Human Physiology assignment
A01_SILV5197_08_SE_FM.indd 1 20/12/2017 21:24
UNIT 1 Basic Cell Processes: Integration and Coordination
1 Introduction to Physiology 1 2 Molecular Interactions 28 3 Compartmentation: Cells and Tissues 58 4 Energy and Cellular Metabolism 92 5 Membrane Dynamics 121 6 Communication, Integration, and Homeostasis 164
UNIT 2 Homeostasis and Control
7 Introduction to the Endocrine System 194 8 Neurons: Cellular and Network Properties 223 9 The Central Nervous System 271 10 Sensory Physiology 307 11 Efferent Division: Autonomic and Somatic Motor Control 355 12 Muscles 374 13 Integrative Physiology I: Control of Body Movement 414
UNIT 3 Integration of Function
14 Cardiovascular Physiology 432 15 Blood Flow and the Control of Blood Pressure 476 16 Blood 510 17 Mechanics of Breathing 532 18 Gas Exchange and Transport 562 19 The Kidneys 587 20 Integrative Physiology II: Fluid and Electrolyte Balance 618
UNIT 4 Metabolism, Growth, and Aging
21 The Digestive System 654 22 Metabolism and Energy Balance 692 23 Endocrine Control of Growth and Metabolism 728 24 The Immune System 754 25 Integrative Physiology III: Exercise 786 26 Reproduction and Development 800
Contents in Brief
CVR_SILV5197_08_SE_FEP.indd 2 12/2/17 6:54 AM
Top Ten Ways to Succeed in Classes that Use Active Learning By Marilla Svinicki, Ph.D., former Director of the University of Texas Center for Teaching Effectiveness
1. Make the switch from an authority-based conception of learning to a self-regulated conception of learning. Recognize and accept your own responsibility for learning.
2. Be willing to take risks and go beyond what is presented in class or the text.
3. Be able to tolerate ambiguity and frustration in the interest of understanding.
4. See errors as opportunities to learn rather than failures. Be willing to make mistakes in class or in study groups so that you can learn from them.
5. Engage in active listening to what’s happening in class.
6. Trust the instructor’s experience in designing class activities and participate willingly if not enthusiastically.
7. Be willing to express an opinion or hazard a guess.
8. Accept feedback in the spirit of learning rather than as a reflection of you as a person.
9. Prepare for class physically, mentally, and materially (do the reading, work the problems, etc.).
10. Provide support for your classmate’s attempts to learn. The best way to learn something well is to teach it to someone who doesn’t understand.
Dr. Dee’s Eleventh Rule: DON’T PANIC! Pushing yourself beyond the comfort zone is scary, but you have to do it in order to improve.
Word Roots for Physiology Simplify physiology and medicine by learning Latin and Greek word roots. The list below has some of the most common ones. Using the list, can you figure out what hyperkalemia means?*
Strategies for Success
* Hyper = excess, kali = potassium, -emia = in the blood, or elevated blood potassium
a- or an- without, absence
anti- against
-ase signifies an enzyme
auto self
bi- two
brady- slow
cardio- heart
cephalo- head
cerebro- brain
contra- against
-crine a secretion
crypt- hidden
cutan- skin
-cyte or cyto- cell
de- without, lacking
di- two
dys- difficult, faulty
-elle small
-emia in the blood
endo- inside or within
epi- over
erythro- red
exo- outside
extra- outside
gastro- stomach
-gen, -genie produce
gluco-, glyco- sugar or sweet
hemi- half
hemo- blood
hepato- liver
homo- same
hydro- water
hyper- above or excess
hypo- beneath or deficient
inter- between
intra- within
-itis inflammation of
kali- potassium
leuko- white
lipo- fat
lumen inside of a hollow tube
-lysis split apart or rupture
macro- large
micro- small
mono- one
multi- many
myo- muscle
oligo- little, few
para- near, close
patho-, -pathy related to disease
peri- around
poly- many
post- after
pre- before
pro- before
pseudo- false
re- again
retro- backward or behind
semi- half
sub- below
super- above, beyond
supra- above, on top of
tachy- rapid
trans- across, through
CVR_SILV5197_08_SE_FEP.indd 3 12/2/17 6:54 AM
Owner’s Manual
Pattern recognition is important for all healthcare professionals, so you can begin to develop this skill by learning the key concepts of physiology that repeat over and over as you study different organ systems. Chapter 1 includes two special Focus On features: one on concept mapping, a study strategy that is also used for decision-making in the clinics, and one on construct- ing and interpreting graphs. The Running Problem in Chapter 1 introduces you to effective ways to find information on the Internet.
Be sure to look for the Essentials and Review fig- ures throughout the book. These figures distill the basics about a topic onto one or two pages, much as the Anatomy Summaries do. My students tell me they find them particularly useful for review when there isn’t time to go back and read all the text.
We have also retained the four approaches to learning physiology that proved so popular since this book was first published in 1998.
1. Cellular and Molecular Physiology Most physiological research today is being done at the cellular and molecular level, and there have been many exciting developments in molecular medicine and physiology in the 10 years since the first edition. For ex- ample, now scientists are paying more attention to pri-
mary cilia, the single cilium that occurs on most cells of the body. Primary cilia are thought to play a role in some kidney and other diseases. Look for similar links between molecular and cellular biology, physiology, and medi- cine throughout the book.
2. Physiology as a Dynamic Field Physiology is a dynamic discipline, with numerous unanswered questions that merit further investigation and research. Many of the “facts” presented in this text are really only our current theories, so you should be prepared to change your mental models as new infor- mation emerges from scientific research.
Welcome to Human Physiology! As you begin your study of the human body, one of your main tasks will be to construct for yourself a global view of the body, its systems, and the many processes that keep the systems working. This “big picture” is what physiologists call the integration of systems, and it is a key theme in this book. To integrate information, however, you must do more than simply memorize it. You need to truly understand it and be able to use it to solve problems that you have never encountered before. If you are headed for a career in the health professions, you will do this in the clinics. If you plan a career in biology, you will solve problems in the laboratory, field, or classroom. Analyzing, synthe- sizing, and evaluating information are skills you need to develop while you are in school, and I hope that the features of this book will help you with this goal.
One of my aims is to provide you not only with in- formation about how the human body functions but also with tips for studying and problem solving. Many of these study aids have been developed with the input of my students, so I think you may find them particu- larly helpful.
On the following pages, I have put together a brief tour of the special features of the book, especially those that you may not have encountered previously in text- books. Please take a few minutes to read about them so that you can make optimum use of the book as you study.
Each chapter begins with a list of Learning Out- comes to guide you as you read the chapter. Within the chapters look for the Running Problem, Phys in Action, and Try It! activities. Phys in Action are online video clips that I created with the assistance of some of my stu-
dents. Look for the references to Mastering A&P in the figures
with associated Phys in Action clips, and watch Kevin and Michael as they demonstrate physiology in action.
EMERGING CONCEPTS
C H
A P
TER
3
3.3 Intracellular Compartments 69
5. Movement. The cytoskeleton helps cells move. For example, the cytoskeleton helps white blood cells squeeze out of blood vessels and helps growing nerve cells send out long extensions as they elongate. Cilia and flagella on the cell membrane are able to move because of their microtubule cytoskeleton. Special motor proteins facilitate movement and intracellular transport by using energy from ATP to slide or step along cytoskeletal fibers.
Motor Proteins Create Movement Motor proteins are proteins that convert stored energy into directed movement. Three groups of motor proteins are associ- ated with the cytoskeleton: myosins, kinesins, and dyneins. All three groups use energy stored in ATP to propel themselves along cyto- skeleton fibers.
Myosins bind to actin fibers and are best known for their role in muscle contraction (Chapter 12). Kinesins and dyneins assist the movement of vesicles along microtubules. Dyneins also associate with the microtubule bundles of cilia and flagella to help create their whiplike motion.
The cytoskeleton has at least five important functions.
1. Cell shape. The protein scaffolding of the cytoskeleton pro- vides mechanical strength to the cell and in some cells plays an important role in determining the shape of the cell. Figure 3.4b shows how cytoskeletal fibers help support microvilli {micro-, small + villus, tuft of hair}, fingerlike extensions of the cell mem- brane that increase the surface area for absorption of materials.
2. Internal organization. Cytoskeletal fibers stabilize the positions of organelles. Figure 3.4b illustrates organelles held in place by the cytoskeleton. Note, however, that this figure is only a snapshot of one moment in the cell’s life. The interior arrangement and composition of a cell are dynamic, changing from minute to minute in response to the needs of the cell, just as the inside of the walled city is always in motion. One disadvantage of the static illustrations in textbooks is that they are unable to represent movement and the dynamic nature of many physiological processes.
3. Intracellular transport. The cytoskeleton helps transport materials into the cell and within the cytoplasm by serving as an intracellular “railroad track” for moving organelles. This function is particularly important in cells of the nervous sys- tem, where material must be transported over intracellular distances as long as a meter.
4. Assembly of cells into tissues. Protein fibers of the cyto- skeleton connect with protein fibers in the extracellular space, linking cells to one another and to supporting material outside the cells. In addition to providing mechanical strength to the tissue, these linkages allow the transfer of information from one cell to another.
FIG. 3.5 Cilia and flagella
Flagellum
Cilia
Cilium
(a) Cilia on surface of respiratory epithelium (b) Cilia and flagella have 9 pairs of microtubules surrounding a central pair.
(c) The beating of cilia and flagella creates fluid movement.
Cell membrane
Fluid movement
Fluid movement
Microtubules
SEM × 1500
This image was taken with a scanning electron microscope (SEM) and then color enhanced. The specimens prepared for scanning electron micros- copy are not sectioned. The whole specimen is coated with an electron-dense material, and then bombarded with electron beams. Because some of the electrons are reflected back, a three- dimensional image of the specimen is created.
Concept Check
5. Name the three sizes of cytoplasmic protein fibers. 6. How would the absence of a flagellum affect a sperm cell? 7. What is the difference between cytoplasm and cytosol? 8. What is the difference between a cilium and a flagellum? 9. What is the function of motor proteins?
M03_SILV5197_08_SE_C03.indd 69 9/12/17 2:35 PM
Play Phys in Action
@Mastering Anatomy & Physiology
CVR_SILV5197_08_SE_FEP.indd 4 12/2/17 6:54 AM
How to Use this Book
3. An Emphasis on Integration The organ systems of the body do not work in isolation, although we study them one at a time. To emphasize the integrative nature of physiology, three chapters (Chapters 13, 20, and 25) focus on how the physi- ological processes of multiple organ sys- tems coordinate with
each other, especially when homeostasis is challenged.
4. A Focus on Problem Solving One of the most valuable life skills students should acquire is the ability to think critically and use informa- tion to solve problems. As you study physiology, you should be prepared to practice these skills. You will find a number of features in this book, such as the Concept Check questions and Figure and Graph Questions. These “test yourself” questions are designed to challenge your critical thinking and analysis skills. In each chapter, read the Running Problem as you work through the text and see if you can apply what you’re reading to the clinical scenario described in the problem.
Also, be sure to look at the back of the text, where we have combined the index and glossary to save time when you are looking up unfamiliar words. The appen- dices have the answers to the Concept Check questions, Figure and Graph Questions, and end-of-chapter ques-
tions, as well as reviews of physics, logarithms, and basic genetics. The back end papers include a periodic table of the ele- ments, diagrams of anatomical positions of the body, and tables
with conversions and normal values of blood compo- nents. Take a few minutes to look at all these features so that you can make optimum use of them.
It is my hope that by reading this book, you will de- velop an integrated view of physiology that allows you to enter your chosen profession with respect for the complexity of the human body and a clear vision of the potential of physiological and biomedical research. May you find physiology as fun and exciting I do. Good luck with your studies!
Warmest regards, Dr. Dee (as my students call me)
silverthorn@utexas.edu
Phys in Action Video Topics:
pp. 130–131 Fig. 5.4 Osmolarity & Tonicity pp. 154–155 Fig. 5.23 Membrane Potential pp. 458–459 Fig.14.15 Electrocardiogram p. 494 Fig. 15.14 Cardiovascular Control p. 545 Fig. 17.7 The Spirometer p. 549 Fig. 17.10 Respiratory Pressure p. 557 Fig. 17.13 Alveolar Gases p. 573 Fig. 18.7 Hemoglobin-Oxygen Transport p. 610 Fig. 19.13 Renal Clearance p. 793 Fig. 25.8 Blood Pressure & Exercise
Try It Activities:
p. 21 Graphing p. 135 Membrane Models (Lipid bylayer) p. 251 Action Potentials p. 325 Salty-Sweet Taste Experiment p. 468 Frank-Starling Law of the Heart p. 605 Insulin p. 682 Oral Rehydration Therapy
4 CHAPTER 1 Introduction to Physiology
These process maps are also called flow charts, and they are frequently used in health care. You will be able to practice mapping with spe- cial end-of-chapter questions throughout the book.
1.2 Function and Mechanism We define physiology as the normal functioning of the body, but physiologists are careful to distinguish between function and mecha- nism. The function of a physiological system or event is the “why” of the system or event: Why does a certain response help an animal survive in a particular situation? In other words, what is the adaptive significance of this event for this animal?
For example, humans are large, mobile, terrestrial animals, and our bodies maintain relatively constant water content despite living in a dry, highly variable external environment. Dehydration is a constant threat to our well-being. What processes have evolved in our anatomy and physiology that allow us to survive in this hos- tile environment? One is the production of highly concentrated urine by the kidney, which allows the body to conserve water. This statement tells us why we produce concentrated urine but does not tell us how the kidney accomplishes that task.
or through a break in the skin. In addition, immune tissues are closely associated with the circulatory system.
Traditionally, physiology courses and books are organized by organ system. Students study cardiovascular physiology and regu- lation of blood pressure in one chapter, and then study the kidneys and control of body fluid volume in a different chapter. In the functioning human, however, the cardiovascular and renal systems communicate with each other, so that a change in one is likely to cause a reaction in the other. For example, body fluid volume influ- ences blood pressure, while changes in blood pressure alter kidney function because the kidneys regulate fluid volume. In this book, you will find several integrative physiology chapters that highlight the coordination of function across multiple organ systems.
Understanding how different organ systems work together is just as important as memorizing facts, but the complexity of inter- actions can be challenging. One way physiologists simplify and integrate information is by using visual representations of physi- ological processes called maps. The Focus on Mapping feature in this chapter will help you learn how to make maps. The first type of map, shown in FIGURE 1.3A, is a schematic representation of structure or function. The second type of map, shown in Figure 1.3b, diagrams a physiological process as it proceeds through time.
FIG. 1.2 Organ systems of the human body and their integration
FIG. 1.2 Organ Systems of the Human Body and their Integration
System Name Includes Representative Functions The Integration between Systems of the Body
Circulatory Heart, blood vessels, blood
Transport of materials between all cells of the body
Digestive Stomach, intestine, liver, pancreas
Conversion of food into particles that can be transported into the body; elimination of some wastes
Endocrine Thyroid gland, adrenal gland
Coordination of body function through synthesis and release of regulatory molecules
Immune Thymus, spleen, lymph nodes
Defense against foreign invaders
Integumentary Skin Protection from external environment
Musculoskeletal Skeletal mus- cles, bone
Support and movement
Nervous Brain, spinal cord
Coordination of body function through electrical signals and release of regulatory molecules
Reproductive Ovaries and uterus, testes
Perpetuation of the species
Respiratory Lungs, airways Exchange of oxygen and carbon dioxide between the internal and external environments
Urinary Kidneys, bladder Maintenance of water and solutes in the internal environment; waste removal
This schematic figure indicates relationships between systems of the human body. The interiors of some hollow organs (shown in white) are part of the external environment.
Integumentary System
Nervous system
Endocrine system
Musculoskeletal system
Respiratory system
Digestive system
Circulatory system
Reproductive system
Urinary system
M01_SILV5197_08_SE_C01.indd 4 9/11/17 11:49 AM
CVR_SILV5197_08_SE_FEP.indd 5 12/2/17 6:54 AM
@ Pearson
EIGHTH EDITION
AN INTEGRAT
UNIVERSITY OF TEXAS, AUSTIN
with contributions by
Bruce R. Johnson, Ph.D.
and
William C. Ober, M.D. ILLUSTRATION COORDINATOR
Claire E. Ober, R.N. ILLUSTRATOR
Anita lmpaglizzo, ILLUSTRATOR
Andrew C. Silverthorn, M.D. CLINICAL CONSULTANT
PPROACH
ISBN 10: 0-13-460519-5; ISBN 13: 978-0-13-460519-7 (Student edition) ISBN 10: 0-13-470434-7; ISBN 13: 978-0-13-470443-0 (Instructor’s Review Copy)
Cover Photo: Motor Neuron in Muscle Credit: Kent Wood/Science Source
Copyright ©2019, 2016, 2013, 2012 Pearson Education, Inc. All rights reserved. Printed in the United States of America. This publication is protected by copyright, and permission should be obtained from the publisher prior to any prohibited reproduction, storage in a retrieval system, or transmission in any form or by any means, electronic, mechanical, photocopying, recording, or otherwise. For information regarding permissions, request forms and the appropriate contacts within the Pearson Education Global Rights & Permissions department, please visit www.pearson.com.
Acknowledgements of third party content appear on page C-1, which constitutes an extension of this copyright page.
PEARSON, ALWAYS LEARNING, Mastering™ A&P, BioFlix, and A&P Flix are exclusive trademarks in the U.S. and/or other countries owned by Pearson Education, Inc. or its affiliates.
Unless otherwise indicated herein, any third-party trademarks that may appear in this work are the property of their respective owners and any references to third-party trademarks, logos or other trade dress are for demonstrative or descriptive purposes only. Such references are not intended to imply any sponsorship, endorsement, authorization, or promotion of Pearson’s products by the owners of such marks, or any relationship between the owner and Pearson Education, Inc. or its affiliates, authors, licensees or distributors.
Library of Congress Cataloging-in-Publication Data Catalogue in Publication Data is on file with the Library of Congress
Courseware Portfolio Manager: Lauren Harp Content Producer: Deepti Agarwal Managing Producer: Nancy Tabor Courseware Director, Content Development: Barbara Yien Courseware Editorial Assistant: Dapinder Dosanjh Rich Media Content Producer: Nicole Constantine Mastering Content Developer, Science: Lorna Perkins Full-Service Vendor: SPi Global Copyeditor: Alyson Platt
Art Project Manager: Stephanie Marquez, Imagineering Art LLC Illustrators: William C. Ober, Anita Impagliazzo, and Cliare E. Ober Design Manager: Maria Guglielmo Walsh Interior Designer: Gary Hespenheide Cover Designer: Gary Hespenheide Rights & Permissions Project Manager: Katrina Mohn,
Cenveo Publisher Services Rights & Permissions Management: Ben Ferrini Manufacturing Buyer: Stacey Weinberger, LSC Communications Product Marketing Manager: Wendy Mears
1 18
www.pearson.com
A01_SILV5197_08_SE_FM.indd 2 12/14/17 12:39 AM
iii
William C. Ober, M.D. (art coordinator and illustrator) received his undergraduate degree from Washington and Lee University and his M.D. from the University of Virginia. He also studied in the Department of Art as Applied to Medicine at Johns Hopkins University. After graduation, Dr. Ober completed a residency in Family Practice and later was on the faculty at the University of Virginia in the Department of Family Medicine and in the De- partment of Sports Medicine. He also served as Chief of Medi- cine of Martha Jefferson Hospital in Charlottesville, VA. He is currently a visiting Professor of Biology at Washington & Lee Uni- versity, where he has taught several courses and led student trips to the Galapagos Islands. He was part of the Core Faculty at Shoals Marine Laboratory, where he taught Biological Illustration for 22 years. The textbooks illustrated by Medical & Scientific Illustra- tion have won numerous design and illustration awards.
About the Illustrators
DEE UNGLAUB SILVERTHORN studied biology as an undergraduate at Newcomb College of Tulane Uni- versity, where she did research on cockroaches. For graduate school, she switched to studying crabs and received a Ph.D. in marine science from the Belle W. Baruch Institute for Marine and Coastal Sciences at the University of South Carolina. Her research interest is epithelial transport, and most recently work in her laboratory has focused on transport properties of the chick allantoic membrane. Her teaching career started in the Physiology Department at the Medical Uni- versity of South Carolina but over the years she has taught a wide range of students, from medical and college students to those still preparing for higher education. At the University of Texas–Aus- tin, she teaches physiology in both lecture and laboratory settings, and instructs graduate students on developing teaching skills in the life sciences. In 2015 she joined the faculty of the new UT-Austin Dell Medical School. She has received numerous teaching awards and honors, including a 2011 UT System Regents’ Outstanding
Teaching Award, the 2009 Out- standing Undergraduate Science Teacher Award from the Society for College Science Teachers, the American Physiological Society’s Claude Bernard Distinguished Lec- turer and Arthur C. Guyton Physi- ology Educator of the Year, and multiple awards from UT–Austin, including the Burnt Orange Apple Award. The first edition of her textbook won the 1998 Robert W. Hamilton Author Award for best textbook published in 1997–1998 by a University of Texas faculty
member. Dee was the president of the Human Anatomy and Physiology Society in 2012–2013, has served as editor-in-chief of Advances in Physiology Education, and is currently chair of the American Physiological Society Book Committee. She works with members of the International Union of Physiological Sciences to improve physiology education in developing countries, and this book has been translated into seven languages. Her free time is spent creating multimedia fiber art and enjoying the Texas hill country with her husband, Andy, and their dogs.
Claire E. Ober, R.N. (illustrator) practiced pedi- atric and obstetric nursing before turning to medical illustration as a full-time career. She returned to school at Mary Baldwin College where she received her degree with distinction in studio art. Following a five-year apprenticeship, she has worked as Dr. Ober’s partner in Medical and Scientific Illustration since 1986. She was also on the Core Faculty at Shoals Marine Laboratory and co-taught Biologi- cal Illustration at both Shoals Marine Lab and at Washington and Lee University.
Michael Chirillo, Dee Silverthorn, and Kevin Christmas
ABOUT THE AUTHOR
A01_SILV5197_08_SE_FM.indd 3 12/14/17 12:39 AM
About the Clinical Consultant Andrew C. Silverthorn, M.D. is a graduate of the U n i t e d S t a t e s M i l i t a r y Academy (West Point). He s e r ve d i n t h e i n f a n t r y i n Vietnam, and upon his return entered medical school at the Medical University of South Carolina in Charleston. He was chief resident in family medicine at the University
of Texas Medical Branch, Galveston, and is currently a family physician in solo practice in Austin, Texas. When Andrew is not busy seeing patients, he may be found on the golf course or play- ing with his two rescue dogs, Molly and Callie.
iv ABOUT THE AUTHORS
About the Contributor Bruce Johnson, Ph.D. is a Senior Research Asso- ciate in the Department of Neurobiology and Behavior at Cornell University. He earned biolog y deg rees at F lorida State University (B.A.), Florida Atlantic University (M.S.), and at the Marine Biological Laboratory in Woods Hole (Ph.D.) through the Boston
University Marine Program. For three decades, he has led Cor- nell’s highly-praised Principles of Neurophysiology course, in which students receive hands-on instruction in principles and methods in neurophysiology. He is a coauthor of Crawdad: a CD- ROM Lab Manual for Neurophysiology and the Laboratory Manual for Physiology. Bruce has directed and taught in neuroscience fac- ulty workshops sponsored by NSF (Crawdad), ADInstruments (Crawdad and CrawFly), the Grass Foundation and the Faculty for Undergraduate Neuroscience (FUN). He has also lead work- shops and neuroscience courses at the Universities of Copenha- gen (Denmark), Cologne (Germany), Ibadan (Nigeria), and the Marine Biological Laboratory. Bruce has been named a Most Influential Faculty Member by the graduating senior class at Cornell and awarded the John M. and Emily B. Clark Award for Distinguished Teaching at Cornell. His other teaching awards include the FUN Educator of the Year Award, FUN Career Ser- vice Award, and co-recipient of the 2016 Award for Education in Neuroscience, sponsored by the Society for Neuroscience. He is currently the Editor-in-Chief of the Journal of Undergraduate Neuroscience Education. Bruce’s research addresses the cellular and synaptic mechanisms of motor network plasticity.
A01_SILV5197_08_SE_FM.indd 4 12/14/17 12:39 AM
DEDICATION The 8th edition is dedicated to my colleagues who read every word of the first edition man-
uscript and provided valuable feedback that
helped shape the book.
v
Park City, Utah, June 1995 (Standing, L to R): Judy Sullivan, Patricia Munn, Dee Silverthorn, Mary Ann Rokitka, Richard Walker, Pat Berger, Norman Scott
(Seated) Shana Ederer, Prentice Hall development editor
A01_SILV5197_08_SE_FM.indd 5 12/14/17 12:39 AM
A01_SILV5197_08_SE_FM.indd 6 12/14/17 12:39 AM
This page intentionally left blank
vii
The Eighth Edition of Human Physiology: An Integrated Approach builds upon the thorough coverage of integrative and molecular physiology topics that have always been the foundation of this book. The big- gest change is a completely revised Chapter 24 on immunology. This field has expanded dramatically since the First Edition published in 1997, and it was time to step back and re-think the presentation of this complicated and complex subject. Neurophysiology is also changing rapidly, requiring multiple updates in Chapters 8 through 11. In nearly every chapter the latest developments in research and medicine meant changes to the presentation of information.
Continuing the revision of the art introduced in the Seventh Edition, we created additional Review and Essentials figures that students can use for quick review as well as new Anatomy Sum- maries and concept maps. Figures from previous editions that were significantly modified or eliminated are still available to instructors on the Instructor’s DVD and in the Instructor Resources area of Mastering A&P.
In addition to the online Phys in Action videos that are ref- erenced in related figures, we have new Try It! activities through- out the book. These activities present data, usually from classic experiments, and ask the students to interpret the results. Topics include Benjamin Franklin’s little-known experiment that helped development of the phospholipid bilayer model of the membrane, and the experiments that resulted in oral rehydration therapy for treating cholera.
HIGHLIGHTS OF CONTENT UPDATES Chapter 1 Introduction to Physiology • New Focus on Graphing with a new Try It! activity • Added information on the connectome and microbiome • Updated information on literature searches and citations
Chapter 2 Molecular Interactions • Four new element names in the periodic table, inside the
back cover of the text
• Added ribbon diagram/Richardson diagram of proteins Chapter 3 Compartmentation: Cells and Tissues • Explanations of light and electron microscopy • New Emerging Concepts box on induced pluripotent stem
cells (iPSs)
Chapter 5 Membrane Dynamics • New Try It! activity on lipid bilayers • Three Phys in Action video references in Figures 5.4, 5.6,
and 5.23
NEW TO THIS EDITION
Chapter 6 Communication, Integration, and Homeostasis • Juxtacrine signaling • Updated information on NIH Common Fund’s Building
Blocks, Biological Pathways, and Networks Program
• Updated the discussion on cytokine families • Re-classified receptor-enzymes as catalytic receptors • GPCR for eicosanoids
Chapter 7 Introduction to the Endocrine System • Updated information on calcitonin gene-related peptide • Updated information on melatonin and melatonin-related
drugs
Chapter 8 Neurons: Cellular and Network Properties • Update on mechanisms of axonal transport and associ-
ated diseases: dynein, kinesin, fragile X, Alzheimer’s, microcephaly
• Try It! activity on action potentials • New link to online calculator for Nernst and GHK equations • Added discussion of resistance of extracellular fluid to
discussion of resistance to current flow
• Added space constant discussion Chapter 9 The Central Nervous System • Added lateral sulcus, insula, cerebral aqueduct • Re-classification of stages of sleep • Pericytes in blood-brain barrier formation • Dopaminergic pathways and addiction
Chapter 10 Sensory Physiology • New Try It! activity on sweet and salty taste • Additional information on non-neural sensors and
Merkel cells
Chapter 11 Efferent Division: Autonomic and Somatic Motor Control
• Expanded table on properties of autonomic neurotransmitter receptors
• Added NN and NM nicotinic subtypes • Added discussion of sarin nerve gas • Updated anti-nicotine vaccine • Etiology of diabetic neuropathy
Chapter 12 Muscles • Expanded discussion of myosin light chains in striated
muscle
• New table with autonomic effects on smooth muscles
A01_SILV5197_08_SE_FM.indd 7 12/14/17 12:39 AM
viii FM/BM TITLE
Chapter 13 Integrative Physiology I: Control of Body Movement
• Addition information on reflexes and muscle tone • Updated Parkinson’s treatments • Expanded tetanus Running Problem
Chapter 14 Cardiovascular Physiology • New Running problem on atypical presentation of myocar-
dial infarction in a woman
• New section and new figure on coronary circulation • New Try It! activity on Starling’s law of the heart • Added discussion of echocardiography • Expanded ejection fraction discussion • New discussion of ion channel subtypes
Chapter 15 Blood Flow and the Control of Blood Pressure • Updated information on pericytes and their functions • New discussion of blood-retinal barrier • Updated discussion of angiogenesis including angiopoietin
and angiopoietin/Tie signaling pathway.
• New Review quantitative question on Bernoulli’s principle of fluid flow
• New sections on coronary blood flow and cerebral blood flow
• Updated statistics on CV diseases • Added neurogenic shock
Chapter 16 Blood • Revised art, includes Figures 16.2, 16.4, 16.6, and 16.7 • Updated information on treatment for sickle cell disease
Chapter 17 Mechanics of Breathing • Forced vital capacity test • FEV1 /FVC ratio • New figure and Figure Question for forced vital capacity test • Antenatal corticosteroids to prevent NRDS
Chapter 18 Gas Exchange and Transport • Updated information on action of carbonic anhydrase • Updated information on hemoglobin-based blood substitutes • Carotid body plasticity in disease states
Chapter 19 The Kidneys • New map for factors influencing GFR • Updated model of organic anion transport, including
OAT family transporters
• New figure and table on renal handling of some common substances
• New Try It! activity on glucosuria and the discovery of insulin
• PAH clearance and calculation of renal plasma f low discussion
• New term: renal handling • New Figure Question • Updated glomerular filtration barrier to include glomerular
capillary glycocalyx, slit diaphragm
Chapter 20 Integrative Physiology II: Fluid and Electrolyte Balance
• New section on role of kidney in hypertension • New Concept Check question • Expanded discussion of K+ handling • Added zona gomerulosa, paraventricular and supraoptic nuclei • New section on endocrine pathologies in fluid balance • New Level 3 Review question on Liddle’s syndrome
Chapter 21 The Digestive System • New Try It! activity on role of the SGLT in treating diarrhea • New information on cholera vaccine • Updated discussion on microfold cells • Added guanylate cyclase-C (GC-C), uroguanylin and
guanylin, plecanatide
Chapter 22 Metabolism and Energy Balance • Updated model for appetite • Updated pharmacological trials for anorexia • Latent autoimmune diabetes; also called type 1.5; gestational
diabetes (GDM); MODY, maturity-onset diabetes of the young.
• Added mechanism of action of metformin • Added cardiovascular risk calculator link
Chapter 23 Endocrine Control of Growth and Metabolism • Expanded discussion of melanocortins and their receptors
in the control of food intake.
• Agouti-related protein (AGRP), MC4R receptors • Added explanation of the role of ghrelin in growth hormone
release
• New figure for feedback control of growth hormone release • Updated discussion on off-label use of growth hormone in
adults
• Primary cilia in chrondrocytes and osteocytes act as mechnotransducers
• Role of calcium-sensing receptor and NALCN channel in neuronal excitability
• New figure and discussion of intestinal and renal Ca2 + transport
• Skeletal deformaties in ciliopathies • New figure and discussion of bone remodeling, including
RANK, RANKL, osteoprotegerin, osteoid
• New Review question on osteopetrosis Chapter 24 The Immune System • 6 NEW figures. Most art significantly revised. • Added concepts include long-lived plasma cells, mucosa-
associated lymphoid tissue (MALT), self-antigens, negative selection, hygiene hypothesis, Zika virus, DAMPS – danger- associated molecular patterns, B cell receptors, regulatory T cells (Tregs)
• Updated information on IgD, contact-dependent signaling Chapter 26 Reproduction and Development • Kisspeptin control of GNRH and role in puberty • Origin of the acrosome • Flibanserin for low libido in women
A01_SILV5197_08_SE_FM.indd 8 12/14/17 12:39 AM
ix
ACKNOWLEDGMENTS
Writing, editing, and publishing a textbook is a group project that requires the talent and expertise of many people. No one scientist has the detailed background needed in all areas to write a book of this scope, and I am indebted to all my colleagues who so gener- ously share their expertise in each edition. I particularly want to acknowledge Bruce Johnson, Cornell University, Department of Neurobiology and Behavior, a superb neurobiologist and educa- tor, who once again ensured that the chapters on neurobiology are accurate and reflect the latest developments in that rapidly chang- ing field. I would also like to thank Michael Chirillo, a former graduate teaching assistant of mine, for his work developing the Try It! features in between interviewing for and starting a medical residency program. Peter English, a colleague and former student, has also joined the team helping with this revision.
A huge thank you goes to immunologists Natalie Steinel, from UT-Austin Dell Medical School, and Tynan A. Becker, from Uni- versity of Alaska, for their assistance and critical review of the Chapter 24 revision. Brian Sumner, a 3rd year medical student at the George Washington University School of Medicine, gra- ciously volunteered time out of his busy clinical rotations to read the revised chapter and ensure that it was student-friendly.
The art team of Bill Ober, M.D. and Claire Ober, R.N. has worked with me since the first edition, and I am always grateful for their scientifically astute suggestions and revisions. They were joined in the last edition by Anita Impagliazzo, who brought a fresh eye and new figure ideas.
Instructors and students often contact me directly about the book, and for this edition I would particularly like to thank Allison Brekke, James Mayer, and Dean A. Wiseman for comments and suggestions. Thanks also to my students who keep me informed of the typos that creep in no matter how many people look at the manuscript and pages.
Many other people devoted their time and energy to making this book a reality, and I would like to thank them all, collectively and individually. I apologize in advance to anyone whose name I have omitted.
Reviewers I am particularly grateful to the instructors who reviewed one or more chapters of the last edition. There were many suggestions in their thoughtful reviews that I was unable to include in the text, but I appreciate the time and thought that went into their comments. The reviewers for this edition include:
Jake Brashears, San Diego City College Trevor Cardinal, California Polytechnic State University Michael S. Finkler, Indiana University Kokomo Victor Fomin, University of Delaware Jill Gifford, Youngstown State University
David Kurjiaka, Grand Valley State University Mary Jane Niles, University of San Francisco Rudy M. Ortiz, University of California, Merced Jennifer Rogers, University of Iowa Jia Sun, Imperial Valley College Alan Sved, University of Pittsburgh
Many other instructors and students took time to write or e-mail queries or suggestions for clarification, for which I thank them. I am always delighted to have input, and I apologize that I do not have room to acknowledge them all individually.
Specialty Reviews No one can be an expert in every area of physiology, and I am deeply thankful for my friends and colleagues who reviewed entire chapters or answered specific questions. Even with their help, there may be errors, for which I take full responsibility. The specialty reviewers for this edition were:
Natalie Steinel, UT-Austin Dell Medical School Tynan A. Becker, University of Alaska
Photographs I would like to thank Kristen Harris, University of Texas who generously provided micrographs from her research.
Supplements Damian Hill once again worked with me to revise and improve the Instructor Resource Manual that accompanies the book. I believe that supplements should reflect the style and approach of the text, so I am grateful that Damian has continued to be my alter-ego for so many editions. Peter English is helping with Mastering activities this revision.
I would also like to thank my colleagues who helped with the test bank and media supplements for this edition:
Heidi Bustamante, University of Colorado, Boulder Chad M. Wayne, University of Houston Margaret Flemming, Austin Community College Cheryl Neudauer, Minneapolis Community & Technical
College
The Development and Production Team Writing a manuscript is only a first step in the long and compli- cated process that results in a bound book with all its ancillaries. The team that works with me on book development deserves a lot of credit for the finished product. Gary Hespenheide designed a bright and cheerful cover that continues our tradition of images that show science as art. Anne A. Reid, my long-time developmental
A01_SILV5197_08_SE_FM.indd 9 12/14/17 12:39 AM
x ACKNOWLEDGMENTS
editor, is always wonderful to work with, and provides thoughtful suggestions that improve what I wrote.
The team at Pearson Education worked tirelessly to see this edition move from manuscript to bound book. My acquisitions editor, Kelsey Volker Churchman, was joined by Lauren Harp, Senior Acquisitions Editor for the second part of this revision. Ash- ley Williams and Kate Abderholden, assistant editors, kept track of everyone and everything for us. Chriscelle Palaganas, Program Manager, provided excellent guidance and support throughout the whole production process.
The task of coordinating production fell to Pearson Content Producer Deepti Agarwal. Nathaniel Jones handled composi- tion and project management, and Project Manager Stephanie Marquez at the art house, Imagineering, managed the team that prepared the art for production. Katrina Mohn was the photo researcher who found the wonderful new photos that appear in this edition. Nicole Constantine was the assistant media producer who kept my supplements authors on task and on schedule. Wendy Mears is the product marketing manager who works with the excellent sales teams at Pearson Education and Pearson Interna- tional, and Derek Perrigo is the Field Marketing Manager for the anatomy and physiology list.
Special Thanks As always, I would like to thank my students and colleagues who looked for errors and areas that needed improvement. I’ve learned that awarding one point of extra credit for being the first student to report a typo works really well. My graduate teaching assistants over the years have all played a huge role in my teaching, and their input has helped shape how I teach. Many of them are now faculty members themselves. They include:
Ari Berman, Ph.D. Lawrence Brewer, Ph.D. Kevin Christmas, Ph.D. Michael Chirillo, M.D., Ph.D. Lynn Cialdella Kam, M.S., M.B.A., Ph.D. Sarah Davies Kanke, Ph.D. Peter English, Ph.D. Carol C. Linder, Ph.D. Karina Loyo-Garcia, Ph.D. Jan M. Machart, Ph.D. Tonya Thompson, M.D. Patti Thorn, Ph.D.
Justin Trombold, Ph.D. Kurt Venator, Ph.D. Kira Wenstrom, Ph.D.
Finally, special thanks to my colleagues in the American Physiological Society, the Human Anatomy & Physiology Soci- ety, and the International Union of Physiological Sciences whose experiences in the classroom have enriched my own understanding of how to teach physiology. I would also like to recognize a special group of friends for their continuing sup- port: Penelope Hansen (Memorial University, St. John’s), Mary Anne Rokitka (SUNY Buffalo), Rob Carroll (East Carolina University School of Medicine), Cindy Gill (Hampshire College), and Joel Michael (Rush Medical College), as well as Ruth Buskirk, Jeanne Lagowski, Jan M. Machart and Marilla Svinicki (University of Texas).
As always, I thank my family and friends for their patience, understanding, and support during the chaos that seems inevitable with book revisions. The biggest thank you goes to my husband Andy, whose love, support, and willingness to forgo home-cooked meals on occasion help me meet my deadlines.
A Work in Progress One of the most rewarding aspects of writing a textbook is the opportunity it has given me to meet or communicate with other instructors and students. In the 20 years since the first edition was published, I have heard from people around the world and have had the pleasure of hearing how the book has been incorporated into their teaching and learning.
