Annotated Bibliography
Science ~MAS
D JSTOR
Natural Selection and the Origin of jingwei, a Chimeric Processed Functional Gene in Drosophila
Author(s): Manyuan Long and Charles H. Langley
Source: Science , Apr. 2, 1993, New Series, Vol. 260, No. 5104 (Apr. 2, 1993), pp. 91-95
Published by: American Association for the Advancement of Science
Stable URL: https://www.jstor.org/stable/2881129
JSTOR is a not-for-profit service that helps scholars, researchers, and students discover, use, and build upon a wide range of content in a trusted digital archive. We use information technology and tools to increase productivity and facilitate new forms of scholarship. For more information about JSTOR, please contact support@jstor.org.
Your use of the JSTOR archive indicates your acceptance of the Terms & Conditions of Use, available at https://about.jstor.org/terms
American Association for the Advancement of Science is collaborating with JSTOR to digitize, preserve and extend access to Science
This content downloaded from �������������71.57.134.161 on Wed, 29 Dec 2021 11:13:06 UTC�������������
All use subject to https://about.jstor.org/terms
111:~~I HlllllllH'lllf-'lllillllllllllll®I-Hll11!11&111elllll!llill11flll!llll!!IIH Jll■l■lallll REPORTS
Phosphoinositides could serve as specific membrane targets that bind proteins re quired for the formation of transport vesi cles, such as the polypeptides of the adaptor complex that link clathrin to the cytoplas mic tails of certain transmembrane receptor proteins {for example, the mannose-6-phos phate receptor) (28). Vesicles from rat adi pocytes that contain the glucose transporter also contain PI 4-kinase, which may regulate the transport (fusion) of these vesicles with the plasma membrane in response to insulin (29). In addition to its potential role in signaling cell proliferation, PI 3-kinase asso ciated with receptor protein tyrosine kinases at the plasma membrane may also take part in the endocytosis and down-regulation {ly sosomal degradation) of these receptors. In this way, the duration and the magnitude of the growth signal might be modulated. The association of Vps34p with the membrane appears to be mediated by the product of another VPS gene, VPS15. The VPS15 gene encodes a membrane-associated protein ki nase (Vpsl5) (30, 31) that can be chem ically cross-linked to Vps34p (21). This raises the possibility that the Vpsl5 and Vps34 proteins may function together as components of a signal transduction com plex that regulates intracellular protein sorting decisions.
REFERENCES AND NOTES
1. L. C. Cantley et al., Cell 64, 281 (1991). 2. J. M. Backer et al., EMBO J. 11, 3469 (1992). 3. S. Soltoff, S. Rabin, L. Cantley, D. Kaplan, J. Biol.
Chem. 267, 17472 (1992). 4. M. J. Berridge and R. F. Irvine, Nature 341,197
(1989). 5. M. Whitman et al., ibid. 332,644 (1988). 6. D. L. Lips et al., J. Biol. Chem. 264, 8759 (1989). 7. L.A. Serunian et al., ibid., p. 17809. 8. C. Carpenter et al., ibid. 265, 19704 (1990). 9. F. Shibasaki, Y. Homma, T. Takenawa, ibid. 266,
8108 (1991). 10. M. Otsu et al., Cell 65, 91 (1991 ). 11. I. D. Hiles et al., ibid. 70,419 (1992). 12. C. A. Koch, D. Anderson, M. F. Moran, C. Ellis, T.
Pawson, Science 252, 668 (1991). 13. P. Hu et al., Mo/. Cell. Biol. 12, 981 (1992). 14. C. J. McGlade et al., ibid., p. 991. 15. P. K. Herman and S. D. Emr, ibid. 10, 6742 (1990). 16. S. Kornfeld and I. Mellman, Annu. Rev. Cell Biol.
5, 483 (1989). 17. D. J. Klionsky, P. K. Herman, S. D. Emr, Microbial.
Rev. 54, 266 (1990). 18. J. E. Rothman and L. Orci, Nature 355, 409
(1992). 19. T. Stevens et al., Cell 30, 439 (1982). 20. T. R. Graham and S. D. Emr, J. Cell Biol. 114, 207
(1991). 21. J. H. Stack, P. K. Herman, P. V. Schu, S. D. Emr,
EMBO J., in press. 22. K. R. Auger, C. L. Carpenter, L. C. Cantley, L.
Varticovski, J. Biol. Chem. 264, 20181 (1989). 23. G. Endemann, S. N. Dunn, L. C. Cantley, Bio
chemistry26, 6845 (1987). 24. Genetics Computer Group sequence analysis
package; University of Wisconsin. 25. S. K. Hanks eta/., Science 241, 42 (1988). 26. D. R. Knighton et al., ibid. 253, 407 (1991). 27. M. P. Sheetz and S. J. Singer, Proc. Natl. Acad.
Sci. U.S.A. 71, 4457 (1974). 28. B. M. Pearse and M. S. Robinson, Annu. Rev. Cell
Biol. 6, 151 (1990).
29. R. L. Del Vecchio and P. F. Pilch, J. Biol. Chem. 266, 13278 (1991).
30. P. K. Herman et al., Cell 64, 425 (1991). 31. P. K. Herman, J. H. Stack, S. D. Emr, EMBOJ.10,
4049 (1991). 32. T. Kunkel, Proc. Natl. Acad. Sci. U.S.A. 82, 5463
(1985). 33. F. Sherman, G. R. Fink, L. W. Lawrence, Methods in
Yeast Genetics: A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, NY, 1979).
