample could be obtained. Samples were also taken from the sexual partners of patients O and CC (designated O-l and CC-1, respective- ly); neither of these partners had been a patient of the dentist.
The mean genetic distances between the viruses of the dentist and his patients and between the viruses of the patients were 13.0% and 12.1%, respectively (Table 3), suggesting that these viral strains were not similar. The smallest genetic distance, 5.8%, occurred between the viral strains of patients K and Q; the dental visits of these patients were separated by at least 5 years. On the other hand, the viruses of patient O and her sexual partner, O-l, had a distance of 4.0%.
The results of the genetic distance analysis were con- sistent with those of the phylogenetic tree analysis, which
indicated a lack of similar viral sequences, with the ex- ception of the sequences from O and O-l (Figure 1). Support for phylogenetic relatedness can be estimated by calculating bootstrap proportions (Table 3). A bootstrap proportion above 95%, such as that uniting the viral sequences of O and O-l (97.6%), indicates strong support for linkage between the viruses. However, bootstrap pro- portions below 65%, which were found for all other se- quences including those from patients K and Q, indicate that any similarity between these sequences may be the result of chance alone (12).
For patients X, CC, DD, and U, no blood samples were available for HIV DNA sequencing (Table 4). Patient X had an ex-husband who was infected with HIV and who was an injecting drug user. The viral strain of CC-1, a woman infected with HIV who had been a regular sexual partner of patient CC and who reported no other risk factors, differed from the viruses infecting the dentist and his patients. If we assume that she had been infected by patient CC, we may infer that patient CC was not in- fected by the dentist. The medical records of patient DD show that the patient's husband had had sexual contacts with prostitutes. Patient DD's death certificate indicates that she was widowed. Her dental records showed visits for construction and relining of dentures, procedures that do not involve the intraoral use of sharp instruments. Patient U died before she could be interviewed; no in- formation about her potential risk factors for HIV infec- tion is available. Her husband was located but failed to keep his appointment for HIV testing.
Discussion
We found no evidence for dentist-to-patient or patient- to-patient transmission of HIV infection during dental care, despite breaches in recommended infection-control practices. Although we identified 28 patients with HIV infection who had been cared for by the dentist, most of these patients had sexual or drug-related behaviors that placed them at risk for HIV infection. The identification of numerous persons infected with HIV in the practice of this dentist is not surprising because the dentist worked in an area with a high rate of reported AIDS cases (HRS. Unpublished data). Analysis of HIV nucleotide sequences from the dentist and 24 of the patients infected with HIV indicated that each was infected with a distinct viral strain. This finding was consistent with epidemiologic data suggesting that HIV transmission occurred in the commu- nity rather than in the dental practice.
We must, however, acknowledge several limitations of our study. Although the dentist cared for more than 6000 patients during the last 5 years of his practice, we ob-
Table 2. Dates on Which Invasive Procedures Were Documented in Patient Dental Records
Year January February March April May June July August September October November December
1988 T Z, BB* X H BB 1989 E Kt O S V A, B 1990 N, B D I G S L E 1991 M
* Shared visit day. t Patient K had three invasive procedures during March 1989.
1 December 1994 • Annals of Internal Medicine • Volume 121 • Number 11 857
Table 3. Human Immunodeficiency Virus Nucleotide Diversity in the V3 and Flanking Regions of the Envelope Glyco- protein gp!20
Persons Compared Interperson Variation, % Bootstrap Proportion, %
Dentist and patients Range, 8.0 to 17.0; mean, 13.0 <65.0 All patients Range, 5.0 to 18.0; mean, 12.1 <65.0 Patient O and sexual partner O-l 4.0 97.6
tained HIV antibody test results for only 1279 of these patients. Other patients may have sought testing from their own physicians or may have been tested anony- mously at public facilities. Given the intense publicity that accompanied this case, we believe that most dental pa- tients with HIV infection would have been reported to HRS. However, we can exclude neither the possibility that some patients with HIV infection were not tested for HIV nor the possibility that some patients with positive test results were not reported. Additionally, we could not ob- tain HIV sequence data for four of the patients known to be infected with HIV, which precluded us from defini- tively identifying the source of their infections. However, one of these four patients had known behavioral risk factors for HIV infection, one had a sexual partner whose HIV strain was not similar to the strains infecting the dentist and other patients, and one had had no invasive dental procedures.
Nucleotide sequence analysis was a powerful tool in the study of this dental practice. Given the number of in- fected patients, which was larger than that reported for any other practice, this analysis was essential to the de- termination of whether the patients were infected while receiving dental care. Because of the high mutation rate of HIV, strains from epidemiologically unrelated persons are genetically distinct. As we reported in the study of another Florida dental practice, the presence of similar HIV sequences in different persons implies an epidemio- logic relation between those persons (4). Conversely, in the present study, the lack of similar HIV sequences in the dentist and his former patients implies that these persons acquired their infections independent of one an- other. The only persons with similar HIV strains were patient O and her sexual partner O-l, a finding that validates our other sequencing results.
We found no evidence of patient-to-patient transmis- sion of HIV within this dental practice, but several of the dentist's infection-control procedures, particularly his in- strument reprocessing techniques, did not accord with
recommended practices (13). If reusable dental instru- ments contaminated with the blood or tissue of patients with HIV infection are not appropriately cleaned and disinfected or sterilized between uses, HIV can be trans- mitted to subsequent patients. In this practice, for exam- ple, the dentist used a quaternary ammonium compound to disinfect curettes, which cut soft tissues, and other nonsurgical instruments used intraorally. Quaternary am- monium compounds are low-level disinfectants and are not recommended for use on any instrument used in the mouth (14). In addition, between patients, the dentist wiped the external surfaces of handpieces with alcohol but did not autoclave them. Handpiece and dental unit water lines were not flushed. Because the internal sur- faces of handpieces may become contaminated with pa- tient material during use, retained patient material can be expelled intraorally during use on subsequent patients (15).
Recently, investigators from Australia reported patient- to-patient transmission of HIV in the outpatient practice of a surgeon who was not infected with HIV (16). Four women were apparently infected on the same day, while having skin lesions removed; the most likely source of infection was a homosexual man who had also had a skin lesion removed on the day the women were treated. Al- though the precise route of transmission could not be determined, a failure of infection control most likely re- sulted in transmission of HIV from the man to the four women. No similar cases have been reported from the United States.
Results of this investigation and others indicate that the risk for HIV transmission from an infected health care worker to his or her patients is very small. In addition to this study, investigations involving 12 499 patients of 32 dentists and dental students infected with HIV have failed to document HIV transmission in the practice setting (17-24; CDC. Unpublished data). No HIV transmission from surgeons or obstetrician-gynecologists to patients has been reported. Nonetheless, all health care workers
Table 4. Characteristics of Patients with HIV Infection for Whom No HIV DNA Sequences Were Available*
Patient Age,)> Sex Vital Status
Number of Dental Visits
(Dates)
Dental Procedures Other HIV Risks
X 37 Female Dead 1 (5/88) Extraction Heterosexual transmission CC 30 Male Dead NA NA Multiple sexual partners,
heterosexual transmission DD 69 Female Dead 9 (3/87-12/89) Construction and
relining of dentures No identified risk
U 32 Female Dead 3 (9/86-4/87) Prophylaxis and probable extraction
No identified risk
* HIV = human immunodeficiency virus. NA = not available.
858 1 December 1994 • Annals of Internal Medicine • Volume 121 • Number 11
infected with HIV should be familiar with recommenda- tions for preventing HIV transmission to patients and should follow the specific guidelines that have been im- plemented by their state or territorial health departments (25, 26).
Acknowledgments: The authors thank Stacy Bourgeois, Mercedes Es- calante, Carol Trotter, Charlene Gilbert, Charlotte Gloster, and Tom Walch for epidemiologic assistance; Claudiu Bandea, Chi-Ching Luo, Nick De la Torre, and Jennifer Rapier for laboratory assistance; and Robert Dumbaugh, Alan Lasch, and Donald Marianos for reviewing the dental aspects of the investigation.