Because science textbooks are revised every 3 or 4 years, they are always works in progress. I invite you to contact me or my publisher with any suggestions, corrections, or comments about this edition. I am most reachable through e-mail at silverthorn@ utexas.edu. You can reach my editor at the following address:
Applied Sciences Pearson Education 1301 Sansome Street San Francisco, CA 94111
Dee U. Silverthorn silverthorn@utexas.edu
University of Texas Austin, Texas
A01_SILV5197_08_SE_FM.indd 10 12/14/17 12:39 AM
xi
CONTENTS
CHAPTER 1 Introduction to Physiology 1 Physiology Is an Integrative Science 2 RUNNING PROBLEM What to Believe? 2
EMERGING CONCEPTS The Changing World of Omics 3
Function and Mechanism 4 Themes in Physiology 5
FOCUS ON . . . Mapping 6 Theme 1: Structure and Function Are Closely Related 8 Theme 2: Living Organisms Need Energy 8 Theme 3: Information Flow Coordinates Body Functions 9 Theme 4: Homeostasis Maintains Internal Stability 9
Homeostasis 9 What Is the Body’s Internal Environment? 10 Homeostasis Depends on Mass Balance 10 Excretion Clears Substances from the Body 12 Homeostasis Does Not Mean Equilibrium 13
Control Systems and Homeostasis 13 Local Control Is Restricted to a Tissue 13 Reflex Control Uses Long-Distance Signaling 14 Response Loops Begin with a Stimulus 14 Feedback Loops Modulate the Response Loop 15 Negative Feedback Loops Are Homeostatic 15 Positive Feedback Loops Are Not Homeostatic 16 Feedforward Control Allows the Body to Anticipate Change 17 Biological Rhythms Result from Changes in a Setpoint 17
The Science of Physiology 18 Good Scientific Experiments Must Be Carefully Designed 18 FOCUS ON . . . Graphing 20 The Results of Human Experiments Can Be Difficult to Interpret 22
CHAPTER SUMMARY 25 | REVIEW QUESTIONS 26
UNIT 1 Basic Cell Processes: Integration and Coordination
CHAPTER 2 Molecular Interactions 28 RUNNING PROBLEM Chromium Supplements 29
Molecules and Bonds 29 Most Biomolecules Contain Carbon, Hydrogen, and Oxygen 29 Electrons Have Four Important Biological Roles 33 Covalent Bonds between Atoms Create Molecules 33 Noncovalent Bonds Facilitate Reversible Interactions 39
Noncovalent Interactions 40 Hydrophilic Interactions Create Biological Solutions 40 Molecular Shape Is Related to Molecular Function 40 Hydrogen Ions in Solution Can Alter Molecular Shape 41
Protein Interactions 46 Proteins Are Selective about the Molecules They Bind 46 Protein-Binding Reactions Are Reversible 47 Binding Reactions Obey the Law of Mass Action 47 The Dissociation Constant Indicates Affinity 48 Multiple Factors Alter Protein Binding 48 The Body Regulates the Amount of Protein in Cells 51 Reaction Rate Can Reach a Maximum 51
CHAPTER SUMMARY 55 | REVIEW QUESTIONS 56
CHAPTER 3 Compartmentation: Cells and Tissues 58
Functional Compartments of the Body 59 RUNNING PROBLEM Pap Tests Save Lives 59
The Lumens of Some Organs Are Outside the Body 59 Functionally, the Body Has Three Fluid Compartments 61
Biological Membranes 61 The Cell Membrane Separates Cell from Environment 61 Membranes Are Mostly Lipid and Protein 61 Membrane Lipids Create a Hydrophobic Barrier 62 Membrane Proteins May Be Loosely or Tightly Bound to the Membrane 62 Membrane Carbohydrates Attach to Both Lipids and Proteins 64
A01_SILV5197_08_SE_FM.indd 11 12/14/17 12:39 AM
xii CONTENTS
Enzymes 98 Enzymes Are Proteins 99 Reaction Rates Are Variable 99 Enzymes May Be Activated, Inactivated, or Modulated 99 Enzymes Lower Activation Energy of Reactions 100 Enzymatic Reactions Can Be Categorized 101
Metabolism 102 Cells Regulate Their Metabolic Pathways 102 Catabolic Pathways Produce ATP 104 One Glucose Molecule Can Yield 30–32 ATP 109 Anaerobic Metabolism Makes Two ATP 109 Proteins Are the Key to Cell Function 110 DNA Guides the Synthesis of RNA 113 Alternative Splicing Creates Multiple Proteins from One DNA Sequence 114 mRNA Translation Links Amino Acids 114
EMERGING CONCEPTS Purple Petunias and RNAi 114 Protein Sorting Directs Proteins to Their Destination 115 Proteins Undergo Posttranslational Modification 115
CHAPTER SUMMARY 118 | REVIEW QUESTIONS 119
CHAPTER 5 Membrane Dynamics 121
RUNNING PROBLEM Cystic Fibrosis 122 Homeostasis Does Not Mean Equilibrium 122
Osmosis and Tonicity 124 The Body Is Mostly Water 124 The Body Is in Osmotic Equilibrium 124 Osmolarity Describes the Number of Particles in Solution 125 Tonicity Describes the Volume Change of a Cell 126
Transport Processes 131 Cell Membranes Are Selectively Permeable 131
Diffusion 132 Lipophilic Molecules Cross Membranes by Simple Diffusion 134
Protein-Mediated Transport 136 Membrane Proteins Have Four Major Functions 136
Intracellular Compartments 64 Cells Are Divided into Compartments 65 The Cytoplasm Includes Cytosol, Inclusions, Fibers, and Organelles 65 Inclusions Are in Direct Contact with the Cytosol 65 Cytoplasmic Protein Fibers Come in Three Sizes 68 Microtubules Form Centrioles, Cilia, and Flagella 68 EMERGING CONCEPTS Single Cilia Are Sensors 68 The Cytoskeleton Is a Changeable Scaffold 68 Motor Proteins Create Movement 69 Organelles Create Compartments for Specialized Functions 70 The Nucleus Is the Cell’s Control Center 71
Tissues of the Body 73 Extracellular Matrix Has Many Functions 73 Cell Junctions Hold Cells Together to Form Tissues 73 Epithelia Provide Protection and Regulate Exchange 75 Connective Tissues Provide Support and Barriers 80 Muscle and Neural Tissues Are Excitable 82
Tissue Remodeling 84 Apoptosis Is a Tidy Form of Cell Death 84 Stem Cells Can Create New Specialized Cells 85 EMERGING CONCEPTS Induced Pluripotent Stems Cells 85 FOCUS ON . . . The Skin 86 Organs 87
CHAPTER SUMMARY 88 | REVIEW QUESTIONS 90
CHAPTER 4 Energy and Cellular Metabolism 92 RUNNING PROBLEM Tay-Sachs Disease: A Deadly Inheritance 93 Energy in Biological Systems 93 Energy Is Used to Perform Work 94
Energy Comes in Two Forms: Kinetic and Potential 94 Energy Can Be Converted from One Form to Another 95 Thermodynamics Is the Study of Energy Use 95
Chemical Reactions 96 Energy Is Transferred between Molecules during Reactions 96 Activation Energy Gets Reactions Started 96 Energy Is Trapped or Released during Reactions 96 Net Free Energy Change Determines Reaction Reversibility 98
A01_SILV5197_08_SE_FM.indd 12 12/21/17 6:28 PM
CONTENTS xiii
Channel Proteins Form Open, Water-Filled Passageways 138 Carrier Proteins Change Conformation to Move Molecules 139 Facilitated Diffusion Uses Carrier Proteins 141 Active Transport Moves Substances against Their Concentration Gradients 142 Carrier-Mediated Transport Exhibits Specificity, Competition, and Saturation 144
Vesicular Transport 146 Phagocytosis Creates Vesicles Using the Cytoskeleton 146 Endocytosis Creates Smaller Vesicles 147 CLINICAL FOCUS LDL: The Lethal Lipoprotein 147 Exocytosis Releases Molecules Too Large for Transport Proteins 147 Epithelial Transport 149 Epithelial Transport May Be Paracellular or Transcellular 149 Transcellular Transport of Glucose Uses Membrane Proteins 150 Transcytosis Uses Vesicles to Cross an Epithelium 151
The Resting Membrane Potential 152 Electricity Review 152 The Cell Membrane Enables Separation of Electrical Charge in the Body 152 All Living Cells Have a Membrane Potential 153 The Resting Membrane Potential Is Due Mostly to Potassium 156 Changes in Ion Permeability Change the Membrane Potential 157
Integrated Membrane Processes: Insulin Secretion 158
CHAPTER SUMMARY 160 | REVIEW QUESTIONS 161
CHAPTER 6 Communication, Integration, and Homeostasis 164 RUNNING PROBLEM Diabetes Mellitus: A Growing Epidemic 165 Cell-to-Cell Communication 165
Gap Junctions Create Cytoplasmic Bridges 165 Contact-Dependent Signals Require Cell-to-Cell Contact 165 Local Communication Uses Paracrine and Autocrine Signals 167
Long-Distance Communication May Be Electrical or Chemical 167 Cytokines May Act as Both Local and Long-Distance Signals 167
Signal Pathways 168 Receptor Proteins Are Located Inside the Cell or on the Cell Membrane 168 Membrane Proteins Facilitate Signal Transduction 170 The Most Rapid Signal Pathways Change Ion Flow through Channels 171 Most Signal Transduction Uses G Proteins 173 Many Lipophobic Hormones Use GPCR-cAMP Pathways 173 G Protein-Coupled Receptors Also Use Lipid-Derived Second Messengers 173 Catalytic Receptors Have Enzyme Activity 175 Integrin Receptors Transfer Information from the Extracellular Matrix 175
Novel Signal Molecules 175 Calcium Is an Important Intracellular Signal 176 Gases Are Ephemeral Signal Molecules 177 BIOTECHNOLOGY Calcium Signals Glow in the Dark 177 CLINICAL FOCUS From Dynamite to Medicine 178 Some Lipids Are Important Paracrine Signals 178
Modulation of Signal Pathways 179 Receptors Exhibit Saturation, Specificity, and Competition 179 One Ligand May Have Multiple Receptors 179 Up and Down-Regulation Enable Cells to Modulate Responses 180 Cells Must Be Able to Terminate Signal Pathways 181 Many Diseases and Drugs Target the Proteins of Signal Transduction 181
Homeostatic Reflex Pathways 181 Cannon’s Postulates Describe Regulated Variables and Control Systems 182 Long-Distance Pathways Maintain Homeostasis 182 Control Systems Vary in Their Speed and Specificity 186 Complex Reflex Control Pathways Have Several Integrating Centers 188
CHAPTER SUMMARY 191 | REVIEW QUESTIONS 192
A01_SILV5197_08_SE_FM.indd 13 12/21/17 6:28 PM
xiv CONTENTS
Receptor or Second Messenger Problems Cause Abnormal Tissue Responsiveness 215 Diagnosis of Endocrine Pathologies Depends on the Com- plexity of the Reflex 215
Hormone Evolution 217 FOCUS ON . . . The Pineal Gland 218
CHAPTER SUMMARY 220 | REVIEW QUESTIONS 221
CHAPTER 8 Neurons: Cellular and Network Properties 223 RUNNING PROBLEM Mysterious Paralysis 224 Organization of the Nervous System 224 Cells of the Nervous System 226
Neurons Carry Electrical Signals 226 Establishing Synapses Depends on Chemical Signals 229 Glial Cells Provide Support for Neurons 231 Can Stem Cells Repair Damaged Neurons? 233
Electrical Signals in Neurons 234 The Nernst Equation Predicts Membrane Potential for a Single Ion 234 The GHK Equation Predicts Membrane Potential Using Mul- tiple Ions 234 Ion Movement Creates Electrical Signals 235 Gated Channels Control the Ion Permeability of the Neuron 235 CLINICAL FOCUS Mutant Channels 236 Current Flow Obeys Ohm’s Law 236 Graded Potentials Reflect Stimulus Strength 237 Action Potentials Travel Long Distances 239
Na+ and K+ Move across the Membrane during Action Potentials 240 One Action Potential Does Not Alter Ion Concentration Gradients 242 Axonal Na+ Channels Have Two Gates 242 Action Potentials Will Not Fire during the Absolute Refractory Period 243 Action Potentials Are Conducted 245 Larger Neurons Conduct Action Potentials Faster 245 Conduction Is Faster in Myelinated Axons 247 Chemical Factors Alter Electrical Activity 249 BIOTECHNOLOGY The Body’s Wiring 249
UNIT 2 Homeostasis and Control
CHAPTER 7 Introduction to the Endocrine System 194
Hormones 195 RUNNING PROBLEM Graves’ Disease 195
Hormones Have Been Known Since Ancient Times 195 CLINICAL FOCUS Diabetes: The Discovery of Insulin 196 What Makes a Chemical a Hormone? 196 Hormones Act by Binding to Receptors 197 Hormone Action Must Be Terminated 197
The Classification of Hormones 199 Most Hormones Are Peptides or Proteins 199 Steroid Hormones Are Derived from Cholesterol 200 Some Hormones Are Derived from Single Amino Acids 202
Control of Hormone Release 205 The Endocrine Cell Is the Sensor in Simple Endocrine Reflexes 205 Many Endocrine Reflexes Involve the Nervous System 205 Neurohormones Are Secreted into the Blood by Neurons 205 The Pituitary Gland Is Actually Two Fused Glands 205 The Posterior Pituitary Stores and Releases Two Neurohormones 207 The Anterior Pituitary Secretes Six Hormones 207 A Portal System Connects the Hypothalamus and Anterior Pituitary 209 Anterior Pituitary Hormones Control Growth, Metabolism, and Reproduction 209 Feedback Loops Are Different in the Hypothalamic-Pituitary Pathway 211
Hormone Interactions 212 In Synergism, the Effect of Interacting Hormones Is More than Additive 213 A Permissive Hormone Allows Another Hormone to Exert Its Full Effect 213 Antagonistic Hormones Have Opposing Effects 213
Endocrine Pathologies 214 Hypersecretion Exaggerates a Hormone’s Effects 214 Hyposecretion Diminishes or Eliminates a Hormone’s Effects 215
A01_SILV5197_08_SE_FM.indd 14 12/21/17 6:28 PM
CONTENTS xv
Cell-To-Cell Communication in the Nervous System 249 Neurons Communicate at Synapses 249 Neurons Secrete Chemical Signals 250 Neurotransmitters Are Highly Varied 251 CLINICAL FOCUS Myasthenia Gravis 253 BIOTECHNOLOGY Of Snakes, Snails, Spiders, and Sushi 254 Neurotransmitters Are Released from Vesicles 254 Stronger Stimuli Release More Neurotransmitter 257
Integration of Neural Information Transfer 258 Postsynaptic Responses May Be Slow or Fast 258 Pathways Integrate Information from Multiple Neurons 261 Synaptic Activity Can Be Modified 261 Long-Term Potentiation Alters Synapses 264 Disorders of Synaptic Transmission Are Responsible for Many Diseases 264
CHAPTER SUMMARY 266 | REVIEW QUESTIONS 268
CHAPTER 9 The Central Nervous System 271
Emergent Properties of Neural Networks 272 RUNNING PROBLEM Infantile Spasms 272 Evolution of Nervous Systems 272 Anatomy of the Central Nervous System 274
The CNS Develops from a Hollow Tube 274 The CNS Is Divided into Gray Matter and White Matter 274 Bone and Connective Tissue Support the CNS 277 The Brain Floats in Cerebrospinal Fluid 277 The Blood-Brain Barrier Protects the Brain 279 Neural Tissue Has Special Metabolic Requirements 280 CLINICAL FOCUS Diabetes: Hypoglycemia and the Brain 281
The Spinal Cord 281 The Brain 282
The Brain Stem Is the Oldest Part of the Brain 283 The Cerebellum Coordinates Movement 285 The Diencephalon Contains the Centers for Homeostasis 285 The Cerebrum Is the Site of Higher Brain Functions 287
Brain Function 288 The Cerebral Cortex Is Organized into Functional Areas 289 The Spinal Cord and Brain Integrate Sensory Information 290 Sensory Information Is Processed into Perception 291 The Motor System Governs Output from the CNS 291
The Behavioral State System Modulates Motor Output 292 Why Do We Sleep? 292 EMERGING CONCEPTS Brain Glymphatics 294 Physiological Functions Exhibit Circadian Rhythms 295 Emotion and Motivation Involve Complex Neural Pathways 296 Moods Are Long-Lasting Emotional States 297 Learning and Memory Change Synaptic Connections in the Brain 297 Learning Is the Acquisition of Knowledge 298 Memory Is the Ability to Retain and Recall Information 298 Language Is the Most Elaborate Cognitive Behavior 300 Personality Is a Combination of Experience and Inheritance 301
CHAPTER SUMMARY 303 | REVIEW QUESTIONS 305
CHAPTER 10 Sensory Physiology 307 RUNNING PROBLEM Ménière’s Disease 308 General Properties of Sensory Systems 308
Receptors Are Sensitive to Particular Forms of Energy 309 Sensory Transduction Converts Stimuli into Graded Potentials 310 A Sensory Neuron Has a Receptive Field 310 The CNS Integrates Sensory Information 310 Coding and Processing Distinguish Stimulus Properties 312
Somatic Senses 315 Pathways for Somatic Perception Project to the Cortex and Cerebellum 315
Touch Receptors Respond to Many Different Stimuli 317 Skin Temperature Receptors Are Free Nerve Endings 318 Nociceptors Initiate Protective Responses 318 CLINICAL FOCUS Natural Painkillers 320
Chemoreception: Smell and Taste 322 Olfaction Is One of the Oldest Senses 322 Taste Is a Combination of Five Basic Sensations 324 Taste Transduction Uses Receptors and Channels 325
The Ear: Hearing 328 Hearing Is Our Perception of Sound 329 Sound Transduction Is a Multistep Process 329 The Cochlea Is Filled with Fluid 330 Sounds Are Processed First in the Cochlea 333 Auditory Pathways Project to the Auditory Cortex 333
A01_SILV5197_08_SE_FM.indd 15 12/21/17 6:28 PM
xvi CONTENTS
Hearing Loss May Result from Mechanical or Neural Damage 334
The Ear: Equilibrium 335 The Vestibular Apparatus Provides Information about Move- ment and Position 335 The Semicircular Canals Sense Rotational Acceleration 335 The Otolith Organs Sense Linear Acceleration and Head Position 337 Equilibrium Pathways Project Primarily to the Cerebellum 337
The Eye and Vision 338 The Skull Protects the Eye 338 Light Enters the Eye through the Cornea 339 The Lens Focuses Light on the Retina 341 Phototransduction Occurs at the Retina 343 EMERGING CONCEPTS Melanopsin 344 Photoreceptors Transduce Light into Electrical Signals 344 Signal Processing Begins in the Retina 347
CHAPTER SUMMARY 352 | REVIEW QUESTIONS 353
CHAPTER 11 Efferent Division: Autonomic and Somatic Motor Control 355 RUNNING PROBLEM A Powerful Addiction 356 The Autonomic Division 356
Autonomic Reflexes Are Important for Homeostasis 357 Antagonistic Control Is a Hallmark of the Autonomic Division 358 Autonomic Pathways Have Two Efferent Neurons in Series 358 Sympathetic and Parasympathetic Branches Originate in Different Regions 359 The Autonomic Nervous System Uses a Variety of Chemical Signals 359 Autonomic Pathways Control Smooth and Cardiac Muscle and Glands 359 Autonomic Neurotransmitters Are Synthesized in the Axon 362 Autonomic Receptors Have Multiple Subtypes 363 The Adrenal Medulla Secretes Catecholamines 364 Autonomic Agonists and Antagonists Are Important Tools in Research and Medicine 364 Primary Disorders of the Autonomic Nervous System Are Relatively Uncommon 366 CLINICAL FOCUS Diabetes: Autonomic Neuropathy 366
Summary of Sympathetic and Parasympathetic Branches 367
The Somatic Motor Division 368 A Somatic Motor Pathway Consists of One Neuron 368 The Neuromuscular Junction Contains Nicotinic Receptors 370
CHAPTER SUMMARY 371 | REVIEW QUESTIONS 372
CHAPTER 12 Muscles 374 RUNNING PROBLEM Periodic Paralysis 375 Skeletal Muscle 376
Skeletal Muscles Are Composed of Muscle Fibers 376 Myofibrils Are Muscle Fiber Contractile Structures 377 Muscle Contraction Creates Force 380 Actin and Myosin Slide Past Each Other during Contraction 382 Myosin Crossbridges Move Actin Filaments 383 Calcium Signals Initiate Contraction 383 Myosin Heads Step along Actin Filaments 384 Acetylcholine Initiates Excitation-Contraction Coupling 385 BIOTECHNOLOGY Watching Myosin Work 385 Skeletal Muscle Contraction Requires a Steady Supply of ATP 388 Fatigue Has Multiple Causes 389 Skeletal Muscle Is Classified by Speed and Fatigue Resistance 390 Resting Fiber Length Affects Tension 392 Force of Contraction Increases with Summation 393
A Motor Unit Is One Motor Neuron and Its Muscle Fibers 393 Contraction Force Depends on the Types and Numbers of Motor Units 394
Mechanics Of Body Movement 395 Isotonic Contractions Move Loads; Isometric Contractions Create Force without Movement 395 Bones and Muscles around Joints Form Levers and Fulcrums 397 Muscle Disorders Have Multiple Causes 399
Smooth Muscle 400 Smooth Muscle Is More Variable Than Skeletal Muscle 401 Smooth Muscle Lacks Sarcomeres 402 Myosin Phosphorylation Controls Contraction 403 MLCP Controls Ca2+ Sensitivity 405 Calcium Initiates Smooth Muscle Contraction 405
A01_SILV5197_08_SE_FM.indd 16 12/21/17 6:28 PM
CONTENTS xvii
CLINICAL FOCUS Fibrillation 455 The Electrocardiogram Reflects Electrical Activity 455 The Heart Contracts and Relaxes during a Cardiac Cycle 459 CLINICAL FOCUS Gallops, Clicks, and Murmurs 462 Pressure-Volume Curves Represent One Cardiac Cycle 462 Stroke Volume Is the Volume of Blood Pumped per Contraction 464 Cardiac Output Is a Measure of Cardiac Performance 464 The Autonomic Division Modulates Heart Rate 464 Multiple Factors Influence Stroke Volume 466 Contractility Is Controlled by the Nervous and Endocrine Systems 467 EMERGING CONCEPTS Stem Cells for Heart Disease 470 EDV and Arterial Blood Pressure Determine Afterload 470
CHAPTER SUMMARY 472 | REVIEW QUESTIONS 474
CHAPTER 15 Blood Flow and the Control of Blood Pressure 476 RUNNING PROBLEM Essential Hypertension 477 The Blood Vessels 478
Blood Vessels Contain Vascular Smooth Muscle 478 Arteries and Arterioles Carry Blood Away from the Heart 478 Exchange Takes Place in the Capillaries 479 Blood Flow Converges in the Venules and Veins 480
CHAPTER 14 Cardiovascular Physiology 432 RUNNING PROBLEM Myocardial Infarction 433 Overview of the Cardiovascular System 433
The Cardiovascular System Transports Materials throughout the Body 433 The Cardiovascular System Consists of the Heart, Blood Ves- sels, and Blood 434
Pressure, Volume, Flow, And Resistance 436 The Pressure of Fluid in Motion Decreases over Distance 436 Pressure Changes in Liquids without a Change in Volume 436 Blood Flows from Higher Pressure to Lower Pressure 438 Resistance Opposes Flow 438 Velocity Depends on the Flow Rate and the Cross-Sectional Area 439
Cardiac Muscle And The Heart 440 The Heart Has Four Chambers 440 Heart Valves Ensure One-Way Flow in the Heart 443 The Coronary Circulation Supplies Blood to the Heart 445 Cardiac Muscle Cells Contract without Innervation 446 Calcium Entry Is a Feature of Cardiac EC Coupling 447 Cardiac Muscle Contraction Can Be Graded 447 Myocardial Action Potentials Vary 448
The Heart as a Pump 452 Electrical Signals Coordinate Contraction 452 Pacemakers Set the Heart Rate 453
UNIT 3 Integration of Function
Some Smooth Muscles Have Unstable Membrane Potentials 406 Chemical Signals Influence Smooth Muscle Activity 407
Cardiac Muscle 409
CHAPTER SUMMARY 410 | REVIEW QUESTIONS 411
CHAPTER 13 Integrative Physiology I: Control of Body Movement 414
Neural Reflexes 415 Neural Reflex Pathways Can Be Classified in Different Ways 415
RUNNING PROBLEM Tetanus 415
Autonomic Reflexes 417 Skeletal Muscle Reflexes 417
Golgi Tendon Organs Respond to Muscle Tension 418 Muscle Spindles Respond to Muscle Stretch 418 Stretch Reflexes and Reciprocal Inhibition Control Movement around a Joint 420 Flexion Reflexes Pull Limbs Away from Painful Stimuli 421
The Integrated Control of Body Movement 422 Movement Can Be Classified as Reflex, Voluntary, or Rhythmic 423 The CNS Integrates Movement 425
Control of Movement in Visceral Muscles 428 EMERGING CONCEPTS Visualization Techniques in Sports 428
CHAPTER SUMMARY 429 | REVIEW QUESTIONS 430
A01_SILV5197_08_SE_FM.indd 17 12/21/17 6:28 PM
xviii CONTENTS
Angiogenesis Creates New Blood Vessels 480
Blood Pressure 481 Blood Pressure Is Highest in Arteries and Lowest in Veins 481 Arterial Blood Pressure Reflects the Driving Pressure for Blood Flow 482 Blood Pressure Is Estimated by Sphygmomanometry 483 Cardiac Output and Peripheral Resistance Determine Mean Arterial Pressure 484 Changes in Blood Volume Affect Blood Pressure 484 CLINICAL FOCUS SHOCK 485
Resistance in the Arterioles 486 Myogenic Autoregulation Adjusts Blood Flow 486 Paracrine Signals Influence Vascular Smooth Muscle 488 The Sympathetic Branch Controls Most Vascular Smooth Muscle 489
Distribution of Blood to the Tissues 489 Cerebral Blood Flow Stays Nearly Constant 491 Coronary Blood Flow Parallels the Work of the Heart 491
Regulation of Cardiovascular Function 492 The Baroreceptor Reflex Controls Blood Pressure 492 Orthostatic Hypotension Triggers the Baroreceptor Reflex 494 Other Systems Influence Cardiovascular Function 495
Exchange at the Capillaries 495 Velocity of Blood Flow Is Lowest in the Capillaries 496 Most Capillary Exchange Takes Place by Diffusion and Transcytosis 496 Capillary Filtration and Absorption Take Place by Bulk Flow 497
The Lymphatic System 499 Edema Results from Alterations in Capillary Exchange 500
Cardiovascular Disease 501 Risk Factors for CVD Include Smoking and Obesity 501 CLINICAL FOCUS Diabetes and Cardiovascular Disease 502 Atherosclerosis Is an Inflammatory Process 502 Hypertension Represents a Failure of Homeostasis 502 EMERGING CONCEPTS Inflammatory Markers for Cardiovascular Disease 504
CHAPTER SUMMARY 505 | REVIEW QUESTIONS 507
CHAPTER 16 Blood 510 RUNNING PROBLEM Blood Doping in Athletes 511 Plasma and the Cellular Elements of Blood 511
Plasma Is Extracellular Matrix 511 Cellular Elements Include RBCs, WBCs, and Platelets 513
Blood Cell Production 513 Blood Cells Are Produced in the Bone Marrow 513 Hematopoiesis Is Controlled by Cytokines 514 Colony-Stimulating Factors Regulate Leukopoiesis 515 Thrombopoietin Regulates Platelet Production 515 Erythropoietin Regulates RBC Production 515
Red Blood Cells 517 Mature RBCs Lack a Nucleus 517 Hemoglobin Synthesis Requires Iron 517 RBCs Live about Four Months 517 FOCUS ON . . . Bone Marrow 518 RBC Disorders Decrease Oxygen Transport 519 CLINICAL FOCUS Diabetes: Hemoglobin and Hyperglycemia 522
Platelets 522 Hemostasis and Coagulation 523 Hemostasis Prevents Blood Loss from Damaged Vessels 523 Platelet Activation Begins the Clotting Process 523 Coagulation Converts a Platelet Plug into a Clot 525 Anticoagulants Prevent Coagulation 527
CHAPTER SUMMARY 529 | REVIEW QUESTIONS 530
CHAPTER 17 Mechanics of Breathing 532 RUNNING PROBLEM Emphysema 533 The Respiratory System 533
Bones and Muscles of the Thorax Surround the Lungs 534 Pleural Sacs Enclose the Lungs 534 Airways Connect Lungs to the External Environment 537 The Airways Warm, Humidify, and Filter Inspired Air 538 CLINICAL FOCUS Congestive Heart Failure 538 Alveoli Are the Site of Gas Exchange 538 Pulmonary Circulation Is High-Flow, Low-Pressure 539
Gas Laws 540 Air Is a Mixture of Gases 540 Gases Move Down Pressure Gradients 540 Boyle’s Law Describes Pressure-Volume Relationships 540
Ventilation 542 Lung Volumes Change during Ventilation 542 During Ventilation, Air Flows because of Pressure Gradients 544 Inspiration Occurs When Alveolar Pressure Decreases 544 Expiration Occurs When Alveolar Pressure Increases 546 Intrapleural Pressure Changes during Ventilation 547
A01_SILV5197_08_SE_FM.indd 18 12/21/17 6:28 PM
CONTENTS xix
Lung Compliance and Elastance May Change in Disease States 548 Surfactant Decreases the Work of Breathing 549 Airway Diameter Determines Airway Resistance 550 Rate and Depth of Breathing Determine the Efficiency of Breathing 551 Alveolar Gas Composition Varies Little during Normal Breathing 553 Ventilation and Alveolar Blood Flow Are Matched 553 Auscultation and Spirometry Assess Pulmonary Function 556
CHAPTER SUMMARY 558 | REVIEW QUESTIONS 559
CHAPTER 18 Gas Exchange and Transport 562 RUNNING PROBLEM High Altitude 563 Gas Exchange in the Lungs and Tissues 563
Lower Alveolar Po2 Decreases Oxygen Uptake 564 Diffusion Problems Cause Hypoxia 565 BIOTECHNOLOGY The Pulse Oximeter 567 Gas Solubility Affects Diffusion 567 Gas Transport In The Blood 569 Hemoglobin Binds to Oxygen 569 Oxygen Binding Obeys the Law of Mass Action 570 Hemoglobin Transports Most Oxygen to the Tissues 571 PO2 Determines Oxygen-Hb Binding 571 EMERGING CONCEPTS Blood Substitutes 572 Oxygen Binding Is Expressed as a Percentage 572 Several Factors Affect O2-Hb Binding 573 Carbon Dioxide Is Transported in Three Ways 575
Regulation of Ventilation 578 Neurons in the Medulla Control Breathing 579 CO2, Oxygen, and pH Influence Ventilation 580 Protective Reflexes Guard the Lungs 582 Higher Brain Centers Affect Patterns of Ventilation 582
CHAPTER SUMMARY 584 | REVIEW QUESTIONS 585
CHAPTER 19 The Kidneys 587
Functions of the Kidneys 588 RUNNING PROBLEM Gout 588
Anatomy of the Urinary System 589 The Urinary System Consists of Kidneys, Ureters, Bladder, and Urethra 589 The Nephron Is the Functional Unit of the Kidney 589
Overview of Kidney Function 592 Kidneys Filter, Reabsorb, and Secrete 592 The Nephron Modifies Fluid Volume and Osmolarity 592
Filtration 594 The Renal Corpuscle Contains Filtration Barriers 595 EMERGING CONCEPTS Diabetes: Diabetic Nephropathy 595 Capillary Pressure Causes Filtration 596 GFR Is Relatively Constant 598 GFR Is Subject to Autoregulation 598 Hormones and Autonomic Neurons Also Influence GFR 600
Reabsorption 600 Reabsorption May Be Active or Passive 600 Renal Transport Can Reach Saturation 602 BIOTECHNOLOGY Artificial Kidneys 603 Peritubular Capillary Pressures Favor Reabsorption 604
Secretion 605 Competition Decreases Penicillin Secretion 606
Excretion 607 Clearance Is a Noninvasive Way to Measure GFR 607 Clearance Helps Us Determine Renal Handling 609
Micturition 612
CHAPTER SUMMARY 614 | REVIEW QUESTIONS 615
CHAPTER 20 Integrative Physiology II: Fluid and Electrolyte Balance 616
Fluid and Electrolyte Homeostasis 617 ECF Osmolarity Affects Cell Volume 617 Multiple Systems Integrate Fluid and Electrolyte Balance 617
RUNNING PROBLEM Hyponatremia 617 Water Balance 620
Daily Water Intake and Excretion Are Balanced 620 The Kidneys Conserve Water 621 The Renal Medulla Creates Concentrated Urine 621 CLINICAL FOCUS Diabetes: Osmotic Diuresis 623 Vasopressin Controls Water Reabsorption 623 Blood Volume and Osmolarity Activate Osmoreceptors 625 The Loop of Henle Is a Countercurrent Multiplier 625
Sodium Balance and ECF Volume 629 Aldosterone Controls Sodium Balance 630 Low Blood Pressure Stimulates Aldosterone Secretion 630 ANG II Has Many Effects 632 Natriuretic Peptides Promote Na+ and Water Excretion 632
A01_SILV5197_08_SE_FM.indd 19 12/21/17 6:28 PM
xx CONTENTS
The Liver Secretes Bile 676 Most Digestion Occurs in the Small Intestine 676 FOCUS ON . . . The Liver 677 Bile Salts Facilitate Fat Digestion 678 Carbohydrates Are Absorbed as Monosaccharides 678 Proteins Are Digested into Small Peptides and Amino Acids 680 Some Larger Peptides Can Be Absorbed Intact 681 Nucleic Acids Are Digested into Bases and Monosaccharides 683 The Intestine Absorbs Vitamins and Minerals 683 The Intestine Absorbs Ions and Water 683 Regulation of the Intestinal Phase 683 The Large Intestine Concentrates Waste 684
Diarrhea Can Cause Dehydration 686 EMERGING CONCEPTS The Human Microbiome Project 687
Immune Functions of the GI Tract 687 M Cells Sample Gut Contents 687 Vomiting Is a Protective Reflex 687
CHAPTER SUMMARY 689 | REVIEW QUESTIONS 690
CHAPTER 22 Metabolism and Energy Balance 692
Appetite and Satiety 693 RUNNING PROBLEM Eating Disorders 693
BIOTECHNOLOGY Discovering Peptides: Research in Reverse 694
CHAPTER 21 The Digestive System 654 RUNNING PROBLEM Cholera in India 655 Anatomy of the Digestive System 655
The Digestive System Is a Tube 655 The GI Tract Wall Has Four Layers 658
Digestive Function and Processes 659 We Secrete More Fluid than We Ingest 660 Digestion and Absorption Make Food Usable 661 Motility: GI Smooth Muscle Contracts Spontaneously 661 GI Smooth Muscle Exhibits Different Patterns of Contraction 663 CLINICAL FOCUS Diabetes: Delayed Gastric Emptying 663
Regulation of GI Function 664 The Enteric Nervous System Can Act Independently 664 GI Peptides Include Hormones, Neuropeptides, and Cytokines 665
Integrated Function: The Cephalic Phase 667 Chemical and Mechanical Digestion Begins in the Mouth 668 Saliva Is an Exocrine Secretion 668 Swallowing Moves Food from Mouth to Stomach 668
Integrated Function: The Gastric Phase 669 The Stomach Stores Food 669 Gastric Secretions Protect and Digest 670 The Stomach Balances Digestion and Defense 673
Integrated Function: The Intestinal Phase 673 Intestinal Secretions Promote Digestion 674 The Pancreas Secretes Enzymes and Bicarbonate 674
UNIT 4 Metabolism, Growth, and Aging
Potassium Balance 635 Behavioral Mechanisms in Salt and Water Balance 636
Drinking Replaces Fluid Loss 636 Low Na+ Stimulates Salt Appetite 636 Avoidance Behaviors Help Prevent Dehydration 636
Integrated Control of Volume, Osmolarity, and Blood Pressure 636
Osmolarity and Volume Can Change Independently 637 Dehydration Triggers Homeostatic Responses 638 Kidneys Assist in Blood Pressure Homeostasis 641 Endocrine Problems Disrupt Fluid Balance 641
Acid-Base Balance 641 pH Changes Can Denature Proteins 641
Acids and Bases in the Body Come from Many Sources 642 pH Homeostasis Depends on Buffers, Lungs, and Kidneys 642 Buffer Systems Include Proteins, Phosphate Ions, and HCO3¯ 643 Ventilation Can Compensate for pH Disturbances 644 Kidneys Use Ammonia and Phosphate Buffers 645 The Proximal Tubule Secretes H+ and Reabsorbs HCO3¯ 645 The Distal Nephron Controls Acid Excretion 646 Acid-Base Disturbances May Be Respiratory or Metabolic 647
CHAPTER SUMMARY 651 | REVIEW QUESTIONS 652
A01_SILV5197_08_SE_FM.indd 20 12/21/17 6:28 PM
CONTENTS xxi
Energy Balance 694 Energy Input Equals Energy Output 695 Oxygen Consumption Reflects Energy Use 695 CLINICAL FOCUS Estimating Fat–The Body Mass Index 696 Many Factors Influence Metabolic Rate 697 Energy Is Stored in Fat and Glycogen 697
Metabolism 698 Ingested Energy May Be Used or Stored 698 Enzymes Control the Direction of Metabolism 698
Fed-State Metabolism 700 Carbohydrates Make ATP 700 Amino Acids Make Proteins 700 Fats Store Energy 700 CLINICAL FOCUS Antioxidants Protect the Body 703 Plasma Cholesterol Predicts Heart Disease 703
Fasted-State Metabolism 704 Glycogen Converts to Glucose 704 Proteins Can Be Used to Make ATP 705 Lipids Store More Energy than Glucose or Protein 706
Homeostatic Control of Metabolism 707 The Pancreas Secretes Insulin and Glucagon 707 The Insulin-to-Glucagon Ratio Regulates Metabolism 707 Insulin Is the Dominant Hormone of the Fed State 708 Insulin Promotes Anabolism 708 Glucagon Is Dominant in the Fasted State 711 Diabetes Mellitus Is a Family of Diseases 712 Type 1 Diabetics Are Prone to Ketoacidosis 715 Type 2 Diabetics Often Have Elevated Insulin Levels 717 Metabolic Syndrome Links Diabetes and Cardiovascular Disease 718 Multiple Hormones Influence Metabolism 719
Regulation of Body Temperature 719 Body Temperature Balances Heat Production, Gain, and Loss 719 Body Temperature Is Homeostatically Regulated 720 Movement and Metabolism Produce Heat 722 The Body’s Thermostat Can Be Reset 723
CHAPTER SUMMARY 725 | REVIEW QUESTIONS 726
CHAPTER 23 Endocrine Control of Growth and Metabolism 728
Review Of Endocrine Principles 729 RUNNING PROBLEM Hyperparathyroidism 729 Adrenal Glucocorticoids 729
The Adrenal Cortex Secretes Steroid Hormones 729 Cortisol Secretion Is Controlled by ACTH 731 Cortisol Is Essential for Life 731 Cortisol Is a Useful Therapeutic Drug 733 Cortisol Pathologies Result from Too Much or Too Little Hormone 733 CRH and ACTH Have Additional Physiological Functions 734
Thyroid Hormones 734 Thyroid Hormones Contain Iodine 736 TSH Controls the Thyroid Gland 736 Thyroid Pathologies Affect Quality of Life 737
Growth Hormone 739 Growth Hormone Is Anabolic 739 Growth Hormone Is Essential for Normal Growth 741 Genetically Engineered hGH Raises Ethical Questions 741
Tissue and Bone Growth 741 Tissue Growth Requires Hormones and Paracrine Factors 741 Bone Growth Requires Adequate Dietary Calcium 742 CLINICAL FOCUS New Growth Charts 742
Calcium Balance 743 Plasma Calcium Is Closely Regulated 744
Three Hormones Control Calcium Balance 746 Multiple Factors Control Bone Remodeling 747 Calcium and Phosphate Homeostasis Are Linked 748 Osteoporosis Is a Disease of Bone Loss 750
CHAPTER SUMMARY 751 | REVIEW QUESTIONS 752
CHAPTER 24 The Immune System 754
Overview 755 RUNNING PROBLEM HPV: To Vaccinate or Not? 755 Anatomy of the Immune System 757
Lymphoid Tissues Are Everywhere 757 Leukocytes Are the Immune Cells 757
A01_SILV5197_08_SE_FM.indd 21 12/21/17 6:28 PM
xxii CONTENTS
Ventilatory Responses to Exercise 790 Cardiovascular Responses to Exercise 791
Cardiac Output Increases during Exercise 791 Muscle Blood Flow Increases during Exercise 791 Blood Pressure Rises Slightly during Exercise 792 The Baroreceptor Reflex Adjusts to Exercise 792
Feedforward Responses to Exercise 793 Temperature Regulation During Exercise 794 Exercise and Health 794
Exercise Lowers the Risk of Cardiovascular Disease 795 Type 2 Diabetes Mellitus May Improve with Exercise 795 Stress and the Immune System May Be Influenced by Exercise 796
CHAPTER SUMMARY 797 | REVIEW QUESTIONS 798
CHAPTER 26 Reproduction and Development 800 RUNNING PROBLEM Infertility 801
Sex Determination 801 Sex Chromosomes Determine Genetic Sex 802 Sexual Differentiation Occurs Early in Development 802 CLINICAL FOCUS X-Linked Inherited Disorders 805
Basic Patterns of Reproduction 806 CLINICAL FOCUS Determining Sex 806 Gametogenesis Begins in Utero 806 The Brain Directs Reproduction 807 Environmental Factors Influence Reproduction 810
Male Reproduction 810 Testes Produce Sperm and Hormones 811 Spermatogenesis Requires Gonadotropins and Testosterone 814 Male Accessory Glands Contribute Secretions to Semen 815 Androgens Influence Secondary Sex Characteristics 815
Female Reproduction 815 The Ovary Produces Eggs and Hormones 818 A Menstrual Cycle Lasts about One Month 818 Hormonal Control of the Menstrual Cycle Is Complex 819 Hormones Influence Female Secondary Sex Characteristics 823
Procreation 823 The Human Sexual Response Has Four Phases 823 The Male Sex Act Includes Erection and Ejaculation 824
Development of Immune Cells 760 FOCUS ON . . . The Thymus Gland 661 Lymphocytes Mediate the Adaptive Immune Response 761 The Immune System Must Recognize “Self” 761 Early Pathogen Exposure Strengthens Immunity 762
Molecules of the Innate Immune Response 762 Many Molecules of the Innate Immune Response Are Always Present 762
Antigen Presentation and Recognition Molecules 763 Antigen-Recognition Molecules 764 B Lymphocytes Produce Antibodies 764
Pathogens of the Human Body 765 Bacteria and Viruses Require Different Defense Mechanisms 765 Viruses Can Only Replicate inside Host Cells 766
The Immune Response 766 Barriers Are the Body’s First Line of Defense 766 Innate Immunity Provides Nonspecific Responses 766 Antigen-Presenting Cells Bridge Innate and Adaptive Responses 768 Adaptive Immunity Creates Antigen-Specific Responses 768 Antibody Functions 769
Integrated Immune Responses 773 Bacterial Invasion Causes Inflammation 773 Viral Infections Require Intracellular Defense 773 Specific Antigens Trigger Allergic Responses 776 MHC Proteins Allow Recognition of Foreign Tissue 777
Immune System Pathologies 778 Autoimmune Disease Results from Antibodies against Self-Antigen 779 Immune Surveillance Removes Abnormal Cells 779
Neuro-Endocrine-Immune Interactions 780 Stress Alters Immune System Function 780 Modern Medicine Includes Mind-Body Therapeutics 781
CHAPTER SUMMARY 782 | REVIEW QUESTIONS 784
CHAPTER 25 Integrative Physiology III: Exercise 786 RUNNING PROBLEM Malignant Hyperthermia 787
Metabolism and Exercise 787 Hormones Regulate Metabolism during Exercise 788 Oxygen Consumption Is Related to Exercise Intensity 789 Several Factors Limit Exercise 790
A01_SILV5197_08_SE_FM.indd 22 12/21/17 6:28 PM
CONTENTS xxiii
Sexual Dysfunction Affects Males and Females 824 Contraceptives Are Designed to Prevent Pregnancy 825 Infertility Is the Inability to Conceive 826
Pregnancy and Parturition 826 Fertilization Requires Capacitation 826 The Developing Embryo Implants in the Endometrium 827 The Placenta Secretes Hormones During Pregnancy 827 Pregnancy Ends with Labor and Delivery 830 The Mammary Glands Secrete Milk During Lactation 830
Growth and Aging 833 Puberty Marks the Beginning of the Reproductive Years 833 Menopause and Andropause Are a Consequence of Aging 833
CHAPTER SUMMARY 834 | REVIEW QUESTIONS 836
Appendices Appendix A Answers A-1 Appendix B Physics and Math A-36 Appendix C Genetics A-39
Photo Credits C-1 Glossary/Index GI-1
A01_SILV5197_08_SE_FM.indd 23 12/21/17 6:28 PM
A01_SILV5197_08_SE_FM.indd 6 12/14/17 12:39 AM
This page intentionally left blank
Move Beyond Memorization: Prepare for Tomorrow’s Challenges
The goals for the Eighth Edition of Human Physiology: An Integrated Approach are to provide an integrated and up-to-date introduction to core concepts in physiology and to equip you with skills for solving real-world problems.
Harlow, England • London • New York • Boston • San Francisco • Toronto • Sydney Dubai • Singapore • Hong Kong • Tokyo • Seoul • Taipei • New Delhi Cape Town • São Paulo • Mexico City • Madrid • Amsterdam • Munich • Paris • Milan
A02_SILV5197_08_SE_FM02.indd 1 12/2/17 7:03 AM
Challenge Yourself: Apply What You Learn
Learning physiology requires that you use information rather than simply memorizing what you think will be on the test. The Eighth Edition text and Mastering™ A&P program provide multiple opportunities for you to practice answering the more challenging types of questions that you are likely to see on a test or exam.
Running Problems explore a real-world disease or disorder that unfolds in short segments throughout the chapter. You can check your understanding by comparing your answers with those in Problem Conclusion at the end of each chapter. Related Coaching Activities can be assigned in Mastering A&P.
see pp. 84–85
Additional Practice Questions include Concept Check Questions, which are placed at intervals throughout the chapter, and Review Questions, which are provided at the end of the chapter and organized into four levels of difficulty. An answer key is in Appendix A.
See p. 217
C H
A P
TER
7
7.6 Hormone Evolution 217
7.6 Hormone Evolution Chemical signaling is an ancient method for communication and the maintenance of homeostasis. As scientists sequence the genomes of diverse species, they are discovering that in many cases hormone structure and function have changed amazingly little from the most primitive vertebrates through the mammals. In fact, hormone signaling pathways that were once considered exclusive to vertebrates, such as those for thyroid hormones and insulin, have now been shown to play physiological or developmental roles in invertebrates such as echinoderms and insects. This evolutionary conser vation of hormone function is also demonstrated by the fact that some hormones from other organisms have biological activity when administered to humans. By studying which portions of a hor- mone molecule do not change from species to species, scientists have acquired important clues to aid in the design of agonist and antagonist drugs.
The ability of nonhuman hormones to work in humans was a critical factor in the birth of endocrinology. When Best and Banting discovered insulin in 1921 and the first diabetic patients were treated with the hormone, the insulin was extracted from cow, pig, or sheep pancreases. Before the mid-1980s, slaugh- terhouses were the major source of insulin for the medical
profession. Now, with genetic engineering, the human gene for insulin has been inserted into bacteria, which then synthesize the hormone, providing us with a plentiful source of human insulin.
Although many hormones have the same function in most vertebrates, a few hormones that play a significant role in the physiology of lower vertebrates seem to be evolutionarily “on their way out” in humans. Calcitonin is a good example of such a hormone. It plays a role in calcium metabolism in fish but apparently has no significant influence on daily calcium balance in adult humans. Neither calcitonin deficiency nor cal- citonin excess is associated with any pathological condition or symptom.
Although calcitonin is not a significant hormone in humans, the calcitonin gene does code for a biologically active protein. In the brain, cells process mRNA from the calcitonin gene to make a peptide known as calcitonin gene-related peptide (CGRP), which acts as a neurotransmitter. The ability of one gene to produce multiple peptides is one reason research is shifting from genomics to physiol- ogy and proteomics (the study of the role of proteins in physiological function).
Some endocrine structures that are important in lower ver- tebrates are vestigial {vestigium, trace} in humans, meaning that in humans these structures are present as minimally functional glands. For example, melanocyte-stimulating hormone (MSH) from the intermediate lobe of the pituitary controls pigmentation in rep- tiles and amphibians. However, adult humans have only a vestigial intermediate lobe and normally do not have measurable levels of MSH in their blood.
In the research arena, comparative endocrinolog y—the study of endocrinology in nonhuman organisms—has made signifi- cant contributions to our quest to understand the human body. Many of our models of human physiology are based on research
FIG. 7.15 Hypocortisolism
Cortisol
Symptoms of
deficiency
Symptoms of
deficiency
Cortisol
ACTH ACTH
CRH CRH
Anterior pituitary Anterior pituitary
Adrenal cortex Adrenal cortex
For each condition, use arrows to indicate whether levels of the three hormones in the pathway will be increased, decreased, or unchanged. Draw in negative feedback loops where functional.
(a) Hyposecretion from Damage to the Pituitary
(b) Hyposecretion from Atrophy of the Adrenal Cortex
HypothalamusHypothalamus
FIGURE QUESTION
RUNNING PROBLEM Researchers have learned that Graves’ disease is an autoimmune disorder in which the body fails to recognize its own tissue. In this condition, the body produces antibodies that mimic TSH and bind to the TSH receptor, turning it on. This false signal “fools” the thyroid gland into overproducing thyroid hormone. More women than men are diagnosed with Graves’ disease, perhaps because of the influence of female hormones on thyroid function. Stress and other environmental factors have also been implicated in hyperthyroidism.
Q7: Antibodies are proteins that bind to the TSH receptor. From that information, what can you conclude about the cellular loca- tion of the TSH receptor?
Q8: In Graves’ disease, why doesn’t negative feedback shut off thyroid hormone production before it becomes excessive?
195 204 212 214 216 217 219
M07_SILV5197_08_SE_C07.indd 217 10/3/17 12:50 PM
Figure Questions challenge you to apply visual literacy skills as you read an illustration or photo. Answers to these questions appear at the end of the text, in Appendix A.
A02_SILV5197_08_SE_FM02.indd 2 12/2/17 7:03 AM
NEW! “Try it” boxes present a real-world research problem or classic experiment and guide you through the process of analyzing the data and thinking like a scientist.
NEW! Additional questions for each “Try it” activity are available in Mastering A&P. Topics include Graphing (Chapter 1), Cell Membranes (Chapter 5), Action Potentials (Chapter 8), Salty-Sweet Taste Experiment (Chapter 10), Frank-Starling Law of the Heart (Chapter 14), Insulin (Chapter 19) and Oral Rehydration Therapy (Chapter 21).
Practice Solving Real-World Problems
See p. 251
Graph Questions encourage you to interpret real data presented in graphs. Answers to these questions appear at the end of the text, in Appendix A.
A02_SILV5197_08_SE_FM02.indd 3 12/2/17 7:03 AM
Study More Efficiently Using the Figures
Eye-tracking research has shown that learning and comprehension levels are higher for students who study both the figures and the text together than for students who only read the text. This book offers dozens of illustrations designed to help you learn physiology more efficiently, and make the best use of your study time.
Essentials Figures distill the basics of a topic into one or two pages, helping you to see the big picture of human physiology. Instructors can assign related Mastering A&P coaching activities that explore these topics in greater depth.
See p. 154
154
FIG. 5.23 ESSENTIALS Membrane Potential
Sodium ion
Potassium ion
Chloride ion
Large anion
KEY
1. If the cell in (e) was made freely permeable to only Na+, which way would the Na+ move? Would the membrane potential become positive or negative?
2. If it became freely permeable to only Cl–, which way would Cl– move? Would the membrane potential become positive or negative?
3. Calculate the equilibrium potential for Na+ (ENa).
4. Calculate the ECl.
ICF ECF
150
15
5
145
K+
Na+
10 108Cl–
Approximate Values for Mammalian Cells
The electrical disequilibrium that exists between the extracellular fluid (ECF) and intracellular fluid (ICF) of living cells is called the membrane potential difference (Vm), or membrane potential for short. The membrane potential results from the uneven distribution of electrical charge (i.e., ions) between the ECF and ICF.
For any given concentration gradient [Ion]out – [Ion]in across a cell membrane, there is a membrane potential difference (i.e., electrical gradient) that exactly opposes ion movement down the concentration gradient. At this membrane potential, the cell is at electrochemical equilibrium: There is no net movement of ion across the cell membrane.
For any ion, the membrane potential that exactly opposes a given concentration gradient is known as the equilibrium potential (Eion). To calculate the equilibrium potential for any concentration gradient, we use the Nernst equation:
The Nernst equation is used for a cell that is freely permeable to only one ion at a time. Living cells, however, have limited permeability to several ions. To calculate the actual membrane potential of cells, we use a multi-ion equation called the Goldman-Hodgkin-Katz equation [discussed in Chapter 8].
What creates the membrane potential?
How much K+ will leave the cell?
To show how a membrane potential difference can arise from ion concentration gradients and a selectively permeable membrane, we will use an artificial cell system where we can control the membrane’s permeability to ions and the composition of the ECF and ICF.
If K+ was uncharged, like glucose, it would diffuse out of the cell until the concentration outside [K]out equaled the concentration inside [K]in. But K
+ is an ion, so we must consider its electrical gradient. Remember the rule for movement along electrical gradients: Opposite charges attract, like charges repel.
The ECF has a slight excess of cations (+).
We insert a leak channel for K+.
K+ starts to move out of the cell down its concentration gradient.
The A– cannot follow K+ out of the cell because the cell is not permeable to A–.
The ICF has a slight excess of anions (–).
Cell (ICF)
ECF + +
+
+
+
+ +
– –
– – –
– –––
– – – –
– –
+ +
+
+
+
+ + +
(a) In illustrations, this uneven distribution of charge is often shown by the charge symbols clustered on each side of the cell membrane. (e) In this example, the concentration gradient sending K+
out of the cell is exactly opposed by the electrical gradient pulling K+ into the cell. This is shown by the arrows that are equal in length but opposite in direction.
(f) In the first example, you saw that the membrane potential results from excess cations in the ECF and excess anions in the ICF. To measure this difference, we can place electrodes in the cell and surrounding fluid (equivalent to the ECF).
Using these values for K+ and the Nernst equation, the EK is ]90 mV.
(b) When we begin, the cell has no membrane potential: The ECF (composed of Na+ and Cl– ions) and the ICF (K+ and large anions, A– ) are electrically neutral.
The system is in chemical disequilibrium, with concentration gradients for all four ions. The cell membrane acts as an insulator to prevent free movement of ions between the ICF and ECF.
The transfer of just one K+ from the cell to the ECF creates an electrical disequilibrium: the ECF has a net positive charge (+1) while the ICF has a net negative charge (–1). The cell now has a membrane potential difference, with the inside of the cell negative relative to the outside.
(c) Now we insert a leak channel for K+ into the membrane, making the cell freely permeable to K+.
(d) As additional K+ ions leave the cell, going down their concentration gradient, the inside of the cell becomes more negative and the outside becomes more positive.
Creation of a Membrane Potential in an Artificial System
Electrochemical Equilibrium
Equilibrium Potential
Measuring Membrane Potential
+ +
++
+
+ +
–
–
–
+ –
–
– –
+ +
+
+
++
+
+
–
– –
–
–
––
–
+ +
+
+ +
–
– –
–
– –
+ +
+
+
++
+
–
–
–
–
––
–
++ + +
+
+
–
– –
–
– –
+ +
+
+
++
+
–
–
–
–
––
–
Additional K+ leaves the cell.
Now the negative charge inside the cell begins to attract ECF K+ back into the cell: an electrical gradient in the opposite direction from the concentration gradient.
+ +
+ + +
+
–
– –
–
– –
+ +
+
+
++
+
–
–
–
–
––
–
Efflux due to concentration gradient
Influx due to electrical gradient
1. Ion concentration gradients between the ECF and ICF 2. The selectively permeable cell membrane
K+
Na+
Cl–
A– K+
Eion = z [ion]in
61 where z is the charge on the ion. (i.e., K+ = +1)
[ion]outlog
]2 ]1 0 +1 +2
Intracellular fluid Extracellular fluid
Absolute charge scale
Intracellular fluid Extracellular fluid
]2 ]1 0 +1 +2
Relative charge scale extracellular fluid set to 0.
In real life, we cannot measure absolute numbers of ions, however. Instead, we measure the difference between the two electrodes. By convention, the ECF is set at 0 mV (the ground). This gives the ICF a relative charge of −2.
On a number line, the ECF would be at +1 and the ICF at −1.
(You will need the log function on a calculator.)
1
2
3
4
5
+
+
+
+ ++
+
+ +
+
– ––
– –
– –
–
–
–
– –
++
FIGURE QUESTIONS
FIGURE QUESTIONS
M05_SILV5197_08_SE_C05.indd 154 10/3/17 11:08 AM
Selected figures from the text are explored in accompanying Phys in Action video tutors and in coaching activities in Mastering A&P.
Play Phys in Action
@Mastering Anatomy & Physiology
A02_SILV5197_08_SE_FM02.indd 4 12/2/17 7:03 AM
Anatomy Summary Figures provide succinct visual overviews of a physiological system from a macro to micro perspective. Whether you are learning the anatomy for the first time or refreshing your memory, these summaries show you the essential features of each system in a single figure.
Review Figures visually present foundational concepts that you may already be familiar with. You may find it helpful to check out these figures before learning new physiology concepts.
Selected figures from the text can be assigned as Art-Labeling Activities in Mastering A&P.
FIG.9.3 ANATOMY SUMMARY . . . The Central Nervous System
Cerebral hemispheres
Cerebellum
Cranium
Cervical spinal nerves
Cranium
Dura mater
Subdural space
Subarachnoid space
Pia mater
Arachnoid membrane
Brain
Thoracic spinal nerves
Lumbar spinal nerves
Sacral spinal nerves
Coccygeal nerve
Spinal nerve
Central canal
Spinal nerve
(b) Sectional View of the Meninges
(c) Posterior View of Spinal Cord and Vertebra
(a) Posterior View of the CNS
Body of vertebra
Spinal cord
Autonomic ganglion
Arachnoid membrane
Pia mater
Dura mater
White matter
Gray matter
Meninges
Sectioned vertebrae
Moving from the cranium in, name the meninges that form the boundaries of the venous sinus and the subdural and subarachnoid spaces.
Venous sinus
The meninges and extracellular fluid cushion the delicate brain tissue.
FIGURE QUESTION
276
M09_SILV5197_08_SE_C09.indd 276 10/12/17 3:06 PM
See p. 276
See p. 44
A02_SILV5197_08_SE_FM02.indd 5 12/2/17 7:03 AM
Mastering A&P provides tutorials and review questions that you can access before, during, and after class.
Get Online Coaching Through Mastering A&P
Phys in Action! Video Tutors and Coaching Activities help you visualize and master challenging physiological concepts by demonstrating laboratory procedures and real- world applications. Demonstrations include pulmonary function test, tilt table, exercise testing, and more.
EXPANDED! Interactive Physiology 2.0 Coaching Activities teach complex physiological processes using exceptionally clear animations, interactive tutorials, games, and quizzes. IP2 features new graphics, quicker navigation, and a mobile- friendly design. New topics include Generation of an Action Potential and Cardiac Cycle. IP2 and IP animations can be assigned from the Mastering A&P Item Library or accessed through the Mastering A&P Study Area.
Mastering A&P offers thousands of tutorials, activities, and questions that can be used to test yourself, or assigned for homework and practice. Additional highlights include:
• Nurses Need Physiology Case Studies guide you through the steps of diagnosing and treating patients in real-world clinical scenarios.
• A&P Flix Animations use 3-D, movie-quality graphics to help you visualize complex physiology processes.
• Dynamic Study Modules are manageable, mobile- friendly sets of questions with extensive feedback for you to test, learn, and retest yourself on basic concepts.
• PhysioEx Laboratory Simulations offer a supplement or substitute for wet labs due to cost, time, or safety concerns.
A02_SILV5197_08_SE_FM02.indd 6 12/2/17 7:03 AM
Access the Complete Textbook Online or Offline with Pearson eText
You can read your textbook without having to add weight to your bookbag.
The Pearson eText mobile app offers offline access and can be downloaded for most iOS and Android phones and tablets from the Apple App or Google Play stores.
Powerful interactive and customization functions in the eText platform include instructor and student note- taking, highlighting, bookmarking, search, and links to glossary terms.
A02_SILV5197_08_SE_FM02.indd 7 12/2/17 7:03 AM
Additional Support for Students & Instructors
NEW! Ready-to-Go Teaching Modules help instructors efficiently make use of the best teaching tools before, during, and after class. Accessed through the Instructor Resources area of Mastering A&P, and curated by author Dee Silverthorn, modules include skill development applications for Human Physiology including Concept Mapping and Graphing.
Learning Catalytics allows students to use their smartphone, tablet, or laptop to respond to questions in class. Visit learningcatalytics.com to learn more.
The Mastering A&P Instructor Resources Area includes the following downloadable tools for instructors who adopt the Eighth Edition for their classes:
• Customizable PowerPoint® lecture outlines include customizable images and provide a springboard for lecture prep.
• All of the figures, photos, and tables from the text are available in JPEG and PowerPoint® formats, in labelled and unlabelled versions, and with customizable labels and leader lines.
• Test bank provides thousands of customizable questions across Bloom’s taxonomy levels. Each question is tagged to chapter learning outcomes that can also be tracked within Mastering Anatomy & Physiology assessments. Available in Microsoft® Word and TestGen® formats.
• Animations and videos bring human physiology concepts to life.
• A comprehensive Instructor Resource Manual, co-authored by Dee Silverthorn and Damian Hill, includes a detailed teaching outline for each chapter, along with a wealth of activities, examples, and analogies that have been thoroughly class-tested with thousands of students.
• Customizable Study Questions, co-authored by Dee Silverthorn and Damian Hill, help students focus their reading on the most important points in each chapters and are organized by chapter section headers for easy editing to reflect the material covered in class.
A02_SILV5197_08_SE_FM02.indd 8 12/2/17 7:03 AM
1.1 Physiology Is an Integrative Science 2
LO 1.1.1 Define physiology. LO 1.1.2 List the levels of organization from
atoms to the biosphere. LO 1.1.3 Name the 10 physiological organ
systems of the body and give their functions.
1.2 Function and Mechanism 4 LO 1.2.1 Distinguish between mechanistic
explanations and teleological explanations.
1.3 Themes in Physiology 5 LO 1.3.1 List and give examples of the four
major themes in physiology.
1.4 Homeostasis g LO 1.4.1 Define homeostasis. What happens
when homeostasis fails? LO 1.4.2 Name and describe the two major
compartments of the human body.
LO 1.4.3 and ho of a substa
LO 1.4.4 sing math- emati in how it relates to
ce and give an example. ish between equilibrium and
.5 Control Systems and Homeostasis 13
LO 1.5.1 List the three components of a control system and give an example.
LO 1.5.2 Explain the relationship between a regulated variable and its setpoint.
LO 1.5.3 Compare local control, long-distance control, and reflex control.
LO 1.5.4 Explain the relationship between a response loop and a feedback loop.
LO 1.5.5 Compare negative feedback, positive feedback, and feedforward control. Give an example of each.
LO 1.5.6 Explain what happens to setpoints in biological rhythms and give some examples.
1. 6 The Science of Physiology 18 LO 1.6.1 Explain and give examples of the
following components of scientific research: independent and dependent variables, experimental control, data, replication, variability.
LO 1.6.2 Compare and contrast the following types of experimental study designs: blind study, double-blind study, crossover study, prospective and retrospective studies, cross-sectional study, longitudinal study, meta-analysis.
LO 1.6.3 Define placebo and nocebo effects and explain how they may influence the outcome of experimental studies.
2 CHAPTER 1 Introduction to Physiology
RUNNING PROBLEM What to Believe? Jimmy had just left his first physiology class when he got the text from his mother: Please call. Need to ask you something. His mother seldom texted, so Jimmy figured it must be important. “Hi, Mom! What’s going on?”
“Oh, Jimmy, I don’t know what to do. I saw the doctor this morning and he’s telling me that I need to take insulin. But I don’t want to! My type of diabetes doesn’t need insulin. I think he’s just trying to make me see him more by putting me on insulin. Don’t you think I’m right?”
Jimmy paused for a moment. “I’m not sure, Mom. He’s prob- ably just trying to do what’s best for you. Didn’t you talk to him about it?”
“Well, I tried but he didn’t have time to talk. You’re studying these things. Can’t you look it up and see if I really need insulin?”
“I guess so. Let me see what I can find out.” Jimmy hung up and thought. “Now what?”
2 5 9 12 16 19 24
When the Human Genome Project (www.genome.gov) began in 1990, scientists thought that by identifying and sequencing all the genes in human DNA, they would understand how the body worked. However, as research advanced, scientists had to revise their original idea that a given segment of DNA contained one gene that coded for one protein. It became clear that one gene may code for many proteins. The Human Genome Project ended in 2003, but before then researchers had moved beyond genomics to proteomics, the study of proteins in living organisms.
Now scientists have realized that knowing that a protein is made by a particular cell does not always tell us the significance of that protein to the cell, the tissue, or the functioning organism. The exciting new areas in biological research are called functional genomics, systems biology, and integrative biology, but fundamen- tally these are all fields of physiology. The integration of func- tion across many levels of organization is a special focus of physiology. (To integrate means to bring varied elements together to create a unified whole.)
FIGURE 1.1 illustrates levels of organization ranging from the molecular level all the way up to populations of different spe- cies living together in ecosystems and in the biosphere. The levels of organization are shown along with the various subdisciplines of chemistry and biology related to the study of each organizational level. There is considerable overlap between the different fields of study, and these artificial divisions vary according to who is defin- ing them. Notice, however, that physiology includes multiple levels, from molecular and cellular biology to the ecological physiology of populations.
At all levels, physiology is closely tied to anatomy. The struc- ture of a cell, tissue, or organ must provide an efficient physical base for its function. For this reason, it is nearly impossible to study the physiology of the body without understanding the underlying anatomy. Because of the interrelationship of anatomy and physi- ology, you will find Anatomy Summaries throughout the book.
W elcome to the fascinating study of the human body! For most of recorded history, humans have been interested in how their bodies work. Early Egyptian, Indian, and Chinese writings
describe attempts by physicians to treat various diseases and to restore health. Although some ancient remedies, such as camel dung and powdered sheep horn, may seem bizarre, we are still using others, such as blood-sucking leeches and chemicals derived from medicinal plants. The way we use these treatments has changed through the centuries as we have learned more about the human body.
There has never been a more exciting time in human physiol- ogy. Physiology is the study of the normal functioning of a living organism and its component parts, including all its chemical and physical processes. The term physiology literally means “knowledge of nature.” Aristotle (384–322 bce) used the word in this broad sense to describe the functioning of all living organisms, not just of the human body. However, Hippocrates (ca. 460–377 bce), consid- ered the father of medicine, used the word physiology to mean “the healing power of nature,” and thereafter the field became closely associated with medicine. By the sixteenth century in Europe, physiology had been formalized as the study of the vital functions of the human body. Currently the term is again used to refer to the study of animals and plants.
Today, we benefit from centuries of work by physiologists who constructed a foundation of knowledge about how the human body functions. Since the 1970s, rapid advances in the fields of cellular and molecular biology have supplemented this work. A few decades ago, we thought that we would find the key to the secret of life by sequencing the human genome, which is the collective term for all the genetic information contained in the DNA of a species. However, this deconstructionist view of biology has proved to have its limitations, because living organisms are much more than the simple sum of their parts.
1.1 Physiology Is an Integrative Science
Many complex systems—including those of the human body— possess emergent properties, which are properties that cannot be predicted to exist based only on knowledge of the system’s individual components. An emergent property is not a property of any single component of the system, and it is greater than the simple sum of the system’s individual parts. Emergent proper- ties result from complex, nonlinear interactions of the different components.
For example, suppose someone broke down a car into its nuts and bolts and pieces and laid them out on a floor. Could you pre- dict that, properly assembled, these bits of metal and plastic would become a vehicle capable of converting the energy in gasoline into movement? Who could predict that the right combination of ele- ments into molecules and assemblages of molecules would result in a living organism? Among the most complex emergent properties in humans are emotion, intelligence, and other aspects of brain function. None of these properties can be predicted from knowing the individual properties of nerve cells.
M01_SILV5197_08_SE_C01.indd 2 11/30/17 11:16 PM
C H
A P
TER
1
1.1 Physiology Is an Integrative Science 3
unit of structure capable of carrying out all life processes. A lipid and protein barrier called the cell membrane (also called the plasma membrane) separates cells from their external environment. Simple organisms are composed of only one cell, but complex organisms have many cells with different structural and functional specializations.
Collections of cells that carry out related functions are called tissues {texere, to weave}. Tissues form structural and functional units known as organs {organon, tool}, and groups of organs inte- grate their functions to create organ systems. Chapter 3 reviews the anatomy of cells, tissues, and organs.
The 10 physiological organ systems in the human body are illustrated in FIGURE 1.2. Several of the systems have alternate names, given in parentheses, that are based on the organs of the system rather than the function of the system. The integumen- tary system {integumentum, covering}, composed of the skin, forms a protective boundary that separates the body’s internal environment from the external environment (the outside world). The musculoskeletal system provides support and body movement.
Four systems exchange materials between the internal and external environments. The respiratory (pulmonary) sys- tem exchanges gases; the digestive (gastrointestinal) system takes up nutrients and water and eliminates wastes; the urinary (renal) system removes excess water and waste material; and the reproductive system produces eggs or sperm.
The remaining four systems extend throughout the body. The circulatory (cardiovascular) system distributes materials by pumping blood through vessels. The nervous and endocrine systems coordinate body functions. Note that the figure shows them as a continuum rather than as two distinct systems. Why? Because the lines between these two systems have blurred as we have learned more about the integrative nature of physiological function.