34. M. Whitman et al., Nature 315,239 (1985). 35. J. P. Walsh, K. K. Caldwell, P. W. Majerus, Proc.
Natl. Acad. Sci. U.S.A. 88, 9184 (1991). 36. L. J. Wickerham, J. Bacterial. 52, 293 (1946). 37. K. R. Auger et al., Cell 57, 167 (1989). 38. We thank members of the Emr lab for discussions
and G. Huyer" for his help in optimizing the Pl 3-kinase assay. Supported by the Howard Hughes Medical Institute, a grant from the NSF (to S.D.E.), and by a fellowship from the Deutsche Forschungs gemeinschaft (to P.V.S.). S.D.E. is an investigator of the Howard Hughes Medical Institute.
8 October 1992; accepted 13 January 1993
Natural Selection and the Origin of jingwei, a Chimeric Processed Functional Gene in Drosophila
Manyuan Long* and Charles H. Langley
The origin of new genes includes both the initial molecular events and subsequent pop ulation dynamics. A processed Drosophila alcohol dehydrogenase (Adh) gene, previously thought to be a pseudogene, provided an opportunity to examine the two phases of the origin of a new gene. The sequence of the processed Adh messenger RNA became part of a new functional gene by capturing several upstream exons and introns of an unrelated gene. This novel chimeric gene, jingwei, differs from its parent Adh gene in both its pattern of expression and rate of molecular evolution. Natural selection participated in the origin and subsequent evolution of this gene.
How genes with novel functions evolve remains a fundamental and fascinating ques tion. Gene duplications (1), exon shuffling, and processed genes (2) have been suggested as important sources of novel genes, but little is known about the evolutionary mech anisms or the participation of natural selec tion in their early history. Our analysis of the structure, expression, and evolution of a putative processed Adh pseudogene in Dro sophila provided an opportunity to examine both the early molecular events and the evolutionary processes that created it. The jingwei (igw) gene, as we named it (3), is a locus located on chromosome 3 in the Dro sophila sibling species D. teissieri and D. yakuba. A part of jgw was initially observed to hybridize to the Adh probe (4). Further analysis suggested that in a single event, in the ancestor of the two species the Adh portion of this potential pseudogene was retrotransposed from an mRNA of the Adh locus on chromosome 2 (5). To understand the molecular population genetics of this potential pseudogene, we investigated its within-species DNA sequence variation. However, our results convince us thatjgw is not a pseudogene and that the Adh-derived sequence is a part of a novel gene.
The Adh-derived portion was sequenced from ten jgw alleles of D. teissieri and of 20 jgw alleles of D. yakuba collected from natural populations (6). Figure 1 shows the
Section of Genetics, Section of Evolution and Ecology, and Center for Population Biology, University of Cali fornia at Davis, Davis, CA 95616.
•To whom correspondence should be addressed.
SCIENCE • VOL. 260 • 2 APRIL 1993
distribution of nucleotide polymorphisms within species and the variation between species in a 765-bp segment that corre sponds to the protein coding region of the Adh gene. Only one possible ancestral poly morphism was apparent {site 782). A sum mary of the DNA sequence variation in this region is presented {Table 1).
Unexpectedly, most polymorphisms were silent {eight out of ten in D. teissieri and 19 out of 21 in D. yakuba). If jgw were a pseudo gene in which mutations had no phenotypic effect, most changes would be at replacement sites and there would be a reasonable frequen cy of stop codons (7). No new stop codons were present. Another prediction of the pseu dogene hypothesis is that a pseudogene has a higher overall level of nucleotide variation. Estimates of DNA sequence polymorphism in jgw were similar to that found in the Adh gene {Table 1) and are typical of many functional genes in Drosophila (=0.005) (8). A compar ison of between-species divergence also re vealed a significant bias toward silent versus replacement substitutions, and the degree of bias was smaller than for the within-species comparison. The bias was noted in the earlier study (5) but by itself was not large enough to convince the authors that this was not a pseudogene. In addition, insertions and dele tions are abundant in the evolution of mam malian pseudogenes (7). In jgw, no length polymorphism or divergence was observed in the coding region (9). These molecular pop ulation genetic observations imply that the Adh-derived sequence is all or part of jgw, a new functional gene in D. teissieri and D. yakuba. This conclusion motivated our search
91
This content downloaded from �������������71.57.134.161 on Wed, 29 Dec 2021 11:13:06 UTC�������������
All use subject to https://about.jstor.org/terms
D.teissieri D.yalcuba Fig. 1. Polymorphic and divergent differ ences in the Adh-de rived portion of jgw. The nucleotide posi tions are indicated in the first column, num bered according to that reported from D. yaku ba (5). The second and thirteenth columns show the consensus nucleo tides. The dots indicate that the nucleotides are identical to those of the consensus. The first row contains the numbers of the sequenced alleles (10 from D. teissieri and 20 from D. yakuba).
I 2 3 4 5 6 7 I 9 10 I 2 3 • 5 6 l I • 10 11 12 ll 14 IS 16 17 IM 1fl 20 219 225 231 232 2•s 2•6 254 297 323 335 365 369 370 372 3H 387 388 389 390 ... 08 •so •s1 09 •60 •61 •63 .,. 00 ••2 •97 sea 525 526 527 535 557 566 569 581 599 608 614 650 680 719 728 70 ,., 776 779 782 785 112 863 178 884 887 893
••• 917 9U 951 960 961 974 977
G A T C G C G C G C G G C C C T G C Q G A A C Q Q C A A Q C C T C G C C Q G C G G G Q C C G C G T C C A T T Q Q C Q Q C A C A T Q C G
i: ;.
;.
o
o
;-
for an RNA from jgw and a more detailed analysis of its structure.