Requests for Reprints: Harold W. Jaffe, MD, Division of HIV/AIDS (G29), Centers for Disease Control and Prevention, Atlanta, GA 30333.
Current Author Addresses: Drs. Jaffe, Kalish, and Richards and Ms. Mc- Curdy: Division of HIV/AIDS (G29), Centers for Disease Control and Prevention, Atlanta, GA 30333. Mr. Liberti and Dr. Witte: Florida Department of Health and Rehabili- tative Services, 1317 Winewood Boulevard, Building E, Room 416, Talla- hassee, FL 32399-0700. Dr. Metellus and Ms. Neasman: HRS Dade County Public Health De- partment, Executive Center, 1444 Biscayne Boulevard, Suite 218, Miami, FL 33132. Dr. Bowman: Roche Molecular Systems, Inc., 1145 Atlantic Avenue, Al- ameda, CA 94501.
References 1. Centers for Disease Control. Possible transmission of human immu-
nodeficiency virus to a patient during an invasive dental procedure. MMWR Morb Mortal Wkly Rep. 1990;39:489-93.
2. Centers for Disease Control. Update—transmission of HIV infection during an invasive dental procedure—Florida. MMWR Morb Mortal Wkly Rep. 1991;40:221-7, 233.
3. Centers for Disease Control. Update: transmission of HIV infection during invasive dental procedures—Florida. MMWR Morb Mortal Wkly Rep. 1991;40:377-81.
4. Ou CY, Ciesielski CA, Myers G, Bandea CI, Luo CC, Korber BT, et al. Molecular epidemiology of HIV transmission in a dental practice. Science. 1992;256:1165-71.
5. Ciesielski C, Marianos D, Ou CY, Dumbaugh R, Witte J, Berkelman R, et al. Transmission of human immunodeficiency virus in a dental practice. Ann Intern Med. 1992;116:798-805.
6. Centers for Disease Control and Prevention. Update: investigations of persons treated by HIV-infected health-care workers—United States. MMWR Morb Mortal Wkly Rep. 1993;42:329-31, 337.
7. Gooch B, Marianos D, Ciesielski C, Dumbaugh R, Lasch A, Jaffe H, et al. Lack of evidence for patient-to-patient transmission of HIV in a dental practice. J Am Dent Assoc. 1993;124:38-44.
8. Rogers MF, Ou CY, Rayfield M, Thomas PA, Schoenbaum EE, Abrams E, et al. Use of the polymerase chain reaction for early
detection of the proviral sequences of human immunodeficiency virus in infants born to seropositive mothers. N Engl J Med. 1989;320:1649- 54.
9. Ou CY, Takebe Y, Weninger BG, Luo CC, Kalish ML, Auwanit W, et al. Independent introduction of two major HIV-1 genotypes into dis- tinct high-risk populations in Thailand. Lancet. 1993;341:1171-4.
10. Cabot EL, Beckenbach AT. Simultaneous editing of multiple nucleic acid and protein sequences with ESEE. Comput Appl Biosci. 1989;5: 233-4.
11. Felsenstein J. PHYLIP-Phylogeny Inference Package (Version 3.4). Cladistics. 1989;5:164-6.
12. Hillis DM, Bull JJ. An empirical test of bootstrapping as a method for assessing confidence in phylogenetic analysis. Systematic Biology. 1993; 42:182-92.
13. Centers for Disease Control and Prevention. Recommended infection- control practices for dentistry, 1993. MMWR Morb Mortal Wkly Rep. 1993;42(RR-8):1-12.
14. Favero MS, Bond WW. Chemical disinfection of medical and surgical materials. In: Block SS, ed. Disinfection, Sterilization, and Preserva- tion. 4th ed. Philadelphia: Lea & Febiger; 1991:617-41.
15. Lewis DL, Boe RK. Cross-infection risks associated with current pro- cedures for using high-speed dental handpieces. J Clin Microbiol. 1992;30:401-6.
16. Chant K, Lowe D, Rubin G, Manning W, O'Donoughue R, Lyle D, et al. Patient-to-patient transmission of HIV in private surgical consult- ing rooms. Lancet. 1993;342:1548-9.
17. Comer RW, Myers DR, Steadman CD, Carter MJ, Rissing JP, Te- desco FJ. Management considerations for an HIV positive dental student. J Dent Educ. 1991;55:187-91.
18. Heuer MA. Recent dental school experiences concerning HIV positive students-Northwestern, 1991-92. J Dent Educ. 1992;56:528-35.
19. Cottone JA, Kalkwarf KL, Kuebker WA. The assessment of an HIV seropositive student at the University of Texas Health Science Center at San Antonio Dental School. J Dent Educ. 1992;56:536-9.
20. Taylor M. Recent dental school experiences concerning HIV positive students: Creighton University. J Dent Educ. 1992;56:540-7.
21. Dickinson GM, Morhart RE, Klimas NG, Bandea CI, Laracuente JM, Bisno AL. Absence of HIV transmission from an infected dentist to his patients. An epidemiologic and DNA sequence analysis. JAMA. 1993;269:1802-6.
22. Arnow PM, Chou T, Shapiro R, Sussman EJ. Maintaining confiden- tiality in a look-back investigation of patients treated by a HIV- infected dentist. Public Health Rep. 1993;108:273-8.
23. York AK, Arthur JS. Determining the HIV status of patients of three HIV-positive Navy dentists. J Am Dent Assoc. 1993;124:74-7.
24. Longfield JN, Brundage J, Badger G, Vire D, Milazzo M, Ray K, et al. Look-back investigation after human immunodeficiency virus serocon- version in a pediatric dentist. J Infect Dis. 1994;169:1-8.
25. Centers for Disease Control. Recommendations for preventing trans- mission of human immunodeficiency virus and hepatitis B virus to patients during exposure-prone invasive procedures. MMWR Morb Mortal Wkly Rep. 1991;40(RR-8):l-9.
26. Bell DM, Shapiro CN, Gooch BF. Preventing HIV transmission to patients during invasive procedures. J Public Health Dent. 1993;53: 170-3.
1 December 1994 • Annals of Internal Medicine • Volume 121 • Number 11 859
mge_a4_study_q3.PDF
RESEARCH ARTICLE
Vector Competence of American Mosquitoes
for Three Strains of Zika Virus
James Weger-Lucarelli, Claudia Rückert, Nunya Chotiwan, Chilinh Nguyen, Selene
M. Garcia Luna, Joseph R. Fauver, Brian D. Foy, Rushika Perera, William C. Black,
Rebekah C. Kading, Gregory D. Ebel*
Department of Microbiology, Immunology and Pathology, Colorado State University, Fort Collins, Colorado
* Gregory.Ebel@colostate.edu
Abstract
In 2015, Zika virus (ZIKV; Flaviviridae; Flavivirus) emerged in the Americas, causing mil-
lions of infections in dozens of countries. The rapid spread of the virus and the association
with disease outcomes such as Guillain-Barré syndrome and microcephaly make under-
standing transmission dynamics essential. Currently, there are no reports of vector compe-
tence (VC) of American mosquitoes for ZIKV isolates from the Americas. Further, it is not
clear whether ZIKV strains from other genetic lineages can be transmitted by American
Aedes aegypti populations, and whether the scope of the current epidemic is in part facili-
tated by viral factors such as enhanced replicative fitness or increased vector competence.
Therefore, we characterized replication of three ZIKV strains, one from each of the three
phylogenetic clades in several cell lines and assessed their abilities to be transmitted by
Ae. aegypti mosquitoes. Additionally, laboratory colonies of different Culex spp. were
infected with an American outbreak strain of ZIKV to assess VC. Replication rates were var-
iable and depended on virus strain, cell line and MOI. African strains used in this study out-
competed the American strain in vitro in both mammalian and mosquito cell culture. West
and East African strains of ZIKV tested here were more efficiently transmitted by Ae.
aegypti from Mexico than was the currently circulating American strain of the Asian lineage.
Long-established laboratory colonies of Culex mosquitoes were not efficient ZIKV vectors.
These data demonstrate the capacity for additional ZIKV strains to infect and replicate in
American Aedes mosquitoes and suggest that neither enhanced virus replicative fitness
nor virus adaptation to local vector mosquitoes seems likely to explain the extent and inten-
sity of ZIKV transmission in the Americas.