The one system not illustrated in Figure 1.2 is the diffuse immune system, which includes but is not limited to the ana- tomical structures known as the lymphatic system. The specialized cells of the immune system are scattered throughout the body. They protect the internal environment from foreign substances by intercepting material that enters through the intestines and lungs
These special review features illustrate the anatomy of the physi- ological systems at different levels of organization.
At the most basic level of organization shown in Figure 1.1, atoms of elements link together to form molecules. Collec- tions of molecules in living organisms form cells, the smallest
EMERGING CONCEPTS The Changing World of Omics
If you read the scientific literature, it appears that contem- porary research has exploded into an era of “omes” and “omics.” What is an “ome”? The term apparently derives from the Latin word for a mass or tumor, and it is now used to refer to a collection of items that make up a whole, such as a genome. One of the earliest uses of the “ome” suffix in biology is the term biome, meaning all organisms living in a major ecological region, such as the marine biome or the desert biome. A genome, for example, is a collection of all the genetic material of an organism. Its physiome describes the organism’s coordinated molecular, cellular, and physi- ological functioning.
The related adjective “omics” describes the research related to studying an “ome.” Adding “omics” to a root word has become the cutting-edge way to describe a research field. For example, pharmacogenomics (the influence of genetics on the body’s response to drugs) is now as impor- tant as genomics, the sequencing of DNA (the genome). There is even a journal named OMICS!
New “omes” emerge every year. The human con- nectome project (www.neuroscienceblueprint.nih.gov/ connectome/) sponsored by the American National Insti- tutes of Health is a collaborative effort by multiple institu- tions to map all the neural connections of the human brain. NIH also sponsors the human microbiome project (https:// commonfund.nih.gov/hmp/overview), whose goal is to study the effects of microbes that normally live on or in the human body. Ignored as unimportant for many years, these microbes are now being shown to have an influence on both health and disease.
FIG. 1.1 Levels of organization and the related fields of study
CHEMISTRY
MOLECULAR BIOLOGY
CELL BIOLOGY
PHYSIOLOGY
BiosphereAtoms Molecules Cells Tissues Organs Organ
systems Organisms
Populations of one species
Ecosystem of different species
ECOLOGY
M01_SILV5197_08_SE_C01.indd 3 11/30/17 11:16 PM
4 CHAPTER 1 Introduction to Physiology
These process maps are also called flow charts, and they are frequently used in health care. You will be able to practice mapping with spe- cial end-of-chapter questions throughout the book.
1.2 Function and Mechanism We define physiology as the normal functioning of the body, but physiologists are careful to distinguish between function and mecha- nism. The function of a physiological system or event is the “why” of the system or event: Why does a certain response help an animal survive in a particular situation? In other words, what is the adaptive significance of this event for this animal?
For example, humans are large, mobile, terrestrial animals, and our bodies maintain relatively constant water content despite living in a dry, highly variable external environment. Dehydration is a constant threat to our well-being. What processes have evolved in our anatomy and physiology that allow us to survive in this hos- tile environment? One is the production of highly concentrated urine by the kidney, which allows the body to conserve water. This statement tells us why we produce concentrated urine but does not tell us how the kidney accomplishes that task.
or through a break in the skin. In addition, immune tissues are closely associated with the circulatory system.
Traditionally, physiology courses and books are organized by organ system. Students study cardiovascular physiology and regu- lation of blood pressure in one chapter, and then study the kidneys and control of body fluid volume in a different chapter. In the functioning human, however, the cardiovascular and renal systems communicate with each other, so that a change in one is likely to cause a reaction in the other. For example, body fluid volume influ- ences blood pressure, while changes in blood pressure alter kidney function because the kidneys regulate fluid volume. In this book, you will find several integrative physiology chapters that highlight the coordination of function across multiple organ systems.
Understanding how different organ systems work together is just as important as memorizing facts, but the complexity of inter- actions can be challenging. One way physiologists simplify and integrate information is by using visual representations of physi- ological processes called maps. The Focus on Mapping feature in this chapter will help you learn how to make maps. The first type of map, shown in FIGURE 1.3a, is a schematic representation of structure or function. The second type of map, shown in Figure 1.3b, diagrams a physiological process as it proceeds through time.
FIG. 1.2 Organ systems of the human body and their integration
FIG. 1.2 Organ Systems of the Human Body and their Integration
System Name Includes Representative Functions The Integration between Systems of the Body
Circulatory Heart, blood vessels, blood
Transport of materials between all cells of the body
Digestive Stomach, intestine, liver, pancreas
Conversion of food into particles that can be transported into the body; elimination of some wastes
Endocrine Thyroid gland, adrenal gland
Coordination of body function through synthesis and release of regulatory molecules
Immune Thymus, spleen, lymph nodes
Defense against foreign invaders
Integumentary Skin Protection from external environment
Musculoskeletal Skeletal mus- cles, bone
Support and movement
Nervous Brain, spinal cord
Coordination of body function through electrical signals and release of regulatory molecules
Reproductive Ovaries and uterus, testes
Perpetuation of the species
Respiratory Lungs, airways Exchange of oxygen and carbon dioxide between the internal and external environments
Urinary Kidneys, bladder Maintenance of water and solutes in the internal environment; waste removal
This schematic figure indicates relationships between systems of the human body. The interiors of some hollow organs (shown in white) are part of the external environment.
Integumentary System
Nervous system
Endocrine system
Musculoskeletal system
Respiratory system
Digestive system
Circulatory system
Reproductive system
Urinary system
M01_SILV5197_08_SE_C01.indd 4 11/30/17 11:16 PM
C H
A P
TER
1
1.3 Themes in Physiology 5
At the systems level, we know about most of the mechan- ics of body function from centuries of research. The unanswered questions today mostly involve integration and control of these mechanisms, particularly at the cellular and molecular levels. Nev- ertheless, explaining what happens in test tubes or isolated cells can only partially answer questions about function. For this reason, animal and human trials are essential steps in the process of apply- ing basic research to treating or curing diseases.
1.3 Themes in Physiology “Physiology is not a science or a profession but a point of view.”3 Physiologists pride themselves on relating the mechanisms they study to the functioning of the organism as a whole. For students, being able to think about how multiple body systems integrate their function is one of the more difficult aspects of learning physiology. To develop expertise in physiology, you must do more than simply memorize facts and learn new terminology. Researchers have found that the ability to solve problems requires a conceptual framework, or “big picture,” of the field.
This book will help you build a conceptual framework for physiology by explicitly emphasizing the basic biological concepts, or themes, that are common to all living organisms. These con- cepts form patterns that repeat over and over, and you will begin to recognize them when you encounter them in specific contexts. Pattern recognition is an important skill in healthcare professions, and it will also simplify learning physiology.
In the past few years, three different organizations issued reports to encourage the teaching of biology using these fun- damental concepts. Although the descriptions vary in the three reports, five major themes emerge:
1. structure and function across all levels of organization 2. energy transfer, storage, and use 3. information flow, storage, and use within single organisms and
within a species of organism
3 R. W. Gerard. Mirror to Physiology: A Self-Survey of Physiological Science. Washington, DC: American Physiology Society, 1958.
Thinking about a physiological event in terms of its adap- tive significance is the teleological approach to science. For example, the teleological answer to the question of why red blood cells transport oxygen is “because cells need oxygen and red blood cells bring it to them.” This answer explains why red blood cells transport oxygen—their function—but says nothing about how the cells transport oxygen.
In contrast, most physiologists study physiological processes, or mechanisms—the “how” of a system. The mechanistic approach to physiology examines process. The mechanistic answer to the question “How do red blood cells transport oxygen?” is “Oxygen binds to hemoglobin molecules in the red blood cells.” This very concrete answer explains exactly how oxygen transport occurs but says nothing about the significance of oxygen transport to the animal.
Students often confuse these two approaches to thinking about physiology. Studies have shown that even medical students tend to answer questions with teleological explanations when the more appropriate response would be a mechanistic explanation.1 Often they do so because instructors ask why a physiological event occurs when they really want to know how it occurs. Staying aware of the two approaches will help prevent confusion.
Although function and mechanism seem to be two sides of the same coin, it is possible to study mechanisms, particularly at the cellular and subcellular level, without understanding their func- tion in the life of the organism. As biological knowledge becomes more complex, scientists sometimes become so involved in studying complex processes that they fail to step back and look at the sig- nificance of those processes to cells, organ systems, or the animal. Conversely, it is possible to use teleological thinking incorrectly by saying, “Oh, in this situation the body needs to do this.” This may be a good solution, but if a mechanism for doing this doesn’t exist, the situation cannot be corrected.
Applying the concept of integrated functions and mechanisms is the underlying principle in translational research, an approach sometimes described as “bench to bedside.” Transla- tional research uses the insights and results gained from basic bio- medical research on mechanisms to develop treatments and strategies for preventing human diseases. For example, researchers working on rats found that a chemical from the pancreas named amylin reduced the rats’ food intake. These findings led directly to a translational research study in which human volunteers injected a synthetic form of amylin and recorded their subsequent food intake, but without intentionally modifying their lifestyle.2 The drug suppressed food intake in humans, and was later approved by the Food and Drug Administration for treatment of diabetes mellitus.
1 D. R. Richardson. A survey of students’ notions of body function as teleo- logic or mechanistic. Advan Physiol Educ 258: 8–10, Jun 1990. Access free at http://advan.physiology.org. 2 S. R. Smith et al. Pramlintide treatment reduces 24-h caloric intake and meal sizes and improves control of eating in obese subjects: a 6-wk transla- tional research study. Am J Physiol Endocrinol Metab 293: E620–E627, 2007.
RUNNING PROBLEM When Jimmy got back to his room, he sat down at his computer and went to the Internet. He typed diabetes in his search box— and came up with 267 million results. “That’s not going to work. What about insulin?” Nearly 48 million results. “How in the world am I going to get any answers?” He clicked on the first sponsored ad that advertised “Information for type 2 diabetes.” That might be good. His mother had type 2 diabetes. But it was for a pharma- ceutical company trying to sell him a drug. “Maybe my physiology prof can help me with this search. I’ll ask tomorrow.”
Q1: What search terms could Jimmy have used to get fewer results?
2 5 9 12 16 19 24
M01_SILV5197_08_SE_C01.indd 5 11/30/17 11:16 PM
Why use maps to study physiology? The answer is simple: maps will help you organize information you are learning in a way that makes sense to you and they will make that informa- tion easier to recall on a test. Creating a map requires higher-level thinking about the relationships among items on the map.
What is a map? Mapping is a nonlinear way of organizing material. A map can take a variety of forms but usually consists of terms (words or short phrases) linked by arrows to indicate associations. You can label the connecting arrows to describe the type of linkage between the terms (structure/function, cause/effect) or with explanatory phrases.
Practice making maps. Many maps appear in this textbook, and they can serve as the starting point for your own maps. However, the real benefit of mapping comes from preparing maps yourself rather than memorizing someone else’s maps. Your instructor can help you get started.
Electronic mapping. Some people do not like the messiness of hand-drawn maps. There are several electronic ways of making maps, including PowerPoint or free and commercial software programs. Free concept mapping software is available from IHMC CmapTools at http://cmap.ihmc.us. Or search for the term free concept map to find other resources on the Web. A popular commercial program for mapping is Inspiration (www.inspiration.com).
• To help you get started, the end-of-chapter questions in this book include at least one list of terms to map for each chapter.
• Write your terms on individual slips of paper or small sticky notes so that you can rearrange the map more easily.
• Some terms may seem to belong to more than one group. Do not duplicate the item but make a note of it, as this term will probably have several arrows pointing to it or leading away from it.
• If arrows crisscross, try rearranging the terms on the map. • Use color to indicate similar items. • Add pictures and graphs that are associated with specific terms in your map.
Here are two typical maps used in physiology.
The next page walks you through the process of creating a structure-function map.
Mapping is not just a study technique. Scientists map out the steps in their experiments. Healthcare professionals create maps to guide them while diagnosing and treating patients. You can use mapping for almost every subject you study.
Science is a collaborative field. A useful way to study with a map is to trade maps with a classmate and try to under- stand each other’s maps. Your maps will almost certainly not look the same! It’s OK if they are different. Remember that your map reflects the way you think about the subject, which may be different from the way someone else thinks about it. Did one of you put in something the other forgot? Did one of you have an incorrect link between two items?
SANDWICHES
Outside components Fillings
Breads Tortillas Wraps Vegetables
Put your key term on the top.
Then put your terms in groups that are similar.
results in
consists of
containscontains
can be found in
Makes proteins such as
These are the 3 main parts of a cell.
Studying Better grades
Cheeses Meats Dressings and sauces
Person working outside on a hot,
dry day
Loses body water by evaporation
Body fluids become more concentrated
Thirst pathways stimulated
Person seeks out and drinks water
Internal receptors sense change in
internal concentration
Water added to body fluids
decreases their concentration
Process maps or flow charts follow normal homeostatic control pathways or the body’s responses to abnormal (pathophysiological) events as they unfold over time.
Structure/function maps focus on the relationships between anatomical structures and their functions.
HINTS
STEP 1: Write out the terms to map. If you need help generating ideas for topics to map, the end-of-chapter mapping questions in each chapter have lists of terms to help you get started.
STEP 2: Organize the terms.
STEP 3: Link the terms.
Once you have created your map, sit back and think about it. Are all the items in the right place? You may want to move them around once you see the big picture. Add new concepts or correct wrong links. Review by recalling the main concept and then moving to the more specific details. Ask yourself questions like, What is the cause and what is the effect? What parts are involved? What are the main characteristics?
These are all found inside the cell. Parts in the left column do not have membranes.
Parts in the right column have membranes.
You may think of additional terms to
add as you work.
Labeling arrows can help explain
linkages.
Cytoplasm
Cytoplasm
Cytoplasm
Protein fibers Inclusions
Smooth ER
Cytoskeleton
Rough ER
Membranous organelles
Nucleus
Nucleus
Nucleus
Nucleolus
Nucleolus
Nucleolus
The Cell
The Cell
The Cell
Cell membrane
Cell membrane
Cell membrane
Ribosomes
Ribosomes
Ribosomes
Mitochondria
Mitochondria
Mitochondria
Golgi
Golgi
Golgi
Endoplasmic reticulum
Endoplasmic reticulum
Endoplasmic reticulum
FIG. 1.3 Focus on . . . Mapping
M01_SILV5197_08_SE_C01.indd 6 11/30/17 11:16 PM
7
Why use maps to study physiology? The answer is simple: maps will help you organize information you are learning in a way that makes sense to you and they will make that informa- tion easier to recall on a test. Creating a map requires higher-level thinking about the relationships among items on the map.
What is a map? Mapping is a nonlinear way of organizing material. A map can take a variety of forms but usually consists of terms (words or short phrases) linked by arrows to indicate associations. You can label the connecting arrows to describe the type of linkage between the terms (structure/function, cause/effect) or with explanatory phrases.
Practice making maps. Many maps appear in this textbook, and they can serve as the starting point for your own maps. However, the real benefit of mapping comes from preparing maps yourself rather than memorizing someone else’s maps. Your instructor can help you get started.
Electronic mapping. Some people do not like the messiness of hand-drawn maps. There are several electronic ways of making maps, including PowerPoint or free and commercial software programs. Free concept mapping software is available from IHMC CmapTools at http://cmap.ihmc.us. Or search for the term free concept map to find other resources on the Web. A popular commercial program for mapping is Inspiration (www.inspiration.com).
• To help you get started, the end-of-chapter questions in this book include at least one list of terms to map for each chapter.
• Write your terms on individual slips of paper or small sticky notes so that you can rearrange the map more easily.
• Some terms may seem to belong to more than one group. Do not duplicate the item but make a note of it, as this term will probably have several arrows pointing to it or leading away from it.
• If arrows crisscross, try rearranging the terms on the map. • Use color to indicate similar items. • Add pictures and graphs that are associated with specific terms in your map.
Here are two typical maps used in physiology.
The next page walks you through the process of creating a structure-function map.
Mapping is not just a study technique. Scientists map out the steps in their experiments. Healthcare professionals create maps to guide them while diagnosing and treating patients. You can use mapping for almost every subject you study.
Science is a collaborative field. A useful way to study with a map is to trade maps with a classmate and try to under- stand each other’s maps. Your maps will almost certainly not look the same! It’s OK if they are different. Remember that your map reflects the way you think about the subject, which may be different from the way someone else thinks about it. Did one of you put in something the other forgot? Did one of you have an incorrect link between two items?
SANDWICHES
Outside components Fillings
Breads Tortillas Wraps Vegetables
Put your key term on the top.
Then put your terms in groups that are similar.
results in
consists of
containscontains
can be found in
Makes proteins such as
These are the 3 main parts of a cell.
Studying Better grades
Cheeses Meats Dressings and sauces
Person working outside on a hot,
dry day
Loses body water by evaporation
Body fluids become more concentrated
Thirst pathways stimulated
Person seeks out and drinks water
Internal receptors sense change in
internal concentration
Water added to body fluids
decreases their concentration
Process maps or flow charts follow normal homeostatic control pathways or the body’s responses to abnormal (pathophysiological) events as they unfold over time.
Structure/function maps focus on the relationships between anatomical structures and their functions.
HINTS
STEP 1: Write out the terms to map. If you need help generating ideas for topics to map, the end-of-chapter mapping questions in each chapter have lists of terms to help you get started.
STEP 2: Organize the terms.
STEP 3: Link the terms.
Once you have created your map, sit back and think about it. Are all the items in the right place? You may want to move them around once you see the big picture. Add new concepts or correct wrong links. Review by recalling the main concept and then moving to the more specific details. Ask yourself questions like, What is the cause and what is the effect? What parts are involved? What are the main characteristics?
These are all found inside the cell. Parts in the left column do not have membranes.
Parts in the right column have membranes.
You may think of additional terms to
add as you work.
Labeling arrows can help explain
linkages.
Cytoplasm
Cytoplasm
Cytoplasm
Protein fibers Inclusions
Smooth ER
Cytoskeleton
Rough ER
Membranous organelles
Nucleus
Nucleus
Nucleus
Nucleolus
Nucleolus
Nucleolus
The Cell
The Cell
The Cell
Cell membrane
Cell membrane
Cell membrane
Ribosomes
Ribosomes
Ribosomes
Mitochondria
Mitochondria
Mitochondria
Golgi
Golgi
Golgi
Endoplasmic reticulum
Endoplasmic reticulum
Endoplasmic reticulum
M01_SILV5197_08_SE_C01.indd 7 11/30/17 11:16 PM
8 CHAPTER 1 Introduction to Physiology
4. homeostasis and the control systems that maintain it 5. evolution
In addition, all three reports emphasize the importance of under- standing how science is done and of the quantitative nature of biology. TABLE 1.1 lists the core concepts in biology from the three reports.
In this book, we focus on the four themes most related to physiology: structure-function relationships, biological energy use, information flow within an organism, and homeostasis and the control systems that maintain it. The first six chapters introduce the fundamentals of these themes, which you may already be familiar with from earlier biology or chemistry classes. The themes and their associated concepts, with variations, then re-appear over and over in subsequent chapters of this book. Look for them in the summary material at the end of the chapters and in the end-of- chapter questions as well.
Theme 1: Structure and Function Are Closely Related The integration of structure and function extends across all levels of organization, from the molecular level to the intact body. This theme subdivides into two major ideas: molecular interactions and compartmentation.
Molecular Interactions The ability of individual molecules to bind to or react with other molecules is essential for biologi- cal function. A molecule’s function depends on its structure and shape, and even a small change to the structure or shape may have significant effects on the function. The classic exam- ple of this phenomenon is the change in one amino acid of the hemoglobin protein. (Hemoglobin is the oxygen-carrying pigment of the blood.) This one small change in the protein
converts normal hemoglobin to the form associated with sickle cell disease.
Many physiologically significant molecular interactions that you will learn about in this book involve the class of biological mol- ecules called proteins. Functional groups of proteins include enzymes that speed up chemical reactions, signal molecules and the receptor pro- teins that bind signal molecules, and specialized proteins that func- tion as biological pumps, filters, motors, or transporters. Chapter 2 describes molecular interactions involving proteins in more detail.
Interactions between proteins, water, and other molecules influence cell structure and the mechanical properties of cells and tissues. Mechanical properties you will encounter in your study of physiology include compliance (ability to stretch), elastance (stiffness or the ability to return to the unstretched state), strength, flexibility, and fluidity (viscosity).
Compartmentation Compartmentation is the division of space into separate compartments. Compartments allow a cell, a tissue, or an organ to specialize and isolate functions. Each level of orga- nization is associated with different types of compartments. At the macroscopic level, the tissues and organs of the body form discrete functional compartments, such as body cavities or the insides of hollow organs. At the microscopic level, cell membranes separate cells from the fluid surrounding them and also create tiny compart- ments within the cell called organelles. Compartmentation is the theme of Chapter 3.
Theme 2: Living Organisms Need Energy Growth, reproduction, movement, homeostasis—these and all other processes that take place in an organism require the continu- ous input of energy. Where does this energy come from, and how is it stored? We will answer those questions and describe some of
TABLE 1.1 Biology Concepts
Scientific Foundations for Future Physicians (HHMI and AAMC)1 Vision and Change (NSF and AAAS)2
The 2010 Advanced Placement Biology Curriculum (College Board)3
Structure/function from molecules to organisms
Structure and function (anatomy and physiology)
Relationship of structure to function
Physical principles applied to living systems Chemical principles applied to living systems
Pathways and transformations of energy and matter
Energy transfer
Biomolecules and their functions Information flow, exchange, and storage Continuity and change
Organisms sense and control their inter- nal environment and respond to external change
Systems Regulation (“a state of dynamic balance”)
Evolution as an organizing principle Evolution Evolution
1Scientific Foundations for Future Physicians. Howard Hughes Medical Institute (HHMI) and the Association of American Medical Colleges (AAMC), 2009. www.aamc.org/ scientificfoundations 2Vision and Change: A Call to Action. National Science Foundation (NSF) and American Association for the Advancement of Science (AAAS). 2011. http://visionandchange .org/finalreport. The report mentioned the integration of science and society as well. 3College Board AP Biology Course Description, The College Board, 2010. http://apcentral.collegeboard.com/apc/public/repository/ap-biology-course-description.pdf. The AP report also included “Interdependence in Nature” and “Science, Technology and Society” as two of their eight themes.
M01_SILV5197_08_SE_C01.indd 8 11/30/17 11:16 PM
C H
A P
TER
1
1.4 Homeostasis 9
In 1929, an American physiologist named Walter B. Cannon wrote a review for the American Physiological Society.5 Using observations made by numerous physiologists and physicians dur- ing the nineteenth and early twentieth centuries, Cannon proposed a list of variables that are under homeostatic control. We now know that his list was both accurate and complete. Cannon divided his variables into what he described as environmental factors that affect cells (osmolarity, temperature, and pH) and “materials for cell needs” (nutrients, water, sodium, calcium, other inorganic ions, oxygen, as well as “internal secretions having general and continu- ous effects”). Cannon’s “internal secretions” are the hormones and other chemicals that our cells use to communicate with one another.
In his essay, Cannon created the word homeostasis to describe the regulation of the body’s internal environment. He explained that he selected the prefix homeo- (meaning like or similar) rather than the prefix homo- (meaning same) because the internal environ- ment is maintained within a range of values rather than at an exact fixed value. He also pointed out that the suffix -stasis in this instance means a condition, not a state that is static and unchang- ing. Cannon’s homeostasis, therefore, is a state of maintaining “a similar condition,” similar to Claude Bernard’s relatively constant internal environment.
Some physiologists contend that a literal interpretation of stasis {a state of standing} in the word homeostasis implies a static, unchanging state. They argue that we should use the word homeody- namics instead, to reflect the small changes constantly taking place in our internal environment {dynamikos, force or power}. Whether the process is called homeostasis or homeodynamics, the important concept to remember is that the body monitors its internal state and takes action to correct disruptions that threaten its normal function.
5 W. B. Cannon. Organization for physiological homeostasis. Physiol Rev 9: 399–443, 1929.
the ways that energy in the body is used for building and breaking down molecules in Chapter 4. In subsequent chapters, you will learn how energy is used to transport molecules across cell mem- branes and to create movement.
Theme 3: Information Flow Coordinates Body Functions Information flow in living systems ranges from the transfer of infor- mation stored in DNA from generation to generation (genetics) to the flow of information within the body of a single organism. At the organismal level, information flow includes translation of DNA’s genetic code into proteins responsible for cell structure and function.
In the human body, information flow between cells coordinates function. Cell-to-cell communication uses chemical signals, electrical signals, or a combination of both. Information may go from one cell to its neighbors (local communication) or from one part of the body to another (long-distance communication). Chapter 6 discusses chemical communication in the body.
When chemical signals reach their target cells, they must get their information into the cell. Some molecules are able to pass through the barrier of the cell membrane, but signal molecules that cannot enter the cell must pass their message across the cell membrane. How molecules cross biological membranes is the topic of Chapter 5.
Theme 4: Homeostasis Maintains Internal Stability Organisms that survive in challenging habitats cope with external variability by keeping their internal environment relatively sta- ble, an ability known as homeostasis {homeo-, similar + @stasis, condition}. Homeostasis and regulation of the internal environ- ment are key principles of physiology and underlying themes in each chapter of this book. The next section looks in detail at the key elements of this important theme.
1.4 Homeostasis The concept of a relatively stable internal environment is attrib- uted to the French physician Claude Bernard in the mid-1800s. During his studies of experimental medicine, Bernard noted the stability of various physiological functions, such as body tempera- ture, heart rate, and blood pressure. As the chair of physiology at the University of Paris, he wrote “La fixité du milieu intérieur est la condition de la vie libre, indépendante.” (The constancy of the internal environment is the condition for a free and independent life.)4 This idea was applied to many of the experimental observa- tions of his day, and it became the subject of discussion among physiologists and physicians.
4 C. Bernard. Leçons sur les phénomènes de la vie communs aux animaux et aux végé- taux (Vol. 1, p. 113), Paris: J.-B. Baillière, 1885. (http://obvil.paris-sorbonne.fr/ corpus/critique/bernard_lecons-phenomenes-vie-I/body-2)
RUNNING PROBLEM After his second physiology class, Jimmy introduced himself to his professor and explained his problem. The professor’s first suggestion was simple: try to narrow the search. “One of the best ways to search is to combine terms using the connector AND. If you remember set theory from your math class, the connec- tor AND will give you the intersection of the sets. In other words, you’ll get only the results that occur in both sets.”
Seemed simple enough. Jimmy went back to the Internet and tried diabetes and insulin. That search still had 46 million results but on the first page was a link to the American Diabetes Asso- ciation, diabetes.org. Now he was getting somewhere.
Q2: What kinds of websites should Jimmy be looking for in his results list, and how can he recognize them?
2 5 9 12 16 19 24
Play BioFlix Animation
@Mastering Anatomy & Physiology
M01_SILV5197_08_SE_C01.indd 9 11/30/17 11:16 PM
10 CHAPTER 1 Introduction to Physiology
If the body fails to maintain homeostasis of the critical vari- ables listed by Walter Cannon, then normal function is disrupted and a disease state, or pathological condition {pathos, suffering}, may result. Diseases fall into two general groups according to their origin: those in which the problem arises from internal failure of some normal physiological process, and those that originate from some outside source. Internal causes of disease include the abnor- mal growth of cells, which may cause cancer or benign tumors; the production of antibodies by the body against its own tissues (auto- immune diseases); and the premature death of cells or the failure of cell processes. Inherited disorders are also considered to have internal causes. External causes of disease include toxic chemicals, physical trauma, and foreign invaders such as viruses and bacteria.
In both internally and externally caused diseases, when homeostasis is disturbed, the body attempts to compensate (FIG. 1.4). If the compensation is successful, homeostasis is restored. If compensation fails, illness or disease may result. The study of body functions in a disease state is known as pathophysiology. You will encounter many examples of pathophysiology as we study the various systems of the body.
One very common pathological condition in the United States is diabetes mellitus, a metabolic disorder characterized by abnormally high blood glucose concentrations. Although we speak of diabetes as if it were a single disease, it is actually a whole family of diseases with various causes and manifestations. You will learn more about diabetes in the focus boxes scattered throughout
the chapters of this book. The influence of this one disorder on many systems of the body makes it an excellent example of the integrative nature of physiology.
What Is the Body’s Internal Environment? Claude Bernard wrote of the “constancy of the internal environ- ment,” but why is constancy so essential? As it turns out, most cells in our bodies are not very tolerant of changes in their sur- roundings. In this way they are similar to early organisms that lived in tropical seas, a stable environment where salinity, oxygen content, and pH vary little and where light and temperature cycle in predictable ways. The internal composition of these ancient creatures was almost identical to that of seawater. If environmen- tal conditions changed, conditions inside the primitive organisms changed as well. Even today, marine invertebrates cannot tolerate significant changes in salinity and pH, as you know if you have ever maintained a saltwater aquarium.
In both ancient and modern times, many marine organisms relied on the constancy of their external environment to keep their internal environment in balance. In contrast, as organisms evolved and migrated from the ancient seas into estuaries, then into fresh- water environments and onto the land, they encountered highly variable external environments. Rains dilute the salty water of estuaries, and organisms that live there must cope with the influx of water into their body fluids. Terrestrial organisms, including humans, face the challenge of dehydration—constantly losing internal water to the dry air around them. Keeping the internal environment stable means balancing water loss with appropriate water intake.
But what exactly is the internal environment of the body? For multicellular animals, it is the watery internal environment that surrounds the cells, a “sea within” the body called the extra- cellular fluid (ECF) {extra-, outside of} (FIG. 1.5). Extracellular fluid serves as the transition between an organism’s external envi- ronment and the intracellular fluid (ICF) inside cells {intra-, within}. Because extracellular fluid is a buffer zone between cells and the outside world, elaborate physiological processes have evolved to keep its composition relatively stable.
When the extracellular fluid composition varies outside its normal range of values, compensatory mechanisms activate and try to return the fluid to the normal state. For example, when you drink a large volume of water, the dilution of your extracellu- lar fluid triggers a mechanism that causes your kidneys to remove excess water and protect your cells from swelling. Most cells of mul- ticellular animals do not tolerate much change. They depend on the constancy of extracellular fluid to maintain normal function.
Homeostasis Depends on Mass Balance In the 1960s, a group of conspiracy theorists obtained a lock of Napoleon Bonaparte’s hair and sent it for chemical analysis in an attempt to show that he died from arsenic poisoning. Today, a group of students sharing a pizza joke about the garlic odor on their breath. At first glance these two scenarios appear to have little
FIG. 1.4 Homeostasis
Organism in homeostasis
External change
Internal change results in loss
of homeostasis
Compensation succeedsCompensation fails
WellnessIllness or disease
Organism attempts to compensate
Internal change
M01_SILV5197_08_SE_C01.indd 10 11/30/17 11:16 PM
C H
A P
TER
1
1.4 Homeostasis 11
external environment plus metabolic water production (input). The concentrations of other substances, such as oxygen and carbon dioxide, salts, and hydrogen ions (pH), are also maintained through mass balance. The following equation summarizes the law of mass balance:
Total amount of = intake + production - substance x in the body excretion - metabolism
Most substances enter the body from the outside environment, but some (such as carbon dioxide) are produced internally through metabolism (Fig. 1.6b). In general, water and nutrients enter the
in common, but in fact Napoleon’s hair and “garlic breath” both demonstrate how the human body works to maintain the balance that we call homeostasis.
The human body is an open system that exchanges heat and materials with the outside environment. To maintain homeosta- sis, the body must maintain mass balance. The law of mass balance says that if the amount of a substance in the body is to remain constant, any gain must be offset by an equal loss (FIG. 1.6a). The amount of a substance in the body is also called the body’s load, as in “sodium load.”
For example, water loss to the external environment (output) in sweat and urine must be balanced by water intake from the
FIG. 1.6 Mass balance
Input
To maintain constant level, output must equal input.
Intake through intestine, lungs, skin
Excretion by kidneys, liver, lungs, skinBODY
LOAD BODY LOAD
Metabolic production
Metabolism to a new substance
Mass balance Existing body load
Law of Mass Balance
+ Intake or metabolic production
Excretion or metabolic removal
= –
Input Output
(a) Mass balance in an open system requires input equal to output.
(b) Mass balance in the body
Output
FIG. 1.5 The body’s internal and external environments
Put a * on the cell membrane of the box diagram.
Cells are surrounded by the extracellular
fluid (ECF).
Cells contain intracellular fluid (ICF).
The cell membrane separates cells from
the ECF.
ECF
Extracellular fluid (ECF)External
environment
External environment
Cells
Intracellular fluid (ICF)
(a) Extracellular fluid is a buffer between cells and the outside world.
(b) A box diagram represents the ECF, ICF, and external environment as three separate compartments.
FIGURE QUESTION
M01_SILV5197_08_SE_C01.indd 11 11/30/17 11:16 PM
12 CHAPTER 1 Introduction to Physiology
body as food and drink absorbed through the intestine. Oxygen and other gases and volatile molecules enter through the lungs. A few lipid-soluble chemicals make their way to the internal environ- ment by penetrating the barrier of the skin.
To maintain mass balance, the body has two options for out- put. The simplest option is simply to excrete the material. Excre- tion is defined as the elimination of material from the body, usually through the urine, feces, lungs, or skin. For example, car- bon dioxide (CO2) produced during metabolism is excreted by the lungs. Many foreign substances that enter the body, such as drugs or artificial food additives, are excreted by the liver and kidneys. (Any foreign substance in the body is called a xenobiotic, from the Greek word xenos, a stranger.)
A second output option for maintaining mass balance is to convert the substance to a different substance through metabo- lism. Nutrients that enter the body become the starting point for metabolic pathways that convert the original nutrient to a different molecule. However, converting the original nutrient to something different then creates a new mass balance disturbance by adding more of the new substance, or metabolite, to the body. (Metabolite is the general term for any product created in a metabolic pathway.)
Scientists use mass flow to follow material throughout the body. Mass flow describes the rate of transport of a substance x as it moves through body fluids or into and out of the body. The equation for mass flow is
Mass flow = concentration of x * volume flow (amount x/min) = (amount x/vol) * (vol/min)
where volume flow describes the flow of blood, air, urine, and the like.
For example, suppose a person is given an intravenous (IV) infusion of glucose solution that has a concentration of 50 grams of glucose per liter of solution. If the infusion is given at a rate of 2 milliliters per minute, the mass flow of glucose into the body is:
50 g glucose
1000 mL solution * 2 mL solution/min = 0.1 g glucose/min
The rate of glucose input into the body is 0.1 g glucose/min. Mass flow applies not only to the entry, production, and
removal of substances but also to the movement of substances from one compartment in the body to another. When materials enter the body, they first become part of the extracellular fluid. Where a substance goes after that depends on whether or not it can cross the barrier of the cell membrane and enter the cells.
Excretion Clears Substances from the Body It is relatively easy to monitor how much of a substance enters the body from the outside world, but it is more difficult to track molecules inside the body to monitor their excretion or metab- olism. Instead of directly measuring the substance, we can fol- low the rate at which the substance disappears from the blood, a concept called clearance. Clearance is usually expressed as a volume of blood cleared of substance x per unit of time. For this
reason, clearance is only an indirect measure of how substance x is handled by the body. For example, urea is a normal metabo- lite produced from protein metabolism. A typical value for urea clearance is 70 mL plasma cleared of urea per minute, written as 70 mL plasma/min. Knowing the rate at which urea disappears does not tell us anything about where urea is going. (It is being excreted by the kidneys.)
The kidney and the liver are the two primary organs that clear solutes from the body. Hepatocytes {hepaticus, pertaining to the liver + cyte, cell}, or liver cells, metabolize many different types of molecules, especially xenobiotics such as drugs. The resulting metabolites may be secreted into the intestine for excretion in the feces or released into the blood for removal by the kidneys. Phar- maceutical companies testing chemicals for their potential use as therapeutic drugs must know the clearance of the chemical before they can develop the proper dosing schedule.
Clearance also takes place in tissues other than the liver and kidneys. Saliva, sweat, breast milk, and hair all contain substances that have been cleared from the body. Salivary secretion of the hormone cortisol provides a simple noninvasive source of hormone for monitoring chronic stress.
An everyday example of clearance is “garlic breath,” which occurs when volatile lipid-soluble garlic compounds in the blood pass into the airways and are exhaled. The lungs also clear ethanol in the blood: exhaled alcohol is the basis of the “breathalyzer” test used by law enforcement agencies. Drugs and alcohol secreted into breast milk are potentially dangerous because a breastfeeding infant will ingest these substances.
The 1960s analysis of Napoleon Bonaparte’s hair tested it for arsenic because hair follicles help clear some compounds from
RUNNING PROBLEM Jimmy called his mother with the news that he had found some good information on the American Diabetes Association website (www.diabetes.org). According to that organization, someone with type 2 diabetes might begin to require insulin as the disease progresses. But Jimmy’s mother was still not convinced that she needed to start insulin injections.
“My friend Ahn read that some doctors say that if you eat a high-fiber diet, you won’t need any other treatment for diabetes.”
“Mom, that doesn’t sound right to me.” “But it must be,” Jimmy’s mother replied. “It says so in The
Doctors’ Medical Library.”
Q3: Go to The Doctors’ Medical Library at www.medical-library. net and search for the article called “Fiber” by typing the word into the Search box or by using the alphabetical listing of Library Articles. What does Dr. Kennedy, the author of the article, say about high-fiber diet and diabetes?
Q4: Should Jimmy’s mother believe what it says on this web- site? How can Jimmy find out more about who created the site and what their credentials are?
2 5 9 12 16 19 24
M01_SILV5197_08_SE_C01.indd 12 11/30/17 11:16 PM
C H
A P
TER
1
1.5 Control Systems and Homeostasis 13
Steady state is not the same as equilibrium {aequus, equal + libra, balance}, however. Equilibrium implies that the composition of the body compartments is identical. If we examine the composition of the ECF and ICF, we find that the concentra- tions of many substances are different in the two compartments (FIG. 1.7). For example, sodium (Na+) and chloride (Cl-) are far more concentrated in the ECF than in the ICF, while potassium (K+) is most concentrated in the ICF. Because of these concentra- tion differences, the two fluid compartments are not at equilib- rium. Instead the ECF and ICF exist in a state of relatively stable disequilibrium {dis- is a negative prefix indicating the opposite of the base noun}. For living organisms, the goal of homeostasis is to maintain the dynamic steady states of the body’s compartments, not to make the compartments the same.
1.5 Control Systems and Homeostasis To maintain homeostasis, the human body monitors certain key functions, such as blood pressure and blood glucose concentration, that must stay within a particular operating range if the body is to remain healthy. These important regulated variables are kept within their acceptable (normal) range by physiological control mechanisms that kick in if the variable ever strays too far from its setpoint, or optimum value. There are two basic patterns of control mechanisms: local control and long-distance reflex control.
In their simplest form, all control systems have three components (FIG. 1.8): (1) an input signal; (2) a controller, or integrating center {integrare, to restore}, that integrates in - coming information and initiates an appropriate response; and (3) an output signal that creates a response. Long-distance reflex control systems are more complex than this simple model, however, as they may include input from multiple sources and have output that acts on multiple targets.
Local Control Is Restricted to a Tissue The simplest form of control is local control, which is re - stricted to the tissue or cell involved (FIG. 1.9). In local control, a relatively isolated change occurs in a tissue. A nearby cell or group of cells senses the change in their immediate vicinity and responds, usually by releasing a chemical. The response is restricted to the region where the change took place—hence the term local control.
One example of local control can be observed when oxygen concentration in a tissue decreases. Cells lining the small blood
the body. The test results showed significant concentrations of the poison in his hair, but the question remains whether Napoleon was murdered, poisoned accidentally, or died from stomach cancer.
FIG. 1.7 Steady-state disequilibrium
20
40
60
80
100
120
140 ECF ICF
C o
n ce
n tr
at io
n (m
m o
l/ L )
Cl- K+Na+ Cl- K+Na+
The body compartments are in a dynamic steady state but are not at equilibrium. Ion concentrations are very different in the extracellular fluid compartment (ECF) and the intracellular fluid compartment (ICF).
FIG. 1.8 A simple control system
Input signal
Output signal
Integrating center
Response
Concept Check
1. If a person eats 12 milligrams (mg) of salt in a day and excretes 11 mg of it in the urine, what happened to the remaining 1 mg?
2. Glucose is metabolized to CO2 and water. Explain the effect of glucose metabolism on mass balance in the body.
Homeostasis Does Not Mean Equilibrium When physiologists talk about homeostasis, they are speaking of the stability of the body’s internal environment—in other words, the stability of the extracellular fluid compartment (ECF). One reason for focusing on extracellular fluid homeostasis is that it is relatively easy to monitor by taking a blood sample. When you centrifuge blood, it separates into two parts: plasma, the fluid component, plus the heavier blood cells. Plasma is part of the extracellular fluid compartment, and its composition can be easily analyzed. It is much more difficult to follow what is taking place in the intracel- lular fluid compartment (ICF), although cells do maintain cellular homeostasis.
In a state of homeostasis, the composition of both body com- partments is relatively stable. This condition is a dynamic steady state. The modifier dynamic indicates that materials are con- stantly moving back and forth between the two compartments. In a steady state, there is no net movement of materials between the compartments.
M01_SILV5197_08_SE_C01.indd 13 11/30/17 11:16 PM
14 CHAPTER 1 Introduction to Physiology
vessels that bring blood to the area sense the lower oxygen con- centration and respond by secreting a chemical signal. The signal molecule diffuses to nearby muscles in the blood vessel wall, bring- ing them a message to relax. Relaxation of the muscles widens (dilates) the blood vessel, which increases blood flow into the tissue and brings more oxygen to the area.
Reflex Control Uses Long-Distance Signaling Changes that are widespread throughout the body, or systemic in nature, require more complex control systems to maintain homeo- stasis. For example, maintaining blood pressure to drive blood flow throughout the body is a systemic issue rather than a local one. Because blood pressure is body-wide, maintaining it requires long- distance communication and coordination. We will use the term reflex control to mean any long-distance pathway that uses the ner- vous system, endocrine system, or both.
A physiological reflex can be broken down into two parts: a response loop and a feedback loop (FIG. 1.10). As with the simple control system just described, a response loop has three pri- mary components: an input signal, an integrating center to integrate the signal, and an output signal. These three components can be
expanded into the following sequence of seven steps to form a pattern that is found with slight variations in all reflex pathways:
Stimulus S sensor S input signal S integrating center S output signal S target S response
The input side of the response loop starts with a stimulus—the change that occurs when the regulated vari- able moves out of its desirable range. A specialized sen- sor monitors the variable. If the sensor is activated by the stimulus, it sends an input signal to the integrating center. The integrating center evaluates the information coming from the sensor and initiates an output signal. The output signal directs a target to carry out a response. If successful, the response brings the regulated variable back into the desired range.
In mammals, integrating centers are usually part of the nervous system or endocrine system. Output signals may be chemical signals, electrical signals, or a combina- tion of both. The targets activated by output signals can be any cell of the body.
Response Loops Begin with a Stimulus To illustrate response loops, let’s apply the concept to a simple nonbiological example. Think about an aquarium whose heater is programmed to maintain the water tem- perature (the regulated variable) at 30 °C (Fig. 1.10). The room temperature is 25 °C. The desired water tempera- ture (30 °C) is the setpoint for the regulated variable.
Assume that initially the aquarium water is at room temperature, 25 °C. When you turn the control box on, you set the response loop in motion. The thermometer (sensor) registers a temperature of 25 °C. It sends this information through a wire (input signal) to the control box (integrating center). The control box is programmed to evaluate the incoming temperature signal, compare it with the setpoint for the system (30 °C), and “decide” whether a response is needed to bring the water temperature up to the setpoint. The control box sends a signal through another wire (output signal) to the heater (the target), which turns on and starts heating the water (response). This sequence—from stimulus to response—is the response loop.
This aquarium example involves a variable (temperature) con- trolled by a single control system (the heater). We can also describe a system that is under dual control. For example, think of a house that has both heating and air conditioning. The owner would like the house to remain at 70 °F (about 21 °C). On chilly autumn mornings, when the temperature in the house falls, the heater turns on to warm the house. Then, as the day warms up, the heater is no longer needed and turns off. When the sun heats the house above the setpoint, the air conditioner turns on to cool the house back to 70 °F. The heater and air conditioner have antagonistic control over house temperature because they work in opposition to each other.
FIG. 1.9 A comparison of local control and reflex control
Brain
Blood vessels
Brain evaluates the change and initiates a response.
LOCAL CHANGE
LOCAL RESPONSE
REFLEX RESPONSE
is initiated by cells at a distant site.
Systemic change in blood
pressure sensed here.
Stimulus
Integrating center
Response
KEY
(b) Reflex control: In reflex control, cells at a distant site control the response.
(a) Local control: In local control, cells in the vicinity of the change initiate the response.
M01_SILV5197_08_SE_C01.indd 14 11/30/17 11:16 PM
C H
A P
TER
1
1.5 Control Systems and Homeostasis 15
the water. The sensor continuously monitors the temperature and sends that information to the control box. When the temperature warms up to the maximum acceptable value, the control box shuts off the heater, thus ending the reflex response.
Negative Feedback Loops Are Homeostatic For most reflexes, feedback loops are homeostatic—that is, designed to keep the system at or near a setpoint so that the regulated variable is relatively stable. How well an integrating center succeeds in main- taining stability depends on the sensitivity of the system. In the case of our aquarium, the control box is programmed to have a sensitivity of { 1 °C. If the water temperature drops from 30 °C to 29.5 °C, it is still within the acceptable range, and no response occurs. If the water temperature drops below 29 °C (30 - 1), the control box turns the heater on (FIG. 1.11). As the water heats up, the control box constantly receives information about the water temperature from the sensor. When the water reaches 31 °C (30 { 1), the upper limit for the acceptable range, the feedback loop causes the control box to turn the heater off. The water then gradually cools off until the cycle starts all over again. The end result is a regulated variable that oscillates {oscillare, to swing} around the setpoint.
Similar situations occur in the human body when two branches of the nervous system or two different hormones have opposing effects on a single target.
FIG. 1.10 The steps in a reflex pathway
Thermometer
Wire
Water temperature increases.
HeaterWire to heater
Water temperature is 25 °C.
STIMULUS
SENSOR
INPUT SIGNAL
INTEGRATING CENTER
OUTPUT SIGNAL
TARGET
RESPONSE
Reflex Steps
Water temperature is below the setpoint.
Thermometer senses temperature decrease.
Signal passes through wire to heater.
Water temperature increases.
Heater turns on.
Signal passes from sensor to control box through the wire.
Control box is programmed to respond to temperature below 29 degrees.
1
1 2
3
4
4
5
5 66
7
7
Control box
2
3
Feedback loop
Feedback loop
In the aquarium example shown, the control box is set to maintain a water temperature of 30 ± 1 °C.
Concept Check
3. What is the drawback of having only a single control system (a heater) for maintaining aquarium water temperature in some desired range?
Feedback Loops Modulate the Response Loop The response loop is only the first part of a reflex. For example, in the aquarium just described, the sensor sends temperature infor- mation to the control box, which recognizes that the water is too cold. The control box responds by turning on the heater to warm the water. Once the response starts, what keeps the heater from sending the temperature up to, say, 50 °C?
The answer is a feedback loop, where the response “feeds back” to influence the input portion of the pathway. In the aquar- ium example, turning on the heater increases the temperature of
M01_SILV5197_08_SE_C01.indd 15 11/30/17 11:16 PM
16 CHAPTER 1 Introduction to Physiology
In physiological systems, some sensors are more sensitive than others. For example, the sensors that trigger reflexes to con- serve water activate when blood concentration increases only 3% above normal, but the sensors for low oxygen in the blood will not respond until oxygen has decreased by 40%.
A pathway in which the response opposes or removes the sig- nal is known as negative feedback (FIG. 1.12a). Negative feed- back loops stabilize the regulated variable and thus aid the system in maintaining homeostasis. In the aquarium example, the heater warms the water (the response) and removes the stimulus (low water temperature). With loss of the stimulus for the pathway, the
response loop shuts off. Negative feedback loops can restore the normal state but cannot prevent the initial disturbance.
Positive Feedback Loops Are Not Homeostatic A few reflex pathways are not homeostatic. In a positive feedback loop, the response reinforces the stimulus rather than decreasing or removing it. In positive feedback, the response sends the regulated variable even farther from its normal value. This initiates a vicious cycle of ever-increasing response and sends the system temporarily out of control (Fig. 1.12b). Because positive feedback escalates the response, this type of feedback
FIG. 1.11 Oscillation around the setpoint
Setpoint of function
Negative feedback turns response loop off.
Response loop turns on.
T em
p er
at u re
(° C
)
Time
Normal range of function
28
29
30
31
32
Most functions that maintain homeostasis have a setpoint, or normal value. The response loop that controls the function activates when the function moves outside a predetermined normal range.
RUNNING PROBLEM After reading the article on fiber, Jimmy decided to go back to his professor for help. “How can I figure out who to believe on the Internet? Isn’t there a better way to get health information?”
“Well, the site you found, the American Diabetes Association, is excellent for general information aimed at the nonscientific public. But if you want to find the same information that scientists and physicians read, you should search using MEDLINE, the database published by the U.S. National Library of Medicine. PubMed is the free public-access version (www.pubmed.gov). This database lists articles that are peer-reviewed, which means that the research described has gone through a screening proc- ess in which the work is critiqued by an anonymous panel of two or three scientists who are qualified to judge the science. Peer review acts as a kind of quality control because a paper that does not meet the standards of the reviewers will be rejected by the editor of the journal.”
Q5: Jimmy went to PubMed and typed in his search terms: type 2 diabetes and insulin therapy. Repeat his search. Compare the number of results to the Google searches.
2 5 9 12 16 19 24
FIG. 1.12 Negative and positive feedback
(a) Negative feedback: The response counteracts the stimulus, shutting off the response loop.
(b) Positive feedback: The response reinforces the stimulus, sending the variable farther from the setpoint.
Response
Stimulus
Response
Stimulus
Feedback loop An outside factor is required to shut off feedback loop.
+ +
Response loop shuts off.
Initial stimulus
Initial stimulus
M01_SILV5197_08_SE_C01.indd 16 11/30/17 11:16 PM
C H
A P
TER
1
1.5 Control Systems and Homeostasis 17
Feedforward Control Allows the Body to Anticipate Change Negative feedback loops can stabilize a function and maintain it within a normal range but are unable to prevent the change that triggered the reflex in the first place. A few reflexes have evolved that enable the body to predict that a change is about to occur and start the response loop in anticipation of the change. These anticipatory responses are called feedforward control.
An easily understood physiological example of feedforward con- trol is the salivation reflex. The sight, smell, or even the thought of food is enough to start our mouths watering in expectation of eating the food. This reflex extends even further, because the same stimuli can start the secretion of hydrochloric acid as the stomach anticipates food on the way. One of the most complex feedforward reflexes appears to be the body’s response to exercise [discussed in Chapter 25].
Biological Rhythms Result from Changes in a Setpoint As discussed earlier, each regulated variable has a normal range within which it can vary without triggering a correction. In physi- ological systems, the setpoints for many regulated variables are different from person to person, or may change for the same indi- vidual over a period of time. Factors that influence an individual’s setpoint for a given variable include normal biological rhythms, inheritance, and the conditions to which the person has become accustomed.
Regulated variables that change predictably and create repeat- ing patterns or cycles of change are called biological rhythms, or biorhythms. The timing of many biorhythms coincides with a pre- dictable environmental change, such as daily light–dark cycles or the seasons. Biological rhythms reflect changes in the setpoint of the regulated variable.
For example, all animals exhibit some form of daily biological rhythm, called a circadian rhythm {circa, about + dies, day}. Humans have circadian rhythms for many body functions, includ- ing blood pressure, body temperature, and metabolic processes. For example, body temperature peaks in the late afternoon and declines dramatically in the early hours of the morning (FIG. 1.14a). Have you ever been studying late at night and noticed that you feel cold? This is not because of a drop in environmental temperature but because your thermoregulatory reflex has turned down your internal thermostat.
One of the interesting correlations between circadian rhythms and behavior involves body temperature. Researchers found that self-described “morning people” have temperature rhythms that cause body temperature to climb before they wake up in the morn- ing, so that they get out of bed prepared to face the world. On the other hand, “night people” may be forced by school and work schedules to get out of bed while their body temperature is still at its lowest point, before their bodies are prepared for activity. These night people are still going strong and working productively in the early hours of the morning, when the morning people’s body temperatures are dropping and they are fast asleep.
FIG. 1.13 A positive feedback loop
Baby drops lower in uterus to initiate labor.
Cervical stretch
stimulatescausing
Oxytocin release
causes
Uterine contractions
Push baby against cervix
Delivery of baby stops the cycle.
Feedback loop+
Concept Check
4. Does the aquarium heating system in Figure 1.10 operate using positive feedback or negative feedback?
requires some intervention or event outside the loop to stop the response.
One example of a positive feedback loop involves the hor- monal control of uterine contractions during childbirth (FIG. 1.13). When the baby is ready to be delivered, it drops lower in the uterus and begins to put pressure on the cervix, the opening of the uterus. Sensory signals from the cervix to the brain cause release of the hormone oxytocin, which causes the uterus to contract and push the baby’s head even harder against the cervix, further stretching it. The increased stretch causes more oxytocin release, which causes more contractions that push the baby harder against the cervix. This cycle continues until finally the baby is delivered, releasing the stretch on the cervix and stopping the positive feedback loop.
M01_SILV5197_08_SE_C01.indd 17 11/30/17 11:16 PM
18 CHAPTER 1 Introduction to Physiology
Many hormones in humans have blood concentrations that fluctuate predictably in a 24-hour cycle. Cortisol, growth hor- mone, and the sex hormones are among the most noted examples. A cortisol concentration in a 9:00 am sample might be nearly twice as high as one taken in the early afternoon (Fig. 1.14b).
If a patient has a suspected abnormality in hormone secre- tion, it is therefore important to know when hormone levels are measured. A concentration that is normal at 9:00 am is high at 2:00 pm. One strategy for avoiding errors due to circadian fluctua- tions is to collect information for a full day and calculate an average value over 24 hours. For example, cortisol secretion is estimated indirectly by measuring all urinary cortisol metabolites excreted in 24 hours.
What is the adaptive significance of functions that vary with a circadian rhythm? Our best answer is that biological rhythms create an anticipatory response to a predictable envi- ronmental variable. There are seasonal rhythms of reproduc- tion in many organisms. These rhythms are timed so that the offspring have food and other favorable conditions to maximize survival.
Circadian rhythms cued by the light–dark cycle may corre- spond to rest-activity cycles. These rhythms allow our bodies to anticipate behavior and coordinate body processes accordingly. You may hear people who are accustomed to eating dinner at 6:00 pm say that they cannot digest their food if they wait until 10:00 pm to eat because their digestive system has “shut down” in anticipation of going to bed.