Northern (RNA) analysis (10) of both total and polyadenylate [poly(A) ]-selected RNAs from adults probed with jgw yielded only a single band that corresponded in size to that derived from the Adh gene (11). Because of the sequence similarity between the two genes and the abundance of the Adh mRNA, this result was not surprising. Two interpretations are possible. (i) The jgw
A
;- ;- ;- ;.
A i:: A C
G T A G A A A G G C G A A A A G C T A T G T G T C C G G A C T C G C A C Q Q Q A G C T C C A C G T C C A G T
o
;.
o C i::
o
o o o
G G
Q T Q A T Q C C C A A A C T Q
f
;-
o
;-
;.
;-
mRNA may be detectably abundant but obscured by the Adh signal if its size is similar to that of Adh. (ii) The jgw mRNA may be so rare (or nonexistent) that it was undetect able by the Northern technique.
We used the polymerase chain reaction (PCR) in conjunction with reverse transcrip tion (RT-PCR) (12) to identify RNAs with greater sensitivity and specificity than is pos sible with Northern analysis. Several regions can be found in which Adh and the Adh-
Table 1. Summary of the variation within and between species. The numbers of segregating (or polymorphic) sites are classified as replacement (R) and silent (S). Estimates of 8 and 'II' are measures of within-population variation in terms of the parameter 4Nµ per nucleotide, assuming the neutral theory of molecular evolution (20) where N is the effective population size and µ is the mutation rate for selectively equivalent nucleotides. The values of divergence between species (average divergence per nucleotide) are the results of averaging pairwise comparisons between the alleles from the two species minus average within-species differences, subject to the multiple substitution correction according to the Jukes and Cantor model (28). The standard deviations of 8 and divergence estimates were calculated as described (29). Adh polymorphism data (19 of all the samples) of 0. yakuba and D. teissieri Adh sequences are from (5, 19).
Gene
D. teissieri jgw D. yakuba jgw D. yakuba Adh
jgw Adh
92
Segregating sites (n)
R s Polymorphism within species
2 8 2 19 0 18
Divergence between species 0.041 ± 0.009 0.127 ± 0.027 0.007 ± 0.004 0.059 ± 0.018
8
0.005 ± 0.003 0.008 ± 0.003 0.006 ± 0.003
'II'
0.005 0.006 0.006
SCIENCE • VOL. 260 • 2 APRIL 1993
f
;.
;.
;.
C
;.
C
A A
A A A A
(i 0 Ci (i
i T
i: ! A 1 ! T
i. A A A A T T T
f
;.
G 0
i ;. ;.
T
derived portion of jgw differ by two or three contiguous substitutions. Under optimal PCR conditions, primers that contain these substi tutions at their 3' ends specifically amplified jgw RNA. A jgw-specific amplification prod uct was obtained from total RNA extracted from both species. Sequencing these products confirmed the characteristic substitutions of the jgw gene in the 5 71-bp amplified fragment from D. teissieri and the 321-bp amplified fragment from D. yakuba (13). These results demonstrated the presence of jgw-derived RNA in both species.
The single band in the 5' rapid amplifica tion cDNA end (RACE) product and the identity of the two sequenced clones from this product indicated thatjgw RNA has a distinct 5' end in D. teissieri (14). In both species, jgw appears to have captured more than 180 hp of additional exon (or exons) in the 5' direction (Fig. 2). The length of the 3' end ofD. teissieri jgw RNA is similar to that of Adh RNA. Figure 2 also shows the sequence of these products. By extending the Adh reading frame in the 5' direction, the D. teissieri jgw appears to have acquired a new start codon and potentially encodes a hybrid protein with an additional 77 amino acids added to the Adh derived protein. A preliminary analysis of jgw in D. yakuba indicated that it contains a similar structure.
To determine the structure of the genomic region (or regions) containing the exon (or
This content downloaded from �������������71.57.134.161 on Wed, 29 Dec 2021 11:13:06 UTC�������������
All use subject to https://about.jstor.org/terms
Fig. 2. Structure of the jgw transcription unit (13). (A) The structure of jgw deduced from the comparison of the sequenced 0. teissieri RNA and genomic DNA The four boxes show the four exons in jgw , and the solid and hatched portions of the boxes are the putative protein coding regions,
A +-Captured region-j
ATG
/lngwel
Adh
B D. telsslerl 5' portion sequence of jgw AGTATCAAAGT'M'CATTGTATTAGAACAAACATM"CAA'J'TTCGGC.MACATTACAAAAT.v.AAAAAMAATC.AAAAAATTfA
CTGTATTGTATTAACCAA'l"M'GA'ffATAUSiGCGCTTCGTCTTACAACCATTACTCTTCTAAAACGCACTCCTTTATTACTCGTGCCAAAGg Exon 1
t9a9tctacaaaccctattag:atcctgttcatat99taattcattattaacaat9c9attc9cagTTAAAAGCAGCACCGACMCACGCACT lntron 1 Exon 2
CTACTACTAAGAAgt.Aagtaactcgt.9ggeaaH9tccaa9tca9aatt9ctut9t9caaacecatGTCCTTTTCCAGGGAATCTGGTACC lntn>n2
GTTTTCMa.TGATGA~TCATGCM:CATGGGGGGgtaagtactatatgatgagttgtctagaactcca Exon 3
uactca.agacttaccacct.ttgtcataaacctataaaaggattataaaagatatatatatatatattatttttcagTGCGGTTGTCAGTTG -· ~~~ ......... . Exon•~
Adh-derived and recruited, respectively. The open boxes are the putative untranslated portions . The lines among boxes are the three intrans. The exon structure of the original Adh gene is also given , based on (5) . The gray portions in four Adh exons are fused into one exon in the jgwgene. (8) Sequences of the 5' regions of jgwlrom 0. teissieri and 0 . yakuba. Intrans are shown in lowercase letters. The codon ATG underlined in the 0. teissieri sequence is the hypothetical start codon. The 3' region of 0. teissieri jgw is the same as that of the published sequence (5). An apparent polyadenylation signal, AATAAA, is at positions 1123 to 1128 of 0. teissieri.