Author Summary
The mechanisms contributing to the explosive nature of the current ZIKV outbreak in the Americas are poorly understood. Therefore, we characterized the replication of three strains, one from each phylogenetic clade of ZIKV and evaluated virus strain differences in transmission efficiencyby Americanmosquitoes. Our results suggest that the strain cur- rently circulating in the Americas does not have unusually high infectivity for American
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 1 / 16
a11111
OPENACCESS
Citation: Weger-Lucarelli J, Rückert C, Chotiwan N,
Nguyen C, Garcia Luna SM, Fauver JR, et al.
(2016) Vector Competence of American
Mosquitoes for Three Strains of Zika Virus. PLoS
Negl Trop Dis 10(10): e0005101. doi:10.1371/
journal.pntd.0005101
Editor: Michael J Turell, INDEPENDENT
RESEARCHER, UNITED STATES
Received: July 23, 2016
Accepted: October 9, 2016
Published: October 26, 2016
Copyright: © 2016 Weger-Lucarelli et al. This is an open access article distributed under the terms of
the Creative Commons Attribution License, which
permits unrestricted use, distribution, and
reproduction in any medium, provided the original
author and source are credited.
Data Availability Statement: All relevant data are
within the paper and its Supporting Information
files.
Funding: This work was supported by National
Institutes of Health grant #AI067380 and
#AI125996. In addition, the work was supported in
part by funds from the Colorado State University
office of the Vice President For Research, CVMBS
and DMIP. The funders had no role in study
design, data collection and analysis, decision to
publish, or preparation of the manuscript.
Ae. aegypti as compared to the African strains used in this study. Colonized Culex mosqui- toes were inefficient vectors. In vitro data suggested slower replication and decreased fit- ness for the currently circulating American strain compared to African strains isolated decades ago. Therefore, viral adaptation to local mosquitoes does not appear, at present, to be driving the current ZIKV outbreak in the Americas.
Introduction
Zika virus (ZIKV, Flaviviridae; Flavivirus), was first isolated from a febrile sentinel rhesus mon- key in Uganda in 1947 [1]. Until recently, ZIKVwas associated with periodic outbreaks of febrile illness in humans. Prior to 2007, the geographic range was restricted to Africa and parts of Southeast Asia; having been reported fromNigeria [2], Malaysia [3], Sierra Leone [4], Senegal [5], and Indonesia [6]. In 2007, a large outbreak of ZIKV occurredon the island of Yap in Micronesia, which later spread to French Polynesia (2013), New Caledonia (2014), Cook Islands (2014) and Easter Island (2014), before eventually arriving in Brazil in 2014–15 [7–9]. Since arriving in the Americas, local transmission has been reported in a total of 39 countries in the hemisphere as far south as Argentina (http://www.cdc.gov/zika/geo/active-countries.html).
The epidemic of ZIKV in the Americas has been explosive. The factors underlying the rapid spread of the epidemic are likely complex and poorly understood. Based on previous experience withWest Nile (WNV) [10] and chikungunya (CHIKV) [11–14] viruses, however, it seems likely that viral factors, and potentially adaptations, that influence vector transmission may at least partially account for the rapid spread of ZIKV. Accordingly, we sought to determine whether the currently circulating ZIKV strain had higher replication rates and/or fitness in vitro, or was transmitted more efficiently by American Aedes (Stegomyia) aegypti mosquitoes as compared to two different OldWorld strains. Additionally, we sought to determine the suscep- tibility of several colonies of Culex spp. mosquitoes to the currently circulating American strain. Our studies provide evidence that a strain of ZIKV currently circulating in the Americas (a) does not replicate more efficiently (b) is of decreased competitive fitness and (c) is transmitted efficiently by American Ae. aegypti, but not Culex spp. mosquitoes. Collectively, this work expands our knowledge on transmission of the currently circulating Asian lineage ZIKV in Ae. aegypti and the potential of divergent ZIKV lineages to be transmitted by Americanmosquitoes.
Materials and Methods
Cells, viruses and mosquitoes
Vero (ATCC CCL-81) and Huh7 (a kind gift from Dr. Richard Kuhn) cells were maintained in Dulbecco’s modifiedEagle’s medium (DMEM) containing 10% fetal bovine serum (FBS) and 50μg/mL gentamycin at 37°C with 5% CO2. C6/36 cells (ATCC CRL-1660) were maintained in MEMwith 10% FBS and 50μg/mL gentamycin at 28°C with 5% CO2. Aag2 cells (obtained from Dr. Aaron Brault) were maintained in Schneider’s insect mediumwith 10% FBS at 28°C.
ZIKV strains PRVABC59 (Accession # KU501215) and MR766 (Accession #AY632535) were obtained from the CDC. Strain 41525 (Accession #KU955591) was obtained from the University of Texas Medical Branch. All viruses were propagated in Vero cells by infection at a MOI of 0.01. Supernatant was harvested 5–6 days post-infection, clarified by centrifugation at 4°C and aliquoted into single use vials before freezing at -80°C. PRVABC59 was isolated in 2015 from an infected human in Puerto Rico and was passaged four times on Vero cells [15]. MR766, the prototype ZIKV strain was isolated from a rhesus macaque in 1947 in the Zika
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 2 / 16
Competing Interests: The authors have declared
that no competing interests exist.
forest in Uganda and was passaged 149 times in sucklingmouse brains, followed by three addi- tional Vero passages [1]. The 41525 strain was isolated in Senegal in 1984 from Ae. (Stegomyia) africanus (Theobald)mosquitoes and was passaged once in Ae. (Stegomyia) pseudoscutellaris (Theobald) cells, once in C6/36 cells, and 4 times in Vero cells [16].
Aedes aegypti were collected from wild populations in Poza Rica, Mexico [17]. Mosquitoes were maintained on calf blood and given 10% sucrose ad libitum. Larvaewere reared and adults maintained under controlled conditions of temperature (28°C), humidity (70% RH), and light (14:10 L:D diurnal cycle). Experiments involving infectious ZIKV in mosquitoes were performed under BSL3 conditions. The generation of mosquitoes used for these studies was between F11-F13.
For Culex infections, three species of laboratory-colony derivedmosquitoes were used; Culex (Cx.) quinquefasciatus Say, Culex (Cx.) pipiens [L.], and Culex (Cx.) tarsalis Coquillett. The Cx. pipiens colony was derived from egg rafts collected in Pennsylvania in 2002. The Cx. tarsalis mosquitoes were derived from a colony maintained by WK Reisen and collected in Cal- ifornia in 1953. The Cx. quinquefasciatus colony was originally collected in Sebring County, Florida in 1988. Larvaewere raised on a diet of powdered fish food. Pupae were allowed to emerge into containers and adult mosquitoes were kept at 26–27°C with a 16:8 light:dark cycle and 70%-80% relative humidity, with water and sucrose provided ad libitum.
In vitro replication
Multi- and one-step growth curveswere performed on Aag2, C6/36, Huh7, and Vero cells at MOI of 0.01 and 10, respectively. The day before infection, cells were seeded in T25 flasks in triplicate for each virus. Prior to infection, a mock T25 for each cell line was used to count for MOI calculations. Following two hours absorption, virus inoculumwas removed, cells were washed with PBS and fresh culture media was added. At each time point (0, 12, 24, 36, 48, 72, 96, 120, 144, and 168 hours), 500μL supernatant was harvested and frozen for later titration. Cells were then supplemented with 500μL fresh media at each time point. Viral titers were determined by plaque assay.