Some variability in setpoints is associated with changing environmental conditions rather than biological rhythms. The adaptation of physiological processes to a given set of envi- ronmental conditions is known as acclimatization when it occurs naturally. If the process takes place artificially in a labo- ratory setting, it is called acclimation. Each winter, people in the upper latitudes of the northern hemisphere go south in
February, hoping to escape the bitter subzero temperatures and snows of the northern climate. As the northerners walk around in 40 °F (about 4 °C) weather in short-sleeve shirts, the south- erners, all bundled up in coats and gloves, think that the north- erners are crazy: the weather is cold! The difference in behavior is due to different temperature acclimatization, a difference in the setpoint for body temperature regulation that is a result of prior conditioning.
Biorhythms and acclimatization are complex processes that scientists still do not completely understand. Some rhythms arise from special groups of cells in the brain and are reinforced by information about the light–dark cycle that comes in through the eyes. Some cells outside the nervous system generate their own rhythms. Research in simpler animals such as flies is begin- ning to explain the molecular basis for biological rhythms. We discuss the cellular and molecular basis for circadian rhythms in Chapter 9.
1.6 The Science of Physiology How do we know what we know about the physiology of the human body? The first descriptions of physiology came from simple observations. But physiology is an experimental science, one in which researchers generate hypotheses {hypotithenai, to assume; singular hypothesis}, or logical guesses, about how events take place. They test their hypotheses by designing experiments to collect evidence that supports or disproves their hypotheses, and they publish the results of their experiments in the scientific literature. Healthcare providers look in the scientific literature for evidence from these experiments to help guide their clinical decision-making. Critically evaluating the scientific evidence in this manner is a practice known as evidence-based medicine. Obser- vation and experimentation are the key elements of scientific inquiry.
FIG. 1.14 Circadian rhythms in humans
36
37
5
10
15
20
Midnight MidnightMidnight NoonNoon
P la
sm a
co rt
is o
l ( m
g /d
L )
O ra
l b o
d y
te m
p er
at u re
(° C
) Dark Dark Dark
Midnight MidnightMidnight NoonNoon
Dark Dark Dark 9:00 A.M.
(a) Body temperature is lowest in the early morning and peaks in the late afternoon and early evening. Data from W. E. Scales et al., J Appl Physiol 65(4): 1840–1846, 1998.
(b) Plasma cortisol is lowest during sleep and peaks shortly after awakening. Data from L. Weibel et al., Am J Physiol Endocrinol Metab 270: E608–E613, 1996.
M01_SILV5197_08_SE_C01.indd 18 11/30/17 11:16 PM
C H
A P
TER
1
1.6 The Science of Physiology 19
RUNNING PROBLEM “Hi, professor. I’m back again.” Most of the articles Jimmy found in PubMed were too focused on single experiments. And he didn’t really understand the technical terms the authors used. “Is there any way to find papers that are not so complicated?”
“Yes, there are several ways. Many journals publish review articles that contain a synopsis of recent research on a particu- lar topic. When you are just beginning to learn about a topic, it is best to begin with review articles. PubMed will have a link on the Results page that takes you directly to the review articles in your results. Another place to look for basic information is Med- linePlus, another resource from the National Library of Medicine (www.medlineplus.gov). Or try Google Scholar (scholar.google .com).” Jimmy decided to try MedlinePlus because the PubMed and Google Scholar results seemed too technical for his simple question. On the MedlinePlus site, he entered type 2 diabetes and insulin therapy into the search box. After reading a few of the articles he found linked there, he called his mother. “Hey, Mom! I found the answer to your question!”
Q6: Repeat Jimmy’s search in MedlinePlus and look for links to articles on type 2 diabetes published by the National Institutes of Health (NIH), National Library of Medicine (NLM), or the Centers for Disease Control and Prevention (CDC). Based on what you read in those articles, what did Jimmy tell his mother about her need to take insulin for her type 2 diabetes?
Q7: What about the article that said eating a high-fiber diet could help? Go to the website for the National Center for Com- plementary and Integrative Health (NCCIH) (https://nccih.nih .gov), previously called the National Center for Complementary and Alternative Medicine. Search for diabetes and fiber. Is there scientific evidence supporting the claim that high fiber diets help diabetics?
2 5 9 12 16 19 24
Concept Check
5. Students in the laboratory run an experiment in which they drink different volumes of water and measure their urine output in the hour following drinking. What are the independent and dependent variables in this experiment?
An essential feature of any experiment is an experimental control. A control group is usually a duplicate of the experimental group in every respect except that the independent variable is not changed from its initial value. For example, in the bird-feeding experiment, the control group would be a set of birds maintained at a warm summer temperature but otherwise treated exactly like the birds held at cold temperatures. The purpose of the control is to ensure that any observed changes are due to the manipulated variable and not to changes in some other variable. For example, suppose that in the bird-feeding experiment food intake increased after the investigator changed to a different food. Unless she had a control group that was also fed the new food, the investigator could not determine whether the increased food intake was due to temperature or to the fact that the new food was more palatable.
During an experiment, the investigator carefully collects infor- mation, or data {plural; singular datum, a thing given}, about the effect that the manipulated (independent) variable has on the observed (dependent) variable. Once the investigator feels that she has sufficient information to draw a conclusion, she begins to analyze the data. Analysis can take many forms and usually includes statistical analysis to determine if apparent differences are statistically significant. A common format for presenting data is a graph (FIG. 1.15).
If one experiment supports the hypothesis that cold causes birds to eat more, then the experiment should be repeated to ensure that the results were not an unusual one-time event. This step is called replication. When the data support a hypothesis in multiple experiments, the hypothesis may become a working model. A model with substantial evidence from multiple investi- gators supporting it may become a scientific theory.
Most information presented in textbooks like this one is based on models that scientists have developed from the best available experimental evidence. On occasion, investigators publish new experimental evidence that does not support a cur- rent model. In that case, the model must be revised to fit the available evidence. For this reason, you may learn a physiologi- cal “fact” while using this textbook, but in 10 years that “fact” may be inaccurate because of what scientists have discovered in the interval.
For example, in 1970, students learned that the cell mem- brane was a “butter sandwich,” a structure composed of a layer of fats sandwiched between two layers of proteins. In 1972, however, scientists presented a very different model of
Good Scientific Experiments Must Be Carefully Designed A common type of biological experiment either removes or alters some variable that the investigator thinks is an essential part of an observed phenomenon. That altered variable is the independent variable. For example, a biologist notices that birds at a feeder seem to eat more in the winter than in the summer. She generates a hypothesis that cold temperatures cause birds to increase their food intake. To test her hypothesis, she designs an experiment in which she keeps birds at different temperatures and monitors how much food they eat. In her experiment, temperature, the manipulated element, is the independent variable. Food intake, which is hypoth- esized to be dependent on temperature, becomes the dependent variable.
M01_SILV5197_08_SE_C01.indd 19 11/30/17 11:16 PM
For the line graph and scatter plot, answer the following: • What was the investigator trying to determine? • What are the independent and dependent variables? • What are the results or trends indicated by the data?
20
10
40
30
60
50
90
80
70
100
E xa
m s
co re
(% )
Time spent studying (hours)
Student scores were directly related to the amount of time they spent studying.
2 4 6 8 10 12
KEY 60
50
40
30
20
10
B o
d y
w ei
g h t
(g )
Day 0 1 2 3 4 5 6 7
Males
Females
1
2
3
4
5
6
7
8
Fo o
d in
ta ke
(g /d
ay )
A B C Diet
Which food did the canaries prefer?
D ep
en d
en t
va ri ab
le (u
n its
)
Independent variable (units)
y-axis
1 unit
x-axis
Key
1 unit
Group A X Group B
X
X
X X
X
•
• • •
•
•
•
KEY
A key shows what each symbol or color on the graph represents.
Male and female mice were fed a standard diet and weighed daily.
A viewer can extract information much more rapidly from a graph than from a table of numbers or from a written description. A well-constructed graph should contain (in very abbreviated form) everything the reader needs to know about the data, including the purpose of the experiment, how the experiment was conducted, and the results.
A graph should have a title (usually put above the graph) or legend below the graph. These describe what the graph represents.
Each axis of a graph is divided into units represented by evenly spaced tick marks on the axis.
Each axis has a label that tells • what variable the axis represents (time, temperature,
amount of food consumed) • the units of the axis (days, degrees Celsius, grams per day).
Graphs are pictorial representations of the relationship between two (or more) variables, plotted in a rectangu- lar region (Fig. 1.15a). Graphs present a large amount of numerical data in a small space, emphasize compari- sons between variables, or show trends over time.
The horizontal axis is called the x-axis.
The vertical axis is called the y-axis.
The intersection of the two axes is called the origin. The origin usually, but not always, has a value of zero for both axes.
The simplest way to know what most graphs mean is the substitute the labels on the X and Y axes into the following sentence:
The effect of [X] on [Y]
The x-axis shows values of the variable manipulated by the experimenter. This is called the independent variable.
The y-axis shows the variable measured by the experimenter. It is called the dependent variable.
If the experimental design is valid and the hypothesis is correct, changes in the independent variable (x-axis) will cause changes in the dependent variable (y-axis).
In other words, y is a function of x, or mathematically, y = f(x).
• Each point on the graph represents the average of a set of observations.
• Because the independent variable is a continuous function, the points can be connected with a line (point-to-point connections or a mathematically calculated “best fit” line or curve).
• The slope of the line between two points represents the rate at which the variable changed.
• Connecting the points with lines allows the reader to interpolate, or estimate values between the measured values.
• Usually each point on the plot represents one member of a test population.
• Individual points on a scatter plot are never connected by a line, but a “best fit” line or curve may indicate a trend in the data.
Bar graphs are used when the independent variables are distinct entities. Each bar represents a different variable. The bars are lined up side by side so that they can easily be compared with one another. Scientific bar graphs traditionally have vertical bars.
Line graphs are used when the independent variable on the x-axis is a continuous phenomenon, such as time, temperature, or weight.
Scatter plots show the relationship between two variables, such as time spent studying for an exam and performance on that exam.
Students in a physiology laboratory collected heart rate data on one another. In each case, heart rate was measured first for the subject at rest and again after the subject had exercised for 5 minutes using a step test.
Data from the experiment are shown in the table.
(a) What was the independent variable in this experiment? What was the dependent variable?
(b) Describe two observations you can make from the data.
(c) Draw one graph that illustrates both findings you described in (b). Label each axis with the correct variable.
Most graphs you will encounter in physiology display data either as bars (bar graphs or histograms), as lines (line graphs), or as dots (scatter plots). Some typical types of graphs are shown here.
Here’s one approach to reading graphs:
1. Read the title and legend. These are a capsule summary of the graph’s contents.
2. Read the axis labels and put them into the sentence
The effect of [X] on [Y].
3. Look for trends in the graph. Are lines horizontal or do they have a slope? Are bars the same height or different heights?
GRAPH QUESTION
When did male mice increase their body weight the fastest?
GRAPH QUESTION
GRAPH QUESTIONS
All scientific graphs have common features.
Canaries were fed one of three diets and their food intake was monitored for three weeks.
TRY IT! Graphing
Answers: see Appendix A
Subject
HINT: Excel is a simple way to make graphs from data in tables. Excel calls graphs “charts.”
Sex Age Resting heart rate
(beats/min) Post exercise heart
rate (beats/min)
1 M 20 58 90
2 M 21 62 110
3 F 19 70 111
4 M 20 64 95
5 F 20 85 120
6 F 19 72 98
7 F 21 73 101
Instructors: A version of this Try it! Activity can be assigned in@Mastering Anatomy & Physiology
FIG. 1.15 Focus on . . . Graphing
M01_SILV5197_08_SE_C01.indd 20 11/30/17 11:16 PM
21
For the line graph and scatter plot, answer the following: • What was the investigator trying to determine? • What are the independent and dependent variables? • What are the results or trends indicated by the data?
20
10
40
30
60
50
90
80
70
100
E xa
m s
co re
(% )
Time spent studying (hours)
Student scores were directly related to the amount of time they spent studying.
2 4 6 8 10 12
KEY 60
50
40
30
20
10
B o
d y
w ei
g h t
(g )
Day 0 1 2 3 4 5 6 7
Males
Females
1
2
3
4
5
6
7
8
Fo o
d in
ta ke
(g /d
ay )
A B C Diet
Which food did the canaries prefer?
D ep
en d
en t
va ri ab
le (u
n its
)
Independent variable (units)
y-axis
1 unit
x-axis
Key
1 unit
Group A X Group B
X
X
X X
X
•
• • •
•
•
•
KEY
A key shows what each symbol or color on the graph represents.
Male and female mice were fed a standard diet and weighed daily.
A viewer can extract information much more rapidly from a graph than from a table of numbers or from a written description. A well-constructed graph should contain (in very abbreviated form) everything the reader needs to know about the data, including the purpose of the experiment, how the experiment was conducted, and the results.
A graph should have a title (usually put above the graph) or legend below the graph. These describe what the graph represents.
Each axis of a graph is divided into units represented by evenly spaced tick marks on the axis.
Each axis has a label that tells • what variable the axis represents (time, temperature,
amount of food consumed) • the units of the axis (days, degrees Celsius, grams per day).
Graphs are pictorial representations of the relationship between two (or more) variables, plotted in a rectangu- lar region (Fig. 1.15a). Graphs present a large amount of numerical data in a small space, emphasize compari- sons between variables, or show trends over time.
The horizontal axis is called the x-axis.
The vertical axis is called the y-axis.
The intersection of the two axes is called the origin. The origin usually, but not always, has a value of zero for both axes.
The simplest way to know what most graphs mean is the substitute the labels on the X and Y axes into the following sentence:
The effect of [X] on [Y]
The x-axis shows values of the variable manipulated by the experimenter. This is called the independent variable.
The y-axis shows the variable measured by the experimenter. It is called the dependent variable.
If the experimental design is valid and the hypothesis is correct, changes in the independent variable (x-axis) will cause changes in the dependent variable (y-axis).
In other words, y is a function of x, or mathematically, y = f(x).
• Each point on the graph represents the average of a set of observations.
• Because the independent variable is a continuous function, the points can be connected with a line (point-to-point connections or a mathematically calculated “best fit” line or curve).
• The slope of the line between two points represents the rate at which the variable changed.
• Connecting the points with lines allows the reader to interpolate, or estimate values between the measured values.
• Usually each point on the plot represents one member of a test population.
• Individual points on a scatter plot are never connected by a line, but a “best fit” line or curve may indicate a trend in the data.
Bar graphs are used when the independent variables are distinct entities. Each bar represents a different variable. The bars are lined up side by side so that they can easily be compared with one another. Scientific bar graphs traditionally have vertical bars.
Line graphs are used when the independent variable on the x-axis is a continuous phenomenon, such as time, temperature, or weight.
Scatter plots show the relationship between two variables, such as time spent studying for an exam and performance on that exam.
Students in a physiology laboratory collected heart rate data on one another. In each case, heart rate was measured first for the subject at rest and again after the subject had exercised for 5 minutes using a step test.
Data from the experiment are shown in the table.
(a) What was the independent variable in this experiment? What was the dependent variable?
(b) Describe two observations you can make from the data.
(c) Draw one graph that illustrates both findings you described in (b). Label each axis with the correct variable.
Most graphs you will encounter in physiology display data either as bars (bar graphs or histograms), as lines (line graphs), or as dots (scatter plots). Some typical types of graphs are shown here.
Here’s one approach to reading graphs:
1. Read the title and legend. These are a capsule summary of the graph’s contents.
2. Read the axis labels and put them into the sentence
The effect of [X] on [Y].
3. Look for trends in the graph. Are lines horizontal or do they have a slope? Are bars the same height or different heights?
GRAPH QUESTION
When did male mice increase their body weight the fastest?
GRAPH QUESTION
GRAPH QUESTIONS
All scientific graphs have common features.
Canaries were fed one of three diets and their food intake was monitored for three weeks.
TRY IT! Graphing
Answers: see Appendix A
Subject
HINT: Excel is a simple way to make graphs from data in tables. Excel calls graphs “charts.”
Sex Age Resting heart rate
(beats/min) Post exercise heart
rate (beats/min)
1 M 20 58 90
2 M 21 62 110
3 F 19 70 111
4 M 20 64 95
5 F 20 85 120
6 F 19 72 98
7 F 21 73 101
Instructors: A version of this Try it! Activity can be assigned in@Mastering Anatomy & Physiology
M01_SILV5197_08_SE_C01.indd 21 11/30/17 11:16 PM
22 CHAPTER 1 Introduction to Physiology
the membrane, in which globules of proteins float within a double layer of fats. As a result, students who had learned the butter sandwich model had to revise their mental model of the membrane.
Where do our scientific models for human physiology come from? We have learned much of what we know from experiments on animals ranging from fruit flies and squid to rats. In many instances, the physiological processes in such animals are either identical to those taking place in humans or else similar enough that we can extrapolate from the animal model to humans. It is important to use nonhuman models because experiments using human subjects can be difficult to perform.
However, not all studies done on animals can be applied to humans. For example, an antidepressant that Europeans had used safely for years was undergoing stringent testing required by the U.S. Food and Drug Administration before it could be sold in this country. When beagles took the drug for a period of months, the dogs started dying from heart problems. Scientists were alarmed until further research showed that beagles have a unique genetic makeup that causes them to break down the drug into a more toxic substance. The drug was perfectly safe in other breeds of dogs and in humans, and it was subsequently approved for human use.
The Results of Human Experiments Can Be Difficult to Interpret There are many reasons it is difficult to carry out physiological experiments in humans, including variability, psychological factors, and ethical considerations.
Variability Human populations have tremendous genetic and environmental variability. Although physiology books usu- ally present average values for many physiological variables, such as blood pressure, these average values simply represent a number that falls somewhere near the middle of a wide range of values. Thus, to show significant differences between experimental and control groups in a human experiment, an investigator would have to include a large number of identical subjects.
However, getting two groups of people who are identical in every respect is impossible. Instead, the researcher must attempt to recruit subjects who are similar in as many aspects as pos- sible. You may have seen newspaper advertisements request- ing research volunteers: “Healthy males between 18 and 25, nonsmokers, within 10% of ideal body weight, to participate in a study. . . .” Researchers must take into account the vari- ability inherent in even a select group of humans when doing experiments with human subjects. This variability may affect the researcher’s ability to interpret the significance of data collected on that group.
One way to reduce variability within a test population, whether human or animal, is to do a crossover study. In a
crossover study, each individual acts both as experimental subject and as control. Thus, each individual’s response to the treatment can be compared with his or her own control value. This method is particularly effective when there is wide variability within a population.
For example, in a test of blood pressure medication, investi- gators might divide subjects into two groups. Group A takes an inactive substance called a placebo (from the Latin for “I shall be pleasing”) for the first half of the experiment, then changes to the experimental drug for the second half. Group B starts with the experimental drug, and then changes to the placebo. This scheme enables the researcher to assess the effect of the drug on each individual. In other words, each subject acts as his or her own control. Statistically, the data analysis can use methods that look at the changes within each individual rather than at changes in the collective group data.
Psychological Factors Another significant variable in human studies is the psychological aspect of administering a treat- ment. If you give someone a pill and tell the person that it will help alleviate some problem, there is a strong possibility that the pill will have exactly that effect, even if it contains only sugar or an inert substance. This well-documented phenom- enon is called the placebo effect. Similarly, if you warn peo- ple that a drug they are taking may have specific adverse side effects, those people will report a higher incidence of the side effects than a similar group of people who were not warned. This phenomenon is called the nocebo effect, from the Latin nocere, to do harm. The placebo and nocebo effects show the ability of our minds to alter the physiological functioning of our bodies.
In setting up an experiment with human subjects, we must try to control for the placebo and nocebo effects. The simplest way to do this is with a blind study, in which the subjects do not know whether they are receiving the treatment or the pla- cebo. Even this precaution can fail, however, if the research- ers assessing the subjects know which type of treatment each subject is receiving. The researchers’ expectations of what the treatment will or will not do may color their measurements or interpretations.
To avoid this outcome, researchers often use double-blind studies. A third party, not involved in the experiment, is the only one who knows which group is receiving the experimental treatment and which group is receiving the control treatment. The most sophisticated experimental design for minimizing psy- chological effects is the double-blind crossover study. In this type of study, the control group in the first half of the experi- ment becomes the experimental group in the second half, and vice versa, but no one involved knows who is taking the active treatment.
Ethical Considerations Ethical questions arise when humans are used as experimental subjects, particularly when the subjects are
M01_SILV5197_08_SE_C01.indd 22 11/30/17 11:16 PM
C H
A P
TER
1
1.6 The Science of Physiology 23
disease or condition. Data from cross-sectional studies identify trends to be investigated further, such as whether age group or socioeconomic status is associated with a higher risk of devel- oping the condition being surveyed. Retrospective studies {retro, backward + spectare, to look} match groups of people who all have a particular disease to a similar but healthy con- trol group. The goal of these studies is to determine whether development of the disease can be associated with a particular variable.
Often, the results of one or more published studies do not agree with the conclusions of other published studies. In some cases, the reason for the disagreement turns out to be a limitation of the experimental design, such as a small number of subjects who may not be representative of larger populations. In other cases, the disagreement may be due to small but potentially sig- nificant differences in the experimental designs of the different studies.
One way scientists attempt to resolve contradictory results is to perform a meta-analysis of the data {meta-, at a higher level}. A meta-analysis combines all the data from a group of similar studies and uses sophisticated statistical techniques to extract sig- nificant trends or findings from the combined data. For example, multiple studies have been done to assess whether glucosamine and chondroitin, two dietary supplements, can improve degenerative joint disease. However, the individual studies had small numbers of subjects ( 6 50) and used different dosing regimens. A meta- analysis using statistical methods is one way to compare the results from these studies.6
The difficulty of using human subjects in experiments is one of the reasons scientists use animals to develop many of our scientific models. Since the 1970s, physiological research has increasingly augmented animal experimentation with techniques developed by cellular biologists and molecular geneticists. As we have come to understand the fundamentals of chemical signaling and communication in the body, we have unlocked the mysteries of many processes. In doing so, we also have come closer to being able to treat many diseases by correcting their cause rather than simply treating their symptoms.
More and more, medicine is turning to therapies based on interventions at the molecular level. A classic example is the treat- ment of cystic fibrosis, an inherited disease in which the mucus of the lungs and digestive tract is unusually thick. For many years, patients with this condition had few treatment options, and most died at a young age. However, basic research into the mechanisms by which salt and water move across cell membranes provided clues to the underlying cause of cystic fibrosis: a defective protein in the membrane of certain cells. Once molecular geneticists found
6 See, for example, S. Wandel et al. Effects of glucosamine, chondroitin, or placebo in patients with osteoarthritis of hip or knee: network meta-analysis. Br Med J 341: c4675–c4676, 2010.
people suffering from a disease or other illness. Is it ethical to withhold a new and promising treatment from the control group? A noteworthy example occurred some years ago when research- ers were testing the efficacy of a treatment for dissolving blood clots in heart attack victims. The survival rate among the treated patients was so much higher that testing was halted so that mem- bers of the control group could also be given the experimental drug.
In contrast, tests on some anticancer agents have shown that the experimental treatments were less effective in stopping the spread of cancer than were the standard treatments used by the controls. Was it ethical to undertreat patients in the experimen- tal group by depriving them of the more effective current medi- cal practice? Most studies now are evaluated continually over the course of the study to minimize the possibility that subjects will be harmed by their participation.
In 2002, a trial on hormone replacement therapy in post- menopausal women was halted early when investigators realized that women taking a pill containing two hormones were develop- ing cardiovascular disease and breast cancer at a higher rate than women on placebo pills. On the other hand, the women receiving hormones also had lower rates of colon cancer and bone fractures. The investigators decided that the risks associated with taking the hormones exceeded the potential benefits, and they stopped the study. To learn more about this clinical trial and the pros and cons of hormone replacement therapy, go to www.nlm.nih.gov/ medlineplus/hormonereplacementtherapy.html, the website of the U.S. National Library of Medicine.
Human Studies Can Take Many Forms Almost daily, the newspa- pers carry articles about clinical trials studying the efficacy of drugs or other medical treatments. Many different aspects of experimen- tal design can affect the validity and applicability of the results of these trials. For example, some trials are carried out for only a limited time on a limited number of people, such as studies con- ducted for the U.S. Food and Drug Administration’s drug-approval process. In several instances in the past few years, drugs approved as a result of such studies have later been withdrawn from the market when extended use of the drug uncovered adverse side effects, including deaths.
Longitudinal studies are designed to be carried out for a long period of time. One of the most famous longitudinal studies is the Framingham Heart Study (www.framingham.com/heart), started in 1948 and still ongoing. Framingham is a prospective study {prospectus, outlook, looking forward} that recruited healthy people and has been following them for years to identify factors that con- tribute to the development of cardiovascular disease. This study has already made important contributions to healthcare, and it continues today with the adult children and grandchildren of the original participants.
Additional study designs you may encounter in the litera- ture include cross-sectional and retrospective studies. Cross- sectional studies survey a population for the prevalence of a
M01_SILV5197_08_SE_C01.indd 23 11/30/17 11:16 PM
24 CHAPTER 1 Introduction to Physiology
the gene that coded for that protein, the possibility of repairing the defective protein in cystic fibrosis patients became a reality. Without the basic research into how cells and tissues carry out their normal function, however, this treatment would never have been developed.
As you read this book and learn what we currently know about how the human body works, keep in mind that many of the ideas presented in it reflect models that represent our current under- standing and are subject to change. There are still many questions in physiology waiting for investigators to find the answers.
RUNNING PROBLEM CONCLUSION What to Believe?
One skill all physiology students should acquire is the ability to find information in the scientific literature. In today’s world, the scientific literature can be found both in print, in the form of books and periodicals, and on the Web. However, unless a book has a recent publication date, it may not be the most up-to-date source of information.
Many students begin their quest for information on a sub- ject by searching the Internet. Be cautious! Anyone can create
a web page and publish information on the Web. There is no screening process comparable to peer review in journals, and the reader of a web page must decide how valid the informa- tion is. Websites published by recognized universities and not- for-profit organizations are likely to have good information, but you should view an article about vitamins on the web page of a health food store with a skeptical eye unless the article cites published peer-reviewed research.
Question Answer and Commentary
Q1: What search terms could Jimmy have used to get fewer results?
Including more words in a web search is the best way to narrow the results list. For example, Jimmy could have searched for insulin therapy diabetes. That search would have produced about 5 million results. Being more specific about his mother’s type of diabetes might help. A search for insulin therapy for type 2 diabetes comes up with about 4.3 million results. That’s still a lot of web pages to look at!
Q2: What kinds of websites should Jimmy be looking for in his results list, and how can he recognize them?
The best websites for health information come from organizations that are part of the scientific and healthcare communities, such as the National Institutes of Health (NIH), nonprofit groups dedicated to supporting research on a particular disease (e.g., The American Diabetes Association, diabetes.org), or clinics and universities where sci- entists and physicians are actively investigating causes and treatments for diseases. Treat commercial websites that end in *.com with extra caution.
Q3: In The Doctors’ Medical Library article called “Fiber,” what does Dr. Kennedy say about high-fiber diet and diabetes?
Dr. Kennedy claims that some patients with type 2 diabetes can be “successfully treated” by eating a high-fiber diet. (The classification of type 2 diabetes as “adult onset” is obsolete.)
Q4: How can Jimmy find out more about who created the site and what their credentials are?
To learn more about who created a website and why, look for links at the bottom of the page for HOME or ABOUT US. On the home page for The Doctors’ Medical Library, you will learn that the site promotes reader education. The information on Ron Kennedy, MD, implies that he is licensed by the State of California but does not give any information on his training.
Q5: Compare the number of results from the PubMed search to those for the Google searches.
The number of results will depend on when you do the search because new articles are added constantly. But the number will probably be fewer than 60,000, much less than the millions of results that came up following a Google search.
Q6: What did Jimmy tell his mother about her need to take insulin for her type 2 diabetes?
The articles published by these national organizations all say that people with type 2 diabetes may need to take insulin. Patients should always listen to their healthcare providers and ask questions if they are uncertain about what they should be doing.
Q7: Do the articles from NCCIH mention dietary fiber as an alternative treatment for diabetes?
The NCCIH articles list a number of alternative treatments that people have tried. It also says that, so far, there is no scientific evidence supporting the use of dietary supplements for treating diabetes. Patients should never stop their conventional treat- ments when using complementary treatments, and they should always inform their healthcare providers about any vitamins or dietary supplements they are taking.
Citing Resources Whenever you use someone else’s material, even if it is just for a class project, you should cite your source. If you put a photo from the web into a PowerPoint slide, be sure to include the URL. If you paraphrase something written, acknowledge where you learned the information. Copying or paraphrasing material from another source without acknowledging that source is academic dishonesty.
Citing Web Sources Unlike print resources, web pages are not permanent and frequently disappear or move. Here is one suggested format for citing information from a website:
M01_SILV5197_08_SE_C01.indd 24 11/30/17 11:16 PM
C H
A P
TER
1
Chapter Summary 25
Author/Editor (if known). Revision or copyright date (if available). Title of web page [Publication medium]. Publisher of web page. URL [Date accessed].
Example: Patton G (editor). 2005. Biological Journals and Abbreviations. [Online]. National Cancer Institute. http://home.ncifcrf.gov/research/ bja [accessed April 10, 2005].
Citing Print Sources Citation formats for papers in research journals vary but will usually include the following elements (with the punctuation shown):
Author(s). Article title. Journal Name volume (issue): inclusive pages, year of publication.
Example: Echevarria M and Ilundain AA. Aquaporins. J Physiol Biochem 54(2): 107–118, 1998.
Helpful Hints
• If you access a print journal on the Web, you should give the print citation, not the URL.
• Many publications now have a unique DOI (digital object identifier) number. These are alphanumerical codes that provide a permanent link to the article on the Internet, so that even if a website changes names, you will still be able to find the article.
• Journal names are abbreviated using standard abbreviations. One-word titles, such as Science, are never abbreviated. For example, the American Journal of Physiology is abbreviated as Am J Physiol.
• Journals group their publications into volumes that correspond to a certain period of time (a year, six months, etc.). The first publication of a given volume is designated issue 1, the second is issue 2, and so on. In the citation J Physiol Biochem 54(2): 107–118, 1998, you know that this was volume 54, issue 2.
• Word-for-word quotations placed within quotation marks are rarely used in scientific writing.
• When paraphrasing in written work, acknowledge the source this way:
Some rare forms of epilepsy are known to be caused by mutations in ion channels (Mulley et al., 2003).
When a paper has three or more authors, we usually use the abbreviation et al.—from the Latin et alii, meaning “and others”—to save space in the body of the text. All authors’ names are given in the full citation, which is usually included within a References section at the end of the paper.
• If you have questions about the proper way to cite something, look at the Scientific Style and Format website, published by the Council of Science Editors, http://www.scientificstyleandformat.org/Tools/SSF-Citation-Quick-Guide.html.
2 5 9 12 16 19 24
CHAPTER SUMMARY 1. Physiology is the study of the normal functioning of a living
organism and its component parts. (p. 2)
1.1 Physiology Is an Integrative Science 2. Many complex functions are emergent properties that cannot be
predicted from the properties of the individual component parts. (p. 2) 3. Physiologists study the many levels of organization in living organ-
isms, from molecules to populations of one species. (p. 2; Fig. 1.1) 4. The cell is the smallest unit of structure capable of carrying out
all life processes. (p. 3) 5. Collections of cells that carry out related functions make up
tissues and organs. (p. 3) 6. The human body has 10 physiological organ systems: integumentary,
musculoskeletal, respiratory, digestive, urinary, immune, circulatory, nervous, endocrine, and reproductive. (p. 3; Fig. 1.2)
1.2 Function and Mechanism 7. The function of a physiological system or event is the “why” of the
system. The mechanism by which events occur is the “how” of a sys- tem. The teleological approach to physiology explains why events happen; the mechanistic approach explains how they happen. (p. 5)
8. Translational research applies the results of basic physiological research to medical problems. (p. 5)
1.3 Themes in Physiology 9. The four key themes in physiology are structure/function relation-
ships, such as molecular interactions and compartmenta- tion; biological energy use; information flow within the body; and homeostasis. (p. 8)
1.4 Homeostasis 10. Homeostasis is the maintenance of a relatively constant internal
environment. Variables that are regulated to maintain homeo- stasis include temperature, pH, ion concentrations, oxygen, and water. (p. 9)
11. Failure to maintain homeostasis may result in illness or disease. (p. 10; Fig. 1.4)
12. The body’s internal environment is the extracellular fluid. (p. 10; Fig. 1.5)
13. The human body as a whole is adapted to cope with a variable external environment, but most cells of the body can tolerate much less change. (p. 10)
RUNNING PROBLEM CONCLUSION Continued
M01_SILV5197_08_SE_C01.indd 25 11/30/17 11:16 PM
26 CHAPTER 1 Introduction to Physiology
14. The law of mass balance says that if the amount of a substance in the body is to remain constant, any input must be offset by an equal loss. (p. 11; Fig. 1.6)
15. Input of a substance into the body comes from metabolism or from the outside environment. Output occurs through metabolism or excretion. (p. 12; Fig. 1.6)
16. The rate of intake, production, or output of a substance x is expressed as mass flow, where mass flow = concentration * volume flow. (p. 12)
17. Clearance is the rate at which a material is removed from the blood by excretion, metabolism, or both. The liver, kidneys, lungs, and skin all clear substances from the blood. (p. 12)
18. Cells and the extracellular fluid both maintain homeostasis, but they are not identical in composition. Their stable condition is a dynamic steady state. (p. 13)
19. Most solutes are concentrated in either one compartment or the other, creating a state of disequilibrium. (p. 13; Fig. 1.7)
1.5 Control Systems and Homeostasis 20. Regulated variables have a setpoint and a normal range.
(p. 13; Fig. 1.11) 21. The simplest homeostatic control takes place at the tissue or cell
level and is known as local control. (p. 13; Fig. 1.9) 22. Control systems have three components: an input signal, an
integrating center, and an output signal. (p. 13; Fig. 1.8) 23. Reflex pathways can be broken down into response loops and
feedback loops. A response loop begins when a stimulus is sensed by a sensor. The sensor is linked by the input signal to the integrating center that decides what action to take. The output signal travels from the integrating center to a target that carries out the appropriate response. (p. 14; Fig. 1.10)
24. In negative feedback, the response opposes or removes the original stimulus, which in turn stops the response loop. (p. 16; Fig. 1.12a)
25. In positive feedback loops, the response reinforces the stimu- lus rather than decreasing or removing it. This destabilizes the system until some intervention or event outside the loop stops the response. (p. 16; Figs. 1.12b, 1.13)
26. Feedforward control allows the body to predict that a change is about to occur and start the response loop in anticipation of the change. (p. 17)
27. Regulated variables that change in a predictable manner are called biological rhythms. Those that coincide with light–dark cycles are called circadian rhythms. (p. 17; Fig. 1.14)
1.6 The Science of Physiology 28. Observation and experimentation are the key elements of
scientific inquiry. A hypothesis is a logical guess about how an event takes place. (p. 18)
29. In scientific experimentation, the factor manipulated by the inves- tigator is the independent variable, and the observed factor is the dependent variable. All well-designed experiments have controls to ensure that observed changes are due to the experi- mental manipulation and not to some outside factor. (p. 19)
30. Data, the information collected during an experiment, are analyzed and presented, often as a graph. (p. 19; Fig. 1.15)
31. A scientific theory is a hypothesis supported by data from multiple sources. When new evidence does not support a theory or a model, the theory or model must be revised. (p. 19)
32. Animal experimentation is important because of the tremendous variability within human populations and because it is difficult to control human experiments. In addition, ethical questions may arise when using humans as experimental subjects. (p. 22)
33. To control many experiments, some subjects take an inactive sub- stance known as a placebo. Placebo and nocebo effects, in which changes take place even if the treatment is inactive, may affect experimental outcomes. (p. 22)
34. In a blind study, the subjects do not know whether they are receiving the experimental treatment or a placebo. In a double- blind study, a third party removed from the experiment is the only one who knows which group is the experimental group and which is the control. In a crossover study, the control group in the first half of the experiment becomes the experimental group in the second half, and vice versa. (p. 22)
35. Meta-analysis of data combines data from many studies to look for trends. (p. 23)
REVIEW QUESTIONS In addition to working through these questions and checking your answers on p. A-1, review the Learning Outcomes at the beginning of this chapter.
Level One Reviewing Facts and Terms 1. Define physiology. Describe the relationship between physiology
and anatomy.
2. Name the different levels of organization in the biosphere.
3. Name the 10 systems of the body and give their major function(s).
4. What does “Physiology is an integrative science” mean?
5. Define homeostasis. Name some regulated variables that are main- tained through homeostasis.
6. Name four major themes in physiology.
7. Put the following parts of a reflex in the correct order for a physio- logical response loop: input signal, integrating center, output signal, response, sensor, stimulus, target.
8. The name for daily fluctuations of body functions such as blood pressure, temperature, and metabolic processes is a(n) .
Level Two Reviewing Concepts 9. Mapping exercise: Make a large map showing the organization
of the human body. Show all levels of organization in the body (see Fig. 1.1) and all 10 organ systems. Try to include functions of all components on the map and remember that some structures may share functions. (Hint: Start with the human body as the most important term. You may also draw the outline of a body and make your map using it as the basis.)
10. Distinguish between the items in each group of terms. a. tissues and organs b. x-axis and y-axis on a graph c. dependent and independent variables d. teleological and mechanistic approaches e. the internal and external environments for a human f. blind, double-blind, and crossover studies g. the target and the sensor in a control system
M01_SILV5197_08_SE_C01.indd 26 11/30/17 11:16 PM
C H
A P
TER
1
a. What kind of graph is this? b. What question were the investigators asking? c. In one sentence, summarize the relationship between the two
variables plotted on the graph.
19. Answer the questions after the following article summary.
A study7 was carried out on human volunteers to see whether two procedures performed during arthroscopic surgery {arthro-, joint + scopium, to look at} are effective in relieving knee pain asso- ciated with osteoarthritis, or degenerative joint disease {osteon, bone + arthro@, joint + @itis, inflammation}. The volunteers were up to 75 years old and were recruited from a Veterans Affairs Med- ical Center. They were 93% male and 60% white. One-third of the subjects had placebo operations—that is, they were given anesthe- sia and their knees were cut open, but the remainder of the treat- ment procedure was not done. The other two-thirds of the subjects had one of the two treatment procedures performed. Subjects were followed for two years. They answered questions about their knee pain and function and were given an objective walking and stair- climbing test. At the end of the study, the results showed no signifi- cant difference in knee function or perception of pain between subjects getting one of the standard treatments and those getting the placebo operation.
a. Do you think it is ethical to perform placebo surgeries on humans who are suffering from a painful condition, even if the subjects are informed that they might receive the placebo operation and not the standard treatment?
b. Give two possible explanations for the decreased pain reported by the placebo operation subjects.
c. Analyze and critique the experimental design of this study. Are the results of this study applicable to everyone with knee pain?
d. Was this study a blind, double-blind, or double-blind crossover design?
e. Why do you think the investigators felt it was necessary to include a placebo operation in this study?
7 J. B. Moseley et al. A controlled trial of arthroscopic surgery for osteoarthri- tis of the knee. N Eng J Med 347(2): 81–88, 2002.
A er
o b
ic f
itn es
s
Very poor
Fair
Good
Excellent
Superior
10 20 30 40
Midarm muscle circumference (cm)
11. Name as many organs or body structures that connect directly with the external environment as you can.
12. Which organ systems are responsible for coordinating body func- tion? For protecting the body from outside invaders? Which sys- tems exchange material with the external environment, and what do they exchange?
13. Explain the differences among positive feedback, negative feed- back, and feedforward mechanisms. Under what circumstances would each be advantageous?
Level Three Problem Solving 14. A group of biology majors went to a mall and asked passersby,
“Why does blood flow?” These are some of the answers they received. Which answers are teleological and which are mechanis- tic? (Not all answers are correct, but they can still be classified.)
a. Because of gravity b. To bring oxygen and food to the cells c. Because if it didn’t flow, we would die d. Because of the pumping action of the heart
15. Although dehydration is one of the most serious physiological obstacles that land animals must overcome, there are others. Think of as many as you can, and think of various strategies that different terrestrial animals have to overcome these obstacles. (Hint: Think of humans, insects, and amphibians; also think of as many different terrestrial habitats as you can.)
Level Four Quantitative Problems 16. A group of students wanted to see what effect a diet deficient in
vitamin D would have on the growth of baby guppies. They fed the guppies a diet low in vitamin D and measured fish body length every third day for three weeks. Their data looked like this:
Day 0 3 6 9 12 15 18 21
Average body length (mm) 6 7 9 12 14 16 18 21
a. What was the dependent variable and what was the indepen- dent variable in this experiment?
b. What was the control in this experiment? c. Make a fully labeled graph with a legend, using the data in the
table. d. During what time period was growth slowest? Most rapid?
(Use your graph to answer this question.)
17. You performed an experiment in which you measured the volumes of nine slices of potato, then soaked the slices in solutions of different salinities for 30 minutes. At the end of 30 minutes, you again mea- sured the volumes of the nine slices. The changes you found were:
Percent Change in Volume after 30 Minutes
Solution Sample 1 Sample 2 Sample 3
Distilled water 10% 8% 11%
1% salt (NaCl) 0% - 0.5% 1% 9% salt (NaCl) - 8% - 12% - 11% a. What was the independent variable in this experiment? What
was the dependent variable? b. Can you tell from the information given whether or not there was
a control in this experiment? If there was a control, what was it? c. Graph the results of the experiment using the most appropriate
type of graph.
18. At the end of the semester, researchers measured an intermediate- level class of 25 male weight lifters for aerobic fitness and midarm muscle circumference. The relationship between those two vari- ables is graphed here.
Review Questions 27
Answers to Concept Checks, Figure and Graph Questions, and end-of-chapter Review Questions can be found in Appendix A [p. A-1].
M01_SILV5197_08_SE_C01.indd 27 11/30/17 11:16 PM
2.1 Molecules and Bonds 29 LO 2.1.1 Compare and contrast the composi-
tion, structure, and functions of the four major groups of biomolecules.
LO 2.1.2 Describe four important biological roles of electrons.
LO 2.1.3 Describe and compare the differ- ent types of covalent and noncovalent bonds.
LO 2.2.1 Contrast y of polar and no
LO 2.2.2 Describ noncova- lent int · ute to molecu- lar sh molecular shape · nction.
LO ords and mathemati- e differences between
d buffers.
2.3 Protein Interactions 46 LO 2.3.1 List seven important functions of
soluble proteins in the body.
LO 2.3.2 Explain the meanings of affinity, speci- ficity, saturation, and competition in protein- ligand binding.
LO 2.3.3 Explain the different methods by which modulators alter protein binding or protein activity.
C H
A P
TER
2
2.1 Molecules and Bonds 29
it pertains to physiology. You can test your knowledge of basic chemistry and biochemistry with a special review quiz at the end of the chapter.
2.1 Molecules and Bonds There are more than 100 known elements on Earth, but only three—oxygen, carbon, and hydrogen—make up more than 90% of the body’s mass. These three plus eight additional elements are considered major essential elements. Some additional minor essential elements (trace elements) are required in minute amounts, but there is no universal agreement on which trace elements are essential for cell function in humans. A periodic table showing the major and commonly accepted minor essential elements is located inside the back cover of the book.
Most Biomolecules Contain Carbon, Hydrogen, and Oxygen Molecules that contain carbon are known as organic molecules, because it was once thought that they all existed in or were derived from plants and animals. Organic molecules associated with liv- ing organisms are also called biomolecules. There are four major groups of biomolecules: carbohydrates, lipids, proteins, and nucleotides.
The body uses carbohydrates, lipids, and proteins for energy and as the building blocks of cellular components. The fourth group, the nucleotides, includes DNA, RNA, ATP, and cyclic AMP. DNA and RNA are the structural components of genetic material. ATP (adenosine triphosphate) and related molecules carry energy, while cyclic AMP (adenosine monophosphate; cAMP) and related compounds regulate metabolism.
Each group of biomolecules has a characteristic composition and molecular structure. Lipids are mostly carbon and hydrogen (FIG. 2.1). Carbohydrates are primarily carbon, hydrogen, and oxygen, in the ratio CH2O (FIG. 2.2). Proteins and nucleotides contain nitrogen in addition to carbon, hydrogen, and oxygen (FIGS. 2.3 and 2.4). Two amino acids, the building blocks of proteins, also contain sulfur.
Not all biomolecules are pure protein, pure carbohydrate, or pure lipid, however. Conjugated proteins are protein molecules combined with another kind of biomolecule. For example, proteins combine with lipids to form lipoproteins. Lipoproteins are found in cell membranes and in the blood, where they act as carriers for less soluble molecules, such as cholesterol.
Glycosylated molecules are molecules to which a carbohydrate has been attached. Proteins combined with carbohydrates form glycoproteins. Lipids bound to carbohydrates become glycolipids. Glycoproteins and glycolipids, like lipoproteins, are important components of cell membranes (see Chapter 3).
Many biomolecules are polymers, large molecules made up of repeating units {poly-, many + -mer, a part}. For example, glycogen and starch are both glucose polymers. They differ in the way the glucose molecules attach to each other, as you can see at the bottom of Figure 2.2.
N early 100 years ago two scientists, Aleksander Oparin in Russia and John Haldane in England, speculated on how life might have arisen on a primitive Earth whose atmo-
sphere consisted mainly of hydrogen, water, ammonia, and methane. Their theories were put to the test in 1953, when a 23-year-old scientist named Stanley Miller combined these molecules in a closed flask and boiled them for a week while periodically discharging flashes of electricity through them, simulating lightning. At the end of his test, Miller found amino acids had formed in the flask. With this simple experiment, he had shown that it was possible to create organic molecules, usu- ally associated with living creatures, from nonliving inorganic precursors.
Miller’s experiments were an early attempt to solve one of the biggest mysteries of biology: How did a collection of chemi- cals first acquire the complex properties that we associate with living creatures? We still do not have an answer to this question. Numerous scientific theories have been proposed, ranging from life arriving by meteor from outer space to molecules forming in deep ocean hydrothermal vents. No matter what their origin, the molecules associated with living organisms have the ability to orga- nize themselves into compartments, replicate themselves, and act as catalysts to speed up reactions that would otherwise proceed too slowly to be useful.
The human body is far removed from the earliest life forms, but we are still a collection of chemicals—dilute solutions of dis- solved and suspended molecules enclosed in compartments with lipid-protein walls. Strong links between atoms, known as chemi- cal bonds, store and transfer energy to support life functions. Weaker interactions between and within molecules create distinc- tive molecular shapes and allow biological molecules to interact reversibly with each other.
This chapter introduces some of the fundamental principles of molecular interactions that you will encounter repeatedly in your study of physiology. The human body is more than 50% water, and because most of its molecules are dissolved in this water, we will review the properties of aqueous solutions. If you would like to refresh your understanding of the key features of atoms, chemical bonds, and biomolecules, you will find a series of one- and two-page review features that encapsulate biochemistry as
RUNNING PROBLEM Chromium Supplements “Lose weight while gaining muscle,” the ads promise. “Prevent heart disease.” “Stabilize blood sugar.” What is this miracle sub- stance? It’s chromium picolinate, a nutritional supplement being marketed to consumers looking for a quick fix. Does it work, though, and is it safe? Some athletes, like Stan—the star run- ning back on the college football team—swear by it. Stan takes 500 micrograms of chromium picolinate daily. Many researchers, however, are skeptical and feel that the necessity for and safety of chromium supplements have not been established.
29 39 40 41 46 48 53
M02_SILV5197_08_SE_C02.indd 29 12/1/17 3:06 AM
FIG. 2.1 REVIEW Biochemistry of Lipids
Fatty Acids
Fatty acids are long chains of carbon atoms bound to hydrogens, with a carboxyl (–COOH) or “acid” group at one end of the chain.
Saturated fatty acids have no double bonds between carbons, so they are “saturated” with hydrogens. The more saturated a fatty acid is, the more likely it is to be solid at room temperature.
Monounsaturated fatty acids have one double bond between two of the carbons in the chain. For each double bond, the molecule has two fewer hydrogen atoms attached to the carbon chain.
Polyunsaturated fatty acids have two or more double bonds between carbons in the chain.
Palmitic acid, a saturated fatty acid
Oleic acid, a monounsaturated fatty acid
Linolenic acid, a polyunsaturated fatty acid
Formation of Lipids
Glycerol is a simple 3-carbon molecule that makes up the backbone of most lipids.
Glycerol plus one fatty acid produces a monoglyceride.
Glycerol plus two fatty acids produces a diglyceride.
Glycerol plus three fatty acids produces a triglyceride (triacylglycerol). More than 90% of lipids are in the form of triglycerides.
Monoglyceride
Fatty acid
Diglyceride
Triglyceride
+
Phospholipids
Lipid-Related Molecules
In addition to true lipids, this category includes three types of lipid-related molecules.
Eicosanoids {eikosi, twenty} are modified 20-carbon fatty acids with a complete or partial carbon ring at one end and two long carbon chain “tails.”
Steroids are lipid- related molecules whose structure includes four linked carbon rings.
Phospholipids have 2 fatty acids and a phosphate group (–H2PO4). Cholesterol and phospholipids are important components of animal cell membranes.
Eicosanoids, such as thromboxanes, leukotrienes, and prostaglandins, act as regulators of physiological functions.
Prostaglandin E2 (PGE2)
Eicosanoids
Cholesterol is the primary source of steroids in the human body.
Steroids
O
Lipids are biomolecules made mostly of carbon and hydrogen. Most lipids have a backbone of glycerol and 1–3 fatty acids. An important characteristic of lipids is that they are nonpolar and therefore not very soluble in water. Lipids can be divided into two broad categories.
• Fats are solid at room temperature. Most fats are derived from animal sources.
• Oils are liquid at room temperature. Most plant lipids are oils.
O
COOH
OH OH
H H H H O
OH H H H H
H3C
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
H
C C C C C C C C C C C C C C C
H H H H O
OH H H
H3C
H H H
H
H H H
H
H
H
H
H
H
H
H
H
H
H
H
H
C C C C C C C C C C C C C C C C C
H H H H O
OH H H H H HH
H3C
H H H
H
H H H
H
H
H
H
H
H
H
H
H
H
H
H
H
C C C C C C C C C C C C C C C C C
HO CH
CH2OH
CH2OH
Fatty acidGlycerol
Fatty acid
Fatty acid
Fatty acid
Fatty acid
Fatty acid
G L Y C E R O L
G L Y C E R O L
G L Y C E R O L
H
CH3
C C CH2
H3C
H3C
HO
H3C
H3C
H
CH3
CH2 CH2 CH3
HO C O
CH2OH
Cortisol
OH
Fatty acid
Fatty acid
Phosphate group
P
G L Y C E R O L
M02_SILV5197_08_SE_C02.indd 30 12/1/17 3:06 AM
31
FIG. 2.2 REVIEW Biochemistry of Carbohydrates
OOO
O
O
O O
O O
O
O
O O
O
O
O
O O
O O
O
O
O O
O
O
O
O O
O O
O
O
O
O
Glucose (dextrose)
H–C–OH
O
H
H
H
OH
OH
C C
HO
H
HO
H
H
C C
C
CH2OH
OH
O
O HO
OH
HOCH2 HOCH2 HOCH2 HOCH2
HO
O
OH
HO
O
O
OH
OH OH
O
Forms the sugar- phosphate backbone of RNA
Forms the sugar- phosphate backbone of DNA
Glucose* Fructose+ Glucose Glucose+ Galactose Glucose+
Sucrose (table sugar) Maltose Lactose
OH
HOCH2 HO
OH
OH
O
O
OH
OH
O
Animals Plants Yeasts and bacteria
Chitin** in invertebrate
animals
Glycogen
Glucose molecules
Starch Dextran
Digestion of starch or glycogen yields
maltose.
HOCH2
OH OH
HO
OH
OH
OH CH2OH
OH
O
HO
Fructose Galactose
OHOCH2
HOCH2 OH
OH OH
O
Ribose
HOCH2
C5H10O5 C5H10O4
OH
OH
O
Deoxyribose
HOCH2 OH
Notice that the only difference between glucose and galactose is the spatial arrangement of the hydroxyl (–OH) groups.
Cellulose** Humans cannot digest cellulose and obtain its energy, even
though it is the most abundant polysaccharide
on earth.
Monosaccharides
Disaccharides
Polysaccharides
**Chitin and cellulose are structural polysaccharides.
Monosaccharides are simple sugars. The most common monosaccharides are the building blocks of complex carbohydrates and have either five carbons, like ribose, or six carbons, like glucose.
Disaccharides consist of glucose plus another monosaccharide.
*In shorthand chemical notation, the carbons in the rings and their associated hydrogen atoms are not written out. Compare this notation to the glucose structure in the row above.
Polysaccharides are glucose polymers. All living cells store glucose for energy in the form of a polysaccharide.
Five-Carbon Sugars (Pentoses) Six-Carbon Sugars (Hexoses)
Carbohydrates are the most abundant biomolecule. They get their name from their structure, literally carbon {carbo-} with water {hydro-}. The general formula for a carbohy- drate is (CH2O)n or CnH2nOn, showing that for each carbon there are two hydrogens and one oxygen. Carbohydrates can be divided into three categories: monosaccharides, disaccharides, and complex glucose polymers called polysaccharides.
O
HOCH2 HOCH2 HOCH2 O O
O O O O
HOCH2 HOCH2 HOCH2 HOCH2 HOCH2CH2 OOOO
OOO O
OO
O O O
M02_SILV5197_08_SE_C02.indd 31 12/1/17 3:06 AM
FIG. 2.3 REVIEW Biochemistry of Proteins
Structure of Peptides and ProteinsAmino Acids
NH2
R
C
H The nitrogen (N) in the amino group makes proteins our major dietary source of nitrogen.
H2O
Amino acidAmino acid
In a peptide bond, the amino group of one amino acid joins the carboxyl group of the other, with the loss of water.
The R groups differ in their size, shape, and ability to form hydrogen bonds or ions. Because of the different R groups, each amino acid reacts with other molecules in a unique way.
All amino acids have a carboxyl group (–COOH), an amino group (–NH2), and a hydrogen attached to the same carbon. The fourth bond of the carbon attaches to a variable “R” group.
Primary Structure
Secondary Structure
Tertiary Structure
Quaternary Structure
The 20 protein-forming amino acids assemble into polymers called peptides. The sequence of amino acids in a peptide chain is called the primary structure. Just as the 26 letters of our alphabet combine to create different words, the 20 amino acids can create an almost infinite number of combinations.
