Molecular Genetics

1

The genetics and epigenetics of wizardry.

Foreword: The data and examples are intended to be an exercise in synthesizing what you’ve

learned in class in a hypothetical human genetics application. The only information you will

need to go through this exam is the one provided in class and in the body of this exam. You will

not need to read JK Rowling’s “Harry Potter” books although reading the books or seeing the

movies may increase your enjoyment in solving the problems!

A few notes and tips:

- Most questions are open answers: be concise! Quality, not quantity, matters. - Solving the puzzle here involves using the UCSC genome browser. Please see the notes at

the end of this exam on how to use the UCSC genome browser. - When indicated, please pay attention to the notes.

Just in case: Genome Browser User Guide: http://genome.ucsc.edu/goldenPath/help/hgTracksHelp.html Genome Browser FAQ: http://genome.ucsc.edu/FAQ/

2

The Board of Governors at Hogwart’s School of Witchcraft and Wizardry has given you a grant

to identify the gene that separates witches and wizards from mere Muggles (non-magic humans).

The reason they’re funding this research is that they want to identify an early screening test to

identify the best aspiring young witches and wizards for acceptance to their prestigious school.

The currently enrolled students at Hogwarts are roughly equally represented as girls (witches)

and boys (wizards). Although the majority of students come from marriages of witches and

wizards and are “pure-bloods”, many students are “half-bloods.” “Mum’s a witch, Dad’s a

Muggle. He was sure surprised when he found out!” Family pedigrees of Harry Potter, Ron

Weasley and Seamus Finnigan are shown as examples in Figure 1.

More curious are the fairly common cases of “Mudbloods” that are witch or wizard children born

to two Muggle parents and the rare cases of “Squibs” that are born to witch and wizard parents in

“pure-blood” families, but are incompetent at performing magic. You decide to investigate these

families and take extensive family histories and DNA samples from the following three families:

Harry’s friend Hermione Granger is considered a “Mudblood” because both her parents are both

Muggles. Hermione is the only child of Mr. and Mrs. Granger. Mr. Granger has two brothers

and his parents and their three children are all Muggles. Mrs. Granger has two sisters who are

both Muggles and unmarried. Although Mrs. Granger’s parents are still alive and both

Muggles, she reports having a “crazy old wizard” for a grandfather on her dad’s side who is

still alive at 99 years although his wife, a Muggle, died years ago. Through a nurse working at

St Mungo's Hospital for Magical Maladies and Injuries who takes care of him on weekends,

you are able to track down Mrs. Granger’s grandfather and interview him. While his memory is

not what it used to be, he clearly indicates that his Mom was a witch while his Dad was “good

for naught” when it came to magic.

The first-year pest Colin Creevey is also considered a “Mudblood” because both his parents are

Muggles. Colin heard all about Hogwarts and the wizarding world from his maternal

grandfather, a wizard that married a Muggle and had two daughters and a son, all Muggles.

Colin’s maternal grandparents are both alive and Colin and his brother Dennis, also a wizard,

are their only grandchildren. Colin’s paternal grandparents are dead but were reportedly both

Muggles.

Argus Filch is the curmudgeonly caretaker at Hogwarts who is bitter towards the young students

at Hogwarts because he is a “Squib”. Although born to an extended wizarding family, he

dropped out of Hogwarts after a year because he was unable to successfully perform even the

simplest spells or incantations. Although Filch is somewhat uncooperative towards your

research, fortunately, his parents are still alive and help you complete the family history.

Argus has a sister and a brother that were successful Hogwarts graduates and fully functioning

witch and wizard. Argus’ father was an only child from several generations of “pure-blood”

witches and wizards. Argus’ mother also comes from an extended lineage of pure-bloods and

has three brothers and one sister, all who successfully perform magic. All four siblings

married witches or wizards and all three brothers had children (two each) who were all

successful witches or wizards. Argus’s aunt had two daughters and two sons. The eldest son

(Phinneas) and daughter (Hazel) were “Squibs” like Argus, while the youngest two children

could easily perform magic.