Vector competence studies
For comparison of fresh and frozen virus on vector competence, Vero cells were infected at a MOI of 0.01 with PRVABC59 4 days prior to a blood-meal of female mosquitoes of the F11-F13 generation (5–7 days post-eclosion). Supernatant was harvested and centrifuged at 3,000xg for 10 min at 4°C to remove any cellular debris. Clarified supernatant was transferred to a clean tube, brought to a 20% concentration of FBS, and aliquoted into two tubes. The first tube, designated “fresh”, was placed at 4°C until furthermanipulation (~4 hours). The second tube designated “frozen”, was placed at -80°C either for 4 hours or for more than 1 week, and then thawed at 37°C. Mosquitoes were then exposed concurrently to a blood-meal containing 500μL defibrinated calf blood, 5mMATP (100ul) and 400μL supernatant from either fresh or the two different frozen virus stocks. Following 1-hour feeding,mosquitoes were anesthetized at 4°C and engorged females were separated into new cartons and maintained on sucrose at 28°C. Back-titrations of each infectious blood-meal on Vero cells estimated ZIKV titers to be 2.0x106 PFU/mL and 1.6x107 PFU/mL for fresh and frozen virus, respectively. These values are close to the range of viremia that has been previously reported for hospitalized cases of ZIKV infection [18].
For additional studies using only frozen virus, an infectious blood-meal containing 1.6x107
PFU/mL ZIKVwas used. Three experimental replicates were performedwith each strain of ZIKV and Ae. aegypti (Poza Rica). For Culex mosquitoes, three replicates were performed for
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 3 / 16
Cx. quinquefasciatus and one for both Cx. tarsalis and Cx. pipiens. Following each infectious blood-meal, back-titration was performed to ensure that virus titers mosquitoes were exposed to during each experimental replicate were comparable. For all studies, on 7 and 14 days post- infection, a subset of mosquitoes was knocked down by cold treatment at 4°C. Legs/wingswere removed and transferred into a tube containing 250μL mosquito diluent (1x PBS supplemented with 20% FBS (heat-inactivated), 50 μg/ml Penicillin/Streptomycin, 50 μ/ml Gentamycin, 2.5μg/ml Fungizone) and a stainless steel bead for homogenization. The mosquito proboscis was inserted into a capillary tube containing immersion oil (~5μL) and allowed to salivate for 20 min. Following salivation, mosquito bodies were placed in a separate tube containing mos- quito diluent and a bead. The ends of capillary tubes containing oil and saliva were broken off into microcentrifuge tubes containing 100μL mosquito diluent. Mosquito tissues (bodies, and legs+wings) were homogenized at 25 cycles/second for one min using a RetschMixer Mill MM400 (Germany) and centrifuged at 15,000xg for 5 min at 4°C. Clarified supernatant was titrated by Vero cell plaque assay to determine the amount of infectious virus present in mos- quito bodies. The determination of vector competence was performed essentially as described by Turell et al. [19]. Briefly, the infection rate is defined as the percentage of exposedmosqui- toes positive for infectious virus in the body. Dissemination is reported as the percent of exposedmosquitoes that contained infectious virus in their legs and wings, regardless of infec- tion status. The transmission rate is reported as the percent of exposedmosquitoes that contain infectious virus in the saliva, regardless of infection status. Transmission (disseminated) rate (transmission (D) rate) is reported as the percent of mosquitoes with infectious virus in the saliva that were also positive for infectious virus in the legs.
Competitive Fitness
Competitive fitness was assessed using direct competition assays between each strain of virus in Vero, Huh7, C6/36 and Aag2 cells essentially as previously described [10,20]. Briefly, viruses were mixed 1:1 at a MOI of 0.01 in triplicate and then added to confluent monolayers of cells. After two hours, virus inoculumwas removed and fresh mediumwas added. Supernatant was then harvested at 2 and 3 days post-infection and stored at -80°C for subsequent analysis. RNA was extracted and the region between nucleotides 3649 and 3960 was amplified by RT-PCR. Bands were subjected to Sanger sequencing and the proportion of each virus was assessed by analyzing chromatograms with PolySNP [21].
Statistical analysis
Comparisons of virus titers in growth curveswere performed using two-way ANOVA with Tukey’s correction at each time point. A two-tailed Fisher’s exact test was used to compare rates of infection, dissemination and transmission in vector competence studies. GraphPad Prism 6.0 (La Jolla, CA) was used for all statistical tests and significancewas defined as p<0.05.
Results
Phylogeny of ZIKV
Fig 1 depicts the phylogenetic analysis of 29 ZIKV sequences obtained from GenBank using neighbor-joiningmethods (using the Tamura-Nei genetic distance model [22]) with 1,000 bootstrap pseudoreplicates (maximum likelihood and maximum parsimony analyses were per- formed and yielded similar tree topography). As previously reported [15], ZIKV sequences sep- arate into three distinct genetic clades;West African, East African, and Asian. For this study, we selected one strain from each clade: strain 41525 from Senegal represented theWest African
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 4 / 16
clade, prototype strain MR766 from Uganda represented the East African clade, and the cur- rently-circulating strain from the Americas, PRVABC59 from Puerto Rico, belongs to the Asian clade. The three viruses will be herein referred to as PRVABC59 (Americas), 41525 (West African), and MR766 (East African).
Growth kinetics in vitro
Viral replication was assessed using single- and multi-step growth curves in two mammalian and two mosquito derived cell lines. In Vero cells, which lack functional type-1 interferon (IFN), growth kinetics were similar among the three viruses tested at bothMOIs of 0.01 and 10. For MOI of 0.01 at 48h post-infection, significantly higher amounts of virus were observed for PRVABC59 than MR766 but not for 41525 (p = 0.005) (Fig 2a). At peak replication, 72h post-infection, 41525 had a significantly higher titer than MR766, but not PRVABC59 (p = 0.02). At a MOI of 10, no significant differences were observedbetween any of the strains during peak replication (Fig 2b), however at later time points, 41525 and PRVABC59 titers dropped quickly to significantly lower titers, which was also observed at a MOI of 0.01. In C6/36 cells, which have a deficient RNAi pathway [23], differences in replication were more apparent. Particularly, titers for PRVABC59 were significantly lower at most time points than either 41525 or MR766 after 12 hours and prior to 96h post-infection (Fig 2c). PRVABC59 peak titers subsequently recovered as compared to MR766, which appeared to plateau earlier than the other viruses. At a MOI of 10, 41525 and PRVABC59 also had higher peak titers at 72h than MR766 (p<0.001 for either comparison). In contrast to Vero cells, Huh7 cells, which are IFN competent, displayed vastly different susceptibility to replication by different strains. MR766, which is highly mammalian adapted, replicated to high titers faster at bothMOIs of 0.01 and 10 (Fig 2e and 2f). The fall in titer at later time points correspondedwith strong CPE caused by MR766 at bothMOI. In multi-step growth curves, 41525 also replicated at higher levels than PRVABC59 in Huh7 cells (Fig 2e). In Aag2 cells, which are competent for RNAi, lower levels of replication were observed than in C6/36 cells (Fig 2g and 2h). Peak replication levels were lower for MR766 than either 41525 or PRVABC59, although replication levels were
Fig 1. Phylogenetic tree of 29 Zika virus isolates. The tree was generated by Neighbor-Joining methods
using the Tamura-Nei genetic distance model (bootstrapped 1,000 times). Similar results were obtained
using maximum parsimony or maximum likelihood algorithms. Strains used in this study are shown in bold;
distinct lineages are East African (MR766), West African (41525), and Asian (PRVABC59).
doi:10.1371/journal.pntd.0005101.g001
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 5 / 16
Fig 2. Growth of ZIKV strains in different cell types in vitro. Cells were infected with ZIKV strains at a MOI of
0.01 or 10. Following infection, cells were washed and fresh growth medium was added. Supernatant was
harvested at the indicated time points for titration via plaque assay. (A) Vero MOI 0.01 (B) Vero MOI 10 (C) C6/36
MOI 0.01 (D) C6/36 MOI 10 (E) Huh7 MOI 0.01 (F) Huh7 MOI 10 (G) Aag2 MOI 0.01 (H) Aag2 MOI 10.
doi:10.1371/journal.pntd.0005101.g002
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 6 / 16
similar for all three strains during the first 72h post-infection at a MOI of 0.01 (Fig 2g). Virus titers appeared to peak around 104 PFU/mL for MR766 at both of the MOI tested, suggesting this virusmay have lost some ability to replicate in RNAi competent mosquito cells during mammalian passage, as this was not as apparent in C6/36 cells.