Peptides range in length from two to two million amino acids: • Oligopeptide {oligo-, few}: 2–9 amino acids • Polypeptide: 10–100 amino acids • Proteins: >100 amino acids
Sequence of amino acids
a-helix b-strands form sheets
Fibrous proteins Collagen Globular
proteins
Hemoglobin
A few amino acids do not occur in proteins but have important physiological functions.
• Homocysteine: a sulfur-containing amino acid that in excess is associated with heart disease
• g-amino butyric acid (gamma-amino butyric acid) or GABA: a chemical made by nerve cells
• Creatine: a molecule that stores energy when it binds to a phosphate group
Amino Acids in Natural Proteins
Twenty different amino acids commonly occur in natural proteins. The human body can synthesize most of them, but at different stages of life some amino acids must be obtained from diet and are therefore considered essential amino acids. Some physiologically important amino acids are listed below.
Covalent bond angles between amino acids determine secondary structure.
Secondary structure is created primarily by hydrogen bonds between adjacent chains or loops.
Tertiary structure is the protein’s three-dimensional shape.
Tertiary structures can be a mix of secondary structures. Beta-sheets are shown as flat ribbon arrows and alpha helices are shown as ribbon coils.
Multiple subunits combine with noncovalent bonds. Hemoglobin molecules are made from four globular protein subunits.
*The suffix -ate indicates the anion form of the acid.
Amino Acid Three-Letter Abbreviation
Arginine Arg
Aspartic acid (aspartate)* Asp
Cysteine Cys
Glutamic acid (glutamate)* Glu
Glutamine Gln
Glycine Gly
Tryptophan Trp
Tyrosine Tyr
R
D
C
E
Q G
W
Y
One-Letter Symbol
Note:
Proteins are polymers of smaller building-block molecules called amino acids.
C O
R
N H
H C
H
OH
H C
OH
O
R
N C
H
H +
C OH
O C
H
C
O
N
H
C
H
R
N H
H R
C O
OH
32
M02_SILV5197_08_SE_C02.indd 32 12/2/17 12:07 AM
C H
A P
TER
2
2.1 Molecules and Bonds 33
Concept Check
1. List three major essential elements found in the human body. 2. What is the general formula of a carbohydrate? 3. What is the chemical formula of an amino group? Of a carboxyl
group?
Some combinations of elements, known as functional groups, occur repeatedly in biological molecules. The atoms in a functional group tend to move from molecule to molecule as a single unit. For example, hydroxyl groups, - OH, common in many biological molecules, are added and removed as a group rather than as single hydrogen or oxygen atoms. Amino groups, - NH2, are the signature of amino acids. The phosphate group, - H2PO4, plays a role in many important cell processes, such as energy trans- fer and protein regulation. Addition of a phosphate group is called phosphorylation; removal of a phosphate group is dephosphorylation.
The most common functional groups are listed in TABLE 2.1.
Ions are the basis for electrical signaling in the body. Ions may be single atoms, like the sodium ion Na+ and chloride ion Cl-. Other ions are combinations of atoms, such as the bicarbonate ion HCO3
-. Important ions of the body are listed in TABLE 2.2.
3. High-energy electrons. The electrons in certain atoms can capture energy from their environment and transfer it to other atoms. This allows the energy to be used for synthesis, movement, and other life processes. The released energy may also be emitted as radiation. For example, bioluminescence in fireflies is visible light emitted by high-energy electrons return- ing to their normal low-energy state.
4. Free radicals. Free radicals are unstable molecules with an unpaired electron. They are thought to contribute to aging and to the development of certain diseases, such as some can- cers. Free radicals and high-energy electrons are discussed in Chapter 22.
The role of electrons in molecular bond formation is dis- cussed in the next section. There are four common bond types, two strong and two weak. Covalent and ionic bonds are strong bonds because they require significant amounts of energy to make or break. Hydrogen bonds and van der Waals forces are weaker bonds that require much less energy to break. Interactions between molecules with different bond types are responsible for energy use and transfer in metabolic reactions as well as a variety of other reversible interactions.
Covalent Bonds between Atoms Create Molecules Molecules form when atoms share pairs of electrons, one elec- tron from each atom, to create covalent bonds. These strong bonds require the input of energy to break them apart. It is possible to predict how many covalent bonds an atom can form by knowing how many unpaired electrons are in its outer shell, because an atom is most stable when all of its electrons are paired (FIG. 2.6).
For example, a hydrogen atom has one unpaired electron and one empty electron place in its outer shell. Because hydro- gen has only one electron to share, it always forms one covalent bond, represented by a single line ( - ) between atoms. Oxygen has six electrons in an outer shell that can hold eight. That means oxygen can form two covalent bonds and fill its outer shell with
Electrons Have Four Important Biological Roles An atom of any element has a unique combination of protons and electrons that determines the element’s properties (FIG. 2.5). We are particularly interested in the electrons because they play four important roles in physiology:
1. Covalent bonds. The arrangement of electrons in the outer energy level (shell) of an atom determines an element’s ability to bind with other elements. Electrons shared between atoms form strong covalent bonds that bind atoms together to form molecules.
2. Ions. If an atom or molecule gains or loses one or more electrons, it acquires an electrical charge and becomes an ion.
Notice that oxygen, with two electrons to share, sometimes forms a double bond with another atom.
TABLE 2.1 Common Functional Groups
Shorthand Bond Structure
Amino ¬ NH2 H
H N
Carboxyl (acid) ¬ COOH O
OH C
Hydroxyl ¬ OH O H
Phosphate ¬ H2PO4
OH
OH
O P O
Cations Anions
Na+ Sodium Cl- Chloride
K+ Potassium HCO3 - Bicarbonate
Ca2+ Calcium HPO4 2- Phosphate
H+ Hydrogen SO4 2- Sulfate
Mg2+ Magnesium
TABLE 2.2 Important Ions of the Body
M02_SILV5197_08_SE_C02.indd 33 12/1/17 3:06 AM
FIG. 2.4 REVIEW Nucleotides and Nucleic Acids
C
C
C
C
C
Nucleotide
A nucleotide consists of (1) one or more phosphate groups, (2) a 5-carbon sugar, and (3) a carbon-nitrogen ring structure called a nitrogenous base.
CH2OH
OH
OH
OH O
OP
O N N
N
CH C
C N
HC
NH2
Base
Phosphate
Sugar
consists of
Purines have a double ring structure.
Pyrimidines have a single ring.
Ribose Deoxyribose {de-, without; oxy-, oxygen}
HOCH2 OH
HO
OHOCH2 OH
OHHO
HO HO
O
N CH
CH
H C
N
HC N N
H
N
C CH
C
H C
N
HC
P –O
O
Adenine (A)
Adenine + Ribose
Adenosine
Guanine (G) Cytosine (C) Thymine (T) Uracil (U)
PhosphateFive-Carbon SugarsNitrogenous Bases
ATP + +=
= Adenine Ribose 3 phosphate groups
ADP + +Adenine Ribose 2 phosphate groups =NAD + +Adenine 2 Ribose 2 phosphate groups + Nicotinamide
=FAD + +Adenine Ribose 2 phosphate groups + Riboflavin
=cAMP + +Adenine Ribose 1 phosphate group
Single nucleotide molecules have two critical functions in the human body: (1) Capture and transfer energy in high-energy electrons or phosphate bonds, and (2) aid in cell-to-cell communication.
Energy capture and transfer
Cell-to-cell communication
Nucleotide consists of Base Sugar+ Other Component FunctionPhosphate Groups + +
RNA (ribonucleic acid) is a single–strand nucleic acid with ribose as the sugar in the backbone, and four bases—adenine, guanine, cytosine, and uracil.
Bases on one strand form hydrogen bonds with bases on the adjoining strand. This bonding follows very specific rules: • Because purines are larger than pyrimidines, space limitations always pair a purine with a pyrimidine. • Guanine (G) forms three hydrogen bonds with cytosine (C). • Adenine (A) forms two hydrogen bonds with thymine (T) or uracil (U).
DNA (deoxyribonucleic acid) is a double helix, a three-dimensional structure that forms when two DNA strands link through hydrogen bonds between complementary base pairs. Deoxyribose is the sugar in the backbone, and the four bases are adenine, guanine, cytosine, and thymine.
Antiparallel orienta- tion: The 3' end of one strand is bound to the 5' end of the second strand.
The nitrogenous bases extend to the side of the chain.
Sugar
Phosphate
3' end
5' end The end of the strand with the unbound phosphate is called the 5' end.
The end of the strand that has an unbound sugar is called the 3' (“three prime”) end.
More energy is required to break the triple hydrogen bonds of G C than the double bonds of A T or A U.
U
U
U
U
U
A
A
A
A
G
G
G
G
G
G
C Nitrogenous bases
C
C
C
TA
T A
T A
T A
TA
G
G
G
T A
G
T A
G
G
G
Hydrogen bonds
C
C
Sugar–Phosphate backbones
C
Guanine Adenine Cytosine
Thymine
G
Nucleotides are biomolecules that play an important role in energy and information transfer. Single nucleotides include the energy-transferring compounds ATP (adenosine triphosphate) and ADP (adenosine diphos- phate), as well as cyclic AMP, a molecule important in the transfer of signals between cells. Nucleic acids (or nucleotide polymers) such as RNA and DNA store and transmit genetic information.
Nucleic acids (nucleotide polymers) function in information storage and transmission. The sugar of one nucleotide links to the phosphate of the next, creating a chain of alternat- ing sugar–phosphate groups. The sugar– phosphate chains, or backbone, are the same for every nucleic acid molecule. Nucleotide chains form strands of DNA and RNA.
A
G
T
C
U
PPhosphate
Sugar
A Adenine
T Thymine
G Guanine
U Uracil
Hydrogen bonds
CytosineC
KEY
DNA strand 1
DNA strand 2
end3'
end3'
5' end
5' end
P
P
P
D
P
D
D
D
G
A
C
T
D
P
C
T D
P
DG
P
A D
P
Single Nucleotide Molecules
C
Base-Pairing Guanine-Cytosine Base Pair Adenine-Thymine Base Pair
M02_SILV5197_08_SE_C02.indd 34 12/1/17 3:06 AM
35
C
C
C
C
C
Nucleotide
A nucleotide consists of (1) one or more phosphate groups, (2) a 5-carbon sugar, and (3) a carbon-nitrogen ring structure called a nitrogenous base.
CH2OH
OH
OH
OH O
OP
O N N
N
CH C
C N
HC
NH2
Base
Phosphate
Sugar
consists of
Purines have a double ring structure.
Pyrimidines have a single ring.
Ribose Deoxyribose {de-, without; oxy-, oxygen}
HOCH2 OH
HO
OHOCH2 OH
OHHO
HO HO
O
N CH
CH
H C
N
HC N N
H
N
C CH
C
H C
N
HC
P –O
O
Adenine (A)
Adenine + Ribose
Adenosine
Guanine (G) Cytosine (C) Thymine (T) Uracil (U)
PhosphateFive-Carbon SugarsNitrogenous Bases
ATP + +=
= Adenine Ribose 3 phosphate groups
ADP + +Adenine Ribose 2 phosphate groups =NAD + +Adenine 2 Ribose 2 phosphate groups + Nicotinamide
=FAD + +Adenine Ribose 2 phosphate groups + Riboflavin
=cAMP + +Adenine Ribose 1 phosphate group
Single nucleotide molecules have two critical functions in the human body: (1) Capture and transfer energy in high-energy electrons or phosphate bonds, and (2) aid in cell-to-cell communication.
Energy capture and transfer
Cell-to-cell communication
Nucleotide consists of Base Sugar+ Other Component FunctionPhosphate Groups + +
RNA (ribonucleic acid) is a single–strand nucleic acid with ribose as the sugar in the backbone, and four bases—adenine, guanine, cytosine, and uracil.
Bases on one strand form hydrogen bonds with bases on the adjoining strand. This bonding follows very specific rules: • Because purines are larger than pyrimidines, space limitations always pair a purine with a pyrimidine. • Guanine (G) forms three hydrogen bonds with cytosine (C). • Adenine (A) forms two hydrogen bonds with thymine (T) or uracil (U).
DNA (deoxyribonucleic acid) is a double helix, a three-dimensional structure that forms when two DNA strands link through hydrogen bonds between complementary base pairs. Deoxyribose is the sugar in the backbone, and the four bases are adenine, guanine, cytosine, and thymine.
Antiparallel orienta- tion: The 3' end of one strand is bound to the 5' end of the second strand.
The nitrogenous bases extend to the side of the chain.
Sugar
Phosphate
3' end
5' end The end of the strand with the unbound phosphate is called the 5' end.
The end of the strand that has an unbound sugar is called the 3' (“three prime”) end.
More energy is required to break the triple hydrogen bonds of G C than the double bonds of A T or A U.
U
U
U
U
U
A
A
A
A
G
G
G
G
G
G
C Nitrogenous bases
C
C
C
TA
T A
T A
T A
TA
G
G
G
T A
G
T A
G
G
G
Hydrogen bonds
C
C
Sugar–Phosphate backbones
C
Guanine Adenine Cytosine
Thymine
G
Nucleotides are biomolecules that play an important role in energy and information transfer. Single nucleotides include the energy-transferring compounds ATP (adenosine triphosphate) and ADP (adenosine diphos- phate), as well as cyclic AMP, a molecule important in the transfer of signals between cells. Nucleic acids (or nucleotide polymers) such as RNA and DNA store and transmit genetic information.
Nucleic acids (nucleotide polymers) function in information storage and transmission. The sugar of one nucleotide links to the phosphate of the next, creating a chain of alternat- ing sugar–phosphate groups. The sugar– phosphate chains, or backbone, are the same for every nucleic acid molecule. Nucleotide chains form strands of DNA and RNA.
A
G
T
C
U
PPhosphate
Sugar
A Adenine
T Thymine
G Guanine
U Uracil
Hydrogen bonds
CytosineC
KEY
DNA strand 1
DNA strand 2
end3'
end3'
5' end
5' end
P
P
P
D
P
D
D
D
G
A
C
T
D
P
C
T D
P
DG
P
A D
P
Single Nucleotide Molecules
C
Base-Pairing Guanine-Cytosine Base Pair Adenine-Thymine Base Pair
M02_SILV5197_08_SE_C02.indd 35 12/1/17 3:06 AM
FIG. 2.5 REVIEW Atoms and Molecules
C
C
C
H
+
-
in orbitals around the nucleus
* A periodic table of the elements can be found inside the back cover of the book.
Atoms
Molecules
2 or more atoms share electrons to form
Such as
Water (H2O)
H
O
Protons: determine the element (atomic number)
An atom that gains or loses neutrons becomes an isotope of the same element.
An atom that gains or loses electrons becomes an ion of the same element.
Protons + neutrons in nucleus = atomic mass
Helium, He
Helium (He) has two protons and two neutrons, so its atomic number = 2, and its atomic
mass = 4
Neutrons: determine the isotope
Electrons: • form covalent bonds • create ions when
gained or lost • capture and store
energy • create free radicals
loses an electron
gains a neutron
H+, Hydrogen ion
Hydrogen isotope2H,
Biomolecules
Major Essential Elements
Minor Essential Elements
H, C, O, N, Na, Mg, K, Ca, P, S, Cl
DNA molecule
Oleic acid, a fatty acid
Polysaccharide
Amino acid sequence
Ala Val Ser Lys Arg Trp
Amino acids
Amino acid sequence
a-helix or b-strand
Globular or fibrous shape
Proteins
Carbohydrates
Lipids
Monosaccharides Disaccharides Polysaccharides
Glycogen
Starch
Cellulose
Fatty acids
Glycerol
Monoglycerides Diglycerides Triglycerides
RNA, DNA
ATP, ADP, FAD, NAD
cAMP, cGMP
Phospholipids
Steroids
Eicosanoids
Glycoproteins
Lipoproteins
Glycolipids
Lipid-related molecules
T
T
T
T
T
A
AA
A
A
A
G
G
G
G
G
C
C
-
+
Hydrogen1H,
Li, F, Cr, Mn, Fe, Co, Ni, Cu, Zn, Se, Y, I, Zr, Nb, Mo, Tc, Ru, Rh, La
Isotopes and Ions
Proteins
Carbohydrates
Lipids
Nucleotides
Elements are the simplest type of matter. There are over 100 known elements,* but only three—oxygen, carbon, and hydrogen—make up more than 90% of the body’s mass. These three plus eight additional elements are major essential elements. An additional 19 minor essential elements are required in trace amounts. The smallest particle of any element is an atom {atomos, indivisible}. Atoms link by sharing electrons to form molecules.
+
+
-
-
++
-
-
O
O
CH2
O O
O
O O
O
O O
O
M02_SILV5197_08_SE_C02.indd 36 12/1/17 3:06 AM
37
C
C
C
H
+
-
in orbitals around the nucleus
* A periodic table of the elements can be found inside the back cover of the book.
Atoms
Molecules
2 or more atoms share electrons to form
Such as
Water (H2O)
H
O
Protons: determine the element (atomic number)
An atom that gains or loses neutrons becomes an isotope of the same element.
An atom that gains or loses electrons becomes an ion of the same element.
Protons + neutrons in nucleus = atomic mass
Helium, He
Helium (He) has two protons and two neutrons, so its atomic number = 2, and its atomic
mass = 4
Neutrons: determine the isotope
Electrons: • form covalent bonds • create ions when
gained or lost • capture and store
energy • create free radicals
loses an electron
gains a neutron
H+, Hydrogen ion
Hydrogen isotope2H,
Biomolecules
Major Essential Elements
Minor Essential Elements
H, C, O, N, Na, Mg, K, Ca, P, S, Cl
DNA molecule
Oleic acid, a fatty acid
Polysaccharide
Amino acid sequence
Ala Val Ser Lys Arg Trp
Amino acids
Amino acid sequence
a-helix or b-strand
Globular or fibrous shape
Proteins
Carbohydrates
Lipids
Monosaccharides Disaccharides Polysaccharides
Glycogen
Starch
Cellulose
Fatty acids
Glycerol
Monoglycerides Diglycerides Triglycerides
RNA, DNA
ATP, ADP, FAD, NAD
cAMP, cGMP
Phospholipids
Steroids
Eicosanoids
Glycoproteins
Lipoproteins
Glycolipids
Lipid-related molecules
T
T
T
T
T
A
AA
A
A
A
G
G
G
G
G
C
C
-
+
Hydrogen1H,
Li, F, Cr, Mn, Fe, Co, Ni, Cu, Zn, Se, Y, I, Zr, Nb, Mo, Tc, Ru, Rh, La
Isotopes and Ions
Proteins
Carbohydrates
Lipids
Nucleotides
Elements are the simplest type of matter. There are over 100 known elements,* but only three—oxygen, carbon, and hydrogen—make up more than 90% of the body’s mass. These three plus eight additional elements are major essential elements. An additional 19 minor essential elements are required in trace amounts. The smallest particle of any element is an atom {atomos, indivisible}. Atoms link by sharing electrons to form molecules.
+
+
-
-
++
-
-
O
O
CH2
O O
O
O O
O
O O
O
M02_SILV5197_08_SE_C02.indd 37 12/1/17 3:06 AM
FIG. 2.6 REVIEW Molecular Bonds
Nonpolar molecules have an even distribution of electrons. For example, molecules composed mostly of carbon and hydrogen tend to be nonpolar.
Hydrogen bonds form between a hydrogen atom and a nearby oxygen, nitrogen, or fluorine atom. So, for example, the polar regions of adjacent water molecules allow them to form hydrogen bonds with one another.
Covalent bonds result when atoms share electrons. These bonds require the most energy to make or break.
Polar molecules have regions of partial charge (d+ or d–). The most important example of a polar molecule is water.
Covalent Bonds
(a) Nonpolar Molecules
Noncovalent Bonds
(c) Ionic Bonds
(d) Hydrogen Bonds
(e) Van der Waals Forces
(b) Polar Molecules
Fatty acid Hydrogen
Carbon
Negative pole
Positive pole
Water molecule
H H H2OHHO O
= =
The sodium and chloride ions both have stable outer shells that are filled with electrons. Because of their opposite charges, they are attracted to each other and, in the solid state, the ionic bonds form a sodium chloride (NaCl) crystal.
Sodium gives up its one weakly held electron to chlorine, creating sodium and chloride ions, Na+ and Cl-.
Ionic bonds are electrostatic attractions between ions. A common example is sodium chloride.
Van der Waals forces are weak, nonspecific attractions between atoms.
Sodium atom Chlorine atom Sodium ion (Na+ )
Chloride ion (CI– )
Na CINa CI
+ –
Hydrogen bonding Hydrogen bonding
between water molecules is responsible for the surface tension of water.
Bonds
When two or more atoms link by sharing electrons, they make units known as molecules. The transfer of electrons from one atom to another or the sharing of electrons by two atoms is a critical part of forming bonds, the links between atoms.
d+d+
d– d– O
HH
- - - -
-
- -
- -
-
38
M02_SILV5197_08_SE_C02.indd 38 12/2/17 12:07 AM
C H
A P
TER
2
2.1 Molecules and Bonds 39
electrons. If adjacent atoms share two pairs of electrons rather than just one pair, a double bond, represented by a double line ( “ ), results. If two atoms share three pairs of electrons, they form a triple bond.
Polar and Nonpolar Molecules Some molecules develop regions of partial positive and negative charge when the electron pairs in their covalent bonds are not evenly shared between the linked atoms. When electrons are shared unevenly, the atom(s) with the stronger attraction for electrons develops a slight negative charge (indicated by d +), and the atom(s) with the weaker attraction for electrons develops a slight positive charge (d -). These molecules are called polar molecules because they can be said to have positive and negative ends, or poles. Certain elements, particularly nitrogen and oxygen, have a strong attraction for electrons and are often found in polar molecules.
A good example of a polar molecule is water (H2O). The larger and stronger oxygen atom pulls the hydrogen elec- trons toward itself (Fig. 2.6b). This pull leaves the two hydro- gen atoms of the molecule with a partial positive charge, and the single oxygen atom with a partial negative charge from the unevenly shared electrons. Note that the net charge for the entire water molecule is zero. The polarity of water makes it a good solvent, and all life as we know it is based on watery, or aqueous, solutions.
A nonpolar molecule is one whose shared electrons are distributed so evenly that there are no regions of partial positive or negative charge. For example, molecules composed mostly of carbon and hydrogen, such as the fatty acid shown in Figure 2.6a, tend to be nonpolar. This is because carbon does not attract electrons as strongly as oxygen does. As a result, the carbons and hydrogens share electrons evenly, and the molecule has no regions of partial charge.
Noncovalent Bonds Facilitate Reversible Interactions Ionic bonds, hydrogen bonds, and van der Waals forces are noncovalent bonds. They play important roles in many physiologi- cal processes, including pH, molecular shape, and the reversible binding of molecules to each other.
Ionic Bonds Ions form when one atom has such a strong attraction for electrons that it pulls one or more electrons completely away from another atom. For example, a chlorine atom needs only one electron to fill the last of eight places in its outer shell, so it pulls an electron from a sodium atom, which has only one weakly held electron in its outer shell (Fig. 2.6c). The atom that gains electrons acquires one negative charge ( - 1) for each electron added, so the chlorine atom becomes a chloride ion Cl-. Negatively charged ions are called anions.
An atom that gives up electrons has one positive charge ( + 1) for each electron lost. For example, the sodium atom becomes a sodium ion Na+. Positively charged ions are called cations.
Ionic bonds, also known as electrostatic attractions, result from the attraction between ions with opposite charges. (Remember the basic principle of electricity that says that opposite charges attract and like charges repel.) In a crystal of table salt, the solid form of ionized NaCl, ionic bonds between alternating Na+ and Cl- ions hold the ions in a neatly ordered structure.
Hydrogen Bonds A hydrogen bond is a weak attractive force between a hydrogen atom and a nearby oxygen, nitrogen, or fluo- rine atom. No electrons are gained, lost, or shared in a hydrogen bond. Instead, the oppositely charged regions in polar molecules are attracted to each other. Hydrogen bonds may occur between atoms in neighboring molecules or between atoms in different parts of the same molecule. For example, one water molecule may hydrogen-bond with as many as four other water molecules. As a result, the molecules line up with their neighbors in a somewhat ordered fashion (Fig. 2.6d).
Hydrogen bonding between molecules is responsible for the surface tension of water. Surface tension is the attractive force between water molecules that causes water to form spherical drop- lets when falling or to bead up when spilled onto a nonabsorbent surface (Fig. 2.6d). The high cohesiveness {cohaesus, to cling together} of water is due to hydrogen bonding and makes it difficult to stretch or deform, as you may have noticed in trying to pick up a wet glass that is “stuck” to a slick table top by a thin film of water. The surface tension of water influences lung function (described in Chapter 17).
Van der Waals Forces Van der Waals forces are weak, nonspe- cific attractions between the nucleus of any atom and the electrons of nearby atoms. Two atoms that are weakly attracted to each other by van der Waals forces move closer together until they are so close that their electrons begin to repel one another. Conse- quently, van der Waals forces allow atoms to pack closely together and occupy a minimum amount of space. A single van der Waals attraction between atoms is very weak.
RUNNING PROBLEM What is chromium picolinate? Chromium (Cr) is an essential ele- ment that has been linked to normal glucose metabolism. In the diet, chromium is found in brewer’s yeast, broccoli, mushrooms, and apples. Because chromium in food and in chromium chlo- ride supplements is poorly absorbed from the digestive tract, a scientist developed and patented the compound chromium pico- linate. Picolinate, derived from amino acids, enhances chromium uptake at the intestine. The recommended adequate intake (AI) of chromium for men ages 19–50 is 35 mg/day. (For women, it is 25 mg/day.) As we’ve seen, Stan takes more than 10 times this amount.
Q1: Locate chromium on the periodic table of the elements. What is chromium’s atomic number? Atomic mass? How many electrons does one atom of chromium have? Which elements close to chromium are also essential elements?
29 39 40 48 41 46 53
M02_SILV5197_08_SE_C02.indd 39 12/1/17 3:07 AM
40 CHAPTER 2 Molecular Interactions
Concept Check
4. Are electrons in an atom or molecule most stable when they are paired or unpaired?
5. When an atom of an element gains or loses one or more elec- trons, it is called a(n) of that element.
6. Match each type of bond with its description:
(a) covalent bond 1. weak attractive force between hydro- gen and oxygen or nitrogen
(b) ionic bond 2. formed when two atoms share one or more pairs of electrons
(c) hydrogen bond 3. weak attractive force between atoms
(d) van der Waals force
4. formed when one atom loses one or more electrons to a second atom
2.2 Noncovalent Interactions Many different kinds of noncovalent interactions can take place between and within molecules as a result of the four different types of bonds. For example, the charged, uncharged, or partially charged nature of a molecule determines whether that molecule can dissolve in water. Covalent and noncovalent bonds determine molecular shape and function. Finally, noncovalent interactions allow proteins to associate reversibly with other molecules, creat- ing functional pairings such as enzymes and substrates, or signal receptors and molecules.
Hydrophilic Interactions Create Biological Solutions Life as we know it is established on water-based, or aqueous, solu- tions that resemble dilute seawater in their ionic composition. The adult human body is about 60% water. Na+, K+, and Cl- are the main ions in body fluids, with other ions making up a lesser
proportion. All molecules and cell components are either dissolved or suspended in these solutions. For these reasons, it is useful to understand the properties of solutions, which are reviewed in FIGURE 2.7.
The degree to which a molecule is able to dissolve in a solvent is the molecule’s solubility: the more easily a molecule dissolves, the higher its solubility. Water, the biological solvent, is polar, so molecules that dissolve readily in water are polar or ionic molecules whose positive and negative regions readily interact with water. For example, if NaCl crystals are placed in water, polar regions of the water molecules disrupt the ionic bonds between sodium and chloride, which causes the crystals to dissolve (FIG. 2.8a). Mol- ecules that are soluble in water are said to be hydrophilic {hydro-, water + @philic, loving}.
In contrast, molecules such as oils that do not dissolve well in water are said to be hydrophobic {-phobic, hating}. Hydrophobic substances are usually nonpolar molecules that cannot form hydro- gen bonds with water molecules. The lipids (fats and oils) are the most hydrophobic group of biological molecules.
When placed in an aqueous solution, lipids do not dissolve. Instead they separate into distinct layers. One familiar example is salad oil floating on vinegar in a bottle of salad dressing. Before hydrophobic molecules can dissolve in body fluids, they must combine with a hydrophilic molecule that will carry them into solution.
For example, cholesterol, a common animal fat, is a hydropho- bic molecule. Fat from a piece of meat dropped into a glass of warm water will float to the top, undissolved. In the blood, cholesterol will not dissolve unless it binds to special water-soluble carrier molecules. You may know the combination of cholesterol with its hydrophilic carriers as HDL-cholesterol and LDL-cholesterol, the “good” and “bad” forms of cholesterol associated with heart disease.
Some molecules, such as the phospholipids, have both polar and nonpolar regions (Fig. 2.8b). This dual nature allows them to associate both with each other (hydrophobic interactions) and with polar water molecules (hydrophilic interactions). Phospholipids are the primary component of biological membranes.
Concept Check
7. Which dissolve more easily in water, polar molecules or non- polar molecules?
8. A molecule that dissolves easily is said to be hydro ic. 9. Why does table salt (NaCl) dissolve in water?
Molecular Shape Is Related to Molecular Function A molecule’s shape is closely related to its function. Molecular bonds—both covalent bonds and weak bonds—play a critical role in determining molecular shape. The three-dimensional shape of a molecule is difficult to show on paper, but many molecules have characteristic shapes due to the angles of covalent bonds between the atoms. For example, the two hydrogen atoms of the water molecule shown in Figure 2.6b are attached to the oxygen with
RUNNING PROBLEM One advertising claim for chromium is that it improves the transfer of glucose—the simple sugar that cells use to fuel all their activities—from the bloodstream into cells. In people with diabetes mellitus, cells are unable to take up glucose from the blood efficiently. It seemed logical, therefore, to test whether the addition of chromium to the diet would enhance glucose uptake in people with diabetes. In one Chinese study, diabetic patients receiving 500 micrograms (mg) of chromium picolinate twice a day showed significant improvement in their glucose uptake, but patients receiving 100 micrograms or a placebo did not.
Q2: If people have a chromium deficiency, would you predict that their blood glucose level would be lower or higher than nor- mal? From the results of the Chinese study, can you conclude that all people with diabetes suffer from a chromium deficiency?
29 39 40 41 46 48 53
M02_SILV5197_08_SE_C02.indd 40 12/1/17 3:07 AM
C H
A P
TER
2
2.2 Noncovalent Interactions 41
can change. A change in shape may alter or destroy the molecule’s ability to function.
The concentration of free H+ in body fluids, or acidity, is mea- sured in terms of pH. FIGURE 2.9 reviews the chemistry of pH and shows a pH scale with the pH values of various substances. The normal pH of blood in the human body is 7.40, slightly alkaline. Regulation of the body’s pH within a narrow range is critical because a blood pH more acidic than 7.00 (pH 6 7.00) or more alkaline than 7.70 (pH 7 7.70) is incompatible with life.
Where do hydrogen ions in body fluids come from? Some of them come from the separation of water molecules (H2O) into H
+ and OH- ions. Others come from acids, molecules that release H+ when they dissolve in water (Fig. 2.9). Many of the molecules made during normal metabolism are acids. For example, carbonic acid is made in the body from CO2 (carbon dioxide) and water. In solution, carbonic acid separates into a bicarbonate ion and a hydrogen ion:
CO2 + H2O L H2CO3 (carbonic acid) L H+ + HCO3 -
Note that when the hydrogen is part of the intact carbonic acid molecule, it does not contribute to acidity. Only free H + contrib- utes to the hydrogen ion concentration.
We are constantly adding acid to the body through metabolism, so how does the body maintain a normal pH? One answer is buf- fers. A buffer is any substance that moderates changes in pH. Many buffers contain anions that have a strong attraction for H+ molecules. When free H+ is added to a buffer solution, the buffer’s anions bond to the H+, thereby minimizing any change in pH.
The bicarbonate anion, HCO3 -, is an important buffer in the
human body. The following equation shows how a sodium bicar- bonate solution acts as a buffer when hydrochloric acid (HCl) is added. When placed in plain water, hydrochloric acid separates, or dissociates, into H+ and Cl- and creates a high H+ concentration (low pH). When HCl dissociates in a sodium bicarbonate solution, however, some of the bicarbonate ions combine with some of the H+ to form undissociated carbonic acid. “Tying up” the added H+ in this way keeps the free H+ concentration of the solution from changing significantly and minimizes the pH change.
a bond angle of 104.5°. Double bonds in long carbon chain fatty acids cause the chains to kink or bend, as shown by the three- dimensional model of oleic acid in Figure 2.5.
Weak noncovalent bonds also contribute to molecular shape. The complex double helix of a DNA molecule, shown in Figure 2.4, results both from covalent bonds between adjacent bases in each strand and the hydrogen bonds connecting the two strands of the helix.
Proteins have the most complex and varied shapes of all the biomolecules. Their shapes are determined both by the sequence of amino acids in the protein chain (the primary structure of the protein) plus varied noncovalent interactions as long poly- peptide chains loop and fold back on themselves. The stable secondary structures of proteins are formed by covalent bond angles between amino acids in the polypeptide chain.
The two common protein secondary structures are the A@helix (alpha-helix) spiral and the zigzag shape of B@sheets (Fig. 2.3). Adjacent b@strands in the polypeptide chain associate into sheetlike structures held together by hydrogen bonding, shown as dotted lines (. . .) in Figure 2.3. The sheet configuration is very stable and occurs in many proteins destined for structural uses. Proteins with other functions may have a mix of b@strands and a@helices. Protein secondary structure is illustrated by ribbon dia- grams (or Richardson diagrams), with beta-sheets shown as flat arrows and a@helices as ribbon spirals (Fig. 2.3).
The tertiary structure of a protein is its three-dimensional shape, created through spontaneous folding as the result of covalent bonds and noncovalent interactions. Proteins are categorized into two large groups based on their shape: globular and fibrous (see Fig. 2.3). Globular proteins can be a mix of a@helices, b-sheets, and amino acid chains that fold back on themselves. The result is a complex tertiary structure that may contain pockets, channels, or protruding knobs. The tertiary structure of globular proteins arises partly from the angles of covalent bonds between amino acids and partly from hydrogen bonds, van der Waals forces, and ionic bonds that stabilize the molecule’s shape.
In addition to covalent bonds between adjacent amino acids, covalent disulfide (S - S) bonds play an important role in the shape of many globular proteins (Fig. 2.8c). The amino acid cysteine contains sulfur as part of a sulfhydryl group ( - SH). Two cysteines in different parts of the polypeptide chain can bond to each other with a disulfide bond that pulls the sections of chain together.
Fibrous proteins can be b@strands or long chains of a@helices. Fibrous proteins are usually insoluble in water and form important structural components of cells and tissues. Examples of fibrous proteins include collagen, found in many types of connective tissue, such as skin, and keratin, found in hair and nails.
Hydrogen Ions in Solution Can Alter Molecular Shape Hydrogen bonding is an important part of molecular shape. How- ever, free hydrogen ions, H+, in solution can also participate in hydrogen bonding and van der Waals forces. If free H+ disrupts a molecule’s noncovalent bonds, the molecule’s shape, or conformation,
RUNNING PROBLEM Chromium is found in several ionic forms. The chromium usually found in biological systems and in dietary supplements is the cat- ion Cr3+. This ion is called trivalent because it has a net charge of + 3. The hexavalent cation, Cr6+, with a charge of + 6, is used in industry, such as in the manufacturing of stainless steel and the chrome plating of metal parts.
Q3: How many electrons have been lost from the hexavalent ion of chromium? From the trivalent ion?
29 39 40 41 46 48 53
H+ + Cl- + HCO3 - + Na+ L H2CO3 + Cl- + Na+ Hydrochloric
acid +
Sodium bicarbonate
L Carbonic acid
+ Sodium chloride
(table salt)
M02_SILV5197_08_SE_C02.indd 41 12/1/17 3:07 AM
FIG. 2.7 REVIEW Solutions
5. Which solution is more concentrated: a 100 mM solution of glucose or a 0.1 M solution of glucose? 6. When making a 5% solution of glucose, why don’t you measure out 5 grams of glucose and add it to 100 mL
of water?
1. What are the two components of a solution? 2. The concentration of a solution is expressed as:
(a) amount of solvent/volume of solute
(b) amount of solute/volume of solvent
(c) amount of solvent/volume of solution
(d) amount of solute/volume of solution
3. Calculate the molecular mass of water, H2O. 4. How much does a mole of KCl weigh?
Life as we know it is established on water-based, or aqueous, solutions that resemble dilute seawater in their ionic composition. The human body is 60% water. Sodium, potassium, and chloride are the main ions in body fluids. All molecules and cell compo- nents are either dissolved or suspended in these saline solutions. For these reasons, the properties of solutions play a key role in the functioning of the human body.
AnswerWhat is the molarity of a 5% dextrose solution?
• Molarity is the number of moles of solute in a liter of solution, and is abbreviated as either mol/L or M. A one molar solution of glucose (1 mol/L, 1 M) contains 6.02 × 1023 molecules of glucose per liter of solution. It is made by dissolving one mole (180 grams) of glucose in enough water to make one liter of solution. Typical biological solutions are so dilute that solute concentrations are usually expressed as millimoles per liter (mmol/L or mM).
5 g glucose/100 mL = 50 g glucose/1000 mL ( or 1 L)
1 mole glucose = 180 g glucose
50 g/L × 1 mole/180 g = 0.278 moles/L or 278 mM
AnswerSolutions used for intravenous (IV) infusions are often expressed as percent solutions. How would you make 500 mL of a 5% dextrose (glucose) solution?
• Percent solutions. In a laboratory or pharmacy, scientists cannot measure out solutes by the mole. Instead, they use the more conventional measurement of weight. The solute concentration may then be expressed as a percentage of the total solution, or percent solution. A 10% solution means 10 parts of a solute per 100 parts of total solution. Weight/volume solutions, used for solutes that are solids, are usually expressed as g/100 mL solution or mg/dL. An out-of-date way of expressing mg/dL is mg% where % means per 100 parts or 100 mL. A concentration of 20 mg/dL could also be expressed as 20 mg%.
5% solution = 5 g glucose dissolved in water to make a final volume of 100 mL solution.
5 g glucose/100 mL = ? g/500 mL
25 g glucose with water added to give a final volume of 500 mL
Molecular mass = SUM ×atomic mass of each element the number of atoms
of each element
Answer
Element
Carbon 12.0 amu × 6 = 726
Oxygen 16.0 amu × 6 = 96
Molecular mass of glucose = 180 amu (or Da)
6 Hydrogen 1.0 amu × 12 = 1212
# of Atoms Atomic Mass of Element
What is the molecular mass of glucose, C6H12O6?
Useful Conversions
Concentration = solute amount/volume of solution
Terminology
Expressions of Solute Amount
• Mass (weight) of the solute before it dissolves. Usually given in grams (g) or milligrams (mg).
• Molecular mass is calculated from the chemical formula of a molecule. This is the mass of one molecule, expressed in atomic mass units (amu) or, more often, in daltons (Da), where 1 amu = 1 Da.
• Moles (mol) are an expression of the number of solute molecules, without regard for their weight. One mole = 6.02 × 1023 atoms, ions, or molecules of a substance. One mole of a substance has the same number of particles as one mole of any other substance, just as a dozen eggs has the same number of items as a dozen roses.
• Gram molecular weight. In the laboratory, we use the molecular mass of a substance to measure out moles. For example, one mole of glucose (with 6.02 × 1023 glucose molecules) has a molecular mass of 180 Da and weighs 180 grams. The molecular mass of a substance expressed in grams is called the gram molecular weight.
• Equivalents (Eq) are a unit used for ions, where 1 equivalent = molarity of the ion × the number of charges the ion carries. The sodium ion, with its charge of +1, has one equivalent per mole. The hydrogen phosphate ion (HPO42–) has two equivalents per mole. Concentrations of ions in the blood are often reported in milliequivalents per liter (mEq/L).
Volume is usually expressed as liters (L) or milliliters (mL) {milli-, 1/1000}. A volume convention common in medicine is the deciliter (dL), which is 1/10 of a liter, or 100 mL.
Expressions of Volume
Prefixes
deci- (d) 1/10 1 × 10-1
milli- (m) 1/1000 1 × 10-3
micro- (µ) 1/1,000,000 1 × 10-6
nano- (n) 1/1,000,000,000 1 × 10-9
pico- (p) 1/1,000,000,000,000 1 × 10-12
Expressions of Concentration
• 1 liter of water weighs 1 kilogram (kg) {kilo-, 1000}
• 1 kilogram = 2.2 pounds
A solvent is the liquid into which solutes dissolve. In biological solutions, water is the universal solvent.
A solution is the combination of solutes dissolved in a solvent. The concentration of a solution is the amount of solute per unit volume of solution.
A solute is any substance that dissolves in a liquid. The degree to which a molecule is able to dissolve in a solvent is the molecule’s solubility. The more easily a solute dissolves, the higher its solubility.
Example
Example
Example
FIGURE QUESTIONS
FIGURE QUESTIONS
M02_SILV5197_08_SE_C02.indd 42 12/1/17 3:07 AM
5. Which solution is more concentrated: a 100 mM solution of glucose or a 0.1 M solution of glucose? 6. When making a 5% solution of glucose, why don’t you measure out 5 grams of glucose and add it to 100 mL
of water?
1. What are the two components of a solution? 2. The concentration of a solution is expressed as:
(a) amount of solvent/volume of solute
(b) amount of solute/volume of solvent
(c) amount of solvent/volume of solution
(d) amount of solute/volume of solution
3. Calculate the molecular mass of water, H2O. 4. How much does a mole of KCl weigh?
Life as we know it is established on water-based, or aqueous, solutions that resemble dilute seawater in their ionic composition. The human body is 60% water. Sodium, potassium, and chloride are the main ions in body fluids. All molecules and cell compo- nents are either dissolved or suspended in these saline solutions. For these reasons, the properties of solutions play a key role in the functioning of the human body.
AnswerWhat is the molarity of a 5% dextrose solution?
• Molarity is the number of moles of solute in a liter of solution, and is abbreviated as either mol/L or M. A one molar solution of glucose (1 mol/L, 1 M) contains 6.02 × 1023 molecules of glucose per liter of solution. It is made by dissolving one mole (180 grams) of glucose in enough water to make one liter of solution. Typical biological solutions are so dilute that solute concentrations are usually expressed as millimoles per liter (mmol/L or mM).
5 g glucose/100 mL = 50 g glucose/1000 mL ( or 1 L)
1 mole glucose = 180 g glucose
50 g/L × 1 mole/180 g = 0.278 moles/L or 278 mM
AnswerSolutions used for intravenous (IV) infusions are often expressed as percent solutions. How would you make 500 mL of a 5% dextrose (glucose) solution?
• Percent solutions. In a laboratory or pharmacy, scientists cannot measure out solutes by the mole. Instead, they use the more conventional measurement of weight. The solute concentration may then be expressed as a percentage of the total solution, or percent solution. A 10% solution means 10 parts of a solute per 100 parts of total solution. Weight/volume solutions, used for solutes that are solids, are usually expressed as g/100 mL solution or mg/dL. An out-of-date way of expressing mg/dL is mg% where % means per 100 parts or 100 mL. A concentration of 20 mg/dL could also be expressed as 20 mg%.
5% solution = 5 g glucose dissolved in water to make a final volume of 100 mL solution.
5 g glucose/100 mL = ? g/500 mL
25 g glucose with water added to give a final volume of 500 mL
Molecular mass = SUM ×atomic mass of each element the number of atoms
of each element
Answer
Element
Carbon 12.0 amu × 6 = 726
Oxygen 16.0 amu × 6 = 96
Molecular mass of glucose = 180 amu (or Da)
6 Hydrogen 1.0 amu × 12 = 1212
# of Atoms Atomic Mass of Element
What is the molecular mass of glucose, C6H12O6?
Useful Conversions
Concentration = solute amount/volume of solution
Terminology
Expressions of Solute Amount
• Mass (weight) of the solute before it dissolves. Usually given in grams (g) or milligrams (mg).
• Molecular mass is calculated from the chemical formula of a molecule. This is the mass of one molecule, expressed in atomic mass units (amu) or, more often, in daltons (Da), where 1 amu = 1 Da.
• Moles (mol) are an expression of the number of solute molecules, without regard for their weight. One mole = 6.02 × 1023 atoms, ions, or molecules of a substance. One mole of a substance has the same number of particles as one mole of any other substance, just as a dozen eggs has the same number of items as a dozen roses.
• Gram molecular weight. In the laboratory, we use the molecular mass of a substance to measure out moles. For example, one mole of glucose (with 6.02 × 1023 glucose molecules) has a molecular mass of 180 Da and weighs 180 grams. The molecular mass of a substance expressed in grams is called the gram molecular weight.
• Equivalents (Eq) are a unit used for ions, where 1 equivalent = molarity of the ion × the number of charges the ion carries. The sodium ion, with its charge of +1, has one equivalent per mole. The hydrogen phosphate ion (HPO42–) has two equivalents per mole. Concentrations of ions in the blood are often reported in milliequivalents per liter (mEq/L).
Volume is usually expressed as liters (L) or milliliters (mL) {milli-, 1/1000}. A volume convention common in medicine is the deciliter (dL), which is 1/10 of a liter, or 100 mL.
Expressions of Volume
Prefixes
deci- (d) 1/10 1 × 10-1
milli- (m) 1/1000 1 × 10-3
micro- (µ) 1/1,000,000 1 × 10-6
nano- (n) 1/1,000,000,000 1 × 10-9
pico- (p) 1/1,000,000,000,000 1 × 10-12
Expressions of Concentration
• 1 liter of water weighs 1 kilogram (kg) {kilo-, 1000}
• 1 kilogram = 2.2 pounds
A solvent is the liquid into which solutes dissolve. In biological solutions, water is the universal solvent.
A solution is the combination of solutes dissolved in a solvent. The concentration of a solution is the amount of solute per unit volume of solution.
A solute is any substance that dissolves in a liquid. The degree to which a molecule is able to dissolve in a solvent is the molecule’s solubility. The more easily a solute dissolves, the higher its solubility.
Example
Example
Example
FIGURE QUESTIONS
FIGURE QUESTIONS
M02_SILV5197_08_SE_C02.indd 43 12/2/17 12:07 AM
FIG. 2.8 REVIEW Molecular Interactions
+
+
+
+ + – –
––
–
–
–
+ +
(c) Molecular Shape
Covalent bond angles, ionic bonds, hydrogen bonds, and van der Waals forces all interact to create the distinctive shape of a complex biomolecule. This shape plays a critical role in the molecule’s function.
Hydrogen bonds or van der Waals forces
Disulfide bond
Ionic bond
Ionic repulsion
Disulfide bond
(a) Hydrophilic Interactions
Molecules that have polar regions or ionic bonds readily interact with the polar regions of water. This enables them to dissolve easily in water. Molecules that dissolve readily in water are said to be hydrophilic {hydro-, water + philos, loving}.
Water molecules interact with ions or other polar molecules to form hydration shells around the ions. This disrupts the hydrogen bonding between water molecules, thereby lowering the freezing temperature of water (freezing point depression).
Glucose molecule in solutionNaCl in solution
Glucose molecule
Water molecules
Hydration shells
Na+
CI–
(b) Hydrophobic Interactions
Because they have an even distribution of electrons and no positive or negative poles, nonpolar molecules have no regions of partial charge, and therefore tend to repel water molecules. Molecules like these do not dissolve readily in water and are said to be hydrophobic {hydro-, water + phobos, fear}. Molecules such as phospholipids have both polar and nonpolar regions that play critical roles in biological systems and in the formation of biological membranes.
Phospholipids arrange themselves so that the polar heads are in contact with water and the nonpolar tails are directed away from water.
This characteristic allows the phospholipid molecules to form bilayers, the basis for biological membranes that separate compartments.
Phospholipid molecules have polar heads and nonpolar tails.
Nonpolar fatty acid
tail (hydrophobic)
Polar head (hydrophilic)
Stylized modelMolecular models
Hydrophobic tails
Hydrophilic head
Hydrophilic head
KEY
Water
Water
CH2 CH2
NH
NH
C
C
C
CO
O
SS HH
S S
S S
S S
M02_SILV5197_08_SE_C02.indd 44 12/1/17 3:07 AM
45
Acids and Bases
An acid is a molecule that contributes H+ to a solution.
• The carboxyl group, –COOH, is an acid because in solution it tends to lose its H+:
• Molecules that produce hydroxide ions, OH–, in solution are bases because the hydroxide combines with H+ to form water:
A base is a molecule that decreases the H+ concentration of a solution by combining with free H+.
• Another molecule that acts as a base is ammonia, NH3. It reacts with a free H+ to form an ammonium ion:
The concentration of H+ in body fluids is measured in terms of pH.
The pH of a solution is measured on a numeric scale between 0 and 14. The pH scale is logarithmic, meaning that a change in pH value of 1 unit indicates a 10-fold change in [H+]. For example, if a solution changes from pH 8 to pH 6, there has been a 100-fold (102 or 10 × 10) increase in [H+].
The normal pH of blood in the human body is 7.40. Homeostatic regulation is critical because blood pH less than 7.00 or greater than
7.70 is incompatible with life.
• The expression pH stands for “power of hydrogen.”
This equation is read as “pH is equal to the negative log of the hydrogen ion concentration.” Square brackets are shorthand notation for “concentration” and by convention, concentration is expressed in mEq/L.
• Using the rule of logarithms that says –log x = log (1/x), pH equation (1) can be rewritten as:
This equation shows that pH is inversely related to H+ concentration. In other words, as the H+ concentration goes up, the pH goes down.
1. When the body becomes more acidic, does pH increase or decrease?
2. How can urine, stomach acid, and saliva have pH values outside the pH range that is compatible with life and yet be part of the living body?
AnswerWhat is the pH of a solution whose hydrogen ion concentration [H+] is 10–7 meq/L?
pH = –log [H+] pH = –log [10-7]
Using the rule of logs, this can be rewritten as
pH = log (1/10-7)
Using the rule of exponents that says 1/10x = 10-x
pH = log 107
the log of 107 is 7, so the solution has a pH of 7.
Basic or alkaline solutions have an H+ concentration lower than that of pure water
and have a pH value greater than 7.
Pure water has a pH value of 7.0, meaning its H+ concentration
is 1 × 10-7 M.
Extremely acidic
Extremely basic
Acidic solutions have gained H+ from an acid and have a
pH less than 7.
Stomach acid
Lemon juice
Vinegar, cola
Tomatoes, grapes
Urine (4.5–7)
Pancreatic secretions
Baking soda
Soap solutions
Household ammonia
Chemical hair removers
1 M NaOH
Saliva
141312111098 8.57.76 76.5543210
pH = –log [H+]
pH = log (1/[H+])
R–COOH R–COO– + H+ NH3 + H + NH4
+R–OH R+ + OH– OH– H2O + H +
pH
1
2
Example
FIGURE QUESTIONS
FIG. 2.9 REVIEW pH
M02_SILV5197_08_SE_C02.indd 45 12/1/17 3:07 AM
46 CHAPTER 2 Molecular Interactions
Concept Check
10. To be classified as an acid, a molecule must do what when dissolved in water?
11. pH is an expression of the concentration of what in a solution? 12. When pH goes up, acidity goes .
2.3 Protein Interactions Noncovalent molecular interactions occur between many different biomolecules and often involve proteins. For example, biological membranes are formed by the noncovalent associations of phos- pholipids and proteins. Also, glycosylated proteins and glycosylated lipids in cell membranes create a “sugar coat” on cell surfaces, where they assist cell aggregation {aggregare, to join together} and adhesion {adhaerere, to stick}.
Proteins play important roles in so many cell functions that we can consider them the “workhorses” of the body. Most soluble proteins fall into seven broad categories:
1. Enzymes. Some proteins act as enzymes, biological catalysts that speed up chemical reactions. Enzymes play an important role in metabolism (discussed in Chapters 4 and 22).
2. Membrane transporters. Proteins in cell membranes help move substances back and forth between the intracellular and extracellular compartments. These proteins may form chan- nels in the cell membrane, or they may bind to molecules and carry them through the membrane. Membrane transporters are discussed in detail in Chapter 5.
3. Signal molecules. Some proteins and smaller peptides act as hormones and other signal molecules. Different types of signal molecules are described in Chapters 6 and 7.
4. Receptors. Proteins that bind signal molecules and initiate cellular responses are called receptors. Receptors are discussed along with signal molecules in Chapter 6.
5. Binding proteins. These proteins, found mostly in the extracellular fluid, bind and transport molecules throughout the body. Examples you have already encountered include the oxygen-transporting protein hemoglobin and the cholesterol- binding proteins, such as LDL, low-density lipoprotein.
6. Immunoglobulins. These extracellular immune proteins, also called antibodies, help protect the body from foreign invaders and substances. Immune functions are discussed in Chapter 24.
7. Regulatory proteins. Regulatory proteins turn cell processes on and off or up and down. For example, the regulatory proteins known as transcription factors bind to DNA and alter gene expression and protein synthesis. The details of regulatory proteins can be found in cell biology textbooks.
Although soluble proteins are quite diverse, they do share some common features. They all bind to other molecules through
noncovalent interactions. The binding, which takes place at a location on the protein molecule called a binding site, exhibits important properties that will be discussed shortly: specificity, affinity, competition, and saturation. If binding of a molecule to the protein initiates a process, as occurs with enzymes, mem- brane transporters, and receptors, we can describe the activity rate of the process and the factors that modulate, or alter, the rate.
Any molecule or ion that binds to another molecule is called a ligand {ligare, to bind or tie}. Ligands that bind to enzymes and membrane transporters are also called substrates {sub-, below + stratum, a layer}. Protein signal molecules and protein transcription factors are ligands. Immunoglobulins bind ligands, but the immunoglobulin-ligand complex itself then becomes a ligand (for details, see Chapter 24).
Proteins Are Selective about the Molecules They Bind The ability of a protein to bind to a certain ligand or a group of related ligands is called specificity. Some proteins are very specific about the ligands they bind, while others bind to whole groups of molecules. For example, the enzymes known as peptidases bind poly- peptide ligands and break apart peptide bonds, no matter which two amino acids are joined by those bonds. For this reason peptidases are not considered to be very specific in their action. In contrast, amino- peptidases also break peptide bonds but are more specific. They will bind only to one end of a protein chain (the end with an unbound amino group) and can act only on the terminal peptide bond.
Ligand binding requires molecular complementarity. In other words, the ligand and the protein binding site must be complementary, or
RUNNING PROBLEM The hexavalent form of chromium used in industry is known to be toxic to humans. In 1992, officials at California’s Hazard Evalua- tion System and Information Service warned that inhaling chro- mium dust, mist, or fumes placed chrome and stainless steel workers at increased risk for lung cancer. Officials found no risk to the public from normal contact with chrome surfaces or stain- less steel. In 1995 and 2002, a possible link between the biologi- cal trivalent form of chromium (Cr3+) and cancer came from in vitro studies {vitrum, glass—that is, a test tube} in which mam- malian cells were kept alive in tissue culture. In these experi- ments, cells exposed to moderately high levels of chromium picolinate developed potentially cancerous changes.1
Q4: From this information, can you conclude that hexavalent and trivalent chromium are equally toxic?