3

Question 1. (10 pts) Draw the pedigrees for these three families (use closed symbols for

magic folks – feel free to be artistic if so inclined!). Include all individuals mentioned in

the descriptions. What are the possible patterns of inheritance?

(tip – you do not need to list all possible patterns of inheritance. Instead, I suggest you come

back to the question after you work through to the end of Question 4 and write here the most

likely inheritance pattern according to your research).

4

You perform linkage analysis on half-blood and Mudblood families and discover a significant

linkage between the ability to perform magic and a portion of chromosome 17q12 spanning

coordinates chr17:37,560,000-37,821,000.

2. (10 pts) Using the UCSC Genome Browser (https://genome.ucsc.edu make sure to use

Human 2009 (GRCh37/hg19 Assembly)), list the characterized UCSC genes at this locus

and:

1) indicate in one or two sentences what their presumptive function is.

2) indicate what is the likely expression status of each gene in human H1 embryonic

stem cells (H1-ESC) based on their epigenetic landscape. Take into account the

distribution of H3K4me3, H3K9Ac, H3K27me3 and H3K36me3. Justify your

conclusions on their expression status in H1-ESCs.

Notes:

1- to look for gene function, make sure the “UCSC Genes” track is displayed (can be

found under “Genes and Gene Prediction” tab) and click on each gene.

2- to access the chromatin data, look under the “Regulation / ENC histone modification”

tab of the UCSC genome browser. Choose “full” display for the data. Click on

“Broad Histone” and only choose the H1-ESC cell type and only the histone marks

mentioned above. Click “submit” when done with selection. If need be, CpG islands

can be displayed under the “Regulation” tab.

5

Since none of these genes are obvious candidates for the magic trait, you perform Comparative

Genomic Hybridization using microarrays scanning across the region to identify potential

chromosomal variations. Using this approach, you successfully identify a ~0.8 kb insertion in

witch/wizard families that is not observed in normal controls (pure muggle families). Upon

further sequencing, you map the insertion exactly to position 37,761,706 in the NEUROD2 gene.

The sequence of the inserted region is given below.

Question 3. (22 pts) Using the BLAT sequence alignment tools within the UCSC Genome

Browser, trace back the origin of this insertion and answer the following questions.

A) (4 points) Where does this sequence originate from in the human genome?

B) (4 points) How does the inserted sequence relate to (and differ from) the original

genomic sequence?

C) (6 points) Based on what you learned in class, provide a plausible mechanism by which

this insertional event might have occurred. How does the proposed mechanism explain the

observations?

D) (4 points) What is the consequence of this insertion on the protein-coding potential of

the NEUROD2 gene?

6) (4 points) What type of promoter transcribes NEUROD2 and what tissue-specificity does

NEUROD2 show?

6

You develop a PCR assay for routine screening of the presence of the insertion using one reverse

primer hybridizing upstream of the insertion site and one primer hybridizing downstream of the

insertion site (Figure 2A). Figure 2B show the genotyping results for Harry Potter, Seamus

Finnigan, Ron Weasley and two Muggle controls. Genotyping results from the pedigrees in

question #1 are also given in a Table format using “+” for the presence of the insertion and “-“

for its absence.

Question 4. (10 pts) Based on this information, particularly in the Mudblood (Granger) and

half-blood (Creevey) pedigrees, what do you conclude about the mode of inheritance of the

magic trait? Explain your reasoning and why certain inheritance modes can be rejected or

preserved as possible.

7

You then develop an assay for determining the methylation status of the NEUROD2 insertion.