D. yakube 5' portion sequence of Jgw 1 .... .. 7'1'C1"'J'TCGACCA~CTTTGTTACTCGTGCAAAAGgtgaggctaaaaatccctattagattctgttc
Exon 1 lntron 1
atat99taattcactattucaatqecattcgcagTTAAAAGCAGCACAGCCGCACTCTACTACTCTCTACTACMCAAgtaa9taa Exon 2
ctc9t999caua9tccaa9tca99att,ctu.9t9caaacccatqtccttttacaqGGM.TCTGGT'J'CCGTTTAGGTCATGATTCTTGT 0-.2 Exon3
GTGTTCTCAAATMGGCCATCATCCCCCATGGGGGCg"ta9t-agtcta9uctccaaucttaccacattt9atataa9cgattcaaat9aga
caaatacataacutcca99a9atctgctee99gt.tctcttctcttcatatc9atcautuauttgt.ctca9t9ca9ttgtca9ttgcag lnln>n3
ttca9C9agUattgcatctctttaaattUcttatttgatcaaatc9aca~ . ... .... . Exon•~
exons) from which this new mRNA is de rived, we carried out PCR-based genomic sequencing. Three intrans (and three exons) were found 5' to the Adh-derived exon in both species (Fig. 2). The size and positions of the three intrans are similar in the two spe cies, and the standard intron-splicing signal (GT-AG) was found in each case except for the D. teissieri second intron (GT-AT).
Because the structure of jgw is similar in both species, it seems likely that the insert ed exons of Adh recruited the observed three 5' exons (and introns) rather quickly. This interpretation is supported by the ob servation that no silent substitution accu mulated in the Adh-derived portion of jgw before speciation, although several replace ment substitutions were common to jgw in both species. This suggests that there was relatively little time between the insertion event and the subsequent molecular evolu tionary events: the recruitment of the addi tional 5' components into a functional transcription unit, the substitution of sev eral amino acids, and the speciation.
In spite of similarities of structure and early common ancestry, jgw appears to have evolved distinct patterns of expression in the two species. Figure 3 shows the pattern of jgw expression at different development stages de termined by quantitative PCR technique ( I 5). Quantitative PCR provides at least a relative comparison of abundance and con firmed that the amount of jgw RNA was generally smaller than the amount of Adh. In D. teissieri, jgw showed sex-specific expression. The expected band was abundant in amplifi cations of RNA from adult males, whereas no band was present in reactions from RNA of other stages or adult females. However, in D. yakuba reactions with RNA from all stages showed less expression than was seen with D. teissieri RNA. Larval stages L1 and L2 and
adult male RNA showed more expression than L3 and adult female RNA. Just as the protein sequences evolved rapidly, the se quences controlling the regulation of jgw have also evolved rapidly. Further analysis will determine if the species-specific patterns of expression are the result of the divergence of sequences in and around the jgw transcription unit or whether these expression patterns reflect divergence at more distant, trans-act ing regulatory loci.
Whereas a distinct mRNA was expressed fromjgw in each species, the conclusion that jgw is a functional gene also rests on the evolutionary interpretation of the polymor phism observed within each species. The extension of this evolutionary analysis in order to incorporate between-species diver gence reveals that the early history of jgw was dominated by positive natural selection instead of the neutral mutation and genetic drift that are expected to characterize the dynamics of pseudogenes (16).
To explore the divergence of jgw in the period immediately after the Adh retro-
Fig. 3. Developmental pattern of jgwexpression . The same method as described ( 12) was used to amplify jgw RNA from total RNA extracted from the different development stages. The cDNA product from 300 ng of RNA was added as a template for amplification because for the range from 100 ng to 1000 ng of total RNA, the yield of jgw RNA PCR products was observed to be linearly related to the template RNA concen tration ( 11). PCR cycles (30) were conducted at 94°C (1 min) for denaturation, 60°C (2 min) for annealing, and 72°C (3 min) for polymerization. The products of the PCR reactions were electro phoresed on a 1 % agarose gel and stained with ethidium bromide . More Adh RNA was amplified from the same cDNA preparations, which sug
transposition but before the split of D. teissieri and D. yakuba, we compared the Adh-derived portions of all jgw alleles with the available Adh alleles in D. teissieri and D. yakuba and with Adh alleles from various members of the melanogaster subgroup (Fig. 4). The fixed nucleotide substitutions that distinguished the Adh-derived portion of all jgw alleles from Adh in all alleles of D. teissieri and D. yakuba were assumed to have been fixed in the ancestral species after the insertion. Eight such sites exist at positions 339, 576, 600, 791, 831, 861, 918, and 954. Surprisingly, all eight substitutions were amino acid replacements; no silent substitutions were found. By incorporating the available Adh sequences of the other six members of the melanogaster subgroup, we found that all eight substitutions were unique mutations that were fixed in the jgw lineage. Assuming the replacement rate of substitution of 0.5 x 10- 9 per nucleotide per year [calculated from melanogaster sub group Adh data (I 7) I, these eight substitu tions (out of 572 possible replacement sites)
D. teissieri Adult
L1 L2 L3 Female Male
571
u
321
gests that Adh is expressed in larger amounts than jgw ( 11). Molecular size markers are on the right in base pairs .