1 D. M. Stearns et al. Chromium(III) picolinate produces chromosome damage in Chinese hamster ovary cells. FASEB J 9: 1643–1648, 1995.
D. M. Stearns et al. Chromium(III) tris(picolinate) is mutagenic at the hypoxanthine (guanine) phosphoribosyltransferase locus in Chinese hamster ovary cells. Mutat Res Genet Toxicol Environ Mutagen 513: 135–142, 2002.
29 39 40 41 46 48 53
M02_SILV5197_08_SE_C02.indd 46 12/1/17 3:07 AM
C H
A P
TER
2
2.3 Protein Interactions 47
compatible. In protein binding, when the ligand and protein come close to each other, noncovalent interactions between the ligand and the protein’s binding site allow the two molecules to bind. From studies of enzymes and other binding proteins, scientists have discovered that a protein’s binding site and the shape of its ligand do not need to fit one another exactly. When the binding site and the ligand come close to each other, they begin to interact through hydrogen and ionic bonds and van der Waals forces. The protein’s binding site then changes shape (conformation) to fit more closely to the ligand. This induced-fit model of protein-ligand interaction is shown in FIGURE 2.10.
Protein-Binding Reactions Are Reversible The degree to which a protein is attracted to a ligand is called the protein’s affinity for the ligand. If a protein has a high affinity for a given ligand, the protein is more likely to bind to that ligand than to a ligand for which the protein has a lower affinity.
Protein binding to a ligand can be written using the same notation that we use to represent chemical reactions:
P + L L PL
where P is the protein, L is the ligand, and PL is the bound protein-ligand complex. The double arrow indicates that binding is reversible.
Reversible binding reactions go to a state of equilibrium, where the rate of binding (P + L S PL) is exactly equal to the rate of unbinding, or dissociation (P + L d PL). When a reac- tion is at equilibrium, the ratio of the product concentration, or protein-ligand complex [PL], to the reactant concentrations [P][L] is always the same. This ratio is called the equilib- rium constant Keq, and it applies to all reversible chemical reactions:
Keq = [PL]
[P][L]
The square brackets [ ] around the letters indicate concentra- tions of the protein, ligand, and protein-ligand complex.
Binding Reactions Obey the Law of Mass Action Equilibrium is a dynamic state. In the living body, concentrations of protein or ligand change constantly through synthesis, break- down, or movement from one compartment to another. What hap- pens to equilibrium when the concentration of P or L changes? The answer to this question is shown in FIGURE. 2.11, which begins with a reaction at equilibrium (Fig 2.11a).
In Figure 2.11b, the equilibrium is disturbed when more pro- tein or ligand is added to the system. Now the ratio of [PL] to [P][L] differs from the Keq . In response, the rate of the binding
FIG. 2.11 The law of mass action
(a) Reaction at equilibrium
r1
r2
(b) Equilibrium disturbed
(d) Equilibrium is restored when once more.
(c) Reaction rate r1 increases to convert some of the added P or L into product PL.
r1
r1
r2
[P] [L]
[P] [L]
[P] [L]
[PL]
[PL]
[PL]
[PL]
Keq
r1
r2
Keq
Keq [PL]
[P] [L]
[PL] [P] [L]
=
Keq [PL]
[P] [L] =
Keq
Keq
Add more P or L to system
>
r2
Keq
Rate of reaction in forward direction (r1)
Rate of reaction in reverse direction (r2)
The ratio of bound to unbound is always the same at equilibrium.
=
The law of mass action says that when protein binding is at equilibrium, the ratio of the bound and unbound components remains constant.
FIG. 2.10 The induced-fit model of protein-ligand (L) binding
PROTEIN
L1
L2
Binding sites
In this model of protein binding, the binding site shape is not an exact match to the ligands’ (L) shape.
M02_SILV5197_08_SE_C02.indd 47 12/1/17 3:07 AM
48 CHAPTER 2 Molecular Interactions
If one protein binds to several related ligands, a comparison of their Kd values can tell us which ligand is more likely to bind to the protein. The related ligands compete for the binding sites and are said to be competitors. Competition between ligands is a universal property of protein binding.
Competing ligands that mimic each other’s actions are called agonists {agonist, contestant}. Agonists may occur in nature, such as nicotine, the chemical found in tobacco, which mimics the activity of the neurotransmitter acetylcholine by binding to the same recep- tor protein. Agonists can also be synthesized using what scientists learn from the study of protein–ligand binding sites. The ability of agonist molecules to mimic the activity of naturally occurring ligands has led to the development of many drugs.
reaction increases to convert some of the added P or L into the bound protein-ligand complex (Fig. 2.11c). As the ratio approaches its equilibrium value again, the rate of the forward reaction slows down until finally the system reaches the equilibrium ratio once more (Fig. 2.11d). [P], [L], and [PL] have all increased over their initial values, but the equilibrium ratio has been restored.
The situation just described is an example of a reversible reac- tion obeying the law of mass action, a simple relationship that holds for chemical reactions whether in a test tube or in a cell. You may have learned this law in chemistry as Le Châtelier’s principle. In very general terms, the law of mass action says that when a reac- tion is at equilibrium, the ratio of the products to the substrates is always the same. If the ratio is disturbed by adding or removing one of the participants, the reaction equation will shift direction to restore the equilibrium condition. (Note that the law of mass action is not the same as mass balance [see Chapter 1, p. 10].)
One example of this principle at work is the transport of ste- roid hormones in the blood. Steroids are hydrophobic, so more than 99% of hormone in the blood is bound to carrier proteins. The equilibrium ratio [PL]/[P][L] is 99% bound:1% unbound hormone. However, only the unbound or “free” hormone can cross the cell membrane and enter cells. As unbound hormone leaves the blood, the equilibrium ratio is disturbed. The binding proteins then release some of the bound hormone until the 99:1 ratio is again restored. The same principle applies to enzymes and metabolic reactions. Changing the concentration of one partici- pant in a chemical reaction has a chain-reaction effect that alters the concentrations of other participants in the reaction.
Concept Check
13. Consider the carbonic acid reaction, which is reversible:
CO2 + H2O L H2CO3 L H+ + HCO3 - If the carbon dioxide concentration in the body increases, what happens to the concentration of carbonic acid (H2CO3)? What happens to the pH?
Concept Check
14. A researcher is trying to design a drug to bind to a particular cell receptor protein. Candidate molecule A has a Kd of 4.9 for the receptor. Molecule B has a Kd of 0.3. Which molecule has the most potential to be successful as the drug?
The Dissociation Constant Indicates Affinity In protein-binding reactions, the equilibrium constant is a quanti- tative representation of the protein’s binding affinity for the ligand: high affinity for the ligand means a larger Keq . The reciprocal of the equilibrium constant is called the dissociation constant (Kd).
Kd = [P][L]
[PL]
A large Kd indicates low binding affinity of the protein for the ligand, with more P and L remaining in the unbound state. Con- versely, a small Kd means a higher value for [PL] relative to [P] and [L], so a small Kd indicates higher affinity of the protein for the ligand.
Multiple Factors Alter Protein Binding A protein’s affinity for a ligand is not always constant. Chemical and physical factors can alter, or modulate, binding affinity or can even totally eliminate it. Some proteins must be activated before they have a functional binding site. In this section we discuss some
RUNNING PROBLEM Stan has been taking chromium picolinate because he heard that it would increase his strength and muscle mass. Then a friend told him that the Food and Drug Administration (FDA) said there was no evidence to show that chromium would help build muscle. In one study,2 a group of researchers gave high daily doses of chromium picolinate to football players during a two-month train- ing period. By the end of the study, the players who took chro- mium supplements had not increased muscle mass or strength any more than players who did not take the supplement.
Use Google Scholar (http://scholar.google.com) and search for chromium picolinate and muscle. Look for articles on body composition or muscle strength in humans before you answer the next question. (Look beyond the first page of results if necessary.)
Q5: Based on the papers you found, the Hallmark et al. study (which did not support enhanced muscle development from chro- mium supplements), and the studies that suggest that chromium picolinate might cause cancer, do you think that Stan should con- tinue taking chromium picolinate?
2 M. A. Hallmark et al. Effects of chromium and resistive training on muscle strength and body composition. Med Sci Sports Exerc 28(1): 139–144, 1996.
29 39 40 41 46 48 53
M02_SILV5197_08_SE_C02.indd 48 12/1/17 3:07 AM
C H
A P
TER
2
2.3 Protein Interactions 49
Competitive inhibitors are reversible antagonists that compete with the customary ligand for the binding site (Fig. 2.12d). The degree of inhibition depends on the relative concentrations of the competitive inhibitor and the customary ligand, as well as on the protein’s affinities for the two. The binding of competitive inhibitors is reversible: increasing the concentration of the custom- ary ligand can displace the competitive inhibitor and decrease the inhibition.
Irreversible antagonists, on the other hand, bind tightly to the protein and cannot be displaced by competition. Antagonist drugs have proven useful for treating many conditions. For example, tamoxifen, an antagonist to the estrogen receptor, is used in the treatment of hormone-dependent cancers of the breast.
Allosteric and covalent modulators may be either antagonists or activators. Allosteric modulators {allos, other + stereos, solid (as a shape)} bind reversibly to a protein at a regulatory site away from the binding site, and by doing so change the shape of the binding site. Allosteric inhibitors are antagonists that decrease the affinity of the binding site for the ligand and inhibit protein activ- ity (Fig. 2.12e). Allosteric activators increase the probability of pro- tein-ligand binding and enhance protein activity (Fig. 2.12c). For example, the oxygen-binding ability of hemoglobin changes with allosteric modulation by carbon dioxide, H+, and several other factors (see Chapter 18).
Covalent modulators are atoms or functional groups that bind covalently to proteins and alter the proteins’ properties. Like allosteric modulators, covalent modulators may either increase or decrease a protein’s binding ability or its activity. One of the most common covalent modulators is the phosphate group. Many pro- teins in the cell can be activated or inactivated when a phosphate group forms a covalent bond with them, the process known as phosphorylation.
of the processes that have evolved to allow activation, modulation, and inactivation of protein binding.
Isoforms Closely related proteins whose function is similar but whose affinity for ligands differs are called isoforms of one another. For example, the oxygen-transporting protein hemoglobin has multiple isoforms. One hemoglobin molecule has a quaternary structure consisting of four subunits (see Fig. 2.3). In the developing fetus, the hemoglobin isoform has two a (alpha) chains and two g (gamma) chains that make up the four subunits. Shortly after birth, fetal hemoglobin molecules are broken down and replaced by adult hemoglobin. The adult hemoglobin isoform retains the two a chain isoforms but has two b (beta) chains in place of the g chains. Both adult and fetal isoforms of hemoglobin bind oxygen, but the fetal isoform has a higher affinity for oxygen. This makes it more efficient at picking up oxygen across the placenta.
Activation Some proteins are inactive when they are synthesized in the cell. Before such a protein can become active, enzymes must chop off one or more portions of the molecule (FIG. 2.12a). Pro- tein hormones (a type of signal molecule) and enzymes are two groups that commonly undergo such proteolytic activation {lysis, to release}. The inactive forms of these proteins are often identified with the prefix pro- {before}: prohormone, proenzyme, proinsulin, for example. Some inactive enzymes have the suffix -ogen added to the name of the active enzyme instead, as in trypsinogen, the inac- tive form of trypsin.
The activation of some proteins requires the presence of a cofactor, which is an ion or small organic functional group. Cofactors must attach to the protein before the binding site will become active and bind to ligand (Fig. 2.12b). Ionic cofactors include Ca2+, Mg2+, and Fe2+. Many enzymes will not function without their cofactors.
Modulation The ability of a protein to bind a ligand and initiate a response can be altered by various factors, including tempera- ture, pH, and molecules that interact with the protein. A factor that influences either protein binding or protein activity is called a modulator. There are two basic mechanisms by which modula- tion takes place. The modulator either (1) changes the protein’s ability to bind the ligand or it (2) changes the protein’s activity or its ability to create a response. TABLE 2.3 summarizes the different types of modulation.
Chemical modulators are molecules that bind covalently or noncovalently to proteins and alter their binding ability or their activity. Chemical modulators may activate or enhance ligand binding, decrease binding ability, or completely inactivate the pro- tein so that it is unable to bind any ligand. Inactivation may be either reversible or irreversible.
Antagonists, also called inhibitors, are chemical modulators that bind to a protein and decrease its activity. Many are simply molecules that bind to the protein and block the binding site with- out causing a response. They are like the guy who slips into the front of the movie ticket line to chat with his girlfriend, the cashier. He has no interest in buying a ticket, but he prevents the people in line behind him from getting their tickets for the movie.
Essential for Binding Activity
Cofactors Required for ligand binding at binding site
Proteolytic activation
Converts inactive to active form by remov- ing part of molecule. Examples: digestive enzymes, protein hormones
Modulators and Factors That Alter Binding or Activity
Competitive inhibitor
Competes directly with ligand by binding reversibly to active site
Irreversible inhibitor
Binds to binding site and cannot be displaced
Allosteric modulator
Binds to protein away from binding site and changes activity; may be inhibitors or activators
Covalent modulator
Binds covalently to protein and changes its activity. Example: phosphate groups
pH and temperature
Alter three-dimensional shape of protein by disrupting hydrogen or S–S bonds; may be irreversible if protein becomes denatured
TABLE 2.3 Factors That Affect Protein Binding
M02_SILV5197_08_SE_C02.indd 49 12/1/17 3:07 AM
FIG. 2.12 ESSENTIALS Protein Activation and Inhibition
Inactive protein Active protein
Peptide fragments
INACTIVE PROTEIN
ACTIVE PROTEIN
COFACTOR L1
L2
Binding site
Without the cofactor attached, the protein is not active.
Cofactor binding activates the protein.
L1
L2
ACTIVE PROTEIN
INACTIVE PROTEIN
Competitive inhibitor
A
Ligand Ligand
Ligand Ligand
Binding site
ACTIVE PROTEIN
Allosteric activator
INACTIVE PROTEIN
Protein without modulator is active.
Modulator binds to protein away from binding site and inactivates
the binding site.
Modulator binds to protein away from binding site.
Protein without modulator is inactive.
INACTIVE PROTEIN
Allosteric inhibitor
Binding site
ACTIVE PROTEIN
A
(a) Proteolytic activation: Protein is inactive until peptide fragments are removed.
(c) Allosteric activator is a modulator that binds to protein away from binding site and turns it on.
(b) Cofactors are required for an active binding site.
(d) A competitive inhibitor blocks ligand binding at the binding site.
(e) Allosteric inhibitor is a modulator that binds to protein away from binding site and inactivates the binding site.
Activation
Inhibition
50
M02_SILV5197_08_SE_C02.indd 50 12/2/17 12:07 AM
C H
A P
TER
2
2.3 Protein Interactions 51
Concept Check
15. Match each chemical to its action(s).
(a) Allosteric modulator 1. Bind away from the binding site
(b) Competitive inhibitor 2. Bind to the binding site
(c) Covalent modulator 3. Inhibit activity only
4. Inhibit or enhance activity
One of the best known chemical modulators is the antibiotic penicillin. Alexander Fleming discovered this compound in 1928, when he noticed that Penicillium mold inhibited bacterial growth in a petri dish. By 1938, researchers had extracted the active ingre- dient penicillin from the mold and used it to treat infections in humans. Yet it was not until 1965 that researchers figured out exactly how the antibiotic works. Penicillin is an antagonist that binds to a key bacterial protein by mimicking the normal ligand. Because penicillin forms unbreakable bonds with the protein, the protein is irreversibly inhibited. Without the protein, the bacterium is unable to make a rigid cell wall. Without a rigid cell wall, the bacterium swells, ruptures, and dies.
Physical Factors Physical conditions such as temperature and pH (acidity) can have dramatic effects on protein structure and func- tion. Small changes in pH or temperature act as modulators to increase or decrease activity (FIG. 2.13a). However, once these fac- tors exceed some critical value, they disrupt the noncovalent bonds holding the protein in its tertiary conformation. The protein loses its shape and, along with that, its activity. When the protein loses its conformation, it is said to be denatured.
If you have ever fried an egg, you have watched this trans- formation happen to the egg white protein albumin as it changes from a slithery clear state to a firm white state. Hydrogen ions in high enough concentration to be called acids have a similar effect on protein structure. During preparation of ceviche, the national dish of Ecuador, raw fish is marinated in lime juice. The acidic lime juice contains hydrogen ions that disrupt hydrogen bonds in the muscle proteins of the fish, causing the proteins to become denatured. As a result, the meat becomes firmer and opaque, just as it would if it were cooked with heat.
In a few cases, activity can be restored if the original tempera- ture or pH returns. The protein then resumes its original shape as if nothing had happened. Usually, however, denaturation produces a permanent loss of activity. There is certainly no way to unfry an egg or uncook a piece of fish. The potentially disastrous influence of temperature and pH on proteins is one reason these variables are so closely regulated by the body.
The Body Regulates the Amount of Protein in Cells The final characteristic of proteins in the human body is that the amount of a given protein varies over time, often in a regu- lated fashion. The body has mechanisms that enable it to monitor whether it needs more or less of certain proteins. Complex signaling
pathways, many of which themselves involve proteins, direct par- ticular cells to make new proteins or to break down (degrade) existing proteins. This programmed production of new proteins (recep- tors, enzymes, and membrane transporters, in particular) is called up-regulation. Conversely, the programmed removal of proteins is called down-regulation. In both instances, the cell is directed to make or remove proteins to alter its response.
The amount of protein present in a cell has a direct influence on the magnitude of the cell’s response. For example, the graph in Figure 2.13b shows the results of an experiment in which the amount of ligand is held constant while the amount of protein is varied. As the graph shows, an increase in the amount of protein present causes an increase in the response.
As an analogy, think of the checkout lines in a supermarket. Imagine that each cashier is an enzyme, the waiting customers are ligand molecules, and people leaving the store with their purchases are products. One hundred customers can be checked out faster when there are 25 lines open than when there are only 10 lines. Likewise, in an enzymatic reaction, the presence of more protein molecules (enzyme) means that more binding sites are available to interact with the ligand molecules. As a result, the ligands are converted to products more rapidly.
Regulating protein concentration is an important strategy that cells use to control their physiological processes. Cells alter the amount of a protein by influencing both its synthesis and its break- down. If protein synthesis exceeds breakdown, protein accumu- lates and the reaction rate increases. If protein breakdown exceeds synthesis, the amount of protein decreases, as does the reaction rate. Even when the amount of protein is constant, there is still a steady turnover of protein molecules.
Reaction Rate Can Reach a Maximum If the concentration of a protein in a cell is constant, then the concentration of the ligand determines the magnitude of the response. Fewer ligands activate fewer proteins, and the response is low. As ligand concentrations increase, so does the magnitude of the response, up to a maximum where all protein binding sites are occupied.
Figure 2.13c shows the results of a typical experiment in which the protein concentration is constant but the concentration of ligand varies. At low ligand concentrations, the response rate is directly proportional to the ligand concentration. Once the con- centration of ligand molecules exceeds a certain level, the protein molecules have no more free binding sites. The proteins are fully occupied, and the rate reaches a maximum value. This condition is known as saturation. Saturation applies to enzymes, membrane transporters, receptors, binding proteins, and immunoglobulins.
An analogy to saturation appeared in the early days of televi- sion on the I Love Lucy show and can be viewed today by searching YouTube. Lucille Ball’s character was working at the conveyor belt of a candy factory, loading chocolates into the little paper cups of a candy box. Initially, the belt moved slowly, and she had no difficulty picking up the candy and putting it into the box. Gradually, the belt brought candy to her more rapidly, and she had to increase
M02_SILV5197_08_SE_C02.indd 51 12/1/17 3:07 AM
FIG. 2.13 ESSENTIALS Factors That Influence Protein Activity
Temperature and pH changes may disrupt protein structure and cause loss of function.
Reaction rate depends on the amount of protein. The more protein present, the faster the rate.
(a) Temperature and pH
(b) Amount of Protein
If the amount of binding protein is held constant, the reaction rate depends on the amount of ligand, up to the saturation point.
(c) Amount of Ligand
This protein becomes denatured around 50 °C.
Active protein in normal tertiary conformation
Denatured protein
20
R at
e o
f p
ro te
in a
ct iv
ity
30
Temperature (°C)
40 50 60
In this experiment, the amount of binding protein was constant. At the maximum rate, the protein is said to be saturated.
R es
p o
n se
r at
e (m
g /s
ec )
Ligand concentration (mg/mL)
Maximum rate at saturation
In this experiment, the ligand amount remains constant.
Protein concentration
R es
p o
n se
r at
e (m
g /s
ec )
25
0
1
2
3
4
75 100 125 150 17550A
0
1
2
3
B C
What is the rate when the ligand concentration is 200 mg/mL?
Is the protein more active at 30°C or at 48°C?
1. What is the rate when the protein concentration is equal to A?
2. When the rate is 2.5 mg/sec, what is the protein concentration?
FIGURE QUESTION
GRAPH QUESTIONGRAPH QUESTIONS
52
M02_SILV5197_08_SE_C02.indd 52 12/2/17 12:07 AM
C H
A P
TER
2
2.3 Protein Interactions 53
her packing speed to keep up. Finally, the belt brought candy to her so fast that she could not pack it all in the boxes because she was working at her maximum rate. That was Lucy’s saturation point. (Her solution was to stuff the candy into her mouth and apron as well as into the box!)
In conclusion, you have now learned about the important and nearly universal properties of soluble proteins: shape-function rela- tionships, ligand binding, saturation, specificity, competition, and activation/inhibition. You will revisit these concepts many times as you work through the organ systems of the body. The body’s
insoluble proteins, which are key structural components of cells and tissues, are covered in Chapter 3.
Concept Check
16. What happens to the rate of an enzymatic reaction as the amount of enzyme present decreases?
17. What happens to the rate of an enzymatic reaction when the enzyme has reached saturation?
RUNNING PROBLEM CONCLUSION Chromium Supplements
In this running problem, you learned that claims of chromium picolinate’s ability to enhance muscle mass have not been supported by evidence from controlled scientific experiments. You also learned that studies suggest that some forms of the biological trivalent form of chromium may be toxic. To learn
more about current research, go to PubMed (www.pubmed .gov) and search for chromium picolinate. Compare what you find there with the results of a similar Google search. Should you believe everything you read on the Web? Now compare your answers with those in the summary table.
Question Facts Integration and Analysis
Q1: Locate chromium on the periodic table of elements.
The periodic table organizes the elements according to atomic number.
N/A
What is chromium’s atomic number? Atomic mass?
Reading from the table, chromium (Cr) has an atomic number of 24 and an aver- age atomic mass of 52.
N/A
How many electrons does one atom of chromium have?
Atomic number of an element = number of protons in one atom. One atom has equal numbers of protons and electrons.
The atomic number of chromium is 24; therefore, one atom of chromium has 24 protons and 24 electrons.
Which elements close to chromium are also essential elements?
Molybdenum, manganese, and iron. N/A
Q2: If people have chromium deficiency, would you predict that their blood glucose level would be lower or higher than normal?
Chromium helps move glucose from blood into cells.
If chromium is absent or lacking, less glucose would leave the blood and blood glucose would be higher than normal.
From the result of the Chinese study, can you conclude that all people with diabetes suffer from chromium deficiency?
Higher doses of chromium supplements lowered elevated blood glucose levels, but lower doses have no effect. This is only one study, and no information is given about similar studies elsewhere.
We have insufficient evidence from the information presented to draw a conclu- sion about the role of chromium deficiency in diabetes.
Q3: How many electrons have been lost from the hexavalent ion of chro- mium? From the trivalent ion?
For each electron lost from an ion, a posi- tively charged proton is left behind in the nucleus of the ion.
The hexavalent ion of chromium, Cr6+, has six unmatched protons and therefore has lost six electrons. The trivalent ion, Cr3+, has lost three electrons.
Q4: From this information, can you con- clude that hexavalent and trivalent chromium are equally toxic?
The hexavalent form is used in industry and, when inhaled, has been linked to an increased risk of lung cancer. Enough studies have shown an association that California’s Hazard Evaluation System and Information Service has issued warn- ings to chromium workers. Evidence to date for toxicity of trivalent chromium in chromium picolinate comes from studies done on isolated cells in tissue culture.
Although the toxicity of Cr6+ is well established, the toxicity of Cr3+ has not been conclusively determined. Studies performed on cells in vitro may not be applicable to humans. Additional studies need to be performed in which animals are given reasonable doses of chromium picolinate for an extended period of time.
– Continued next page
M02_SILV5197_08_SE_C02.indd 53 12/1/17 3:07 AM
54 CHAPTER 2 Molecular Interactions
Question Facts Integration and Analysis
Q5: Based on the study that did not sup- port enhanced muscle development from chromium supplements and the studies that suggest that chromium picolinate might cause cancer, do you think Stan should continue tak- ing picolinate?
No research evidence supports a role for chromium picolinate in increasing muscle mass or strength in humans. Other research suggests that chromium pico- linate may cause cancerous changes in isolated cells.
The evidence presented suggests that for Stan, there is no benefit from taking chro- mium picolinate, and there may be risks. Using risk–benefit analysis, the evidence supports stopping the supplements. However, the decision is Stan’s personal responsibility. He should keep himself informed of new developments that would change the risk–benefit analysis.
RUNNING PROBLEM CONCLUSION Continued
29 39 40 41 46 48
CHEMISTRY REVIEW QUIZ Use this quiz to see what areas of chemistry and basic biochemistry you might need to review. Answers are on p. A-0. The title above each set of questions refers to a review figure on this topic.
Atoms and Molecules (Fig. 2.5) Match each subatomic particle in the left column with all the phrases in the right column that describe it. A phrase may be used more than once.
1. electron (a) one has atomic mass of 1 amu
2. neutron (b) found in the nucleus
3. proton (c) negatively charged
(d) changing the number of these in an atom creates a new element
(e) adding or losing these makes an atom into an ion
(f ) gain or loss of these makes an isotope of the same element
(g) determine(s) an element’s atomic number
(h) contribute(s) to an element’s atomic mass
4. Isotopes of an element have the same number of __________ and __________, but differ in their number of __________. Unstable isotopes emit energy called __________.
5. Name the element associated with each of these symbols: C, O, N, and H.
6. Write the one- or two-letter symbol for each of these elements: phosphorus, potassium, sodium, sulfur, calcium, and chlorine.
7. Use the periodic table of the elements on the inside back cover to answer the following questions:
(a) Which element has 30 protons? (b) How many electrons are in one atom of calcium? (c) Find the atomic number and average atomic mass of iodine.
What is the letter symbol for iodine?
8. A magnesium ion, Mg2+, has (gained/lost) two (protons/neutrons/ electrons).
9. H+ is also called a proton. Why is it given that name?
10. Use the periodic table of the elements on the inside back cover to answer the following questions about an atom of sodium.
(a) How many electrons does the atom have? (b) What is the electrical charge of the atom? (c) How many neutrons does the average atom have? (d) If this atom loses one electron, it would be called a(n)
anion/cation. (e) What would be the electrical charge of the substance formed
in (d)? (f) Write the chemical symbol for the ion referred to in (d). (g) What does the sodium atom become if it loses a proton from its
nucleus? (h) Write the chemical symbol for the atom referred to in (g).
11. Write the chemical formulas for each molecule depicted. Calculate the molecular mass of each molecule.
(a) (b)
C
H H H H O
OH H HCH3 NH2
H C C C C C
COOH
CH3
H2N H
OCO
OH
O
OH OHHO
HOCH2
(c) (d)
53
M02_SILV5197_08_SE_C02.indd 54 12/1/17 3:07 AM
C H
A P
TER
2
CHAPTER SUMMARY This chapter introduces the molecular interactions between biomolecules, water, and ions that underlie many of the key themes in physiology. These interactions are an integral part of information flow, energy storage and transfer, and the mechanical properties of cells and tissues in the body.
2.1 Molecules and Bonds 1. The four major groups of biomolecules are carbohydrates, lipids,
proteins, and nucleotides. They all contain carbon, hydrogen, and oxygen. (p. 29; Figs. 2.1, 2.2, 2.3, 2.4)
2. Proteins, lipids, and carbohydrates combine to form glycoproteins, glycolipids, or lipoproteins. (p. 29; Fig. 2.5)
3. Electrons are important for covalent and ionic bonds, energy cap- ture and transfer, and formation of free radicals. (p. 33)
4. Covalent bonds form when adjacent atoms share one or more pairs of electrons. (p. 33; Fig. 2.6)
5. Polar molecules have atoms that share electrons unevenly. When atoms share electrons evenly, the molecule is nonpolar. (p. 39; Fig. 2.6)
6. An atom that gains or loses electrons acquires an electrical charge and is called an ion. (p. 33; Fig. 2.6)
7. Ionic bonds are strong bonds formed when oppositely charged ions are attracted to each other. (p. 39)
8. Weak hydrogen bonds form when hydrogen atoms in polar mol- ecules are attracted to oxygen, nitrogen, or fluorine atoms. Hydro- gen bonding among water molecules is responsible for the surface tension of water. (p. 39; Fig. 2.6)
9. Van der Waals forces are weak bonds that form when atoms are attracted to each other. (p. 39)
2.2 Noncovalent Interactions 10. The universal solvent for biological solutions is water.
(p. 40; Figs. 2.7, 2.8a) 11. The ease with which a molecule dissolves in a solvent is called its
solubility in that solvent. Hydrophilic molecules dissolve easily in water, but hydrophobic molecules do not. (p. 40)
12. Molecular shape is created by covalent bond angles and weak non- covalent interactions within a molecule. (p. 40; Fig. 2.8)
13. Free H+ in solution can disrupt a molecule’s noncovalent bonds and alter its ability to function. (p. 41)
14. The pH of a solution is a measure of its hydrogen ion concentra- tion. The more acidic the solution, the lower its pH. (p. 41; Fig. 2.9)
15. Buffers are solutions that moderate pH changes. (p. 41)
2.3 Protein Interactions 16. Most water-soluble proteins serve as enzymes, membrane trans-
porters, signal molecules, receptors, binding proteins, immuno- globulins, or transcription factors. (p. 46)
17. Ligands bind to proteins at a binding site. According to the induced-fit model of protein binding, the shapes of the ligand and binding site do not have to match exactly. (pp. 46, 47; Fig. 2.10)
18. Proteins are specific about the ligands they will bind. The attrac- tion of a protein to its ligand is called the protein’s affinity for the ligand. The equilibrium constant (Keq) and the dissociation constant (Kd) are quantitative measures of a protein’s affinity for a given ligand. (pp. 47, 48)
Lipids (Fig. 2.1) 12. Match each lipid with its best description.
(a) triglyceride 1. most common form of lipid in the body
(b) eicosanoid 2. liquid at room temperature, usually from plants
(c) steroid 3. important component of cell membrane
(d) oil 4. structure composed of carbon rings
(e) phospholipids 5. modified 20-carbon fatty acid
13. Use the chemical formulas given to decide which of the following fatty acids is most unsaturated: (a) C18H36O2 (b) C18H34O2 (c) C18H30O2
Carbohydrates (Fig. 2.2) 14. Match each carbohydrate with its description.
(a) starch 1. monosaccharide
(b) chitin 2. disaccharide, found in milk
(c) glucose 3. storage form of glucose for animals
(d) lactose 4. storage form of glucose for plants
(e) glycogen 5. structural polysaccharide of invertebrates
Proteins (Fig. 2.3) 15. Match these terms pertaining to proteins and amino acids:
(a) the building blocks of proteins 1. essential amino acids
(b) must be included in our diet 2. primary structure
(c) protein catalysts that speed the rate of chemical reactions
(d) sequence of amino acids in a protein
(e) protein chains folded into a ball- shaped structure
3. amino acids
4. globular proteins
5. enzymes
6. tertiary structure
7. fibrous proteins
16. What aspect of protein structure allows proteins to have more ver- satility than lipids or carbohydrates?
17. Peptide bonds form when the group of one amino acid joins the of another amino acid.
Nucleotides (Fig. 2.4) 18. List the three components of a nucleotide.
19. Compare the structure of DNA with that of RNA.
20. Distinguish between purines and pyrimidines.
Chapter Summary 55
M02_SILV5197_08_SE_C02.indd 55 12/2/17 12:37 AM
56 CHAPTER 2 Molecular Interactions
19. Reversible binding reactions go to equilibrium. If equilibrium is disturbed, the reaction follows the law of mass action and shifts in the direction that restores the equilibrium ratio. (p. 48; Fig. 2.11)
20. Ligands may compete for a protein’s binding site. If competing ligands mimic each other’s activity, they are agonists. (p. 48)
21. Closely related proteins having similar function but different affinities for ligands are called isoforms of one another. (p. 49)
22. Some proteins must be activated, either by proteolytic activation or by addition of cofactors. (p. 49; Fig. 2.12)
23. Competitive inhibitors can be displaced from the binding site, but irreversible antagonists cannot. (p. 49; Fig. 2.12)
24. Allosteric modulators bind to proteins at a location other than the binding site. Covalent modulators bind with covalent bonds. Both types of modulators may activate or inhibit the protein. (p. 49; Fig. 2.12)
25. Extremes of temperature or pH will denature proteins. (p. 51; Fig. 2.13)
26. Cells regulate their proteins by up-regulation or down-regulation of protein synthesis and destruction. The amount of protein directly influences the magnitude of the cell’s response. (p. 51; Fig. 2.13)
27. If the amount of protein (such as an enzyme) is constant, the amount of ligand determines the cell’s response. If all binding proteins (such as enzymes) become saturated with ligand, the response reaches its maximum. (p. 51; Fig. 2.13)
REVIEW QUESTIONS In addition to working through these questions and checking your answers on p. A-2, review the Learning Outcomes at the beginning of this chapter.
Level One Reviewing Facts and Terms 1. List the four kinds of biomolecules. Give an example of each kind
that is relevant to physiology.
2. True or false? All organic molecules are biomolecules.
3. When atoms bind tightly to one another, such as H2O or O2, one unit is called a(n) .
4. An atom of carbon has four unpaired electrons in an outer shell with space for eight electrons. How many covalent bonds will one carbon atom form with other atoms?
5. Fill in the blanks with the correct bond type.
In a(n) bond, electrons are shared between atoms. If the electrons are attracted more strongly to one atom than to the other, the molecule is said to be a(n) molecule. If the electrons are evenly shared, the molecule is said to be a(n) molecule.
6. Name two elements whose presence contributes to a molecule becoming a polar molecule.
7. Based on what you know from experience about the tendency of the following substances to dissolve in water, predict whether they are polar or nonpolar molecules: table sugar, vegetable oil.
8. A negatively charged ion is called a(n) , and a positively charged ion is called a(n) .
9. Define the pH of a solution. If pH is less than 7, the solution is ; if pH is greater than 7, the solution is .
10. A molecule that moderates changes in pH is called a .
11. Proteins combined with fats are called , and proteins com- bined with carbohydrates are called .
12. A molecule that binds to another molecule is called a(n) .
13. Match these definitions with their terms (not all terms are used):
(a) the ability of a protein to bind one molecule but not another
(b) the part of a protein molecule that binds the ligand
(c) the ability of a protein to alter shape as it binds a ligand
1. irreversible inhibition
2. induced fit
3. binding site
4. specificity
5. saturation
14. An ion, such as Ca2+ or Mg2+, that must be present in order for an enzyme to work is called a(n) .
15. A protein whose structure is altered to the point that its activity is destroyed is said to be .
Level Two Reviewing Concepts 16. Mapping exercise: Make the list of terms into a map describing
solutions.
• concentration • nonpolar molecule
• equivalent • polar molecule
• hydrogen bond • solubility
• hydrophilic • solute
• hydrophobic • solvent
• molarity • water
• mole
17. A solution in which [H+ ] = 10-3 M is (acidic/basic), whereas a solution in which [H+ ] = 10-10 M is (acidic/basic). Give the pH for each of these solutions.
18. Name three nucleotides or nucleic acids, and tell why each one is important.
19. You know that two soluble proteins are isoforms of each other. What can you predict about their structures, functions, and affini- ties for ligands?
20. You have been asked to design some drugs for the purposes described next. Choose the desirable characteristic(s) for each drug from the numbered list.
(a) Drug A must bind to an enzyme and enhance its activity.
(b) Drug B should mimic the activity of a normal nervous system signal molecule.
(c) Drug C should block the activity of a membrane receptor protein.
1. antagonist
2. competitive inhibitor
3. agonist
4. allosteric activator
5. covalent modulator
M02_SILV5197_08_SE_C02.indd 56 12/1/17 3:07 AM
C H
A P
TER
2
Review Questions 57
Level Three Problem Solving 21. You have been summoned to assist with the autopsy of an alien
being whose remains have been brought to your lab. The chemical analysis returns with 33% C, 40% O, 4% H, 14% N, and 9% P. From this information, you conclude that the cells contain nucleo- tides, possibly even DNA or RNA. Your assistant is demanding that you tell him how you knew this. What do you tell him?
22. The harder a cell works, the more CO2 it produces. CO2 is carried in the blood according to the following equation:
CO2 + H2O L H+ + HCO3 - What effect does hard work by your muscle cells have on the pH of the blood?
Level Four Quantitative Problems 23. Calculate the amount of NaCl you would weigh out to make one
liter of 0.9% NaCl. Explain how you would make a liter of this solution.
24. A 1.0 M NaCl solution contains 58.5 g of salt per liter. (a) How many molecules of NaCl are present in 1 L of this solution? (b) How many millimoles of NaCl are present? (c) How many equivalents of Na+ are present? (d) Express 58.5 g of NaCl per liter as a percent solution.
25. How would you make 200 mL of a 10% glucose solution? Calcu- late the molarity of this solution. How many millimoles of glucose
are present in 500 mL of this solution? (Hint: What is the molecular mass of glucose?)
26. The graph shown below represents the binding of oxygen molecules (O2) to two different proteins, myoglobin and hemoglobin, over a range of oxygen concentrations. Based on the graph, which protein has the higher affinity for oxygen? Explain your reasoning.
0
0 20 40 60 80
20
40
60
80
100
Oxygen concentration (mm mercury)
% o
f p
ro te
in b
o u n d
t o
O 2
M yo
gl ob
in
H em
og lo
bi n
100
Answers to Concept Checks, Figure and Graph Questions, and end-of-chapter Review Questions can be found in Appendix A [p. A-1].
M02_SILV5197_08_SE_C02.indd 57 12/1/17 3:07 AM
Cells viewed by microscope
3
3.1 Functional Compartments of the Body 59
LO 3.1.1 Name and describe the major body cavities and compartments.
3.2 Biological Membranes 61 LO 3.2.1 Explain the four major functions of the
cell membrane. LO 3.2.2 Draw and label the fluid mosaic model
of the cell membrane and describe the func tions of each component.
LO 3.2.3 Compare a phospholipid bilayer to a micelle and a liposome.
3.3 Intracellular Compartments 64 LO 3.3.1 Map the organization of a typical
animal cell. LO 3.3.2 Draw, name, and list the functions of
organelles found in animal cells. LO 3.3.3 Compare the structures and functions
of the three families of cytoplasmic protein fibers.
LO 3.3.4 Compare and contrast cilia and flagella.
LO 3.3.5 Describe five major functions of the cytoskeleton.
3.5 Tissue Remodeling 84 LO 3.5.1 Explain the differences between
apoptosis and necrosis. LO 3.5.2 Distinguish between pluripotent,
multipotent, and totipotent stem cells.
3.6 Organs 87 LO 3.6.1 List as many organs as you can for
each of the 10 physiological organ systems and describe what you know about the tissue types that comprise each organ.
Compartmentation: Cells and Tissues
LO 3.3.6 Name the three motor proteins and explain their functions.
LO 3.3.7 Describe the organization and function of the nucleus.
LO 3.3.8 Explain how protein synthesis uses compartmentation to separate different steps of the process.
3.4 Tissues of the Body 73 LO 3.4.1 Describe the structure and functions of
extracellular matrix. LO 3.4.2 Describe the role of proteins in the
three major categories of cell junctions. LO 3.4.3 Compare the structures and functions
of the four tissue types. LO 3.4.4 Describe the anatomy and functions of
the five functional categories of epithelia. LO 3.4.5 Compare the anatomy and functions
of the seven main categories of connective tissue.
LO 3.4.6 Use structural and functional differences to distinguish between the three types of muscle tissue.
LO 3.4.7 Describe the structural and functional differences between the two types of neural tissue.
Cells are organisms, and entire animals and plants are aggregates of these organisms. Theodor Schwann, 1839
BACKGROUND BASICS Units of measure: inside back cover 8 Compartmentation 10 Extracellular fluid 40 Hydrophobic molecules 32 Proteins 41 pH 33 Covalent and noncovalent interactions
M03_SILV5197_08_SE_C03.indd 58 12/2/17 12:28 AM
C H
A P
TER
3
3.1 Functional Compartments of the Body 59
W hat makes a compartment? We may think of something totally enclosed, like a room or a box with a lid. But not all compartments are totally enclosed . . . think of the modu-
lar cubicles that make up many modern workplaces. And not all functional compartments have walls . . . think of a giant hotel lobby divided into conversational groupings by careful placement of rugs and furniture. Biological compartments come with the same type of anatomic variability, ranging from totally enclosed structures such as cells to functional compartments without visible walls.
The first living compartment was probably a simple cell whose intracellular fluid was separated from the external environment by a wall made of phospholipids and proteins—the cell membrane. Cells are the basic functional unit of living organisms, and an individual cell can carry out all the processes of life.
As cells evolved, they acquired intracellular compartments separated from the intracellular fluid by membranes. Over time, groups of single-celled organisms began to cooperate and special- ize their functions, eventually giving rise to multicellular organisms. As multicellular organisms evolved to become larger and more complex, their bodies became divided into various functional compartments.
Compartments are both an advantage and a disadvantage for organisms. On the advantage side, compartments separate bio- chemical processes that might otherwise conflict with one another. For example, protein synthesis takes place in one subcellular com- partment while protein degradation is taking place in another. Barriers between compartments, whether inside a cell or inside a body, allow the contents of one compartment to differ from the contents of adjacent compartments. An extreme example is the intracellular compartment called the lysosome, with an internal pH of 5 [Fig. 2.9, p. 45]. This pH is so acidic that if the lysosome ruptures, it severely damages or kills the cell that contains it.
The disadvantage to compartments is that barriers between them can make it difficult to move needed materials from one com- partment to another. Living organisms overcome this problem with specialized mechanisms that transport selected substances across membranes. Membrane transport is the subject of Chapter 5.
In this chapter, we explore the theme of compartmentation by first looking at the various compartments that subdivide the human body, from body cavities to the subcellular compartments called organelles. We then examine how groups of cells with similar func- tions unite to form the tissues and organs of the body. Continuing the theme of molecular interactions, we also look at how different molecules and fibers in cells and tissues give rise to their mechanical properties: their shape, strength, flexibility, and the connections that hold tissues together.
3.1 Functional Compartments of the Body The human body is a complex compartment separated from the outside world by layers of cells. Anatomically, the body is divided into three major body cavities: the cranial cavity (commonly referred to as the skull ), the thoracic cavity (also called the thorax), and the abdominopelvic cavity (FIG. 3.1a). The cavities are separated from one another by bones and tissues, and they are lined with tissue membranes.
The cranial cavity {cranium, skull} contains the brain, our pri- mary control center. The thoracic cavity is bounded by the spine and ribs on top and sides, with the muscular diaphragm forming the floor. The thorax contains the heart, which is enclosed in a membranous pericardial sac {peri-, around + cardium, heart}, and the two lungs, enclosed in separate pleural sacs.
The abdomen and pelvis form one continuous cavity, the abdominopelvic cavity. A tissue lining called the peritoneum lines the abdomen and surrounds the organs within it (stomach, intestines, liver, pancreas, gallbladder, and spleen). The kidneys lie outside the abdominal cavity, between the peritoneum and the muscles and bones of the back, just above waist level. The pelvis contains reproductive organs, the urinary bladder, and the terminal portion of the large intestine.
In addition to the body cavities, there are several discrete fluid- filled anatomical compartments. The blood-filled vessels and heart of the circulatory system form one compartment. Our eyes are hollow fluid-filled spheres subdivided into two compartments, the aqueous and vitreous humors. The brain and spinal cord are sur- rounded by a special fluid compartment known as cerebrospinal fluid (CSF). The membranous sacs that surround the lungs (pleural sacs) and the heart (pericardial sac) also contain small volumes of fluid (Fig. 3.1a).
The Lumens of Some Organs Are Outside the Body All hollow organs, such as heart, lungs, blood vessels, and intes- tines, create another set of compartments within the body. The interior of any hollow organ is called its lumen {lumin, window}. A lumen may be wholly or partially filled with air or fluid. For example, the lumens of blood vessels are filled with the fluid we call blood.
For some organs, the lumen is essentially an extension of the external environment, and material in the lumen is not truly part of the body’s internal environment until it crosses the wall of
RUNNING PROBLEM Pap Tests Save Lives Dr. George Papanicolaou has saved the lives of millions of women by popularizing the Pap test, a cervical cytology screen- ing method that detects early signs of cancer in the uterine cervix. In the past 50 years, deaths from cervical cancer have dropped dramatically in countries that routinely use the Pap test. In contrast, cervical cancer is a leading cause of death in regions where Pap test screening is not routine, such as Africa and Central America. If detected early, cervical cancer is one of the most treatable forms of cancer. Today, Jan Melton, who had an abnormal Pap test a year ago, returns to Dr. Baird, her family physician, for a repeat test. The results will determine whether she needs to undergo further testing for cervical cancer.
59 61 65 79 84 87
M03_SILV5197_08_SE_C03.indd 59 12/1/17 12:07 AM
FIG. 3.1 ESSENTIALS Body Compartments
Pleural sac
Pericardial sac
Diaphragm
Pelvic cavity
Abdominal cavity
Abdominopelvic cavity
POSTERIOR ANTERIOR
Cranial cavity
Thoracic cavity
Cell
Dense connective
tissue
Seen magnified, the pericardial membrane is a layer of flattened cells supported by connective tissue.
The pericardial sac is a tissue that surrounds the heart.
Each cell of the pericardial membrane has a cell membrane surrounding it.
The cell membrane is a phospholipid bilayer.
Pericardial membrane
Heart
7.5 mm
100 mm
Red blood cell:
White blood cell: 15 mm
Smooth muscle cell: 15–200 mm long
Fat cell: 50–150 μm
Ovum:
Blood plasma is the
extracellular fluid inside
blood vessels.
Tissue membranes have many cells.
Phospholipid bilayers create cell membranes.
Cells subdivide into intracellular compartments (see Fig. 3.4).
Interstitial fluid
surrounds most cells.
(a) ANATOMICAL: The Body Cavities
(c) Compartments Are Separated by Membranes
(b) FUNCTIONAL: Body Fluid Compartments
BODY COMPARTMENTS
Extracellular fluid (ECF) lies outside the cells.
Cells (intracellular fluid, ICF)
60
M03_SILV5197_08_SE_C03.indd 60 12/2/17 12:28 AM
C H
A P
TER
3
3.2 Biological Membranes 61
the organ. For example, we think of our digestive tract as being “inside” our body, but in reality its lumen is part of the body’s external environment [see Fig. 1.2, p. 4]. An analogy would be the hole through a bead. The hole passes through the bead but is not actually inside the bead.
An interesting illustration of this distinction between the internal environment and the external environment in a lumen involves the bacterium Escherichia coli. This organism normally lives and reproduces inside the large intestine, an internalized compartment whose lumen is continuous with the external envi- ronment. When E. coli is residing in this location, it does not harm the host. However, if the intestinal wall is punctured by disease or accident and E. coli enters the body’s internal environment, a serious infection can result.
Functionally, the Body Has Three Fluid Compartments In physiology, we are often more interested in functional compart- ments than in anatomical compartments. Most cells of the body are not in direct contact with the outside world. Instead, their external environment is the extracellular fluid [Fig. 1.5, p. 11]. If we think of all the cells of the body together as one unit, we can then divide the body into two main fluid compartments: (1) the extracellular fluid (ECF) outside the cells and (2) the intracellular fluid (ICF) within the cells (Fig. 3.1b). The dividing wall between ECF and ICF is the cell membrane. The extracellular fluid subdivides further into plasma, the fluid portion of the blood, and interstitial fluid {inter-, between + stare, to stand}, which surrounds most cells of the body.
3.2 Biological Membranes The word membrane {membrane, a skin} has two meanings in biol- ogy. Before the invention of microscopes in the sixteenth cen- tury, a membrane always described a tissue that lined a cavity or separated two compartments. Even today, we speak of mucous membranes in the mouth and vagina, the peritoneal membrane that lines the inside of the abdomen, the pleural membrane that covers the surface of the lungs, and the pericardial membrane that surrounds the heart. These visible membranes are tissues: thin, translucent layers of cells.
Once scientists observed cells with a microscope, the nature of the barrier between a cell’s intracellular fluid and its external environment became a matter of great interest. By the 1890s, scientists had concluded that the outer surface of cells, the cell membrane, was a thin layer of lipids that separated the aqueous fluids of the interior and outside environment. We now know that cell membranes consist of microscopic double layers, or bilayers, of phospholipids with protein molecules inserted in them.
In short, the word membrane may apply either to a tissue or to a phospholipid-protein boundary layer (Fig. 3.1c). One source of confusion is that tissue membranes are often depicted in book illustrations as a single line, leading students to think of them as if they were similar in structure to the cell membrane. In this section, you will learn more about the phospholipid membranes that create compartments for cells.
The Cell Membrane Separates Cell from Environment There are two synonyms for the term cell membrane: plasma membrane and plasmalemma. We will use the term cell membrane in this book rather than plasma membrane or plasmalemma to avoid confusion with the term blood plasma. The general functions of the cell membrane include:
1. Physical isolation. The cell membrane is a physical bar- rier that separates intracellular fluid inside the cell from the surrounding extracellular fluid.
2. Regulation of exchange with the environment. The cell membrane controls the entry of ions and nutrients into the cell, the elimination of cellular wastes, and the release of products from the cell.
3. Communication between the cell and its environ- ment. The cell membrane contains proteins that enable the cell to recognize and respond to molecules or to changes in its external environment. Any alteration in the cell membrane may affect the cell’s activities.
4. Structural support. Proteins in the cell membrane hold the cytoskeleton, the cell’s interior structural scaffolding, in place to maintain cell shape. Membrane proteins also create special- ized junctions between adjacent cells or between cells and the extracellular matrix {extra-, outside}, which is extracellular mate- rial that is synthesized and secreted by the cells. (Secretion is the process by which a cell releases a substance into the extra- cellular space.) Cell-cell and cell-matrix junctions stabilize the structure of tissues.
How can the cell membrane carry out such diverse func- tions? Our current model of cell membrane structure provides the answer.
Membranes Are Mostly Lipid and Protein In the early decades of the twentieth century, researchers trying to decipher membrane structure ground up cells and analyzed their composition. They discovered that all biological membranes con- sist of a combination of lipids and proteins plus a small amount
RUNNING PROBLEM Cancer is a condition in which a small group of cells starts to divide uncontrollably and fails to differentiate into specialized cell types. Cancerous cells that originate in one tissue can escape from that tissue and spread to other organs through the circulatory system and the lymph vessels, a process known as metastasis.
Q1: Why does the treatment of cancer focus on killing the cancerous cells?
59 61 65 79 84 87
M03_SILV5197_08_SE_C03.indd 61 12/1/17 12:07 AM
62 CHAPTER 3 Compartmentation: Cells and Tissues
the water molecules while the nonpolar fatty acid tails “hide” by putting the polar heads between themselves and the water. This arrangement can be seen in three structures: the micelle, the liposome, and the phospholipid bilayer of the cell membrane (Fig. 3.2a). Micelles are small droplets with a single layer of phos- pholipids arranged so that the interior of the micelle is filled with hydrophobic fatty acid tails. Micelles are important in the digestion and absorption of fats in the digestive tract.
Liposomes are larger spheres with bilayer phospholipid walls. This arrangement leaves a hollow center with an aqueous core that can be filled with water-soluble molecules. Biologists think that a liposome-like structure was the precursor of the first living cell. Today, liposomes are being used as a medium to deliver drugs and cosmetics.
In medicine, the centers of liposomes are filled with drugs or with fragments of DNA for gene therapy. To make drug deliv- ery more specific, researchers can make immunoliposomes that use antibodies to recognize specific types of cancer cells. By targeting drugs to the cells they are treating, researchers hope to increase the effectiveness of the drugs and decrease unwanted side effects.
Phospholipids are the major lipid of membranes, but some membranes also have significant amounts of sphingolipids. Sphingolipids also have fatty acid tails, but their heads may be either phospholipids or glycolipids. Sphingolipids are slightly longer than phospholipids.
Cholesterol is also a significant part of many cell membranes. Cholesterol molecules, which are mostly hydrophobic, insert them- selves between the hydrophilic heads of phospholipids (Fig. 3.2b). Cholesterol helps make membranes impermeable to small water- soluble molecules and keeps membranes flexible over a wide range of temperatures.
Membrane Proteins May Be Loosely or Tightly Bound to the Membrane According to some estimates, membrane proteins may be nearly one-third of all proteins coded in our DNA. Each cell has between 10 and 50 different types of proteins inserted into its membranes. Membrane proteins can be described in several different ways. Integral proteins are tightly bound to the membrane, and the only way they can be removed is by disrupting the membrane structure with detergents or other harsh methods that destroy the membrane’s integrity. Integral proteins include transmembrane proteins and lipid-anchored proteins.
Peripheral proteins {peripheria, circumference} attach to other membrane proteins by noncovalent interactions [p. 39] and
of carbohydrate. However, a simple and uniform structure did not account for the highly variable properties of membranes found in different types of cells. How could water cross the cell membrane to enter a red blood cell but not be able to enter certain cells of the kidney tubule? The explanation had to lie in the molecular arrangement of the proteins and lipids in the various membranes.
The ratio of protein to lipid varies widely, depending on the source of the membrane (TBL. 3.1). Generally, the more meta- bolically active a membrane is, the more proteins it contains. For example, the inner membrane of a mitochondrion, which contains enzymes for ATP production, is three-quarters protein.
This chemical analysis of membranes was useful, but it did not explain the structural arrangement of lipids and proteins in a membrane. Studies in the 1920s suggested that there was enough lipid in a given area of membrane to create a double layer. The bilayer model was further modified in the 1930s to account for the presence of proteins. With the introduction of electron micros- copy, scientists saw the cell membrane for the first time. The 1960s model of the membrane, as seen in electron micrographs, was a “butter sandwich”—a clear layer of lipids sandwiched between two dark layers of protein.