African ZIKV strains have a direct fitness advantage in vitro
We have previously shown that direct fitness assays can detect differences that may be unap- parent in relative replication assays like growth curves [24]. In competition assays in Vero cells, the proportion of PRVABC59 dropped slightly at 2 and 3 days post-infection, as compared to either of the African strains (Fig 3a). Little change in the proportion of virus was observeddur- ing replication betweenMR766 and 41525. In Huh7 cells, MR766 outcompeted both 41525 and PRVABC59, becoming the dominant virus by day 2 post-infection and essentially pushing the other strains to extinction by day 3 (Fig 3b). In C6/36, PRVABC59 dropped below the limit of detection (~10%) at 3 days post-infectionwhen competed with either other virus (Fig 3c). A similar result occurredwith 41525 vs MR766, with the former becoming the dominant virus present in the sample 3 days post-infection. Similarly, in Aag2 cells, PRVABC59 was outcom- peted by both African viruses, and by day 3 was only present at low levels, compared to the other two strains (Fig 3d).
Freezing ZIKV results in decreased infection, dissemination and
transmission in Ae. aegypti
Previous studies have shown that reduced rates of mosquito infection are observedwhen fro- zen and thawed virus is used versus freshly harvested virus (i.e. collecting supernatant directly from cells at the peak infection for use in artificial blood-mealswithout previous freezing) [25– 27]. Since little is known about mosquito infections with ZIKV, we first tested whether frozen- thawed virus was equivalent to fresh virus in mosquito infections. Comparing virus that was harvested fresh versus frozen for 4 hours, or frozen for greater than one week, there were clear differences in infectivity to Ae. aegypti mosquitoes, particularly at early time points (Fig 4a). Seven days post-blood-meal, infection rates were significantly lower for virus that had been fro- zen for over one week (n = 126–144) but not when it was frozen for just 4 hours (n = 45–48), as compared to fresh virus (n = 48 for both time points) (Fig 4a). However, the use of fresh virus was associated with significantly higher dissemination rates on day 7 than either of the other two groups (Fig 4b). No differences were observedon Day 14 between fresh virus or virus that was frozen for only 4 hours, however all values except transmission (d) rate were significantly lower for virus frozen for longer times as compared to the other two groups (Fig 4c & 4d). Although the infection rates were not significantly different at either time point for mosquitoes exposed to unfrozen virus as compared to those exposed to virus that had been frozen for only 4 hours, infection rates were consistently higher in the mosquitoes exposed to the unfrozen virus. In fact, when infection rates were combined for both day 7 and 14 (which should not change after virus exposure)mosquitoes fed fresh virus have a statistically significantly higher rate of infection than do those fed virus that was frozen for 4 hours (p = 0.01).
Vector competence of Mexican Ae. aegypti is highly strain specific
To assess the vector competence of Mexican Ae. aegypti for different strains of ZIKV, mosqui- toes were fed an artificial blood-meal and tissues harvested 7 and 14 days later. Infection rates were significantly higher on days 7 and 14 for mosquitoes exposed to strain 41525 (n = 126 for both time points) as compared to groups exposed to either MR766 or PRVABC59 (n = 144 for both groups, for both time points) (Fig 5a). Dissemination of ZIKV on day 7 and day 14 post-
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 7 / 16
infectionwas significantly lower for MR766- or PRVABC59-infected mosquitoes as compared to mosquitoes infected with 41525 (Fig 5b). Furthermore, after 7 and 14 days following blood- meal, the transmission rate was significantly higher for either African virus, as compared to PRVABC59 (Fig 5c). Additionally, the transmission (d) rate was significantly higher for strain
Fig 3. Select strains of East and West African ZIKV have higher fitness in vitro than the American strain PRVABC59. Equal amounts of
virus (MOI 0.01) was used to infect the indicated cell line. Supernatant was harvested and proportion of each virus was determined by sequencing
and analyzing chromatograms. Data are presented as proportion of the first virus listed present at the indicated time point in (A) Vero, (B) Huh7, C6/
36 (C), and (D) Aag2 cells.
doi:10.1371/journal.pntd.0005101.g003
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 8 / 16
41525 as compared to PRVABC59 at both time points (Fig 5d), indicating this virus strain may have a fitness advantage in these mosquitoes.
Colonized Culex mosquitoes are refractory to ZIKV PRVACB59
infection
Mosquitoes in the genus Culex are also important arbovirus vectors, particularly of other flavi- viruses;WNV [10], Japanese encephalitis virus [28] and St. Louis encephalitis virus [29].
Fig 4. Long term freezing of virus lowers infection rates of Aedes aegypti mosquitoes. Ae. aegypti (Poza Rica strain) mosquitoes were fed an
infectious blood-meal containing 1.6x107 PFU of ZIKV (PRVABC59 strain) that was harvested directly from Vero cells (and stored at 4˚C for 4 hours)
or frozen for 4 hours or more than a week at -80˚C. Mosquitoes were held for 7 or 14 days (n = 48 each time point for each group) and then (A)
Infection rate (% of mosquitoes with virus in their bodies), (B) Dissemination Rate (% of mosquitoes, regardless of infection status, with virus in their
legs), (C) Transmission Rate (% of mosquitoes, regardless of infection status, with virus in their saliva) and (D) Transmission (D) Rate (% of
mosquitoes with a disseminated infection, with virus in their saliva) were collected. * Indicates p<0.05, ** p<0.01, and *** p<0.001 by two-tailed Fisher’s exact test. n = 48–144 for each group at each time point. n.d. indicates that samples were not collected for this time-point.
doi:10.1371/journal.pntd.0005101.g004
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 9 / 16
Therefore, we sought to determine whether the epidemic American strain PRVABC59 could be efficiently transmitted by several species of Culex mosquitoes. Neither fresh nor frozen ZIKV efficiently infected any of the three species tested (Cx. quinquefasciatus, Cx. tarsalis, and Cx. pipiens) (Table 1). Except for infectious virus detected in one Cx. quinquefasciatus mos- quito exposed to frozen ZIKV, no mosquitoes became infected (Cx. quinquefasciatus n = 144, Cx. tarsalis n = 20, and Cx. pipiens n = 48).
Fig 5. Mexican Aedes aegypti have increased vector competence for African strains of ZIKV. Mosquitoes were fed a blood-meal containing
1.6x107 PFU of different ZIKV. Mosquitoes were then held for 7 or 14 days (n = 48 each time point for each group) and then (A) Infection rate (% of
mosquitoes with virus in their bodies), (B) Dissemination Rate (% of mosquitoes, regardless of infection status, with virus in their legs), (C)
Transmission Rate (% of mosquitoes, regardless of infection status, with virus in their saliva) and (D) Transmission (D) Rate (% of mosquitoes with a
disseminated infection, with virus in their saliva) were collected. * Indicates p<0.05, ** p<0.01, and *** p<0.001 by two-tailed Fisher’s exact test. n = 126–144 for each group at each time point.
doi:10.1371/journal.pntd.0005101.g005
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 10 / 16
Discussion
The vector competence of mosquitoes from the Americas for transmission of ZIKV is not well defined, despite the ongoing explosive outbreak. This study aimed to define the growth kinet- ics, relative fitness and vector competence of Mexican Ae. aegypti mosquitoes for several strains of ZIKV, including an Asian lineage strain isolated during the ongoing ZIKV outbreak in the Americas. In addition, we sought to examine the effect of freezing ZIKV prior to per- forming mosquito experiments. Finally, we tested infectivity of ZIKV in several species of Culex mosquitoes.
While some differences in replication kinetics were observed in mammalian cells between strains, the most obvious differences were noted in mosquito cells, particularly C6/36, in which both African strains reached significantly higher titers at many time-points in both one- and multi-step growth curves. These data were further supported by vector competence results, as PRVABC59 had lower infectivity in Ae. aegypti mosquitoes that were originally collected in Poza Rica, Mexico as compared to the other two virus strains. This observationwas surprising, as the population of Ae. aegypti used is expected to be closely related to the populations that vector ZIKV strain PRVABC59 in the current outbreak. Furthermore, competitive fitness data in vitro strengthen the conclusion that both African strains tested here were more fit in mos- quitoes than the Asian lineage isolate, as the latter became extinct in competition with either of the African viruses in vitro.