SCIENCE • VOL. 260 • 2 APRIL 1993 93
This content downloaded from �������������71.57.134.161 on Wed, 29 Dec 2021 11:13:06 UTC�������������
All use subject to https://about.jstor.org/terms
Fig. 4. Phylogenetic analysis of the evolution of the Adh-derived por tion of jingwei. The topol ogy reflects the as sumed evolutionary rela tion between jingwei and Adh (5). The small (stip pled) trees at the tips in dicate that the detailed phylogenies of the al leles within species are
outgroup species
teissieri jingwei yakuba
unknown. Numbers presented as fractions are the numbers of (fixed or polymorphic) amino acid replacement differences over the numbers of (fixed or polymorphic) silent differences. The Adh outgroup includes the sequences of 0. melanogaster, 0. simulans, 0. sechellia, 0. mauritiana, 0. erecta, and 0. arena. These outgroup sequences were used to confirm that all functional Adh genes have the same DNA sequence for the eight codons that are distinct to jingwei (in both 0. teissieri and 0. yakuba) with one exception. At the eighth codon (nucleotide position 954) of 0. arena Adh, there is a substitution that conferred an amino acid replacement. The italic numbers are the average numbers of silent substitutions and the numbers of silent polymorphisms under the HKA test, which also incorporates the standard assumptions of the neutral theory.
yielded an estimate of about 30 million years for the time of the last common ancestor of jgw and Adh. This conflicts with the age of the melanogaster subgroup, which is estimated to be 17 to 20 million years (18). The lack of silent substitutions im plies that the insertion of jgw occurred close to the· time of the speciation of D. teissieri and D. yakuba. The excess of replacement substitutions in the jgw line of descent between the time of its insertion and the speciation of D. teissieri and D. yakuba is consistent with the model thatjgw respond ed to positive natural selection and evolved a new function.
This analysis of the early history of jgw leads us to examine its dynamics after the divergence of the two species. One method to explore the role of natural selection at a single locus is to compare the replacement and silent substitutions found between species with the replacement and silent polymorphism found within species ( I 9). The variation in the Adh-derived portion of jgw within and be tween D. teissieri and D. yakuba is summarized (Fig. 4). A relative excess of (fixed) replace ment substitutions over (fixed) silent substitu tions between species (21: 16) is apparent when compared to the proportion of replace ment polymorphisms over silent polymor phisms within a species (4:27). These results are inconsistent with the null hypothesis in the test proposed (19), which incorporates the assumption of the selective neutrality (x2 = 13.6, P < 0.001). Therefore, adaptive protein evolution remained an important force in the evolutionary history of jgw after the separation of the two species. Further evidence supporting this view of the diver gence of jgw in D. teissieri and D. yakuba comes from a comparison of the captured 5' coding regions. Eleven out of the 15 differ ences in 153 alignable coding sites cause amino acid replacements.
Neutral allele theory considers polymor-
94
phism to be a transient phase of molecular evolution (20). Under the assumptions of this theory, the level of the between-species divergence at different loci is positively cor related with the level of within-species poly morphism. This idea is embodied in a sim ple, two-by-two statistical test (HKA test) (2 I) that calculates the expected amounts of polymorphism and divergence at two loci and can indicate whether the observed amounts are consistent with the neutral theory. Because we determined that there is an excess of replacement substitutions, we directed our attention to the silent variation in jgw and Adh. Figure 4 shows the observed numbers of silent substitutions and polymor phisms in the Adh-derived portion of jgw. Whereas their within-species polymorphism is comparable, the between-species diver gence of jgw is twofold greater than that of Adh (x2 = 7.12, P < 0.01).
The Adh gene in these two species has a very biased codon usage with a 84 to 87% G+C content at the third codon positions. Furthermore, the codon preference as shown by the within-species polymorphism data in D. yakuba (19) also shows a very high G+C content (85. 7%). Nevertheless, the codon usage in the Adh-derived portion of jgw seems to be evolving to a smaller amount of G+C. The G+C contents at the third codon position summed over all silent poly morphism sites in the two species are 70.0% for D. teissieri and 62.4% for D. yakuba, respectively. The G+C content at the third codon position in the fixed replacement sites between the two species is 60.0%. This evolution of a moderate G+C content of third sites is consistent with the higher rate of silent divergence for jgw and the general observation of a negative correlation be tween the codon bias (and G+C content) and the rate of silent divergence (22).
The results presented reveal the molecu lar, genetic, and evolutionary mechanisms
SCIENCE • VOL 260 • 2 APRIL 1993
that participated in the origin of the chimer ic processed functional gene jgw. The chi meric nature of the expressed product of this novel gene is unique among processed genes, including those few that are functional, such as the second gene for rat insulin, the human POK gene, and other examples that have been interpreted as outcomes of retroposi tions (2, 23). It has been proposed that retrotransposition can be a major cause of intron loss during evolution (24), as it was with jgw. The evolution of jgw also demon strates that retrotransposition can be a source of new, intron-containing genes in eukaryotic evolution. It is also unique among instances of exon-shuffiing (25) in that it clearly involved the retrotransposi tion of an mRNA. Experiments of cross hybridization with a genomic Southern (DNA) blot and Northern analysis with the use of a probe generated from the captured portion of jgw indicated that the source of the captured portion of jgw was a duplication of an unrelated gene (26). The analysis of the early molecular evolution of jgw indicat ed that jgw was functional from the begin ning and experienced strong adaptive evolu tion for what must have been a novel func tion. Prevailing theories of the origin of new genes assume initial relaxation of selection (I). Our results provide a contrary interpre tation in which natural selection is present throughout the origin of a new gene.