By the early 1970s, freeze-fracture electron micrographs had revealed the actual three-dimensional arrangement of lipids and proteins within cell membranes. Because of what scientists learned from looking at freeze-fractured membranes, S. J. Singer and G. L. Nicolson in 1972 proposed the fluid mosaic model of the membrane. FIGURE 3.2 highlights the major features of this con- temporary model of membrane structure.
The lipids of biological membranes are mostly phospholipids arranged in a bilayer so that the phosphate heads are on the mem- brane surfaces and the lipid tails are hidden in the center of the membrane (Fig. 3.2b). The cell membrane is studded with protein molecules, like raisins in a slice of bread, and the extracellular surface has glycoproteins and glycolipids. All cell membranes are of relatively uniform thickness, about 8 nm.
Membrane Lipids Create a Hydrophobic Barrier Three main types of lipids make up the cell membrane: phospho- lipids, sphingolipids, and cholesterol. Phospholipids are made of a glycerol backbone with two fatty acid chains extending to one side and a phosphate group extending to the other [p. 30]. The glycerol-phosphate head of the molecule is polar and thus hydro- philic. The fatty acid “tail” is nonpolar and thus hydrophobic.
When placed in an aqueous solution, phospholipids orient themselves so that the polar heads of the molecules interact with
TABLE 3.1 Composition of Selected Membranes
Membrane Protein Lipid Carbohydrate
Red blood cell membrane 49% 43% 8%
Myelin membrane around nerve cells 18% 79% 3%
Inner mitochondrial membrane 76% 24% 0%
M03_SILV5197_08_SE_C03.indd 62 12/1/17 12:07 AM
63
FIG. 3.2 ESSENTIALS The Cell Membrane
Cholesterol ProteinsPhospholipids, Sphingolipids Carbohydrates
GlycoproteinsLipid bilayer Glycolipids
Cell recognition Immune responseStructural stability
Cell Membrane
consists of
can arrange themselves as
together form
functions as
together form together form
whose functions include
Phospholipid bilayer forms a sheet.
Micelles are droplets of phospholipids. They are important in lipid digestion.
Liposomes have an aqueous center.
Nonpolar fatty acid tail (hydrophobic)
Polar head (hydrophilic)
Stylized model
Glycoprotein
Peripheral protein
Transmembrane proteins cross the lipid bilayer.
Cytoskeleton proteins
Lipid-anchored proteins
Cytoplasm
Phospholipid heads face the aqueous intracellular
and extracellular compartments.
Lipid tails form the interior layer of the membrane.
Cholesterol molecules insert themselves into the lipid layer.
Peripheral proteins can be removed without
disrupting the integrity of the membrane.
Selective barrier between cytosol and external environment
NH2
Phosphate
Cytoplasmic loop
Carbohydrate
Intracellular fluid
Extracellular fluid
Cell membrane
COOH
This membrane- spanning protein
crosses the membrane seven times.
Membrane phospholipids form bilayers, micelles, or liposomes. They arrange themselves so that their nonpolar tails are not in contact with aqueous solutions such as extracellular fluid.
(a) Membrane Phospholipids
(b) The Fluid Mosaic Model of Biological Membranes
(c) Concept Map of Cell Membrane Components
M03_SILV5197_08_SE_C03.indd 63 12/1/17 12:07 AM
64 CHAPTER 3 Compartmentation: Cells and Tissues
can be separated from the membrane by chemical methods that do not disrupt the integrity of the membrane. Peripheral proteins include some enzymes as well as structural binding proteins that anchor the cytoskeleton (the cell’s internal “skeleton”) to the mem- brane (Fig. 3.2b).
Transmembrane proteins {trans-, across} are also called membrane-spanning proteins because the protein’s chains extend all the way across the cell membrane (Fig. 3.2b). When a protein crosses the membrane more than once, loops of the amino acid chain protrude into the cytoplasm and the extracel- lular fluid. Carbohydrates may attach to the extracellular loops, and phosphate groups may attach to the intracellular loops. Phosphorylation or dephosphorylation of proteins is one way cells alter protein function [p. 49].
Transmembrane proteins are classified into families according to how many transmembrane segments they have. Many physio- logically important membrane proteins have seven transmembrane segments, as shown in Figure 3.2c. Others cross the membrane only once or up to as many as 12 times.
Membrane-spanning proteins are integral proteins, tightly but not covalently bound to the membrane. The 20–25 amino acids in the protein chain segments that pass through the bilayer are non- polar. This allows those amino acids to create strong noncovalent interactions with the lipid tails of the membrane phospholipids, holding them tightly in place.
Some membrane proteins that were previously thought to be peripheral proteins are now known to be lipid-anchored proteins (Fig. 3.2b). Some of these proteins are covalently bound to lipid tails that insert themselves into the bilayer. Others, found only on the external surface of the cell, are held by a GPI anchor that consists of a membrane lipid plus a sugar-phosphate chain. (GPI stands for glycosylphosphatidylinositol.) Many lipid-anchored proteins are associated with membrane sphingolipids, leading to the formation of specialized patches of membrane called lipid rafts (FIG. 3.3). The longer tails of the sphingolipids elevate the lipid rafts over their phospholipid neighbors.
According to the original fluid mosaic model of the cell membrane, membrane proteins could move laterally from loca- tion to location, directed by protein fibers that run just under the membrane surface. However, researchers have learned that this is not true of all membrane proteins. Some integral proteins are anchored to cytoskeleton proteins (Fig. 3.2b) and are, therefore, immobile. The ability of the cytoskeleton to restrict the move- ment of integral proteins allows cells to develop polarity, in which different faces of the cell have different proteins and therefore dif- ferent properties. This is particularly important in the cells of the transporting epithelia, as you will see in multiple tissues in the body.
Membrane Carbohydrates Attach to Both Lipids and Proteins Most membrane carbohydrates are sugars attached either to membrane proteins (glycoproteins) or to membrane lipids (glyco- lipids). They are found exclusively on the external surface of the cell, where they form a protective layer known as the glycocalyx
{glycol-, sweet + kalyx, husk or pod}. Glycoproteins on the cell sur- face play a key role in the body’s immune response. For example, the ABO blood groups are determined by the number and com- position of sugars attached to membrane sphingolipids.
FIG. 3.3 Lipid rafts are made of sphingolipids
Sphingolipids (orange) are longer than phospholipids and stick up above the phospholipids of the membrane (black). A lipid-anchored enzyme, placental alkaline phosphatase (yellow), is almost always associated with a lipid raft. Image courtesy of D. E. Saslowsky, J. Lawrence, X. Ren, D. A. Brown, R. M. Henderson, and J. M. Edwardson. Placental alkaline phosphatase is efficiently targeted to rafts in supported lipid bilayers. J Biol Chem 277: 26966–26970, 2002.
Concept Check
1. Name three types of lipids found in cell membranes. 2. Describe three types of membrane proteins and how they are
associated with the cell membrane. 3. Why do phospholipids in cell membranes form a bilayer instead
of a single layer? 4. How many phospholipid bilayers will a substance cross passing
into a cell?
Figure 3.2c is a summary map organizing the structure of the cell membrane.
3.3 Intracellular Compartments Much of what we know about cells comes from studies of simple organisms that consist of one cell. But humans are much more com- plex, with trillions of cells in their bodies. It has been estimated that there are more than 200 different types of cells in the human body, each cell type with its own characteristic structure and function.
During development, cells specialize and take on specific shapes and functions. Each cell in the body inherits identical genetic infor- mation in its DNA, but no one cell uses all this information. During
M03_SILV5197_08_SE_C03.indd 64 12/1/17 12:07 AM
C H
A P
TER
3
3.3 Intracellular Compartments 65
other components of the cytoplasm—inclusions, fibers, and organelles—are suspended in the cytosol.
2. Inclusions are particles of insoluble materials. Some are stored nutrients. Others are responsible for specific cell func- tions. These structures are sometimes called the nonmembranous organelles.
3. Insoluble protein fibers form the cell’s internal support sys- tem, or cytoskeleton.
4. Organelles—“little organs”—are membrane-bound com- partments that play specific roles in the overall function of the cell. For example, the organelles called mitochondria (singular, mitochondrion) generate most of the cell’s ATP, and the organ- elles called lysosomes act as the digestive system of the cell. The organelles work in an integrated manner, each organelle taking on one or more of the cell’s functions.
Inclusions Are in Direct Contact with the Cytosol The inclusions of cells do not have boundary membranes and so are in direct contact with the cytosol. Movement of material between inclusions and the cytosol does not require transport across a membrane. Nutrients are stored as glycogen granules and lipid droplets. Most inclusions with functions other than nutrient storage are made from protein or combinations of RNA and protein.
Ribosomes (Fig. 3.4i) are small, dense granules of RNA and protein that manufacture proteins under the direction of the cell’s DNA (see Chapter 4 for details). Fixed ribosomes attach to the cytosolic surface of organelles. Free ribosomes are suspended free in the cytosol. Some free ribosomes form groups of 10 to 20 known as polyribosomes. A ribosome that is fixed one minute may release and become a free ribosome the next. Ribosomes are most numerous in cells that synthesize proteins for export out of the cell.
differentiation, only selected genes become active, transforming the cell into a specialized unit. In most cases, the final shape and size of a cell and its contents reflect its function. Figure 3.1b shows five representative cells in the human body. These mature cells look very different from one another, but they all started out alike in the early embryo, and they retain many features in common.
Cells Are Divided into Compartments We can compare the structural organization of a cell to that of a medieval walled city. The city is separated from the surrounding countryside by a high wall, with entry and exit strictly controlled through gates that can be opened and closed. The city inside the walls is divided into streets and a diverse collection of houses and shops with varied functions. Within the city, a ruler in the castle oversees the everyday comings and goings of the city’s inhabitants. Because the city depends on food and raw material from outside the walls, the ruler negotiates with the farmers in the countryside. Foreign invaders are always a threat, so the city ruler communi- cates and cooperates with the rulers of neighboring cities.
In the cell, the outer boundary is the cell membrane. Like the city wall, it controls the movement of material between the cell interior and the outside by opening and closing “gates” made of protein. The inside of the cell is divided into compartments rather than into shops and houses. Each of these compartments has a specific purpose that contributes to the function of the cell as a whole. In the cell, DNA in the nucleus is the “ruler in the castle,” controlling both the internal workings of the cell and its interaction with other cells. Like the city, the cell depends on supplies from its external environment. It must also communicate and cooper- ate with other cells to keep the body functioning in a coordinated fashion.
FIGURE 3.4a is an overview map of cell structure. The cells of the body are surrounded by the dilute salt solution of the extracellular fluid. The cell membrane separates the inside environment of the cell (the intracellular fluid) from the extracellular fluid.
Internally the cell is divided into the cytoplasm and the nucleus. The cytoplasm consists of a fluid portion, called cytosol; insoluble particles called inclusions; insoluble protein fibers; and membrane- bound structures collectively known as organelles. Figure 3.4 shows a typical cell from the lining of the small intestine. It has most of the structures found in animal cells.
The Cytoplasm Includes Cytosol, Inclusions, Fibers, and Organelles The cytoplasm includes all material inside the cell membrane except for the nucleus. The cytoplasm has four components:
1. Cytosol {cyto-, cell + sol(uble)}, or intracellular fluid: The cytosol is a semi-gelatinous fluid separated from the extracel- lular fluid by the cell membrane. The cytosol contains dis- solved nutrients and proteins, ions, and waste products. The
RUNNING PROBLEM During a Pap test for cervical cancer, tissue is sampled from the cervix (neck) of the uterus with a collection device that resembles a tiny brush. The cells are rinsed off the brush into preservative fluid that is sent to a laboratory. There the sample is processed onto a glass slide that will be examined first by a computer, then by a trained cytologist. The computer and cytologist look for dysplasia {dys-, abnormal + plasia, growth or cell multiplication}, a change in the size and shape of cells that is suggestive of cancerous changes. Cancer cells can usually be recognized by a large nucleus surrounded by a relatively small amount of cytoplasm. Jan’s first Pap test showed all the hallmarks of dysplasia.
Q2: What is happening in cancer cells that explains the large size of their nucleus and the relatively small amount of cytoplasm?
59 61 65 79 84 87
Play BioFlix Animation
@Mastering Anatomy & Physiology
M03_SILV5197_08_SE_C03.indd 65 12/1/17 12:07 AM
FIG. 3.4 REVIEW Cell Structure
(g) Mitochondria
(b) Cytoskeleton
Rough ER
Ribosomes
Outer membrane
Vesicle Cisternae
Intermembrane space
Matrix
Membrane protein
Cristae
Phospholipid
Smooth ER
(h) Golgi Apparatus and Vesicles
(j) Nucleus
Nuclear pores
Nuclear envelope
Nucleolus
(f) Cell Membrane
Centrioles
(d) Lysosomes
Lysosomes are small, spherical storage vesicles that contain powerful digestive enzymes.
(c) Peroxisomes
Peroxisomes contain enzymes that break down fatty acids and some foreign materials.
(e) Centrioles
Centrioles are made from microtubules and direct DNA movement during cell division.
Microvilli increase cell surface area. They are supported by microfilaments.
Microfilaments form a network just inside the cell membrane.
Microtubules are the largest cytoskeleton fiber.
Intermediate filaments include myosin and keratin.
Cytoplasm
Cytosol
Nucleus
Cell membrane
THE CELL
is composed of
Extracellular fluid
• Lipid droplets • Glycogen granules • Ribosomes
Inclusions
• Cytoskeleton • Centrioles • Cilia • Flagella
Protein fibers
• Mitochondria • Endoplasmic reticulum • Golgi apparatus • Lysosomes • Peroxisomes
Fluid portion of cyto- plasm
Membranous organelles
The cell membrane is a phospholipid bilayer studded with proteins that act as structural anchors, transporters, enzymes, or signal receptors. Glycolipids and glycoproteins occur only on the extracellular surface of the membrane. The cell membrane acts as both a gateway and a barrier between the cytoplasm and the extracellular fluid.
Mitchondria are spherical to elliptical organelles with a double wall that creates two separate compartments within the organelle. The inner matrix is surrounded by a membrane that folds into leaflets called cristae. The intermembrane space, which lies between the two membranes, plays an important role in ATP production. Mitochondria are the site of most ATP synthesis in the cell.
The endoplasmic reticulum (ER) is a network of interconnected membrane tubes that are a continuation of the outer nuclear membrane. Rough endoplasmic reticulum has a granular appearance due to rows of ribosomes dotting its cytoplas- mic surface. Smooth endoplasmic reticulum lacks ribosomes and appears as smooth membrane tubes. The rough ER is the main site of protein synthesis. The smooth ER synthesizes lipids and, in some cells, concentrates and stores calcium ions.
The nucleus is surrounded by a double-membrane nuclear envelope. Both membranes of the envelope are pierced here and there by pores to allow communi- cation with the cytoplasm. The outer membrane of the nuclear envelope connects to the endoplasmic reticulum membrane. In cells that are not dividing, the nucleus appears filled with randomly scattered granular material composed of DNA and proteins. Usually a nucleus also contains from one to four larger dark-staining bodies of DNA, RNA, and protein called nucleoli.
The Golgi apparatus consists of a series of hollow curved sacs called cisternae stacked on top of one another and surrounded by vesicles. The Golgi apparatus participates in protein modification and packaging.
(i) Endoplasmic Reticulum (ER) and Ribosomes
(a) This is an overview map of cell structure. The cell membrane separates the inside environment of the cell (the intracellular fluid) from the extracellular fluid. Internally the cell is divided into the cytoplasm and the nucleus. The cytoplasm consists of a fluid portion, called the cytosol; membrane- bound structures called organelles; insoluble particles called inclusions; and protein fibers that create the cytoskeleton.
M03_SILV5197_08_SE_C03.indd 66 12/1/17 12:07 AM
67
(g) Mitochondria
(b) Cytoskeleton
Rough ER
Ribosomes
Outer membrane
Vesicle Cisternae
Intermembrane space
Matrix
Membrane protein
Cristae
Phospholipid
Smooth ER
(h) Golgi Apparatus and Vesicles
(j) Nucleus
Nuclear pores
Nuclear envelope
Nucleolus
(f) Cell Membrane
Centrioles
(d) Lysosomes
Lysosomes are small, spherical storage vesicles that contain powerful digestive enzymes.
(c) Peroxisomes
Peroxisomes contain enzymes that break down fatty acids and some foreign materials.
(e) Centrioles
Centrioles are made from microtubules and direct DNA movement during cell division.
Microvilli increase cell surface area. They are supported by microfilaments.
Microfilaments form a network just inside the cell membrane.
Microtubules are the largest cytoskeleton fiber.
Intermediate filaments include myosin and keratin.
Cytoplasm
Cytosol
Nucleus
Cell membrane
THE CELL
is composed of
Extracellular fluid
• Lipid droplets • Glycogen granules • Ribosomes
Inclusions
• Cytoskeleton • Centrioles • Cilia • Flagella
Protein fibers
• Mitochondria • Endoplasmic reticulum • Golgi apparatus • Lysosomes • Peroxisomes
Fluid portion of cyto- plasm
Membranous organelles
The cell membrane is a phospholipid bilayer studded with proteins that act as structural anchors, transporters, enzymes, or signal receptors. Glycolipids and glycoproteins occur only on the extracellular surface of the membrane. The cell membrane acts as both a gateway and a barrier between the cytoplasm and the extracellular fluid.
Mitchondria are spherical to elliptical organelles with a double wall that creates two separate compartments within the organelle. The inner matrix is surrounded by a membrane that folds into leaflets called cristae. The intermembrane space, which lies between the two membranes, plays an important role in ATP production. Mitochondria are the site of most ATP synthesis in the cell.
The endoplasmic reticulum (ER) is a network of interconnected membrane tubes that are a continuation of the outer nuclear membrane. Rough endoplasmic reticulum has a granular appearance due to rows of ribosomes dotting its cytoplas- mic surface. Smooth endoplasmic reticulum lacks ribosomes and appears as smooth membrane tubes. The rough ER is the main site of protein synthesis. The smooth ER synthesizes lipids and, in some cells, concentrates and stores calcium ions.
The nucleus is surrounded by a double-membrane nuclear envelope. Both membranes of the envelope are pierced here and there by pores to allow communi- cation with the cytoplasm. The outer membrane of the nuclear envelope connects to the endoplasmic reticulum membrane. In cells that are not dividing, the nucleus appears filled with randomly scattered granular material composed of DNA and proteins. Usually a nucleus also contains from one to four larger dark-staining bodies of DNA, RNA, and protein called nucleoli.
The Golgi apparatus consists of a series of hollow curved sacs called cisternae stacked on top of one another and surrounded by vesicles. The Golgi apparatus participates in protein modification and packaging.
(i) Endoplasmic Reticulum (ER) and Ribosomes
(a) This is an overview map of cell structure. The cell membrane separates the inside environment of the cell (the intracellular fluid) from the extracellular fluid. Internally the cell is divided into the cytoplasm and the nucleus. The cytoplasm consists of a fluid portion, called the cytosol; membrane- bound structures called organelles; insoluble particles called inclusions; and protein fibers that create the cytoskeleton.
M03_SILV5197_08_SE_C03.indd 67 12/1/17 12:07 AM
68 CHAPTER 3 Compartmentation: Cells and Tissues
Flagella are found on free-floating single cells, and in humans the only flagellated cell is the male sperm cell. A sperm cell has only one flagellum, in contrast to ciliated cells, which may have one surface almost totally covered with cilia (Fig. 3.5a). The wavelike movements of the flagellum push the sperm through fluid, just as undulating contractions of a snake’s body push it headfirst through its environment. Flagella bend and move by the same basic mechanism as cilia.
The Cytoskeleton Is a Changeable Scaffold The cytoskeleton is a flexible, changeable three-dimensional scaf- folding of actin microfilaments, intermediate filaments, and micro- tubules that extends throughout the cytoplasm. Some cytoskeleton protein fibers are permanent, but most are synthesized or disas- sembled according to the cell’s needs. Because of the cytoskeleton’s changeable nature, its organizational details are complex and we will not discuss the details.
Cytoplasmic Protein Fibers Come in Three Sizes The three families of cytoplasmic protein fibers are classified by diameter and protein composition (TBL. 3.2). All fibers are polymers of smaller proteins. The thinnest are actin fibers, also called micro- filaments. Somewhat larger intermediate filaments may be made of different types of protein, including keratin in hair and skin, and neurofilament in nerve cells. The largest protein fibers are the hollow microtubules, made of a protein called tubulin. A large number of accessory proteins are associated with the cell’s protein fibers.
The insoluble protein fibers of the cell have two general pur- poses: structural support and movement. Structural support comes primarily from the cytoskeleton. Movement of the cell or of ele- ments within the cell takes place with the aid of protein fibers and a group of specialized enzymes called motor proteins. These functions are discussed in more detail in the sections that follow.
Microtubules Form Centrioles, Cilia, and Flagella The largest cytoplasmic protein fibers, the microtubules, create the complex structures of centrioles, cilia, and flagella, which are all involved in some form of cell movement. The cell’s microtubule- organizing center, the centrosome, assembles tubulin molecules into microtubules. The centrosome appears as a region of darkly staining material close to the cell nucleus. In most animal cells, the centrosome contains two centrioles, shown in the typical cell of Figure 3.4e.
Each centriole is a cylindrical bundle of 27 microtubules, arranged in nine triplets. In cell division, the centrioles direct the movement of DNA strands. Cells that have lost their ability to undergo cell division, such as mature nerve cells, lack centrioles.
Cilia are short, hairlike structures projecting from the cell sur- face like the bristles of a brush {singular, cilium, Latin for eyelash}. Most cells have a single short cilium, but cells lining the upper airways and part of the female reproductive tract are covered with cilia. In these tissues, coordinated ciliary movement creates cur- rents that sweep fluids or secretions across the cell surface.
The surface of a cilium is a continuation of the cell mem- brane. The core of motile, or moving, cilia contains nine pairs of microtubules surrounding a central pair (FIG. 3.5b). The microtu- bules terminate just inside the cell at the basal body. These cilia beat rhythmically back and forth when the microtubule pairs in their core slide past each other with the help of the motor protein dynein.
Flagella have the same microtubule arrangement as cilia but are considerably longer {singular, flagellum, Latin for whip}.
TABLE 3.2 Diameter of Protein Fibers in the Cytoplasm
Diameter Type of Protein Functions
Microfilaments 7 nm Actin (globular) Cytoskeleton; associates with myosin for muscle contraction
Intermediate Filaments 10 nm Keratin, neurofilament protein (filaments)
Cytoskeleton, hair and nails, protective barrier of skin
Microtubules 25 nm Tubulin (globular) Movement of cilia, flagella, and chromosomes; intracellular transport of organelles; cytoskeleton
EMERGING CONCEPTS Single Cilia Are Sensors
Cilia in the body are not limited to the airways and the reproductive tract. Scientists have known for years that most cells of the body contain a single, stationary, or nonmotile, cilium, but they thought that these solitary primary cilia were mostly evolutionary remnants and of little significance. Primary cilia differ structurally from motile cilia because they lack the central pair of microtubules found in motile cilia (a 9 + 0 arrangement instead of 9 + 2; see Fig. 3.5). Researchers in recent years have learned that primary cilia actually serve a function. They can act as sensors of the external environment, passing information into the cell. For example, primary cilia in photoreceptors of the eye help with light sensing, and primary cilia in the kidney sense fluid flow. Using molecular techniques, scientists have found that these small, insignificant hairs play critical roles during embryonic development as well. Mutations to ciliary proteins cause disorders (ciliopathies) ranging from polycystic kidney disease and loss of vision to cancer. The role of primary cilia in other disorders, including obesity, is currently a hot topic in research.
M03_SILV5197_08_SE_C03.indd 68 12/1/17 12:07 AM
C H
A P
TER
3
3.3 Intracellular Compartments 69
5. Movement. The cytoskeleton helps cells move. For example, the cytoskeleton helps white blood cells squeeze out of blood vessels and helps growing nerve cells send out long extensions as they elongate. Cilia and flagella on the cell membrane are able to move because of their microtubule cytoskeleton. Special motor proteins facilitate movement and intracellular transport by using energy from ATP to slide or step along cytoskeletal fibers.
Motor Proteins Create Movement Motor proteins are proteins that convert stored energy into directed movement. Three groups of motor proteins are associ- ated with the cytoskeleton: myosins, kinesins, and dyneins. All three groups use energy stored in ATP to propel themselves along cyto- skeleton fibers.
Myosins bind to actin fibers and are best known for their role in muscle contraction (Chapter 12). Kinesins and dyneins assist the movement of vesicles along microtubules. Dyneins also associate with the microtubule bundles of cilia and flagella to help create their whiplike motion.
The cytoskeleton has at least five important functions.
1. Cell shape. The protein scaffolding of the cytoskeleton pro- vides mechanical strength to the cell and in some cells plays an important role in determining the shape of the cell. Figure 3.4b shows how cytoskeletal fibers help support microvilli {micro-, small + villus, tuft of hair}, fingerlike extensions of the cell mem- brane that increase the surface area for absorption of materials.
2. Internal organization. Cytoskeletal fibers stabilize the positions of organelles. Figure 3.4b illustrates organelles held in place by the cytoskeleton. Note, however, that this figure is only a snapshot of one moment in the cell’s life. The interior arrangement and composition of a cell are dynamic, changing from minute to minute in response to the needs of the cell, just as the inside of the walled city is always in motion. One disadvantage of the static illustrations in textbooks is that they are unable to represent movement and the dynamic nature of many physiological processes.
3. Intracellular transport. The cytoskeleton helps transport materials into the cell and within the cytoplasm by serving as an intracellular “railroad track” for moving organelles. This function is particularly important in cells of the nervous sys- tem, where material must be transported over intracellular distances as long as a meter.
4. Assembly of cells into tissues. Protein fibers of the cyto- skeleton connect with protein fibers in the extracellular space, linking cells to one another and to supporting material outside the cells. In addition to providing mechanical strength to the tissue, these linkages allow the transfer of information from one cell to another.
FIG. 3.5 Cilia and flagella
Flagellum
Cilia
Cilium
(a) Cilia on surface of respiratory epithelium (b) Cilia and flagella have 9 pairs of microtubules surrounding a central pair.
(c) The beating of cilia and flagella creates fluid movement.
Cell membrane
Fluid movement
Fluid movement
Microtubules
SEM × 1500
This image was taken with a scanning electron microscope (SEM) and then color enhanced. The specimens prepared for scanning electron micros- copy are not sectioned. The whole specimen is coated with an electron-dense material, and then bombarded with electron beams. Because some of the electrons are reflected back, a three- dimensional image of the specimen is created.
Concept Check
5. Name the three sizes of cytoplasmic protein fibers. 6. How would the absence of a flagellum affect a sperm cell? 7. What is the difference between cytoplasm and cytosol? 8. What is the difference between a cilium and a flagellum? 9. What is the function of motor proteins?
M03_SILV5197_08_SE_C03.indd 69 12/1/17 12:07 AM
70 CHAPTER 3 Compartmentation: Cells and Tissues
Why do mitochondria contain DNA when other organelles do not? This question has been the subject of intense scrutiny. According to the prokaryotic endosymbiont theory, mitochondria are the descendants of bacteria that invaded cells millions of years ago. The bacteria developed a mutually beneficial relationship with their hosts and soon became an integral part of the host cells. Supporting evidence for this theory is the fact that our mitochon- drial DNA, RNA, and enzymes are similar to those in bacteria but unlike those in our own cell nuclei.
The second compartment inside a mitochondrion is the intermembrane space, which lies between the outer and inner mitochondrial membranes. This compartment plays an important role in mitochondrial ATP production, so the number of mito- chondria in a cell is directly related to the cell’s energy needs. For example, skeletal muscle cells, which use a lot of energy, have many more mitochondria than less active cells, such as adipose (fat) cells.
Another unusual characteristic of mitochondria is their ability to replicate themselves even when the cell to which they belong is not undergoing cell division. This process is aided by the mitochon- drial DNA, which allows the organelles to direct their own dupli- cation. Mitochondria replicate by budding, during which small daughter mitochondria pinch off from an enlarged parent. For instance, exercising muscle cells that experience increased energy demands over a period of time may meet the demand for more ATP by increasing the number of mitochondria in their cytoplasm.
The Endoplasmic Reticulum The endoplasmic reticulum (ER) is a network of interconnected membrane tubes with three major functions: synthesis, storage, and transport of biomolecules (Fig. 3.4i). The name reticulum comes from the Latin word for net and refers to the netlike arrangement of the tubules. Electron micrographs reveal that there are two forms of endoplasmic retic- ulum: rough endoplasmic reticulum (RER) and smooth endoplasmic reticulum (SER).
The rough endoplasmic reticulum is the main site of protein synthesis. Proteins are assembled on ribosomes attached to the cytoplasmic surface of the rough ER, then inserted into the rough ER lumen, where they undergo chemical modification.
The smooth endoplasmic reticulum lacks attached ribosomes and is the main site for the synthesis of fatty acids, steroids, and lipids [p. 30]. Phospholipids for the cell membrane are produced here, and cholesterol is modified into steroid hormones, such as the sex hormones estrogen and testosterone. The smooth ER of liver and kidney cells detoxifies or inactivates drugs. In skeletal muscle cells, a modified form of smooth ER stores calcium ions (Ca2+) to be used in muscle contraction.
The Golgi Apparatus The Golgi apparatus (also known as the Golgi complex) was first described by Camillo Golgi in 1898 (Fig. 3.4h). For years, some investigators thought that this organelle was just a result of the fixation process needed to prepare tissues for viewing under the light microscope. However, we now know from electron microscope studies that the Golgi apparatus is indeed a discrete organelle. It consists of a series of hollow curved sacs,
Most motor proteins are made of multiple protein chains arranged into three parts: two heads that bind to the cytoskel- eton fiber, a neck, and a tail region that is able to bind “cargo,” such as an organelle that needs to be transported through the cytoplasm (FIG. 3.6). The heads alternately bind to the cyto- skeleton fiber, then release and “step” forward using the energy stored in ATP.
Organelles Create Compartments for Specialized Functions Organelles are subcellular compartments separated from the cyto- sol by one or more phospholipid membranes similar in structure to the cell membrane. The compartments created by organelles allow the cell to isolate substances and segregate functions. For example, an organelle might contain substances that could be harmful to the cell, such as digestive enzymes. Figures 3.4g, 3.4h, and 3.4i show the four major groups of organelles: mitochondria, the Golgi appa- ratus, the endoplasmic reticulum, and membrane-bound spheres called vesicles {vesicula, bladder}.
Mitochondria Mitochondria {singular, mitochondrion; mitos, thread + chondros, granule} are unique organelles in several ways. First, they have an unusual double wall that creates two separate compartments within the mitochondrion (Fig. 3.4g). In the center, inside the inner membrane, is a compartment called the mitochondrial matrix {matrix, female animal for breeding}. The matrix contains enzymes, ribosomes, granules, and surprisingly, its own unique DNA. This mitochondrial DNA has a different nucleotide sequence from that found in the nucleus. Because mitochondria have their own DNA, they can manufacture some of their own proteins.
FIG. 3.6 Motor proteins
Cytoskeletal fiber
Organelle
Motor protein
Direction of movement
ATP
Motor protein chains form a tail that binds organelles or other cargo, a neck, and two heads that “walk” along the cytoskeleton using energy from ATP.
M03_SILV5197_08_SE_C03.indd 70 12/1/17 12:07 AM
C H
A P
TER
3
3.3 Intracellular Compartments 71
Peroxisomes are storage vesicles that are even smaller than lysosomes (Fig. 3.4c). For years, they were thought to be a kind of lysosome, but we now know that they contain a different set of enzymes. Their main function appears to be to degrade long-chain fatty acids and potentially toxic foreign molecules.
Peroxisomes get their name from the fact that the reactions that take place inside them generate hydrogen peroxide (H2O2), a toxic molecule. The peroxisomes rapidly convert this peroxide to oxygen and water using the enzyme catalase. Peroxisomal disorders disrupt the normal processing of lipids and can severely disrupt neural function by altering the structure of nerve cell membranes.
The Nucleus Is the Cell’s Control Center The nucleus of the cell contains DNA, the genetic material that ultimately controls all cell processes. Figure 3.4j illustrates the structure of a typical nucleus. Its boundary, or nuclear envelope, is a two-membrane structure that separates the nucleus from the cytoplasmic compartment. Both membranes of the envelope are pierced here and there by round holes, or pores.
Communication between the nucleus and cytosol occurs through the nuclear pore complexes, large protein complexes with a central channel. Ions and small molecules move freely through this channel when it is open, but transport of large molecules such as proteins and RNA is a process that requires energy. Specificity of the transport process allows the cell to restrict DNA to the nucleus and various enzymes to either the cytoplasm or the nucleus.
In electron micrographs of cells that are not dividing, the nucleus appears filled with randomly scattered granular material, or chromatin, composed of DNA and associated proteins. Usually a nucleus also contains from one to four larger dark-staining bodies of DNA, RNA, and protein called nucleoli {singular, nucleolus, little nucleus}. Nucleoli contain the genes and proteins that control the synthesis of RNA for ribosomes.
The process of protein synthesis, modification, and pack- aging in different parts of the cell is an excellent example of how compartmentation allows separation of function, as shown in FIGURE 3.7. RNA for protein synthesis is made from DNA
called cisternae, stacked on top of one another like a series of hot water bottles and surrounded by vesicles. The Golgi apparatus receives proteins made on the rough ER, modifies them, and pack- ages them into the vesicles.
Cytoplasmic Vesicles Membrane-bound cytoplasmic vesicles are of two kinds: secretory and storage. Secretory vesicles contain proteins that will be released from the cell. The contents of most storage vesicles, however, never leave the cytoplasm.
Lysosomes {lysis, dissolution + soma, body} are small storage vesicles that appear as membrane-bound granules in the cytoplasm (Fig. 3.4d). Lysosomes act as the digestive system of the cell. They use powerful enzymes to break down bacteria or old organelles, such as mitochondria, into their component molecules. Those molecules that can be reused are reabsorbed into the cytosol, while the rest are dumped out of the cell. As many as 50 types of enzymes have been identified from lysosomes of different cell types.
Because lysosomal enzymes are so powerful, early workers puzzled over the question of why these enzymes do not normally destroy the cell that contains them. What scientists discovered was that lysosomal enzymes are activated only by very acidic condi- tions, 100 times more acidic than the normal acidity level in the cytoplasm. When lysosomes first pinch off from the Golgi appa- ratus, their interior pH is about the same as that of the cytosol, 7.0–7.3. The enzymes are inactive at this pH. Their inactivity serves as a form of insurance. If the lysosome breaks or acciden- tally releases enzymes, they will not harm the cell.
However, as the lysosome sits in the cytoplasm, it accumulates H+ in a process that uses energy. Increasing concentrations of H+ decrease the pH inside the vesicle to 4.8–5.0, and the enzymes are activated. Once activated, lysosomal enzymes can break down biomolecules inside the vesicle. The lysosomal membrane is not affected by the enzymes.
The digestive enzymes of lysosomes are not always kept iso- lated within the organelle. Occasionally, lysosomes release their enzymes outside the cell to dissolve extracellular support mate- rial, such as the hard calcium carbonate portion of bone. In other instances, cells allow their lysosomal enzymes to come in contact with the cytoplasm, leading to self-digestion of all or part of the cell. When muscles atrophy (shrink) from lack of use or the uterus diminishes in size after pregnancy, the loss of cell mass is due to the action of lysosomes.
The inappropriate release of lysosomal enzymes has been implicated in certain disease states, such as the inflamma- tion and destruction of joint tissue in rheumatoid arthritis. In the inherited conditions known as lysosomal storage diseases, lysosomes are ineffective because they lack specific enzymes. One of the best-known lysosomal storage diseases is the fatal inherited con- dition known as Tay-Sachs disease. Infants with Tay-Sachs disease have defective lysosomes that fail to break down glycolipids. Accumulation of glycolipids in nerve cells causes nervous system dysfunction, including blindness and loss of coordina- tion. Most infants afflicted with Tay-Sachs disease die in early childhood. Learn more about Tay-Sachs disease in the Chapter 4 Running Problem.
Concept Check
10. What distinguishes organelles from inclusions? 11. What is the anatomical difference between rough endoplasmic
reticulum and smooth endoplasmic reticulum? What is the functional difference?
12. How do lysosomes differ from peroxisomes? 13. Apply the physiological theme of compartmentation to organ
elles in general and to mitochondria in particular. 14. Microscopic examination of a cell reveals many mitochondria.
What does this observation imply about the cell’s energy requirements?
15. Examining tissue from a previously unknown species of fish, you discover a tissue containing large amounts of smooth endoplasmic reticulum in its cells. What is one possible function of these cells?
M03_SILV5197_08_SE_C03.indd 71 12/1/17 12:07 AM
72 CHAPTER 3 Compartmentation: Cells and Tissues
FIG. 3.7 Protein synthesis demonstrates subcellular compartmentation
Nucleus
mRNA
DNA
Nuclear pore
Ribosome
Growing amino-acid
chain
Targeted proteins
Peroxisome
Mitochondrion
Cytosolic protein
Endoplasmic reticulum
Transport vesicle
Retrograde Golgi-ER transport
Golgi apparatus
Lysosome or storage vesicle
Golgi apparatus
Secretory vesicle
Cell membrane Extracellular fluid
Cytosol
mRNA is transcribed from genes in the DNA.
mRNA leaves the nucleus and attaches to cytosolic ribosomes, initiating protein synthesis.
Some proteins are released by free ribosomes into the cytosol or are targeted to specific organelles.
Ribosomes attached to the rough endoplasmic reticulum direct proteins destined for packaging into the lumen of the rough ER.
Proteins are modified as they pass through the lumen of the ER.
Transport vesicles move the proteins from the ER to the Golgi apparatus.
Golgi cisternae migrate toward the cell membrane.
Some vesicles bud off the cisternae and move in a retrograde or backward fashion.
Some vesicles bud off to form lysosomes or storage vesicles.
Other vesicles become secretory vesicles that release their contents outside the cell.
Golgi
1
1
2
2
4
4
3
3
5
5
6
6
7
7
8
8
9
9
10
10
M03_SILV5197_08_SE_C03.indd 72 12/1/17 12:07 AM
C H
A P
TER
3
3.4 Tissues of the Body 73
proteins in the cell membrane or the cytoskeleton are ways cells communicate with their external environment.
The amount of extracellular matrix in a tissue is highly variable. Nerve and muscle tissue have very little matrix, but the connective tissues, such as cartilage, bone, and blood, have extensive matrix that occupies as much volume as their cells. The consistency of extracellular matrix can vary from watery (blood and lymph) to rigid (bone).
Cell Junctions Hold Cells Together to Form Tissues During growth and development, cells form cell-cell adhesions that may be transient or that may develop into more permanent cell junctions. Cell adhesion molecules (CAMs) are membrane- spanning proteins responsible both for cell junctions and for tran- sient cell adhesions (TBL. 3.3). Cell-cell or cell-matrix adhesions mediated by CAMs are essential for normal growth and develop- ment. For example, growing nerve cells creep across the extracel- lular matrix with the help of nerve-cell adhesion molecules (NCAMs). Cell adhesion helps white blood cells escape from the circulation and move into infected tissues, and it allows clumps of platelets to cling to damaged blood vessels. Because cell adhesions are not permanent, the bond between those CAMs and matrix is weak.
Stronger cell junctions can be grouped into three broad categories by function: communicating junctions, occluding junctions {occludere, to close up}, and anchoring junctions (FIG. 3.8). In animals, the communicating junctions are gap junctions. The occluding junctions of vertebrates are tight junctions that limit movement of materials between cells. The three major types of junctions are described next.
1. Gap junctions are the simplest cell-cell junctions (Fig. 3.8b). They allow direct and rapid cell-to-cell communication through cytoplasmic bridges between adjoining cells. Cylin- drical proteins called connexins interlock to create passageways that look like hollow rivets with narrow channels through their centers. The channels are able to open and close, regulating the movement of small molecules and ions through them.
Gap junctions allow both chemical and electrical signals to pass rapidly from one cell to the next. They were once thought to occur only in certain muscle and nerve cells, but we now
templates in the nucleus 1 , then transported to the cytoplasm through the nuclear pores 2 . In the cytoplasm, proteins are synthesized on ribosomes that may be free inclusions 3 or attached to the rough endoplasmic reticulum 4 . The newly made protein is compartmentalized in the lumen of the rough ER 5 where it is modified before being packaged into a vesicle 6 . The vesicles fuse with the Golgi apparatus, allowing addi-
tional modification of the protein in the Golgi lumen 7 . The modified proteins leave the Golgi packaged in either storage vesicles 8 or secretory vesicles whose contents will be released into the extracellular fluid 10 . The molecular details of protein synthesis are discussed elsewhere (see Chapter 4).
3.4 Tissues of the Body Despite the amazing variety of intracellular structures, no single cell can carry out all the processes of the mature human body. Instead, cells assemble into the larger units we call tissues. The cells in tissues are held together by specialized connections called cell junctions and by other support structures. Tissues range in complex- ity from simple tissues containing only one cell type, such as the lin- ing of blood vessels, to complex tissues containing many cell types and extensive extracellular material, such as connective tissue. The cells of most tissues work together to achieve a common purpose.
The study of tissue structure and function is known as histology {histos, tissue}. Histologists describe tissues by their physical features: (1) the shape and size of the cells, (2) the arrange- ment of the cells in the tissue (in layers, scattered, and so on), (3) the way cells are connected to one another, and (4) the amount of extracellular material present in the tissue. There are four primary tissue types in the human body: epithelial, connective, muscle, and neural, or nerve. Before we consider each tissue type specifically, let’s examine how cells link together to form tissues.
Extracellular Matrix Has Many Functions Extracellular matrix (usually just called matrix) is extracellular material that is synthesized and secreted by the cells of a tissue. For years, scientists believed that matrix was an inert substance whose only function was to hold cells together. However, experimental evidence now shows that the extracellular matrix plays a vital role in many physiological processes, ranging from growth and develop- ment to cell death. A number of disease states are associated with overproduction or disruption of extracellular matrix, including chronic heart failure and the spread of cancerous cells throughout the body (metastasis).
The composition of extracellular matrix varies from tissue to tissue, and the mechanical properties, such as elasticity and flexibility, of a tissue depend on the amount and consistency of the tissue’s matrix. Matrix always has two basic components: proteoglycans and insoluble protein fibers. Proteoglycans are glycoproteins, which are proteins covalently bound to polysaccharide chains [p. 29]. Insoluble protein fibers such as collagen, fibronectin, and laminin provide strength and anchor cells to the matrix. Attachments between the extracellular matrix and
TABLE 3.3 Major Cell Adhesion Molecules (CAMs)
Name Examples
Cadherins Cell-cell junctions such as adherens junctions and desmosomes. Calcium- dependent.
Integrins Primarily found in cell-matrix junctions. These also function in cell signaling.
Immunoglobulin superfamily CAMs
NCAMs (nerve-cell adhesion molecules). Responsible for nerve cell growth during nervous system development.
Selectins Temporary cell-cell adhesions.
M03_SILV5197_08_SE_C03.indd 73 12/1/17 12:07 AM
FIG. 3.8 ESSENTIALS Cell Junctions
(a) This map shows the many ways cell junctions can be categorized.
Cell junctions can be grouped into three categories:
Cell junctions connect one cell with another cell (or to surrounding matrix) with membrane-spanning proteins called cell adhesion molecules, or CAMs.
(e) Cells may have several types of junctions, as shown in this micrograph of two adjacent intestinal cells.
Claudin and occludin proteins
Cadherin proteinsConnexin
proteins
Intercellular space
Intercellular space
Cell membrane
Cell membrane
Plaque glycoproteins
Cytosol
Cell 1
Cell 2
Cell 1
Cell 2
Tight junctions prevent
movement between cells.
Clusters of gap junctions
Desmosomes anchor cells to each other.
Adherens junctions link actin fibers
in adjacent cells.
Intermediate filament
Categories
Location
Type
Membrane Protein
Cytoskeleton Fiber
Matrix Protein
Actin Actin Intermediate
filaments Actin
Keratin (intermediate
filaments)
Fibronectin and other proteins
Laminin
Cell Junctions
Communicating
Communicating junctions
Occluding Anchoring
Cell-cell junctions Cell-matrix junctions
Gap junction
Tight junction
Adherens junction
Desmosome Focal adhesion
Hemidesmosome
Connexin Claudin, occludin
Cadherin Integrin
Freeze Fracture of cell membrane 3 40,000
(b)
allow direct cell to cell communication.
Occluding junctions(c)
block movement of material between cells.
Anchoring junctions(d)
hold cells to one another and to the extracellular matrix.
Heart muscle has gap junctions that allow chemical and electrical signals to pass rapidly from one cell to the next.
Gap junctions are communicating junctions.
A desmosome is a cell- to-cell anchoring junction.
Tight junctions are occluding junctions.
74
M03_SILV5197_08_SE_C03.indd 74 12/2/17 12:28 AM
C H
A P
TER
3
3.4 Tissues of the Body 75
know they are important in cell-to-cell communication in many tissues, including the liver, pancreas, ovary, and thyroid gland.
2. Tight junctions are occluding junctions that restrict the movement of material between the cells they link (Fig. 3.8c). In tight junctions, the cell membranes of adjacent cells partly fuse together with the help of proteins called claudins and occlu- dins, thereby making a barrier. As in many physiological proc- esses, the barrier properties of tight junctions are dynamic and can be altered depending on the body’s needs. Tight junctions may have varying degrees of “leakiness.”
Tight junctions in the intestinal tract and kidney prevent most substances from moving freely between the external and internal environments. In this way, they enable cells to regulate what enters and leaves the body. Tight junctions also create the so-called blood-brain barrier that prevents many potentially harmful substances in the blood from reaching the extracel- lular fluid of the brain.
3. Anchoring junctions (Fig. 3.8d) attach cells to each other (cell-cell anchoring junctions) or to the extracellular matrix (cell-matrix anchoring junctions). In vertebrates, cell-cell anchoring junctions are created by CAMs called cadherins, which connect with one another across the intercellular space. Cell-matrix junctions use CAMs called integrins. Integrins are membrane proteins that can also bind to signal molecules in the cell’s environment, transferring information carried by the signal across the cell membrane into the cytoplasm.
Anchoring junctions contribute to the mechanical strength of the tissue. They have been compared to buttons or zippers that tie cells together and hold them in position within a tissue. Notice how the interlocking cadherin proteins in Figure 3.8d resemble the teeth of a zipper.
The protein linkage of anchoring cell junctions is very strong, allowing sheets of tissue in skin and lining body cavities to resist damage from stretching and twisting. Even the tough protein fibers of anchoring junctions can be broken, however. If you have shoes that rub against your skin, the stress can shear the proteins con- necting the different skin layers. When fluid accumulates in the resulting space and the layers separate, a blister results.
Tissues held together with anchoring junctions are like a picket fence, where spaces between the pickets (the cells) allow materials to pass from one side of the fence to the other. Movement of materials between cells is known as the paracellular pathway. In contrast, tissues held together with tight junctions are more like a solid brick wall: Very little can pass from one side of the wall to the other between the bricks.
Cell-cell anchoring junctions take the form of either adhe- rens junctions or desmosomes. Adherens junctions link actin fibers in adjacent cells together, as shown in the micrograph in Figure 3.8e. Desmosomes {desmos, band + soma, body} attach to intermediate filaments of the cytoskeleton. Desmosomes are the strongest cell-cell junctions. In electron micrographs they can be recognized by the dense glycoprotein bodies, or plaques, that lie just inside the cell membranes in the region where the two cells connect (Fig. 3.8d, e). Desmosomes may be small points of contact between
two cells (spot desmosomes) or bands that encircle the entire cell (belt desmosomes).
There are also two types of cell-matrix anchoring junctions. Hemidesmosomes {hemi-, half} are strong junctions that anchor intermediate fibers of the cytoskeleton to fibrous matrix proteins such as laminin. Focal adhesions tie intracellular actin fibers to different matrix proteins, such as fibronectin.
The loss of normal cell junctions plays a role in a number of diseases and in metastasis. Diseases in which cell junctions are destroyed or fail to form can have disfiguring and painful symp- toms, such as blistering skin. One such disease is pemphigus, a con- dition in which the body attacks some of its own cell junction proteins (www.pemphigus.org).
The disappearance of anchoring junctions probably contrib- utes to the metastasis of cancer cells throughout the body. Cancer cells lose their anchoring junctions because they have fewer cad- herin molecules and are not bound as tightly to neighboring cells. Once a cancer cell is released from its moorings, it secretes protein- digesting enzymes known as proteases. These enzymes, especially those called matrix metalloproteinases, (MMPs), dissolve the extracel- lular matrix so that escaping cancer cells can invade adjacent tis- sues or enter the bloodstream. Researchers are investigating ways of blocking MMP enzymes to see if they can prevent metastasis.
Now that you understand how cells are held together into tissues, we will look at the four different tissue types in the body: (1) epithelial, (2) connective, (3) muscle, and (4) neural.
Epithelia Provide Protection and Regulate Exchange The epithelial tissues, or epithelia {epi-, upon + thele@, nip- ple; singular epithelium}, protect the internal environment of the body and regulate the exchange of materials between the internal and external environments (FIG. 3.9). These tissues cover exposed surfaces, such as the skin, and line internal passageways, such as the digestive tract. Any substance that enters or leaves the internal environ- ment of the body must cross an epithelium.
Some epithelia, such as those of the skin and mucous mem- branes of the mouth, act as a barrier to keep water in the body and invaders such as bacteria out. Other epithelia, such as those in the kidney and intestinal tract, control the movement of materials between the external environment and the extracellular fluid of the body. Nutrients, gases, and wastes often must cross several different epithelia in their passage between cells and the outside world.
Concept Check
16. Name the three functional categories of cell junctions. 17. Which type of cell junction:
(a) restricts movement of materials between cells? (b) allows direct movement of substances from the cytoplasm
of one cell to the cytoplasm of an adjacent cell? (c) provides the strongest cellcell junction? (d) anchors actin fibers in the cell to the extracellular matrix?
M03_SILV5197_08_SE_C03.indd 75 12/1/17 12:07 AM
FIG. 3.9 ESSENTIALS Epithelial Tissue
Cells
(a) Five Functional Categories of Epithelia
Exchange Transporting Ciliated Protective Secretory
Number of Cell Layers
One One One Many One to many
Cell Shape Flattened Columnar or cuboidal Columnar or cuboidal Flattened in surface layers; polygonal in deeper layers
Columnar or polygonal
Special Features
Pores between cells permit easy passage of molecules
Tight junctions prevent movement between cells; surface area increased by folding of cell membrane into fingerlike microvilli
One side covered with cilia to move fluid across surface
Cells tightly connected by many desmosomes
Where Found
Lungs, lining of blood vessels
Intestine, kidney, some exocrine glands
Nose, trachea, and upper airways; female reproductive tract
Skin and lining of cavities (such as the mouth) that open to the environment
Exocrine glands, including pancreas, sweat glands, and salivary glands; endocrine glands, such as thyroid and gonads
Key exchange epithelium transporting epithelium ciliated epithelium protective epithelium secretory epithelium
1. Where do secretions from endocrine glands go?
2. Where do secretions from exocrine glands go?
(c) Most epithelia attach to an underlying matrix layer called the basal lamina or basement membrane.
(b) This diagram shows the distribution of the five kinds of epithelia in the body outlined in the table above.
Integumentary System
FIGURE QUESTIONS
Secretion ExchangeKEY
Underlying tissue
Basal lamina (basement membrane) is an acellular matrix layer that is secreted by the epithelial cells.
Epithelial cells attach to the basal lamina using cell adhesion molecules.
Respiratory system
Digestive system
Circulatory system
Reproductive system
Urinary system
A light micrograph (LM) is the photographic image produced when a light microscope directs visible light through a thin section of tissue. The specimen is magnified with both an ocular lens and a revolving nosepiece that holds several objective lenses of progressive magnifying power. Total magnification equals the magnification of the ocular lens times that of the objective lens.
LM 3 350
Protein-secreting cells filled with membrane-bound secretory granules and extensive RER; steroid-secreting cells contain lipid droplets and extensive SER
76
M03_SILV5197_08_SE_C03.indd 76 12/2/17 12:28 AM
C H
A P
TER
3
3.4 Tissues of the Body 77
Another type of epithelium is specialized to manufacture and secrete chemicals into the blood or into the external environment. Sweat and saliva are examples of substances secreted by epithelia into the environment. Hormones are secreted into the blood.
Structure of Epithelia Epithelia typically consist of one or more layers of cells connected to one another, with a thin layer of extra- cellular matrix lying between the epithelial cells and their underly- ing tissues (Fig. 3.9c). This matrix layer, called the basal lamina {bassus, low; lamina, a thin plate}, or basement membrane, is composed of a network of collagen and laminin filaments embed- ded in proteoglycans. The protein filaments hold the epithelial cells to the underlying cell layers, just as cell junctions hold the individual cells in the epithelium to one another.
The cell junctions in epithelia are variable. Physiologists clas- sify epithelia either as “leaky” or “tight,” depending on how easily substances pass from one side of the epithelial layer to the other. In a leaky epithelium, anchoring junctions allow molecules to cross the epithelium by passing through the gap between two adjacent epithelial cells. A typical leaky epithelium is the wall of capillaries (the smallest blood vessels), where all dissolved molecules except for large proteins can pass from the blood to the interstitial fluid by traveling through gaps between adjacent epithelial cells.
In a tight epithelium, such as that in the kidney, adjacent cells are bound to each other by tight junctions that create a barrier, preventing substances from traveling between adjacent cells. To cross a tight epithelium, most substances must enter the epithelial cells and go through them. The tightness of an epithelium is directly related to how selective it is about what can move across it. Some epithelia, such as those of the intestine, have the ability to alter the tightness of their junctions according to the body’s needs.
Types of Epithelia Structurally, epithelial tissues can be divided into two general types: (1) sheets of tissue that lie on the surface of the body or that line the inside of tubes and hollow organs and (2) secre- tory epithelia that synthesize and release substances into the extracel- lular space. Histologists classify sheet epithelia by the number of cell layers in the tissue and by the shape of the cells in the surface layer. This classification scheme recognizes two types of layering—simple (one cell thick) and stratified (multiple cell layers) {stratum, layer + facere, to make}—and three cell shapes—squamous {squama, flattened plate or scale}, cuboidal, and columnar. However, physiologists are more concerned with the functions of these tissues, so instead of using the histological descriptions, we will divide epithelia into five groups according to their function.
There are five functional types of epithelia: exchange, trans- porting, ciliated, protective, and secretory (FIG. 3.10). Exchange epithe- lia permit rapid exchange of materials, especially gases. Transporting epithelia are selective about what can cross them and are found primarily in the intestinal tract and the kidney. Ciliated epithelia are located primarily in the airways of the respiratory system and in the female reproductive tract. Protective epithelia are found on the surface of the body and just inside the openings of body cavities. Secretory epithelia synthesize and release secretory products into the external environment or into the blood.