The effect of freezing ZIKV on vector competence is notable and should be considered when designingmosquito infection experiments. It is unclear what factors are playing a role in this loss in infectivity as short-term freezing did not appear to have the same effect as more extended storage at -80°C. Previous reports have suggested that virionmorphologymay be altered during freezing, which causes a specific reduction in infectivity in mosquito cells [30]. It has also been shown recently that the flavivirusNS1 protein is critical for mosquito infection, down-regulating host immune responses which results in increased infection rates [31]. Stabil- ity of NS1, which exists in dimeric and hexameric forms, has been shown to rely on surface gly- cosylation, which could be affected during long term freezing [32]. Loss of an N-linked glycan on NS1 was shown to reduce interaction with mammalian complement proteins, indicating interactions with mosquito proteins may also be compromised. Future studies comparing the mosquito immune response with fresh or frozen virus should be performed to assess what role NS1 may be playing in this loss in infectivity. Supplementation of exogenous NS1 may be suffi- cient to regain levels of mosquito infection with frozen virus, thus allowing the generation of long-term frozen stocks to be usedmore consistently.
In all measures tested here (growth kinetics,mosquito infections, competition assays, and genome-to-PFU ratios), the African strains displayed either equal or greater fitness than the currently circulating American strain PRVABC59 of the Asian genotype. This result was
Table 1. Infection of Culex spp after peroral exposure to ZIKV PRVABC59.
Species Bloodmeal Titer (PFU/mL) Fresh or Frozen Day 7 Day 14
Cx. quinq 1.6x107 Frozen (1 week) 1/48 0/48
Cx. quinq 1.6x107 Frozen (1 week) 0/48 0/48
Cx. quinq 5.0x106 Fresh 0/48 0/48
Cx. pipiens 5.0x106 Fresh 0/48 0/48
Cx. tarsalis 5.0x106 Fresh ND 0/20
Ae. aegypti 1.6x107 Frozen (1 week) 67/141 86/144
Ae. aegypti 1.6x107 Fresh 48/48 43/45
doi:10.1371/journal.pntd.0005101.t001
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 11 / 16
particularly surprising for MR766, which has been extensively passaged in mice and, as a result, may have been expected to lose the ability to replicate efficiently in intact mosquitoes [33,34]. The reason for this is unknown and these differences should be determined by in-depth phylo- genetic analyses using a reverse genetics approach to assess the relative importance of different regions of the virus genome in viral fitness in mosquitoes and vertebrate hosts. One limitation of this study is that a single strain from each ZIKV lineage was used in these studies (and MR766 was highly passaged); the relationships of these strains to wild-type strains remains to be determined, but genetic differences among sequencedmembers of each clade appear to be minimal [15]. Nonetheless, the high relative fitness and mosquito transmissibility of the Afri- can strains (which were more highly passaged compared to PRVABC59) suggests that passage has not resulted in loss of vector infectivity. Based on the data presented here, it appears that the explosive nature of the current outbreak may not be solely due to viral genetic factors, but rather other factors such as a naïve human population, underreporting in Africa and Asia, increased global travel, poor hygiene, and an abundance of sufficiently competent, highly anthropophilic mosquito vectors. It is possible that a convergence of entomological, viral and human factors are responsible for the current ZIKV outbreak. Determiningwhy large ZIKV outbreaks are rare, non-existent or go unreported in Africamay provide clues on factors involved in the current outbreak. Additional studies are necessary to identify specific viral resi- dues that may be important in adaptation to transmission in the Americas by comparing them to residues in previously circulating strains in Asia. It is conceivable that one or several muta- tions allow for increased replication in humans or certainmosquito species; as has previously been seenwith chikungunya virus [12,14,35]. In addition, as an RNA virus, the ZIKV strain cir- culating in the Americas is expected to adapt further, therefore continued surveillance of circu- lating strains and additional vector competence work with these strains is necessary. Furthermore, active surveillance is needed for ZIKV in Africa, as very little is known about sero-prevalence or the currently circulating African strains. The African strains of ZIKV used in this study were isolated decades ago and may not represent the currently circulating geno- types. If the currently circulating strains of ZIKV have an advantage in Americanmosquito species or populations as compared to viruses in the Asian lineage, it is possible that introduc- tion would result in increased spread and possibly more disease.
Previous studies examining vector competence of Aedes mosquitoes for ZIKV have pro- duced conflicting results. Wong et al. [36] showed that Ae. (Stegomyia) albopictus Skuse mos- quitoes from Singapore were highly susceptible to ZIKV strain MR766, with 100% of mosquitoes having infectious virus in the saliva by day 14 post-blood-meal.Following the Yap island outbreak, Ledermann et al. [37] showed high infection rates and modest dissemination rates in Ae. (Stegomyia) hensilli Farner mosquitoes using ZIKV strainMR766 8 days after infec- tious blood-meal. In contrast, Diagne et al. [38] reported very low dissemination and almost no transmission of several strains of ZIKV (includingMR766 and several strains from Senegal) in SenegaleseAedes mosquitoes. Given the role of Ae. aegypti in the current outbreak in the Americas, it was interesting that low transmission was observed among domestic or sylvatic Ae. aegypti from Senegal whenmosquitoes were infected with local strains of ZIKV. Finally, using an Asian genotype strain of ZIKV from New Caledonia and several populations of Ae. aegypti and Ae. albopictus from the Americas, Chouin-Carneiro et al. [39] showed high levels of infection and moderate and low levels of dissemination and transmission, respectively, simi- lar to the results reported here for ZIKV strain PRVABC59. While these studies involved dif- ferent strains of ZIKV and different species and collections of mosquitoes from diverse geographic locations, these data demonstrate the variability that can be observed in vector competence studies, and the dependency on the particular virus and mosquito strains evalu- ated and experimental parameters employed. Mosquitoes used in this study were of the
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 12 / 16
F11-F13 generation and thus it is possible that these results do not reflect the actual transmis- sion phenotype of field mosquitoes. Although studies using such mosquitoes are critical, our goal here was mainly to assess whether the explosive nature of the current outbreak was attrib- utable to high transmissibility and/or replicative capacity of the virus strain in its current envi- ronment. Further studies should examine the refractory nature of Senegalesemosquitoes to local ZIKV strains and investigate the specific determinants of vector competence of American Ae. aegypti mosquitoes for transmitting outbreak strains of ZIKV from the Asian lineage as compared with either of the African lineages. It is possible that different American populations of Ae. aegypti are more susceptible to the ZIKV strain currently circulating in the Americas and this is facilitating the current outbreak. Bennett et al. showed that vector competence can vary greatly among Ae. aegypti populations in Mexico.[40]
In the laboratory colonies of Culex mosquitoes tested here, we observedvery little to no infectionwith the epidemic strain of ZIKV, PRVABC59. Several reports have now shown Culex spp. to be refractory to infection [41–45], including one field report [46]. Only one report has shown Culex to be susceptible to ZIKV infection [47]. This is the first report of VC of Cx. tarsalis mosquitoes with ZIKV. The laboratory colonies used here; despite extensive time in colony, have been used at length for WNV experimentationwith high infection, dissemination and transmission rates, providing evidence that they are not generally refractory to flavivirus infection [48]. Further, field populations of Cx. pipiens, Cx. quinquefasciatus, and Cx. tarsalis are not nearly as anthropophilic as Ae. aegypti (although Cx. quinquefasciatus may readily feed on humans in some environments [49]), taking a large proportion of bloodmeals from birds and other non-human vertebrate hosts [50,51]. Therefore, it is unlikely that these species will play a major role in ZIKV transmission. This also predicts that it is unlikely that ZIKV circu- lates in epizootic cycles involving birds, at least in North America.