REFERENCES AND NOTES
1 . S. Ohno, Evolution by Gene Duplication (Spring er-Verlag, Berlin, 1970); T. Ohta, Genome 31, 304 (1989); J. B. S. Haldane, The Causes of Evolution (Longmans, New York, 1932).
2. W. Gilbert, Nature 271, 501 (1978); G. F. Hollis, P. A. Hieter, 0. W. McBride, D. Swan, P. Leder, ibid. 296, 321 (1982); J. R. McCarrey and K. Thomas, ibid. 326, 501 (1987).
3. In an ancient legend from China (San Hai Jing), Jingwei, a daughter of the Emperor Yande (first Chinese emperor 3000 B.C.), tragically drowned while swimming in the East China Sea. Jingwei was then reincarnated as a beautiful bird that drops stones and wood into the sea in an attempt to fill it, thus preventing others from drowning. We used the name "jingwei" because this gene avoided the usual fate of processed gene (death) and was "reincarnated" into a new structure with novel function.
4. C. H. Langley et al., Proc. Natl. Acad. Sci. U.S.A. 79, 5631 (1982).
5. P. Jeffs and M. Ashburner, Proc. R. Soc. London, Ser. B 244, 151 (1991).
6. The sequences were completely determined from both strands by the dideoxyribonucleotide chain terminating method [F. Sanger et al., Proc. Natl. Acad. Sci. U.S.A. 74, 5463 (1977)] on single-strand ed DNA templates prepared directly from the PCR products [R. G. Higuchi and H. Ochman, Nucleic Acids Res. 17, 5865 (1989); K. R. Saiki et al., Science 239,487 (1988)]. The primers used in PCR are 5'-GACAGTGATATGAGATTGCCG-3' and 5' GGAAGAATGTGAGTGTGCTTCG-3' for 0. teissieri and 5'-CTCTAGAACACCAAAACTTACC-3' and 5' GCATACATATTTGTAAAATGCAAG-3' for D. yaku ba. Each sequence was from a single fly of a separate isofemale line that had been mated to its siblings for three generations. The two alleles or haplotypes in the five heterozygous flies were deter-
This content downloaded from �������������71.57.134.161 on Wed, 29 Dec 2021 11:13:06 UTC�������������
All use subject to https://about.jstor.org/terms
~ ~-~lllllBl!llillllMIIB IIIRIIRli ■1111.11. llllill!IIR REPORTS
mined by the cloning and subsequent sequencing of the PCR products.
7. W.-H. Li, in Evolution of Duplicate Genes and Pseudogenes, M. Nei and R. N. Koehn, Eds. (Sinauer, Sunderland, MA, 1983), pp. 14-37.
8. C. H. Langley, in Population Biology of Genes and Molecules, N. T. Takahata and J. F. Crow, Eds. (Baifukan, Tokyo, 1990), pp. 75-91; M. Kreitman, in Evolution at the Molecular Level, R. K. Selander, A.G. Clark, T. S. Whittam, Eds. (Sinauer, Sunder land, MA, 1991), pp. 204-221.
9. Only two length polymorphisms are· observed in the 3' flanking region of 0. yakuba.
10. J.C. Alwine et al., Proc. Natl. Acad. Sci. U.S.A. 74, 5350 (1977).
11. M. Long and C.H. Langley, unpublished data. 12. E. S. Kawasaki, in PCR Protocols, M. A. Innis et al.,
Eds. (Academic Press, New York, 1990), pp. 21-27. 13. Total RNA was extracted from male adult flies (0.
teissien) and L 1 larvae (0. yakuba) as described [D. A. Goldberg et al., Cell 34, 59 (1982)]. We treated the RNA with ribonuclease-free deoxyribonuclease to avoid potential DNA contamination during the PCR experiment. For RT-PCR, the jgw-transcribed RNA sequences were amplified from cDNA as de scribed by Kawasaki (12) with the jgw-specific primers. The primers included the pair 5'-GGCAC TCMTCCAAAGGTGTG-3' (P1) and 5'-GCCCA AGTCCAGTTTCCAGAGT-3' (P2) for D. teissieriand the pair 5'-TCCTTGAGCMCMGMCGTM-3' (P3) and 5'-GTAGTTGACGGCGATGGTTGC-3' (P4) for D. yakuba. The PCR products were cloned into Bluescript SK+ and sequenced by the dideoxy ribonucleotide chain-terminating method.
14. Drosophila teissieri 5' and 3' ends of RNA were amplified from cDNA with the RACE technique (27). For the 5' end of jgw RNA from D. teissieri, the primer used for primer extension was primer 5 (P5, 5'-GGTGGTCTCGGCMTGG-3'), which anneals to the RNA from both jgw and Adh. The cDNA gener ated afterwards was tailed with deoxyadenosine triphosphate. Three primers were used for the sub sequent PCR reactions. They included two artificial primers (27) [dT17-adapter and adapter primers that are able to anneal to the artificially added poly(A) tail of cDNA] and jgw-specific primer 6 (P6, 5'-TCACATCGTAGGG,GTAGMGGTGACGCA-3'). For the 3' end of jgw RNA in 0. teissieri, the jgw-specific primer 7 (P7, 5'-CCMTTTGATTATM TGGCGCTTCG-3') or P1 in conjunction with the dT17-adapter primer was used to amplify the 3' portion of jgw RNA of 0. teissieri. The 5' end of D. yakuba jgw RNA was amplified from cDNA with P7 and D. yakuba jgw-specific primer P4. Genomic DNA was amplified with the use of P7 and a down stream primer; P6 was used for 0. teissieri and primer 8 (P8, 5'-TCCAGACCMTGCCTCCCAGAC CGGCMCGMMTT-3') for D. yakuba. The posi tions of the intrans are determined by alignment of genomic and RNA sequences. Sequencing meth ods of the PCR products included the direct se quencing and the cloning-sequencing approaches as described (6).