Genomic DNA collected from subjects is cleaved with two restriction enzymes including the

NaeI restriction enzyme, which is blocked by the presence of a 5-methyl-C at the internal

cytosine in its recognition sequence (5’-GCCGGC-3’). The other enzyme is the HindIII enzyme

that recognizes 5’-AAGCTT-3’ and is insensitive to the presence of DNA methylation. For each

sample, you perform two sets of digests: one with HindIII only and one with both NaeI and

HindIII. The digests are then separated according to size after agarose gel electrophoresis and the

lengths of the NEUROD2 associated alleles are revealed by a Southern blot. The position of the

restriction enzyme cut sites along the region, as well as the location of the Southern probe and

the results from this experiment are shown in Figure 3.

Note: the use of a “probe” in a Southern blot assay allows you to only reveal fragments that are

exactly complementary to it. Otherwise, there are million of HindIII and NaeI cut sites in the

human genome and you would not be able to image your locus of interest out of the many, many

fragments produced by the digest.

Question 5. (14 pts)

A) Based on the results of the Southern blot methylation analysis in Fig. 3, provide a

molecular model for the inheritance of the magic trait that would fit all pedigrees.

B) Explain it in detail in the case of Harry Potter and of Hermione Granger’s family.

C) Propose a hypothesis (or hypotheses) that would explain how the “Squib” phenotype can

occur, as seen in Filch’s pedigree.

8

Question 6. (6 pts) Lucius Malfoy, a member of the Board of Governors, secretly

approaches you about providing his own private funding for a new project. He brings you

a sample from cryogenically stored blood taken from a certain wizard he refuses to name.

He asks you to characterize it using your Southern blot assay. You reluctantly agree to do

so and the results are shown in Figure 4. What do you conclude from this? What could

have caused this pattern?

Question 7. (8 points) Visibly excited by your findings, Lucius is now asking you to

generate a live clone from the cells he has provided. You are suspicious that he is under the

employ of Lord Voldemort and this is yet another attempt by Voldemort to gain

immortality. Based on your understanding of the genetics of wizardry and the current

state of mammalian cloning, explain to him using scientific objectivity and reason the

feasibility, potential outcomes and ethical issues associated with his plan.

9

10

11

12

13

SEQUENCE OF INSERTION AT NEUROD2

TCAGTGTCTCCGCCTTCCGGCTGCCATCTCCTGAGCGAGCTGCGCTGCCCCCCGGAACCCTAGG

GCCCGCGAGAGCCGTTCCTCGCTGGGCACTAGCCAGGGCCCCGGGGAACCCGGGATCTGGTCGT

TGGAATCCTCAGCGCGGCGCTCAGGAGGAGAAACCGTGGGGCTATCGGCGGCCGCCTCTGGACT

AGGCTCCGGGCTGCCCCGGGCCTTCTTGAGCGTCGTCCGGGATGGAGGGTGCTGAACTAGCGAA

GTGCTGCTGCTGCGAGACCCCGTTACCTCCGGCCCTCCAGGATCTGGGCTGCGATATGGCCATG

ACGGGACAACTCCTTTTCGGGGCTCTCCCACACCTCGAGGCTTGCCAGGGTGGGTCTCCAGAGG

CCGACGAATAACCAGGTGGAGCTGGGGGCCTCCAGCTCGGATCCGCTCCACGGCCTTGGCCTGG

GTGAGGCCTTGCGTTGACTCTCCGTTGATGTGGAGCACGAGGTCCCCGACCTGTGGCCGGTGAT

CCACAATAGTGGCATGAGGCAGGCGACTGTCTGTGACCTCTATGTCCGCAGAGTCCAGCACGCT

AACAGACTCCTTCCGGCGCAGGCGCAATGTGGCGCCCGCCCTGCGTACCAGCGCTGCCACGTCG

ACCGCAGCTCGCGCCGCCAGGGGGCGCGCGTCCAACCGCGCCACGAGCTGCCGGGCGCTAGGGC

CCGCGAGCGGGGAGGGGCCGCGGCTTCCTCTGCTCTCCTTAGGGTTCGCGGCGCCCCGTGTGCG

CGGCTCCAT