Our data demonstrate that the three strains of ZIKV tested here can replicate and dissemi- nate in Ae. aegypti mosquitoes originally collected from Mexico. Interestingly, the two strains of ZIKV from Africa displayed higher rates of infection, dissemination and transmission in these mosquitoes than the American strain of the Asian lineage that is currently circulating. This was unexpected, as MR766 has a long passage history in mice, which is thought to lead to fitness costs in mosquitoes [33,34]. This provides additional evidence that the ZIKV strain cur- rently circulating in the Americas does not have higher fitness in Americanmosquitoes. This finding suggests the possibility that introduction of other lineages of ZIKV could result in autochthonous transmission. This is significant, because the extent of cross-protection between ZIKV genotypes is unknown, and new reports have shown that antibody-dependent enhance- ment (ADE) can occur through ZIKV interaction with anti-dengue antibodies [52]. Further experiments should be performed to assess the protection conferred from one genotype of ZIKV to another. Taken together, our data show that American Ae. aegypti, but not Culex, mosquitoes are susceptible to several strains of ZIKV.
Author Contributions
Conceptualization: JWL CRNC CN SMGL BDF RP WCB RCKGDE.
Funding acquisition: RP BDF GDE.
Investigation: JWL CRNC CN SMGL JRF RCK.
Methodology: JWL CRNC CN SMGL JRF BDF RP WCB RCK GDE.
Resources: JWL CR NC CN SMGL JRF BDF RP WCB RCK GDE.
Supervision:GDE.
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 13 / 16
Visualization: JWL.
Writing – original draft: JWL.
Writing – review& editing: JWL CRNC CN SMGL JRF BDF RP WCB RCK GDE.
References 1. Dick GW, Kitchen SF, Haddow AJ (1952) Zika virus. I. Isolations and serological specificity. Trans R
Soc Trop Med Hyg 46: 509–520. PMID: 12995440
2. Macnamara FN (1954) Zika virus: a report on three cases of human infection during an epidemic of
jaundice in Nigeria. Trans R Soc Trop Med Hyg 48: 139–145. PMID: 13157159
3. Marchette NJ, Garcia R, Rudnick A (1969) Isolation of Zika virus from Aedes aegypti mosquitoes in
Malaysia. Am J Trop Med Hyg 18: 411–415. PMID: 4976739
4. Robin Y, Mouchet J (1975) [Serological and entomological study on yellow fever in Sierra Leone]. Bull
Soc Pathol Exot Filiales 68: 249–258. PMID: 1243735
5. Renaudet J, Jan C, Ridet J, Adam C, Robin Y (1978) [A serological survey of arboviruses in the human
population of Senegal]. Bull Soc Pathol Exot Filiales 71: 131–140. PMID: 33772
6. Olson JG, Ksiazek TG, Suhandiman, Triwibowo (1981) Zika virus, a cause of fever in Central Java,
Indonesia. Trans R Soc Trop Med Hyg 75: 389–393. PMID: 6275577
7. Duffy MR, Chen TH, Hancock WT, Powers AM, Kool JL, et al. (2009) Zika virus outbreak on Yap
Island, Federated States of Micronesia. N Engl J Med 360: 2536–2543. doi: 10.1056/
NEJMoa0805715 PMID: 19516034
8. Tognarelli J, Ulloa S, Villagra E, Lagos J, Aguayo C, et al. (2016) A report on the outbreak of Zika virus
on Easter Island, South Pacific, 2014. Arch Virol 161: 665–668. doi: 10.1007/s00705-015-2695-5
PMID: 26611910
9. Cao-Lormeau VM, Roche C, Teissier A, Robin E, Berry AL, et al. (2014) Zika virus, French polynesia,
South pacific, 2013. Emerg Infect Dis 20: 1085–1086. doi: 10.3201/eid2006.140138 PMID: 24856001
10. Moudy RM, Meola MA, Morin LL, Ebel GD, Kramer LD (2007) A newly emergent genotype of West
Nile virus is transmitted earlier and more efficiently by Culex mosquitoes. Am J Trop Med Hyg 77:
365–370. PMID: 17690414
11. Tsetsarkin KA, Vanlandingham DL, McGee CE, Higgs S (2007) A single mutation in chikungunya virus
affects vector specificity and epidemic potential. PLoS Pathog 3: e201. doi: 10.1371/journal.ppat.
0030201 PMID: 18069894
12. Tsetsarkin KA, Chen R, Yun R, Rossi SL, Plante KS, et al. (2014) Multi-peaked adaptive landscape for
chikungunya virus evolution predicts continued fitness optimization in Aedes albopictus mosquitoes.
Nat Commun 5: 4084. doi: 10.1038/ncomms5084 PMID: 24933611
13. Agarwal A, Sharma AK, Sukumaran D, Parida M, Dash PK (2016) Two novel epistatic mutations (E1:
K211E and E2:V264A) in structural proteins of Chikungunya virus enhance fitness in Aedes aegypti.
Virology 497: 59–68. doi: 10.1016/j.virol.2016.06.025 PMID: 27423270
14. Tsetsarkin KA, Weaver SC (2011) Sequential adaptive mutations enhance efficient vector switching
by chikungunya virus and its epidemic emergence. PLoS Pathog 7: e1002412. doi: 10.1371/journal.
ppat.1002412 PMID: 22174678
15. Lanciotti RS, Lambert AJ, Holodniy M, Saavedra S, Signor Ldel C (2016) Phylogeny of Zika Virus in
Western Hemisphere, 2015. Emerg Infect Dis 22: 933–935. doi: 10.3201/eid2205.160065 PMID:
27088323
16. Ladner JT, Wiley MR, Prieto K, Yasuda CY, Nagle E, et al. (2016) Complete Genome Sequences of
Five Zika Virus Isolates. Genome Announc 4.
17. Vera-Maloof FZ, Saavedra-Rodriguez K, Elizondo-Quiroga AE, Lozano-Fuentes S, Black WC Iv
(2015) Coevolution of the Ile1,016 and Cys1,534 Mutations in the Voltage Gated Sodium Channel
Gene of Aedes aegypti in Mexico. PLoS Negl Trop Dis 9: e0004263. doi: 10.1371/journal.pntd.
0004263 PMID: 26658798
18. Waggoner JJ, Gresh L, Vargas MJ, Ballesteros G, Tellez Y, et al. (2016) Viremia and Clinical Presen-
tation in Nicaraguan Patients Infected with Zika Virus, Chikungunya Virus, and Dengue Virus. Clin
Infect Dis.
19. Turell MJ, Wilson WC, Bennett KE (2010) Potential for North American mosquitoes (Diptera: Culicidae)
to transmit rift valley fever virus. J Med Entomol 47: 884–889. PMID: 20939385
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 14 / 16
20. Gordon A, Henn MR, Harris E (2011) Dynamics of dengue disease severity determined by the interplay
between viral genetics and serotype-specific immunity. Science translational . . ..
21. Hall GS, Little DP (2007) Relative quantitation of virus population size in mixed genotype infections
using sequencing chromatograms. J Virol Methods 146: 22–28. doi: 10.1016/j.jviromet.2007.05.029
PMID: 17640742
22. Tamura K, Nei M (1993) Estimation of the number of nucleotide substitutions in the control region of
mitochondrial DNA in humans and chimpanzees. Mol Biol Evol 10: 512–526. PMID: 8336541
23. Brackney DE, Scott JC, Sagawa F, Woodward JE, Miller NA, et al. (2010) C6/36 Aedes albopictus
cells have a dysfunctional antiviral RNA interference response. PLoS Negl Trop Dis 4: e856. doi: 10.
1371/journal.pntd.0000856 PMID: 21049065
24. Grubaugh ND, Smith DR, Brackney DE, Bosco-Lauth AM, Fauver JR, et al. (2015) Experimental evolu-
tion of an RNA virus in wild birds: evidence for host-dependent impacts on population structure and
competitive fitness. PLoS Pathog 11: e1004874. doi: 10.1371/journal.ppat.1004874 PMID: 25993022
25. Richards SL, Pesko K, Alto BW, Mores CN (2007) Reduced infection in mosquitoes exposed to blood
meals containing previously frozen flaviviruses. Virus research.