15. J. Chelly, J.-C. Kaplan, P. Maire, S. Gautron, A. Kahn, Nature 333,858 (1988); J. Singer-Sam et al., Nucleic Acids Res. 18, 1255 (1990).
16. W.-H. Li, T. Gojobori, M. Nei, Nature 292, 237 (1981),
17. D. T. Sullivan et al., Evol. Biol. 24, 107 (1990). 18. D. Lachaise et al., ibid. 22, 159 (1988). 19. J. H, McDonald and M. Kreitman, Nature 351,652
(1991), 20, M. Kimura, The Neutral Theory of Molecular Evolu
tion (Cambridge Univ. Press, Cambridge, 1983); G. A. Watterson, Theor. Popul. Biol. 7, 256 (1975); M. Nei and F. Tajima, Genetics 97, 145 (1981).
21. R.R. Hudson eta/., Genetics 116,153 (1987). 22. E. N. Moriyama and T. Gojibori, ibid. 130, 855
(1992); P. Sharp and W.-H. Li, J. Mo/. Evo/. 28, 398 (1989).
23. M. B. Soares eta/., Mo/. Cell. Biol. 5, 2090 (1985); A. M. Weiner et al., Annu. Rev. Biochem. 55, 631 (1986); H.-H. M. Dahl et al., Genomics 8, 225 (1990); A. Ashworth et al., EMBO J. 9, 1529 (1990); J. Brosius, Science 251, 753 (1991).
24. G. R. Fink, Ce// 49, 5 (1987).
25. R. L. Dorit, L. Schoenbach, W. Gilbert, Science 250, 1377 (1990); L. Banyai et al., FEBS Lett. 163, 37 (1983).
26. We named this non-Adh parent gene of jgw as Yande (ynd) in consistency with the Chinese legend about jingwei (3, 11).
27, M.A. Frohman et al., Proc. Natl. Acad. Sci. U.S.A. 85, 8998 (1988).
28, M. Nei, Molecular Evolutionary Genetics (Colum bia Univ. Press, New York, 1987), pp. 276-279; T. H. Jukes and C. R. Cantor, in Mammalian Protein Metabolism, H. N. Munro, Ed. (Academic Press, New York, 1969), pp. 21-132.
29. W.-H. Li and D. Graur, Fundamentals of Molec ular Evolution (Sinauer, Sunderland, MA, 1991); R. R. Hudson, in Oxford Surveys in Evolutionary Biology, D. Futuyma and J, Antonovics, Eds.
(Oxford Univ. Press, New York, 1990), vol. 7, pp. 1-40.
30. We thank J. Gillespie, A. Clark, M, Turelli, K. Burtis, and all members of our laboratory for helpful discussions and critical reading of the manuscript. D. Lachaise kindly provided the D. teissieri isofemale lines. We also thank P. Jeffs and M. Ashbumer for sharing DNA sequences of the Adh-derived portions of jgw in 0. yakuba and D. teissieri before they published these se quences (5). Supported by NSF (C.H.L.) and the Center for Population Biology of the University of California at Davis, a University of California at Davis Graduate Research Award, and a Jastro Shields Research Scholarship (M.L.).
26 October 1992; accepted 4 February 1993
Modulation of Neuronal Migration by NMDA Receptors
Hitoshi Komuro and Pasko Rakic The N-methyl-o-aspartate (NMDA) subtype of the glutamate receptor is essential for neuronal differentiation and establishment or elimination of synapses in a developing brain. The activity of the NMDA receptor has now been shown to also regulate the migration of granule cells in slice preparations of the developing mouse cerebellum. First, blockade of NMDA receptors by specific antagonists resulted in the curtailment of cell migration. Second, enhancement of NMDA receptor activity by the removal of magnesium or by the application of glycine increased the rate of cell movement. Third, increase of endogenous extracellular glutamate by inhibition of its uptake accelerated the rate of cell migration. These results suggest that NMDA receptors· may play an early role in the regulation of calcium-dependent cell migration before neurons reach their targets and form synaptic contacts.
In the developing brain, most immature neurons migrate to their distant final desti nations by extending their leading processes and translocating their soma through a ter rain that is densely packed with previously generated neurons and their processes ( 1). This movement of immature neurons is es sential for the establishment of normal cy toarchitecture, synaptic connectivity, and function in the brain (2). In the cerebellum, granule cells migrate from the site of their origin in the germinal external granular layer toward the internal granular layer along the elongated processes of Bergmann glial cells (3). Recently Komuro and Rakic have dem onstrated that the rate of granule cell move ment across the molecular layer in the cere pellum depends both on extracellular Caz+ concentrations and on Caz+ influx through N-type Caz+ channels (4). However, the regulatory mechanism underlying this Caz+ - dependent process remains unknown. We have now examined the role of ionotropic receptors--NMDA, non-NMDA, GABAA> and GABA 8 (GABA is -y-aminobutyric ac id)-in granule cell migration; these recep tors are expressed by immature granule cells (5) and can directly and indirectly affect
Section of Neurobiology, Yale University School of Medicine, New Haven, CT 06510.