26. Turell MJ (1988) Reduced Rift Valley fever virus infection rates in mosquitoes associated with pledget
feedings. Am J Trop Med Hyg 39: 597–602. PMID: 3207178
27. Miller BR, Beaty BJ, Aitken TH, Eckels KH, Russell PK (1982) Dengue-2 vaccine: oral infection, trans-
mission, and lack of evidence for reversion in the mosquito, Aedes aegypti. Am J Trop Med Hyg 31:
1232–1237. PMID: 7149108
28. Okuno T, Mitchell CJ, Chen PS, Wang JS, Lin SY (1973) Seasonal infection of Culex mosquitos and
swine with Japanese encephalitis virus. Bull World Health Organ 49: 347–352. PMID: 4369158
29. Maharaj PD, Bolling BG, Anishchenko M, Reisen WK, Brault AC (2014) Genetic Determinants of Dif-
ferential Oral Infection Phenotypes of West Nile and St. Louis Encephalitis Viruses in Culex spp. Mos-
quitoes. Am J Trop Med Hyg 91: 1066–1072. doi: 10.4269/ajtmh.14-0289 PMID: 25157120
30. Miller BR (1987) Increased yellow fever virus infection and dissemination rates in Aedes aegypti mos-
quitoes orally exposed to freshly grown virus. Trans R Soc Trop Med Hyg 81: 1011–1012. PMID:
3503398
31. Liu J, Liu Y, Nie K, Du S, Qiu J, et al. (2016) Flavivirus NS1 protein in infected host sera enhances viral
acquisition by mosquitoes. Nature Microbiology 1: 16087. doi: 10.1038/nmicrobiol.2016.87 PMID:
27562253
32. Somnuke P, Hauhart RE, Atkinson JP, Diamond MS, Avirutnan P (2011) N-linked glycosylation of den-
gue virus NS1 protein modulates secretion, cell-surface expression, hexamer stability, and interactions
with human complement. Virology 413: 253–264. doi: 10.1016/j.virol.2011.02.022 PMID: 21429549
33. Coffey LL, Vasilakis N, Brault AC, Powers AM, Tripet F, et al. (2008) Arbovirus evolution in vivo is con-
strained by host alternation. Proc Natl Acad Sci U S A 105: 6970–6975. doi: 10.1073/pnas.
0712130105 PMID: 18458341
34. Weaver SC, Brault AC, Kang W, Holland JJ (1999) Genetic and fitness changes accompanying adap-
tation of an arbovirus to vertebrate and invertebrate cells. J Virol 73: 4316–4326. PMID: 10196330
35. Tsetsarkin KA, McGee CE, Volk SM, Vanlandingham DL, Weaver SC, et al. (2009) Epistatic roles of
E2 glycoprotein mutations in adaption of chikungunya virus to Aedes albopictus and Ae. aegypti mos-
quitoes. PLoS One 4: e6835. doi: 10.1371/journal.pone.0006835 PMID: 19718263
36. Wong PS, Li MZ, Chong CS, Ng LC, Tan CH (2013) Aedes (Stegomyia) albopictus (Skuse): a potential
vector of Zika virus in Singapore. PLoS Negl Trop Dis 7: e2348. doi: 10.1371/journal.pntd.0002348
PMID: 23936579
37. Ledermann JP, Guillaumot L, Yug L, Saweyog SC, Tided M, et al. (2014) Aedes hensilli as a potential
vector of Chikungunya and Zika viruses. PLoS Negl Trop Dis 8: e3188. doi: 10.1371/journal.pntd.
0003188 PMID: 25299181
38. Diagne CT, Diallo D, Faye O, Ba Y, Faye O, et al. (2015) Potential of selected Senegalese Aedes spp.
mosquitoes (Diptera: Culicidae) to transmit Zika virus. BMC Infect Dis 15: 492. doi: 10.1186/s12879-
015-1231-2 PMID: 26527535
39. Chouin-Carneiro T, Vega-Rua A, Vazeille M, Yebakima A, Girod R, et al. (2016) Differential Suscepti-
bilities of Aedes aegypti and Aedes albopictus from the Americas to Zika Virus. PLoS Negl Trop Dis
10: e0004543. doi: 10.1371/journal.pntd.0004543 PMID: 26938868
40. Bennett KE, Olson KE, Munoz Mde L, Fernandez-Salas I, Farfan-Ale JA, et al. (2002) Variation in vec-
tor competence for dengue 2 virus among 24 collections of Aedes aegypti from Mexico and the United
States. Am J Trop Med Hyg 67: 85–92. PMID: 12363070
41. Amraoui F, Atyame-Nten C, Vega-Rua A, Lourenco-de-Oliveira R, Vazeille M, et al. (2016) Culex mos-
quitoes are experimentally unable to transmit Zika virus. Euro Surveill 21.
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 15 / 16
42. Fernandes RS, Campos SS, Ferreira-de-Brito A, Miranda RM, Barbosa da Silva KA, et al. (2016)
Culex quinquefasciatus from Rio de Janeiro Is Not Competent to Transmit the Local Zika Virus. PLoS
Negl Trop Dis 10: e0004993. doi: 10.1371/journal.pntd.0004993 PMID: 27598421
43. Hall-Mendelin S, Pyke AT, Moore PR, Mackay IM, McMahon JL, et al. (2016) Assessment of Local
Mosquito Species Incriminates Aedes aegypti as the Potential Vector of Zika Virus in Australia. PLoS
Negl Trop Dis 10: e0004959. doi: 10.1371/journal.pntd.0004959 PMID: 27643685
44. Aliota MT, Peinado SA, Osorio JE, Bartholomay LC (2016) Culex pipiens and Aedes triseriatus Mos-
quito Susceptibility to Zika Virus. Emerg Infect Dis 22.
45. Huang YS, Ayers VB, Lyons AC, Unlu I, Alto BW, et al. (2016) Culex Species Mosquitoes and Zika
Virus. Vector Borne Zoonotic Dis.
46. Guerbois M, Fernandez-Salas I, Azar SR, Danis-Lozano R, Alpuche-Aranda CM, et al. (2016) Out-
break of Zika Virus Infection, Chiapas State, Mexico, 2015, and First Confirmed Transmission by
Aedes aegypti Mosquitoes in the Americas. J Infect Dis.
47. Guo XX, Li CX, Deng YQ, Xing D, Liu QM, et al. (2016) Culex pipiens quinquefasciatus: a potential vec-
tor to transmit Zika virus. Emerg Microbes Infect 5: e102. doi: 10.1038/emi.2016.102 PMID: 27599470
48. Grubaugh ND, Weger-Lucarelli J, Murrieta RA, Fauver JR, Garcia-Luna SM, et al. (2016) Genetic Drift
during Systemic Arbovirus Infection of Mosquito Vectors Leads to Decreased Relative Fitness during
Host Switching. Cell Host Microbe 19: 481–492. doi: 10.1016/j.chom.2016.03.002 PMID: 27049584
49. Samuel PP, Arunachalam N, Hiriyan J, Thenmozhi V, Gajanana A, et al. (2004) Host-feeding pattern
of Culex quinquefasciatus Say and Mansonia annulifera (Theobald) (Diptera: Culicidae), the major
vectors of filariasis in a rural area of south India. J Med Entomol 41: 442–446. PMID: 15185948
50. Kent R, Juliusson L, Weissmann M, Evans S, Komar N (2009) Seasonal blood-feeding behavior of
Culex tarsalis (Diptera: Culicidae) in Weld County, Colorado, 2007. J Med Entomol 46: 380–390.
PMID: 19351092
51. Kent RJ, Reiche AS, Morales-Betoulle ME, Komar N (2010) Comparison of engorged Culex quinque-
fasciatus collection and blood-feeding pattern among four mosquito collection methods in Puerto Bar-
rios, Guatemala, 2007. J Am Mosq Control Assoc 26: 332–336. doi: 10.2987/09-5953.1 PMID:
21033062
52. Dejnirattisai W, Supasa P, Wongwiwat W, Rouvinski A, Barba-Spaeth G, et al. (2016) Dengue virus
sero-cross-reactivity drives antibody-dependent enhancement of infection with zika virus. Nat
Immunol.
Vector Competence of American Mosquitoes for ZIKV
PLOS Neglected Tropical Diseases | DOI:10.1371/journal.pntd.0005101 October 26, 2016 16 / 16