SCIENCE • VOL. 260 • 2 APRIL 1993
Caz+ influx and intracellular Caz+ concen trations (5, 6).
To examine whether NMDA, non NMDA, GABAA, and GABA 8 receptors play a significant role in the migration of. granule cells, we used slice preparations of the developing mouse cerebellum stained with a lipophilic carbocyanine dye [ 1, 1 ' - dioctadecyl-3,3,3 ',3 '-tetramethylindocar bocyanine perchlorate (Oil)] and a laser scanning confocal microscope (7). Postmi totic granule cells in slice preparations mi grate from the external granular layer to ward the internal granular layer (Fig. 1) (8). Antagonists to these receptors were added to the culture medium in separate experiments. Blockade of the non-NMDA subtype of glutamate receptors [that is, kainate and AMPA (L-a-amino-3-hydroxy- 5-methyl-4-isoxazole propionic acid) recep tors) by 6-cyano- 7-nitroquinoxaline-2,3-di one (CNQX) (9), GABAA receptors by bicuculline (6), and GABA 8 receptors by phaclofen ( 10) failed to alter the rate of cell migration (Fig. 2, A and B). However, blockade of the NMDA subtype of gluta mate receptor by D-2-amino-5-phosphono pentanoic acid (D-APS) (11) or (+)-5- methyl-10, 11-dihydro-SH-dibenzo[a,d)cy clohepten-5, 10-imine hydrogen maleate (MK-801) (12) significantly decreased the
95
This content downloaded from �������������71.57.134.161 on Wed, 29 Dec 2021 11:13:06 UTC�������������
All use subject to https://about.jstor.org/terms
- Contents
- 91
- 92
- 93
- 94
- 95
- Issue Table of Contents
- Science, Vol. 260, No. 5104 (Apr. 2, 1993), pp. 1-132
- Front Matter [pp. 1-18]
- Editorial: Improvements in Health Care [p. 11]
- Letters
- EMF and Cancer [pp. 13-14+16]
- Drug Abuse Research [p. 16]
- Corrections and Clarifications: Science, Technology, and National Goals [p. 16]
- Policy Forum
- Uncertainty, Resource Exploitation, and Conservation: Lessons from History [pp. 17+36]
- ScienceScope [p. 19]
- News and Comment
- Computing's Controversial Patron [pp. 20-22]
- American Family Tree Gets New Root [p. 22]
- Researchers Win Decision on Knockout Mouse Pricing [pp. 23-24]
- NSF Wins, NIH Loses in Clinton's 1994 Budget [pp. 24-25]
- The Greening of the National Labs [p. 25]
- Random Samples [pp. 26-27]
- Research News
- Huntington's Gene Finally Found [pp. 28-30]
- Toxicologists-and Snow-Descend on New Orleans [pp. 30-31]
- Ocean-in-a-Machine Starts Looking Like the Real Thing [pp. 32-33]
- Pinning Down a Missing Link in Massive Stars [pp. 34-35]
- Perspectives
- DNA Repair and Transcription: The Helicase Connection [pp. 37-38]
- Superstructures and Superconductivity [pp. 38-39]
- Light Emission from Silicon [pp. 40-46]
- Cognitive Neurophysiology of the Motor Cortex [pp. 47-52]
- Research Articles
- Molecular Mechanism of Transcription-Repair Coupling [pp. 53-58]
- DNA Repair Helicase: A Component of BTF2 (TFIIH) Basic Transcription Factor [pp. 58-63]
- Reports
- Diamonds in Dense Molecular Clouds: A Challenge to the Standard Interstellar Medium Paradigm [pp. 64-66]
- Strong, Pure, and Uniform Carbon Fibers Obtained Directly from the Vapor Phase [pp. 66-68]
- A Photoinduced Persistent Structural Transformation of the Special Pair of a Bacterial Reaction Center [pp. 68-71]
- Evidence for Photochemical Formation of H$_2$O$_2$ and Oxidation of SO$_2$ in Authentic Fog Water [pp. 71-73]
- Aqueous-Phase Photochemical Formation of Peroxides in Authentic Cloud and Fog Waters [pp. 73-75]
- Genetic Conversion of a Fungal Plant Pathogen to a Nonpathogenic, Endophytic Mutualist [pp. 75-78]
- Skn-1a and Skn-1i: Two Functionally Distinct Oct-2-Related Factors Expressed in Epidermis [pp. 78-82]
- Rhythmic Exocytosis Stimulated by GnRH-Induced Calcium Oscillations in Rat Gonadotropes [pp. 82-84]
- Altered Growth of Human Colon Cancer Cell Lines Disrupted at Activated Ki-ras [pp. 85-88]
- Phosphatidylinositol 3-Kinase Encoded by Yeast VPS34 Gene Essential for Protein Sorting [pp. 88-91]
- Natural Selection and the Origin of jingwei, a Chimeric Processed Functional Gene in Drosophila [pp. 91-95]
- Modulation of Neuronal Migration by NMDA Receptors [pp. 95-97]
- HLA-A11 Epitope Loss Isolates of Epstein-Barr Virus from a Highly A11$^+$ Population [pp. 98-100]
- Extracellular Access to the Na,K Pump: Pathway Similar to Ion Channel [pp. 100-103]
- Developmental Regulation of Neural Response to FGF-1 and FGF-2 by Heparan Sulfate Proteoglycan [pp. 103-106]
- Book Reviews
- Review: Progress in the Infrared [p. 107]
- Review: Future-Oriented Physics [pp. 107-109]
- Review: Life of an Evolutionist [pp. 109-110]
- Books Received [p. 110]
- Back Matter [pp. 111-132]