Figure 3.9b shows the distribution of these epithelia in the systems of the body. Notice that most epithelia face the external environment on one surface and the extracellular fluid on the other. One exception is the endocrine glands and a second is the epithelium lining the circulatory system.
Exchange Epithelia The exchange epithelia are composed of very thin, flattened cells that allow gases (CO2 and O2) to pass rapidly across the epithelium. This type of epithelium lines the blood vessels and the lungs, the two major sites of gas exchange in the body. In capillaries, gaps or pores in the epithelium also allow molecules smaller than proteins to pass between two adjacent epi- thelial cells, making this a leaky epithelium (Fig. 3.10a). Histologists classify thin exchange tissue as simple squamous epithelium because it is a single layer of thin, flattened cells. The simple squamous epithelium lining the heart and blood vessels is also called the endothelium.
Transporting Epithelia The transporting epithelia actively and selectively regulate the exchange of nongaseous materials, such as ions and nutrients, between the internal and external environ- ments. These epithelia line the hollow tubes of the digestive system and the kidney, where lumens open into the external environ- ment (p. 4). Movement of material from the external environment across the epithelium to the internal environment is called absorp- tion. Movement in the opposite direction, from the internal to the external environment, is called secretion.
Transporting epithelia can be identified by the following char- acteristics (Fig. 3.10b):
1. Cell shape. Cells of transporting epithelia are much thicker than cells of exchange epithelia, and they act as a barrier as well as an entry point. The cell layer is only one cell thick (a simple epithelium), but cells are cuboidal or columnar.
2. Membrane modifications. The apical membrane, the surface of the epithelial cell that faces the lumen, has tiny finger- like projections called microvilli that increase the surface area avail- able for transport. A cell with microvilli has at least 20 times the surface area of a cell without them. In addition, the basolateral membrane, the side of the epithelial cell facing the extracel- lular fluid, may also have folds that increase the cell’s surface area.
3. Cell junctions. The cells of transporting epithelia are firmly attached to adjacent cells by moderately tight to very tight junctions. This means that to cross the epithelium, material must move into an epithelial cell on one side of the tissue and out of the cell on the other side.
4. Cell organelles. Most cells that transport materials have numerous mitochondria to provide energy for transport proc- esses (discussed further in Chapter 5). The properties of trans- porting epithelia differ depending on where in the body the epithelia are located. For example, glucose can cross the epi- thelium of the small intestine and enter the extracellular fluid but cannot cross the epithelium of the large intestine.
The transport properties of an epithelium can be regulated and modified in response to various stimuli. Hormones, for example, affect the transport of ions by kidney epithelium. You
M03_SILV5197_08_SE_C03.indd 77 12/2/17 12:28 AM
FIG. 3.10 ESSENTIALS Types of Epithelia
Pore Extracellular fluid
Blood
Capillary epithelium
Goblet cells secrete mucus into the lumen of hollow organs such as the intestine.
The thin, flat cells of exchange epithelium allow movement through and between the cells.
Protective epithelia have many stacked layers of cells that are constantly being replaced. This figure shows layers in skin (see Fig. 3.15, Focus On: The Skin).
Apical membrane
Microvilli
Basolateral membrane
Tight junctions in a transporting epithelium
prevent movement between adjacent
cells. Substances must instead pass through
the epithelial cell, crossing two
phospholipid cell membranes as
they do so.
Transporting epithelia selectively move substances between a lumen and the ECF.
Secretory epithelial cells make and release a product. Exocrine secretions, such as the mucus shown here, are secreted outside the body. The secretions of endocrine cells (hormones) are released into the blood.
SEM of the epithelial surface of an airway
Golgi apparatus
Nucleus
Microvilli
Cilia
Mitochondrion
Basal lamina
Beating cilia create fluid currents that sweep across the epithelial surface.
Mucus
Epithelial cells
Capillary
TEM of goblet cell
Section of skin showing cell layers.
Golgi apparatus
Nucleus
Lumen of intestine or kidney
Extracellular fluid
Transporting epithelial
cell
(a) Exchange Epithelium
(b) Transporting Epithelium (c) Ciliated Epithelium
(d) Protective Epithelium (e) Secretory Epithelium
LM × 200
TEM × 3000
SEM × 8000
A transmission electron micrograph (TEM) is produced by an electron microscope. It directs a beam of electrons through a finely sectioned object onto a photographic plate. It allows for far greater magnification than a light microscope.
78
M03_SILV5197_08_SE_C03.indd 78 12/2/17 12:28 AM
C H
A P
TER
3
3.4 Tissues of the Body 79
will learn more about transporting epithelia when you study the kidney and digestive systems.
Ciliated Epithelia Ciliated epithelia are nontransporting tis- sues that line the respiratory system and parts of the reproductive tract. The surface of the tissue facing the lumen is covered with cilia that beat in a coordinated, rhythmic fashion, moving fluid and particles across the surface of the tissue (Fig. 3.10c). Injury to the cilia or to their epithelial cells can stop ciliary movement. For example, smoking paralyzes the ciliated epithelium lining the respiratory tract. Loss of ciliary function contributes to the higher incidence of respiratory infection in smokers, when the mucus that traps bacteria can no longer be swept out of the lungs by the cilia.
Protective Epithelia The protective epithelia prevent exchange between the internal and external environments and protect areas subject to mechanical or chemical stresses. These epithelia are strat- ified tissues, composed of many stacked layers of cells (Fig. 3.10d). Protective epithelia may be toughened by the secretion of keratin {keras, horn}, the same insoluble protein abundant in hair and nails. The epidermis {epi, upon + derma, skin} and linings of the mouth, pharynx, esophagus, urethra, and vagina are all protective epithelia.
Because protective epithelia are subjected to irritating chemi- cals, bacteria, and other destructive forces, the cells in them have a short life span. In deeper layers, new cells are produced con- tinuously, displacing older cells at the surface. Each time you wash your face, you scrub off dead cells on the surface layer. As skin ages, the rate of cell turnover declines. Retinoids, a group
of chemicals derived from vitamin A, speed up cell division and surface shedding so treated skin develops a more youthful appearance.
Secretory Epithelia Secretory epithelia are composed of cells that produce a substance and then secrete it into the extra- cellular space. Secretory cells may be scattered among other epi- thelial cells, or they may group together to form a multicellular gland. There are two types of secretory glands: exocrine and endocrine.
Exocrine glands release their secretions to the body’s exter- nal environment {exo-, outside + krinein, to secrete}. This may be onto the surface of the skin or onto an epithelium lining one of the internal passageways, such as the airways of the lung or the lumen of the intestine (Fig. 3.10e). In effect, an exocrine secre- tion leaves the body. This explains how some exocrine secretions, like stomach acid, can have a pH that is incompatible with life [Fig. 2.9, p. 45].
Most exocrine glands release their products through open tubes known as ducts. Sweat glands, mammary glands in the breast, salivary glands, the liver, and the pancreas are all exocrine glands.
Exocrine gland cells produce two types of secretions. Serous secretions are watery solutions, and many of them contain enzymes. Tears, sweat, and digestive enzyme solutions are all serous exocrine secretions. Mucous secretions (also called mucus) are sticky solutions containing glycoproteins and proteoglycans. Some exocrine glands contain more than one type of secretory cell, and they produce both serous and mucous secretions. For example, the salivary glands release mixed secretions.
Goblet cells, shown in Figure 3.10e, are single exocrine cells that produce mucus. Mucus acts as a lubricant for food to be swal- lowed, as a trap for foreign particles and microorganisms inhaled or ingested, and as a protective barrier between the epithelium and the environment.
Unlike exocrine glands, endocrine glands are ductless and release their secretions, called hormones, into the body’s extracellular compartment (Fig. 3.9b). Hormones enter the blood for distribution to other parts of the body, where they regulate or coordinate the activities of various tissues, organs, and organ systems. Some of the best-known endocrine glands are the pan- creas, the thyroid gland, the gonads, and the pituitary gland. For years, it was thought that all hormones were produced by cells grouped together into endocrine glands. We now know that isolated endocrine cells occur scattered in the epithelial lining of the digestive tract, in the tubules of the kidney, and in the walls of the heart.
FIGURE 3.11 shows the epithelial origin of endocrine and exo- crine glands. During embryonic development, epithelial cells grow downward into the supporting connective tissue. Exocrine glands remain connected to the parent epithelium by a duct that trans- ports the secretion to its destination (the external environment). Endocrine glands lose the connecting cells and secrete their hor- mones into the bloodstream.
RUNNING PROBLEM Many kinds of cancer develop in epithelial cells that are subject to damage or trauma. The uterine cervix consists of two types of epithelia. Columnar secretory epithelium with mucus-secreting glands lines the inside of the cervical canal. A protective strati- fied squamous epithelium covers the outside of the cervix. At the opening of the cervix, these two types of epithelia come together. In many cases, infections caused by the human papil- lomavirus (HPV) cause the cervical cells to develop dysplasia. Dr. Baird ran an HPV test on Jan’s first Pap smear, and it was positive for the virus. Today she is repeating the tests to see if Jan’s dysplasia and HPV infection have persisted.
Q3: What other kinds of damage or trauma are cervical epithe- lial cells normally subjected to?
Q4: Which of the two types of cervical epithelia is more likely to be affected by physical trauma?
Q5: The results of Jan’s first Pap test showed atypical squa- mous cells of unknown significance (ASC-US). Were these cells more likely to come from the secretory portion of the cervix or from the protective epithelium?
59 61 65 79 84 87
M03_SILV5197_08_SE_C03.indd 79 12/1/17 12:07 AM
80 CHAPTER 3 Compartmentation: Cells and Tissues
of connective tissues is the presence of extensive extracellular matrix containing widely scattered cells that secrete and modify the matrix (FIG. 3.12). Connective tissues include blood, the sup- port tissues for the skin and internal organs, and cartilage and bone.
Structure of Connective Tissue The extracellular matrix of con- nective tissue is a ground substance of proteoglycans and water in which insoluble protein fibers are arranged, much like pieces of fruit suspended in a gelatin salad. The consistency of ground substance is highly variable, depending on the type of connec- tive tissue (Fig. 3.12a). At one extreme is the watery matrix of blood, and at the other extreme is the hardened matrix of bone. In between are solutions of proteoglycans that vary in consistency from syrupy to gelatinous. The term ground substance is sometimes used interchangeably with matrix.
Connective tissue cells lie embedded in the extracellular matrix. These cells are described as fixed if they remain in one place and as mobile if they can move from place to place. Fixed cells are responsible for local maintenance, tissue repair, and energy storage. Mobile cells are responsible mainly for defense. The distinction between fixed and mobile cells is not absolute, because at least one cell type is found in both fixed and mobile forms.
Extracellular matrix is nonliving, but the connective tis- sue cells constantly modify it by adding, deleting, or rearranging molecules. The suffix -blast {blastos, sprout} on a connective tissue cell name often indicates a cell that is either growing or actively secreting extracellular matrix. Fibroblasts, for example, are con- nective tissue cells that secrete collagen-rich matrix. Cells that are actively breaking down matrix are identified by the suffix -clast {klastos, broken}. Cells that are neither growing, secreting matrix components, nor breaking down matrix may be given the suffix -cyte, meaning “cell.” Remembering these suffixes should help you remember the functional differences between cells with similar names, such as the osteoblast, osteocyte, and osteoclast, three cell types found in bone.
In addition to secreting proteoglycan ground substance, connective tissue cells produce matrix fibers. Four types of fiber proteins are found in matrix, aggregated into insoluble fibers. Collagen {kolla, glue + @genes, produced} is the most abundant protein in the human body, almost one-third of the body’s dry weight. Collagen is also the most diverse of the four protein types, with at least 12 variations. It is found almost everywhere connec- tive tissue is found, from the skin to muscles and bones. Individual collagen molecules pack together to form collagen fibers, flexible but inelastic fibers whose strength per unit weight exceeds that of steel. The amount and arrangement of collagen fibers help determine the mechanical properties of different types of con- nective tissues.
Three other protein fibers in connective tissue are elastin, fibrillin, and fibronectin. Elastin is a coiled, wavy protein that returns to its original length after being stretched. This property is known as elastance or elastic recoil. Elastin combines with the very thin, straight fibers of fibrillin to form filaments and sheets of elastic fibers. These two fibers are important in elastic tissues
FIG. 3.11 Development of endocrine and exocrine glands
Epithelium
Connective tissue
Duct Connecting cells disappear
Blood vessel
Endocrine secretory cells
Exocrine secretory cells
Exocrine Endocrine
During development, the region of epithelium destined to become glandular tissue divides downward into the underlying connective tissue.
A hollow center, or lumen, forms in exocrine glands, creating a duct that provides a passageway for secretions to move to the surface of the epithelium.
Endocrine glands lose the connecting bridge of cells that links them to the parent epithelium. Their secretions go directly into the bloodstream.
Concept Check
18. List the five functional types of epithelia. 19. Define secretion. 20. Name two properties that distinguish endocrine glands from
exocrine glands. 21. The basal lamina of epithelium contains the protein fiber lam
inin. Are the overlying cells attached by focal adhesions or hemidesmosomes?
22. You look at a tissue under a microscope and see a simple squa mous epithelium. Can it be a sample of the skin surface? Explain.
23. A cell of the intestinal epithelium secretes a substance into the extra cellular fluid, where it is picked up by the blood and carried to the pan creas. Is the intestinal epithelium cell an endocrine or an exocrine cell?
Connective Tissues Provide Support and Barriers Connective tissues, the second major tissue type, pro- vide structural support and sometimes a physical barrier that, along with specialized cells, helps defend the body from for- eign invaders such as bacteria. The distinguishing characteristic
M03_SILV5197_08_SE_C03.indd 80 12/1/17 12:07 AM
81
FIG. 3.12 ESSENTIALS Connective Tissue
Cells
is composed of
CONNECTIVE TISSUE
Mobile Fixed
Blood cells
Macrophages Adipocytes
Store energy in fat
FibroblastsRed blood cells
O2 and CO2 transport
White blood cells
Fight invaders synthesize
(a) Map of Connective Tissue Components
Fibroblast
Macrophage
White blood cell
Red blood cells
Loose connective tissue
Adipocytes
Ground substance
Collagen
Elastin
Mineralized Gelatinous Syrupy Watery
Ground Substance
Bone Blood plasma
• Loose connective tissue • Dense connective tissue • Cartilage • Adipose tissue
Connects cells to matrix
Forms filaments and sheets
Stretch and recoil
Stiff but flexible
Fibronectin Fibrillin Elastin Collagen
can be divided into
(b) Types of Connective Tissue
Tissue Name Ground Substance Fiber Type and Arrangement Main Cell Types Where Found
Loose connective tissue
Gel; more ground substance than fibers or cells
Collagen, elastic, reticular; random Fibroblasts Skin around blood vessels and organs, under epithelia
Dense, irregular connective tissue
More fibers than ground substance
Mostly collagen; random
Muscle and nerve sheaths
Dense, regular connective tissue
More fibers than ground substance
Collagen; parallel Tendons and ligaments
Adipose tissue Very little ground substance None Brown fat and white fat Depends on age and sex
Blood Aqueous None Blood cells In blood and lymph vessels
Cartilage Firm but flexible; hyaluronic acid
Collagen Chondroblasts Joint surfaces, spine, ear, nose, larynx
Bone Rigid due to calcium salts Collagen Osteoblasts and osteocytes Bones
Fibroblasts
Fibroblasts
Matrix
Protein Fibers
M03_SILV5197_08_SE_C03.indd 81 12/1/17 12:07 AM
82 CHAPTER 3 Compartmentation: Cells and Tissues
role in temperature regulation in infants. Until recently it was thought to be almost completely absent in adults. However, modern imaging techniques such as combined CT and PET scans have revealed that adults do have brown fat (discussed in more detail in Chapter 22).
Blood is an unusual connective tissue that is characterized by its watery extracellular matrix called plasma. Plasma consists of a dilute solution of ions and dissolved organic molecules, including a large variety of soluble proteins. Blood cells and cell fragments are suspended in the plasma (Fig. 3.13d), but the insoluble protein fibers typical of other connective tissues are absent. We discuss blood in Chapter 16.
such as the lungs, blood vessels, and skin. As mentioned earlier, fibronectin connects cells to extracellular matrix at focal adhe- sions. Fibronectins also play an important role in wound healing and in blood clotting.
Types of Connective Tissue Figure 3.12b compares the properties of different types of connective tissue. The most common types are loose and dense connective tissue, adipose tissue, blood, car- tilage, and bone. By many estimates, connective tissues are the most abundant of the tissue types as they are a component of most organs.
Loose connective tissues (FIG. 3.13a) are the elastic tissues that underlie skin and provide support for small glands. Dense connective tissues (irregular and regular) provide strength or flexibility. Examples are tendons, ligaments, and the sheaths that surround muscles and nerves. In these dense tissues, collagen fibers are the dominant type. Tendons (Fig. 3.13c) attach skeletal mus- cles to bones. Ligaments connect one bone to another. Because ligaments contain elastic fibers in addition to collagen fibers, they have a limited ability to stretch. Tendons lack elastic fibers and so cannot stretch.
Cartilage and bone together are considered supporting con- nective tissues. These tissues have a dense ground substance that contains closely packed fibers. Cartilage is found in structures such as the nose, ears, knee, and windpipe. It is solid, flexible, and notable for its lack of blood supply. Without a blood supply, nutrients and oxygen must reach the cells of cartilage by diffu- sion. This is a slow process, which means that damaged cartilage heals slowly.
Replacing and repairing damaged cartilage has moved from the research lab into medical practice. Biomedical researchers can take a cartilage sample from a patient and put it into a tissue cul- ture medium to reproduce. Once the culture has grown enough chondrocytes—the cells that synthesize the extracellular matrix of cartilage—the cells are seeded into a scaffold. A physician surgi- cally places the cells and scaffold in the patient’s knee at the site of cartilage damage so that the chondrocytes can help repair the car- tilage. Because the person’s own cells are grown and reimplanted, there is no tissue rejection.
The fibrous extracellular matrix of bone is said to be calcified because it contains mineral deposits, primarily calcium salts, such as calcium phosphate (Fig. 3.13b). These minerals give the bone strength and rigidity. We examine the structure and formation of bone along with calcium metabolism in Chapter 23.
Adipose tissue is made up of adipocytes, or fat cells. An adipocyte of white fat typically contains a single enor- mous lipid droplet that occupies most of the volume of the cell (Fig. 3.13e). This is the most common form of adipose tissue in adults.
Brown fat is composed of adipose cells that contain mul- tiple lipid droplets rather than a single large droplet. This type of fat has been known for many years to play an important
Concept Check
24. What is the distinguishing characteristic of connective tissues? 25. Name four types of protein fibers found in connective tissue
matrix and give the characteristics of each. 26. Name six types of connective tissues. 27. Blood is a connective tissue with two components: plasma and
cells. Which of these is the matrix in this connective tissue? 28. Why does torn cartilage heal more slowly than a cut in the
skin?
Muscle and Neural Tissues Are Excitable The third and fourth of the body’s four tissue types—muscle and neural—are collectively called the excitable tissues because of their ability to generate and propagate electrical signals called action potentials. Both of these tissue types have minimal extracellular matrix, usually limited to a supportive layer called the external lamina. Some types of muscle and nerve cells are also notable for their gap junctions, which allow the direct and rapid conduction of electrical signals from cell to cell.
Muscle tissue has the ability to contract and produce force and movement. The body contains three types of muscle tissue: cardiac muscle in the heart; smooth muscle, which makes up most internal organs; and skeletal muscle. Most skeletal muscles attach to bones and are responsible for gross movement of the body. We discuss muscle tissue in more detail in Chapter 12.
Neural tissue has two types of cells. Neurons, or nerve cells, carry information in the form of chemical and electrical signals from one part of the body to another. They are concentrated in the brain and spinal cord but also include a network of cells that extends to virtually every part of the body. Glial cells, or neuroglia, are the support cells for neurons. We discuss the anatomy of neural tissue in Chapter 8. A summary of the characteristics of the four tissue types can be found in TABLE 3.4.
M03_SILV5197_08_SE_C03.indd 82 12/1/17 12:07 AM
83
FIG. 3.13 ESSENTIALS Types of Connective Tissue
(a) Loose Connective Tissue
(b) Bone and Cartilage
(e) Adipose Tissue(d) Blood
(c) Dense Regular Connective Tissue
Loose connective tissue is very flexible, with multiple cell types and fibers.
Elastic fibers
Free macrophage
Ground substance is the matrix of loose connective tissue.
Collagen fibers
Fibroblasts are cells that secrete
matrix proteins.
Matrix Collagen fibers
Hard bone forms when osteo- blasts deposit calcium phosphate crystals in the matrix.
Cartilage has firm but flexible matrix secreted by cells called chondrocytes.
Collagen fibers of tendon are densely packed into parallel bundles. Tendons connect muscle to bone and ligaments attach bone to bone.
Chondrocytes
Matrix
Red blood cell
Platelet
Lymphocyte
Neutrophil
Eosinophil
Blood consists of liquid matrix (plasma) plus red and white blood cells and the cell fragments called platelets.
In white fat, the cell cytoplasm is almost entirely filled with lipid droplets.
White Blood Cells
Lipid droplets
Nucleus
LM × 400
LM × 350
LM × 800 LM × 300
LM × 450
LM × 375
M03_SILV5197_08_SE_C03.indd 83 12/1/17 12:07 AM
84 CHAPTER 3 Compartmentation: Cells and Tissues
3.5 Tissue Remodeling Most people associate growth with the period from birth to adult- hood. However, cell birth, growth, and death continue throughout a person’s life. The tissues of the body are constantly remodeled as cells die and are replaced.
Apoptosis Is a Tidy Form of Cell Death Cell death occurs two ways, one messy and one tidy. In necrosis, cells die from physical trauma, toxins, or lack of oxygen when their blood supply is cut off. Necrotic cells swell, their organelles
deteriorate, and finally the cells rupture. The cell contents released this way include digestive enzymes that damage adjacent cells and trigger an inflammatory response. You see necrosis when you have a red area of skin surrounding a scab.
In contrast, cells that undergo programmed cell death, or apoptosis {ap-oh-TOE-sis or a-pop-TOE-sis; apo-, apart, away + ptosis, falling}, do not disrupt their neighbors when they die. Apoptosis, also called cell suicide, is a complex process regulated by multiple chemical signals. Some signals keep apoptosis from occurring, while other signals tell the cell to self-destruct. When the suicide signal wins out, chromatin in the nucleus condenses, and the cell pulls away from its neighbors. It shrinks, then breaks up into tidy membrane-bound blebs that are gobbled up by neighboring cells or by wandering cells of the immune system.
Apoptosis is a normal event in the life of an organism. During fetal development, apoptosis removes unneeded cells, such as half the cells in the developing brain and the webs of skin between fin- gers and toes. In adults, cells that are subject to wear and tear from exposure to the outside environment may live only a day or two before undergoing apoptosis. For example, it has been estimated that the intestinal epithelium is completely replaced with new cells every two to five days.
TABLE 3.4 Characteristics of the Four Tissue Types
Epithelial Connective Muscle Nerve
Matrix Amount Minimal Extensive Minimal Minimal
Matrix Type Basal lamina Varied—protein fibers in ground substance that ranges from liquid to gelatinous to firm to calcified
External lamina External lamina
Unique Features No direct blood supply Cartilage has no blood supply
Able to generate electri- cal signals, force, and movement
Able to generate electrical signals
Surface Features of Cells Microvilli, cilia N/A N/A N/A
Locations Covers body surface; lines cavities and hollow organs, and tubes; secre- tory glands
Supports skin and other organs; cartilage, bone, and blood
Makes up skeletal muscles, hollow organs, and tubes
Throughout body; concentrated in brain and spinal cord
Cell Arrangement and Shapes
Variable number of layers, from one to many; cells flattened, cuboidal, or columnar
Cells not in layers; usu- ally randomly scattered in matrix; cell shape irregular to round
Cells linked in sheets or elongated bundles; cells shaped in elongated, thin cylinders; heart muscle cells may be branched
Cells isolated or net- worked; cell append- ages highly branched and/or elongated
RUNNING PROBLEM The day after Jan’s visit, the computerized cytology analysis sys- tem rapidly scans the cells on the slide of Jan’s cervical tissue, looking for abnormal cell size or shape. The computer is pro- grammed to find multiple views for the cytologist to evaluate. The results of Jan’s two Pap tests are shown in FIGURE 3.14.
Q6: Has Jan’s dysplasia improved or worsened? What evidence do you have to support your answer?
Q7: Use your answer to question 6 to predict whether Jan’s HPV infection has persisted or been cleared by her immune system.
59 61 79 65 84 87
Concept Check
29. What are some features of apoptosis that distinguish it from cell death due to injury?
M03_SILV5197_08_SE_C03.indd 84 12/1/17 12:07 AM
C H
A P
TER
3
3.5 Tissue Remodeling 85
Stem Cells Can Create New Specialized Cells If cells in the adult body are constantly dying, where do their replacements come from? This question is still being answered and is one of the hottest topics in biological research today. The following paragraphs describe what we currently know.
All cells in the body are derived from the single cell formed at conception. That cell and those that follow reproduce themselves by undergoing the cell division process known as mitosis (see Appendix C). The very earliest cells in the life of a human being are said to be totipotent {totus, entire} because they have the ability to develop into any and all types of specialized cells. Any totipotent cell has the potential to become a functioning organism.
After about day 4 of development, the totipotent cells of the embryo begin to specialize, or differentiate. As they do so, they narrow their potential fates and become pluripotent {plures, many}. Pluripotent cells can develop into many different cell types but not all cell types. An isolated pluripotent cell cannot develop into an organism.
As differentiation continues, pluripotent cells develop into the various tissues of the body. As the cells specialize and mature, many lose the ability to undergo mitosis and reproduce themselves. They can be replaced, however, by new cells created from stem cells, less specialized cells that retain the ability to divide.
Undifferentiated stem cells in a tissue that retain the ability to divide and develop into the cell types of that tissue are said to be multipotent {multi, many}. Some of the most-studied mul- tipotent adult stem cells are found in bone marrow and give rise to blood cells. However, all adult stem cells occur in very small numbers. They are difficult to isolate and do not thrive in the laboratory.
Biologists once believed that nerve and muscle cells, which are highly specialized in their mature forms, could not be replaced when they died. Now research indicates that stem cells for these tissues do exist in the body. However, naturally occurring neu- ral and muscle stem cells are so scarce that they cannot replace large masses of dead or dying tissue that result from diseases such as strokes or heart attacks. Consequently, one goal of stem cell research is to find a source of pluripotent or multipotent stem cells that could be grown in the laboratory. If stem cells could be grown in larger numbers, they could be implanted to treat damaged tis- sues and degenerative diseases, those in which cells degenerate and die. One example of a degenerative disease is Parkinson’s disease, in which certain types of nerve cells in the brain die.
FIG. 3.14 Pap smears of cervical cells
(a) Jan’s abnormal Pap test. (b) Jan’s second Pap test. Are these cells normal or abnormal?
EMERGING CONCEPTS Induced Pluripotent Stems Cells
In 2006 a group of Japanese researchers, led by Shinya Yamanaka, turned mature skin cells from a mouse back into pluripotent stem cells by altering just four genes. Before this work, scientists thought that once a cell had differentiated, it could not go back to a pluripotent state. Yamanaka’s induced pluripotent stem cells (iPS) cells, changed our model of cell differentiation and provided a way to create stem cells that did not require the use of embryos. In the years since Yamanaka’s discovery was announced, we have learned that iPS cells are very helpful disease models for laboratory stud- ies. However, they have proved less successful as a source of stem cells for treating diseases. For his lab’s discovery of a way to create iPS cells, Dr. Yamanaka received a Nobel Prize in 2012 (www.nobelprize.org).
M03_SILV5197_08_SE_C03.indd 85 12/1/17 12:07 AM
86 CHAPTER 3 Compartmentation: Cells and Tissues
Epidermis consists of multiple cell layers that create a
protective barrier.
The dermis is loose connective tissue that
contains exocrine glands, blood vessels, muscles,
and nerve endings.
Hypodermis contains adipose tissue for insulation.
Vein
(a) The Layers of the Skin
Arrector pili muscles pull hair follicles into a vertical position when the muscle contracts, creating "goose bumps."
Blood vessels extend upward into the dermis.
Sensory receptors monitor external conditions.
Sweat glands secrete a dilute salt fluid to cool the body.
Sebaceous glands are exocrine glands that secrete a lipid mixture.
Apocrine glands in the genitalia, anus, axillae (axilla, armpit), and eyelids release waxy or viscous milky secretions in response to fear or sexual excitement.
Hair follicles secrete the nonliving keratin shaft of hair.
Artery
Sensory nerve
(b) Epidermis
The skin surface is a mat of linked keratin fibers left behind when old epithelial cells die.
Phospholipid matrix acts as the skin's main waterproofing agent.
Melanocytes contain the pigment melanin.
Surface keratinocytes produce keratin fibers.
Desmosomes anchor epithelial cells to each other.
Epidermal cell
Basal lamina
(c) Connection between Epidermis and Dermis
Hemidesmosomes tie epidermal cells to fibers of the basal lamina.
Basal lamina or basement membrane is an acellular layer between epidermis and dermis.
Melanoma Is a Serious Form of Skin Cancer
Melanoma occurs when melanocytes become malignant, often following repeated exposure to UV light. One study found that people who used tanning beds were 24% more likely to develop melanoma.
CLINICAL FOCUS
FIG. 3.15 Focus on . . . The Skin
86
M03_SILV5197_08_SE_C03.indd 86 12/2/17 12:28 AM
example of an organ that incorporates all four types of tissue into an integrated whole. We think of skin as a thin layer that covers the external surfaces of the body, but in reality it is the heaviest single organ, at about 16% of an adult’s total body weight! If it were flattened out, it would cover a surface area of between 1.2 and 2.3 square meters, about the size of a couple of card-table tops. Its size and weight make skin one of the most important organs of the body.
The functions of the skin do not fit neatly into any one chapter of this book, and this is true of some other organs as well. We will highlight several of these organs in special organ Focus features throughout the book. These illustrated boxes discuss the structure and functions of these versatile organs so that you can gain an appreciation for the way different tissues combine for a united purpose. The first of these features, Focus On: The Skin, appears as FIGURE 3.15. Focus On: The Skin, provides an illustration of the structure and function of skin.
As we consider the systems of the body in the succeeding chapters, you will see how diverse cells, tissues, and organs carry out the processes of the living body. Although the body’s cells have different structures and different functions, they have one need in common: a continuous supply of energy. Without energy, cells cannot survive, let alone carry out all the other processes of daily living. Next, we look at energy in living organisms and how cells capture and use the energy released by chemical reactions.
Embryos and fetal tissue are rich sources of stem cells, but the use of embryonic stem cells is controversial and poses many legal and ethical questions. Some researchers hope that adult stem cells will show plasticity, the ability to specialize into a cell of a type different from the type for which they were destined.
There are still many challenges facing us before stem cell therapy becomes a standard medical treatment. One is finding a good source of stem cells. A second major challenge is determin- ing the chemical signals that tell stem cells when to differenti- ate and what type of cell to become. And even once these two challenges are overcome and donor stem cells are implanted, the body may recognize that the new cells are foreign tissue and try to reject them.
Stem cell research is an excellent example of the dynamic and often controversial nature of science. For the latest research findings, as well as pending legislation and laws regulating stem cell research and use, check authoritative websites, such as that sponsored by the U.S. National Institutes of Health (http:// stemcells.nih.gov).
3.6 Organs Groups of tissues that carry out related functions may form struc- tures known as organs. The organs of the body contain the four types of tissue in various combinations. The skin is an excellent
RUNNING PROBLEM CONCLUSION Pap Tests Save Lives
In this running problem, you learned that the Pap test can detect the early cell changes that precede cervical cancer. The diag- nosis is not always simple because the change in cell cytology from normal to cancerous occurs along a continuum and can be subject to individual interpretation. In addition, not all cell changes are cancerous. The human papillomavirus (HPV), a common sexually transmitted infection, can also cause cervical dysplasia. In most cases, the woman’s immune system over- comes the virus within two years, and the cervical cells revert
Question Facts Integration and Analysis
Q1: Why does the treatment of cancer focus on killing the cancerous cells?
Cancerous cells divide uncontrollably and fail to coordinate with normal cells. Cancerous cells fail to differentiate into specialized cells.
Unless removed, cancerous cells will displace normal cells. This may cause destruction of normal tissues. In addition, because cancerous cells do not become specialized, they cannot carry out the same functions as the specialized cells they displace.
Q2: What is happening in cancer cells that explains the large size of their nucleus and the relatively small amount of cytoplasm?
Cancerous cells divide uncontrollably. Dividing cells must duplicate their DNA prior to cell division, and this DNA duplication takes place in the nucleus, leading to the large size of that organelle. (See Appendix C.)
Actively reproducing cells are likely to have more DNA in their nucleus as they prepare to divide, so their nuclei tend to be larger. Each cell division splits the cytoplasm between two daughter cells. If division is occurring rap- idly, the daughter cells may not have time to synthesize new cytoplasm, so the amount of cytoplasm is less than in a normal cell.
to normal. A small number of women with persistent HPV infec- tions have a higher risk of developing cervical cancer, however. Studies indicate that 98% of cervical cancers are associated with HPV infection. To learn more about the association between HPV and cervical cancer, go to the National Cancer Institute home page (www.cancer.gov) and search for HPV. This site also contains information about cervical cancer. To check your under- standing of the running problem, compare your answers with the information in the following summary table.
– Continued next page
3.6 Organs 87
M03_SILV5197_08_SE_C03.indd 87 12/1/17 12:07 AM
CHAPTER SUMMARY Cell biology and histology illustrate one of the major themes in physiol- ogy: compartmentation. In this chapter, you learned how a cell is subdivided into two main compartments—the nucleus and the cytoplasm. You also learned how cells form tissues that create larger compartments within the body. A second theme in this chapter is the molecular interactions that create the mechanical properties of cells and tissues. Protein fibers of the cytoskeleton and cell junctions, along with the molecules that make up the extracellular matrix, form the “glue” that holds tissues together.
3.1 Functional Compartments of the Body 1. The cell is the functional unit of living organisms. (p. 59) 2. The major human body cavities are the cranial cavity (skull),
thoracic cavity (thorax), and abdominopelvic cavity. (p. 59; Fig. 3.1a) 3. The lumens of some hollow organs are part of the body’s exter-
nal environment. (p. 59) 4. The body fluid compartments are the extracellular fluid (ECF)
outside the cells and the intracellular fluid (ICF) inside the cells. The ECF can be subdivided into interstitial fluid bathing the cells and plasma, the fluid portion of the blood. (p. 61; Fig. 3.1b)
3.2 Biological Membranes 5. The word membrane is used both for cell membranes and for tissue
membranes that line a cavity or separate two compartments. (p. 61; Fig. 3.1c)
6. The cell membrane acts as a barrier between the intracellular and extracellular fluids, provides structural support, and regulates exchange and communication between the cell and its environ- ment. (p. 61)
7. The fluid mosaic model of a biological membrane shows it as a phospholipid bilayer with proteins inserted into the bilayer. (p. 62; Fig. 3.2b)
8. Membrane lipids include phospholipids, sphingolipids, and cho- lesterol. Lipid-anchored proteins attach to membrane lipids. (p. 62)
9. Transmembrane proteins are integral proteins tightly bound to the phospholipid bilayer. Peripheral proteins attach less tightly to either side of the membrane. (p. 63; Fig. 3.2b, c)
10. Carbohydrates attach to the extracellular surface of cell mem- branes. (p. 62)
Question Facts Integration and Analysis
Q3: What other kinds of damage or trauma are cervical epithelial cells normally subjected to?
The cervix is the passageway between the uterus and vagina.
The cervix is subject to trauma or damage, such as might occur during sexual intercourse and childbirth.
Q4: Which of its two types of epithelia is more likely to be affected by trauma?
The cervix consists of secretory epithe- lium with mucus-secreting glands lining the inside and protective epithelium cov- ering the outside.
Protective epithelium is composed of multiple layers of cells and is designed to protect areas from mechanical and chemical stress [p. 79]. Therefore, the secretory epithelium with its single-cell layer is more easily damaged.
Q5: Jan’s first Pap test showed atypical squamous cells of unknown significance (ASCUS). Were these cells more likely to come from the secretory portion of the cervix or from the protec- tive epithelium?
Secretory cells are columnar epithelium. Protective epithelium is composed of multiple cell layers.
Protective epithelium with multiple cell layers has cells that are flat (stratified squamous epi- thelium). The designation ASC refers to these protective epithelial cells.
Q6: Has Jan’s dysplasia improved or worsened? What evidence do you have to support your answer?
The slide from Jan’s first Pap test shows abnormal cells with large nuclei and little cytoplasm. These abnormal cells do not appear in the second test.
The disappearance of the abnormal cells indi- cates that Jan’s dysplasia has resolved. She will return in another year for a repeat Pap test. If it shows no dysplasia, her cervical cells have reverted to normal.
Q7: Use your answer to question 6 to predict whether Jan’s HPV infection has persisted or been cleared by her immune system.
The cells in the second Pap test appear normal.
Once Jan’s body fights off the HPV infection, her cervical cells should revert to normal. Her second HPV test should show no evidence of HPV infection.
RUNNING PROBLEM CONCLUSION Continued
59 61 65 79 84 87
88 CHAPTER 3 Compartmentation: Cells and Tissues
M03_SILV5197_08_SE_C03.indd 88 12/1/17 12:07 AM
C H
A P
TER
33
3.3 Intracellular Compartments 11. The cytoplasm consists of semi-gelatinous cytosol with dissolved
nutrients, ions, and waste products. Suspended in the cytosol are the other components of the cytoplasm: insoluble inclusions and fibers, which have no enclosing membrane, and organelles, which are membrane-enclosed bodies that carry out specific functions. (p. 65; Fig. 3.4a)
12. Ribosomes are inclusions that take part in protein synthesis. (p. 65)
13. Insoluble protein fibers come in three sizes: actin fibers (also called microfilaments), intermediate filaments, and microtubules. (p. 68; Tbl. 3.2)
14. Centrioles that aid the movement of chromosomes during cell division, cilia that move fluid or secretions across the cell surface, and flagella that propel sperm through body fluids are made of microtubules. (p. 68; Figs. 3.4e, 3.5)
15. The changeable cytoskeleton provides strength, support, and internal organization; aids transport of materials within the cell; links cells together; and enables motility in certain cells. (p. 68; Fig. 3.4b)
16. Motor proteins such as myosins, kinesins, and dyneins asso- ciate with cytoskeleton fibers to create movement. (p. 69; Fig. 3.6)
17. Membranes around organelles create compartments that separate functions. (p. 70)
18. Mitochondria generate most of the cell’s ATP. (p. 70; Fig. 3.4g) 19. The smooth endoplasmic reticulum is the primary site of
lipid synthesis. The rough endoplasmic reticulum is the pri- mary site of protein synthesis. (p. 70; Fig. 3.4i)
20. The Golgi apparatus packages proteins into vesicles. Secre- tory vesicles release their contents into the extracellular fluid. (p. 70; Fig. 3.4h)
21. Lysosomes and peroxisomes are small storage vesicles that contain digestive enzymes. (p. 71; Figs. 3.4c, d)
22. The nucleus contains DNA, the genetic material that ultimately controls all cell processes, in the form of chromatin. The double- membrane nuclear envelope surrounding the nucleus has nuclear pore complexes that allow controlled chemical commu- nication between the nucleus and cytosol. Nucleoli are nuclear areas that control the synthesis of RNA for ribosomes. (p. 71; Fig. 3.4j)
23. Protein synthesis is an example of how the cell separates func- tions by isolating them to separate compartments within the cell (p. 71; Fig. 3.7)
3.4 Tissues of the Body 24. There are four primary tissue types in the human body: epithelial,
connective, muscle, and neural. (p. 73) 25. Extracellular matrix secreted by cells provides support and a
means of cell-cell communication. It is composed of proteoglycans and insoluble protein fibers. (p. 73)
26. Animal cell junctions fall into three categories. Gap junctions allow chemical and electrical signals to pass directly from cell to cell. Tight junctions restrict the movement of material between cells. Anchoring junctions hold cells to each other or to the extracellular matrix. (p. 75; Fig. 3.8)
27. Membrane proteins called cell adhesion molecules (CAMs) are essential in cell adhesion and in anchoring junctions. (p. 73; Tbl. 3.3)
28. Desmosomes and adherens junctions anchor cells to each other. Focal adhesions and hemidesmosomes anchor cells to matrix. (p. 75; Fig. 3.8)
29. Epithelial tissues protect the internal environment, regulate the exchange of material, or manufacture and secrete chemicals. There are five functional types found in the body: exchange, transporting, ciliated, protective, and secretory. (p. 75; Fig. 3.9)
30. Exchange epithelia permit rapid exchange of materials, particularly gases. Transporting epithelia actively regulate the selective exchange of nongaseous materials between the internal and external environments. Ciliated epithelia move fluid and particles across the surface of the tissue. Protective epithelia help prevent exchange between the internal and external environments. The secretory epithelia release secretory products into the external environment or the blood. (p. 77; Fig. 3.10)
31. Exocrine glands release their secretions into the external envi- ronment through ducts. Endocrine glands are ductless glands that release their secretions, called hormones, directly into the extracellular fluid. (p. 79; Fig. 3.9b)
32. Connective tissues have extensive extracellular matrix that provides structural support and forms a physical barrier. (p. 80; Fig. 3.12)
33. Loose connective tissues are the elastic tissues that under- lie skin. Dense connective tissues, including tendons and ligaments, have strength or flexibility because they are made of collagen. Adipose tissue stores fat. The connective tissue we call blood is characterized by a watery matrix. Cartilage is solid and flexible and has no blood supply. The fibrous matrix of bone is hardened by deposits of calcium salts. (p. 82; Fig. 3.13)
34. Muscle and neural tissues are called excitable tissues because of their ability to generate and propagate electrical signals called action potentials. Muscle tissue has the ability to contract and produce force and movement. There are three types of muscle: car- diac, smooth, and skeletal. (p. 82)
35. Neural tissue includes neurons, which use electrical and chemi- cal signals to transmit information from one part of the body to another, and support cells known as glial cells (neuroglia). (p. 82)
3.5 Tissue Remodeling 36. Cell death occurs by necrosis, which adversely affects neighbor-
ing cells, and by apoptosis, programmed cell death that does not disturb the tissue. (p. 84)
37. Stem cells are cells that are able to reproduce themselves and differentiate into specialized cells. Stem cells are most plentiful in embryos but are also found in the adult body. (p. 85)
3.6 Organs 38. Organs are formed by groups of tissues that carry out related
functions. The organs of the body contain the four types of tissues in various ratios. For example, skin is largely connective tissue. (p. 87)
Chapter Summary 89
M03_SILV5197_08_SE_C03.indd 89 12/1/17 12:07 AM
REVIEW QUESTIONS In addition to working through these questions and checking your answers on p. A3, review the Learning Outcomes at the beginning of this chapter.
Level One Reviewing Facts and Terms 1. List the four general functions of the cell membrane.
2. In 1972, Singer and Nicolson proposed the fluid mosaic model of the cell membrane. According to this model, the membrane is composed of a bilayer of and a variety of embedded , with on the extracellular surface.
3. What are the two primary types of biomolecules found in the cell membrane?
4. Define and distinguish between inclusions and organelles. Give an example of each.
5. Define cytoskeleton. List five functions of the cytoskeleton.
6. Match each term with the description that fits it best:
(a) cilia
(b) centriole
(c) flagellum
(d) centrosome
1. in human cells, appears as single, long, whip- like tail
2. short, hairlike structures that beat to produce currents in fluids
3. a bundle of microtubules that aid in mitosis
4. the microtubule-organizing center
7. Exocrine glands produce watery secretions (such as tears or sweat) called secretions, or stickier solutions called secretions.
8. Match each organelle with its function:
(a) endoplasmic reticulum
(b) Golgi apparatus
(c) lysosome
(d) mitochondrion
(e) peroxisome
1. powerhouse of the cell where most ATP is produced
2. degrades long-chain fatty acids and toxic foreign molecules
3. network of membranous tubules that syn- thesize biomolecules
4. digestive system of cell, degrading or recy- cling components
5. modifies and packages proteins into vesicles
9. What process activates the enzymes inside lysosomes?
10. glands release hormones, which enter the blood and regu- late the activities of organs or systems.
11. List the four major tissue types. Give an example and location of each.
12. The largest and heaviest organ in the body is the .
13. Match each protein to its function. Functions in the list may be used more than once.
(a) cadherin 1. membrane protein used to form cell junctions
(b) CAM 2. matrix glycoprotein used to anchor cells
(c) collagen 3. protein found in gap junctions
(d) connexin 4. matrix protein found in connective tissue
(e) elastin
(f) fibrillin
(g) fibronectin
(h) integrin
(i) occludin
14. What types of glands can be found within the skin? Name the secretion of each type.
15. The term matrix can be used in reference to an organelle or to tis- sues. Compare the meanings of the term in these two contexts.
Level Two Reviewing Concepts 16. List, compare, and contrast the three types of cell junctions and
their subtypes. Give an example of where each type can be found in the body and describe its function in that location.
17. Which would have more rough endoplasmic reticulum: pancreatic cells that manufacture the protein hormone insulin, or adrenal cor- tex cells that synthesize the steroid hormone cortisol?
18. A number of organelles can be considered vesicles. Define vesicle and describe at least three examples.
19. Explain why a stratified epithelium offers more protection than a simple epithelium.
20. Transform this list of terms into a map of cell structure. Add func- tions where appropriate.
• actin • microfilament
• cell membrane • microtubule
• centriole • mitochondria
• cilia • nonmembranous organelle
• cytoplasm • nucleus
• cytoskeleton • organelle
• cytosol • peroxisome
• extracellular matrix • ribosome
• flagella • rough ER
• Golgi apparatus • secretory vesicle
• intermediate filament • smooth ER
• keratin • storage vesicle
• lysosome • tubulin
21. Sketch a short series of columnar epithelial cells. Label the apical and basolateral borders of the cells. Briefly explain the different kinds of junctions found on these cells.
22. Arrange the following compartments in the order a glucose mol- ecule entering the body at the intestine would encounter them: interstitial fluid, plasma, intracellular fluid. Which of these fluid compartments is/are considered extracellular fluid(s)?
23. Explain how inserting cholesterol into the phospholipid bilayer of the cell membrane decreases membrane permeability.
24. Compare and contrast the structure, locations, and functions of bone and cartilage.
25. Differentiate between the terms in each set below:
(a) lumen and wall (b) cytoplasm and cytosol (c) myosin and keratin
26. When a tadpole turns into a frog, its tail shrinks and is reabsorbed. Is this an example of necrosis or apoptosis? Defend your answer.
90 CHAPTER 3 Compartmentation: Cells and Tissues
M03_SILV5197_08_SE_C03.indd 90 12/1/17 12:07 AM
C H
A P
TER
3
27. Match the structures from the chapter to the basic physiological themes in the right column and give an example or explanation for each match. A structure may match with more than one theme.
(a) cell junctions 1. communication
(b) cell membrane 2. molecular interactions
(c) cytoskeleton 3. compartmentation
(d) organelles 4. mechanical properties
(e) cilia 5. biological energy use
28. In some instances, the extracellular matrix can be quite rigid. How might developing and expanding tissues cope with a rigid matrix to make space for themselves?
Level Three Problem Solving 29. One result of cigarette smoking is paralysis of the cilia that line the
respiratory passageways. What function do these cilia serve? Based on what you have read in this chapter, why is it harmful when they no longer beat? What health problems would you expect to arise? How does this explain the hacking cough common among smokers?
30. Cancer is abnormal, uncontrolled cell division. What property of epithelial tissues might (and does) make them more prone to devel- oping cancer?
31. What might happen to normal physiological function if matrix metalloproteinases are inhibited by drugs?
Answers to Concept Checks, Figure and Graph Questions, and end-of-chapter Review Questions can be found in Appendix A [p. A-1].
Review Questions 91
M03_SILV5197_08_SE_C03.indd 91 12/1/17 12:07 AM
4 Energy and Cellular Metabolism
4.1 Energy in Biological Systems 93
LO 4.1.1 Define energy. Describe three categories of work that require energy.
LO 4.1.2 Distinguish between kinetic and potential energy, and describe potential energy in biological systems.
LO 4.1.3 Explain the first and second laws of thermodynamics and how they apply to the human body.
4.2 Chemical Reactions 96 LO 4.2.1 Describe four common types of
chemical reactions. LO 4.2.2 Explain the relationships between free
energy, activation energy, and endergonic and exergonic reactions.
LO 4.2.3 Apply the concepts of free energy and activation energy to reversible and irreversible reactions.
4.3 Enzymes 98 LO 4.3.1 Explain what enzymes are and how
they facilitate biological reactions. LO 4.3.2 How do the terms isozyme, coenzyme,
proenzyme, zymogen, and cofactor apply to enzymes?
LO 4.3.3 Name and explain the four major cat- egories of enzymatic reactions.
4.4 Metabolism 102 LO 4.4.1 Define metabolism, anabolism, and
catabolism. LO 4.4.2 List five ways cells control the flow of
molecules through metabolic pathways. LO 4.4.3 Explain the roles of the following
molecules in biological energy transfer and storage: ADP, ATP, NADH, FADH2, NADPH.
LO 4.4.4 Outline the pathways for aerobic and anaerobic metabolism of glucose, and com- pare the energy yields of the two pathways.
There is no good evidence that . . . life evades the second law of thermodynamics, but in the downward course of the energy-flow it interposes a barrier and dams up a reservoir which provides potential for its own remarkable activities. F. G. Hopkins, 1933. “Some Chemical Aspects of Life,” presidential address to the 1933 meeting of British Association for the Advancement of Science
BACKGROUND BASICS 35 DNA and RNA 65 Organelles 30 Lipids 38 Hydrogen bonds 32 Protein structure 46 Protein interactions 33 Covalent bonds 31 Carbohydrates 20 Graphing 34 ATP
LO 4.4.5 Write two equations for aerobic metabolism of one glucose molecule: one using only words and a second using the chemical formula for glucose.
LO 4.4.6 Explain how the electron transport system creates the high-energy bond of ATP.
LO 4.4.7 Describe how the genetic code of DNA is transcribed and translated to create proteins.
LO 4.4.8 Explain the roles of transcription factors, alternative splicing, and posttransla- tional modification in protein synthesis.
Mitochondrion
M04_SILV5197_08_SE_C04.indd 92 12/1/17 12:08 AM
C H
A P
TER
4
4.1 Energy in Biological Systems 93
C hristine Schmidt, Ph.D., and her graduate students create an engineered matrix and seed them with neurons. They know that if their work is successful and the neurons grow
along the scaffold, their work may help people with spinal cord injuries regain function. Just as a child playing with building blocks assembles them into a house, the bioengineer and her students create tissue from cells. In both cases someone familiar with the starting components, building blocks or cells, can predict what the final product will be: blocks make buildings; cells make tissues.
Why then can’t biologists, knowing the characteristics of nucleic acids, proteins, lipids, and carbohydrates, explain how combinations of these molecules acquire the remarkable attributes of a living cell? How can living cells carry out processes that far exceed what we would predict from understanding their individual components? The answer is emergent properties [p. 2], those distinc- tive traits that cannot be predicted from the simple sum of the component parts. For example, if you came across a collection of metal pieces and bolts from a disassembled car motor, could you predict (without prior knowledge) that, given an energy source and properly arranged, this collection could create the power to move thousands of pounds?
The emergent properties of biological systems are of tremen- dous interest to scientists trying to explain how a simple compart- ment, such as a phospholipid liposome [p. 63], could have evolved into the first living cell. Pause for a moment and see if you can list the properties of life that characterize all living creatures. If you were a scientist looking at pictures and samples sent back from Mars, what would you look for to determine whether life exists there?
Now compare your list with the one in TABLE 4.1. Living organisms are highly organized and complex entities. Even a one-celled bacterium, although it appears simple under a
1. Have a complex structure whose basic unit of organization is the cell
2. Acquire, transform, store, and use energy
3. Sense and respond to internal and external environments
4. Maintain homeostasis through internal control systems with feedback
5. Store, use, and transmit information
6. Reproduce, develop, grow, and die
7. Have emergent properties that cannot be predicted from the simple sum of the parts
8. Individuals adapt and species evolve
TABLE 4.1 Properties of Living Organisms
microscope, has incredible complexity at the chemical level of organization. It uses intricately interconnected biochemi- cal reactions to acquire, transform, store, and use energy and information. It senses and responds to changes in its internal and external environments and adapts so that it can maintain homeostasis. It reproduces, develops, grows, and dies; and over time, its species evolves.
Energy is essential for the processes we associate with living things. Without energy for growth, repair, and maintenance of the internal environment, a cell is like a ghost town filled with buildings that are slowly crumbling into ruin. Cells need energy to import raw materials, make new molecules, and repair or recycle aging parts. The ability of cells to extract energy from the external envi- ronment and use that energy to maintain themselves as organized, functioning units is one of their most outstanding characteristics. In this chapter, we look at the cell processes through which the human body obtains energy and maintains its ordered systems. You will learn how protein interactions [p. 46] apply to enzyme activity and how the subcellular compartments [p. 8] separate vari- ous steps of energy metabolism.
4.1 Energy in Biological Systems Energy cycling between the environment and living organisms is one of the fundamental concepts of biology. All cells use energy from their environment to grow, make new parts, and reproduce. Plants trap radiant energy from the sun and store it as chemical- bond energy through the process of photosynthesis (FIG. 4.1). They extract carbon and oxygen from carbon dioxide, nitrogen from the soil, and hydrogen and oxygen from water to make biomolecules such as glucose and amino acids.
Animals, on the other hand, cannot trap energy from the sun or use carbon and nitrogen from the air and soil to synthesize bio- molecules. They must import chemical-bond energy by ingesting the biomolecules of plants or other animals. Ultimately, however, energy trapped by photosynthesis is the energy source for all ani- mals, including humans.
RUNNING PROBLEM Tay-Sachs Disease: A Deadly Inheritance
In many American ultra-orthodox Jewish communities—in which arranged marriages are the norm—the rabbi is entrusted with an important, life-saving task. He keeps a confidential record of indi- viduals known to carry the gene for Tay-Sachs disease, a fatal, inherited condition that strikes 1 in 3,600 American Jews of East- ern European descent. Babies born with this disease rarely live beyond age 4, and there is no cure. Based on the family trees he constructs, the rabbi can avoid pairing two individuals who carry the deadly gene.
Sarah and David, who met while working on their college newspaper, are not orthodox Jews. Both are aware, however, that their Jewish ancestry might put any children they have at risk for Tay-Sachs disease. Six months before their wedding, they decide to see a genetic counselor to determine whether they are carriers of the gene for Tay-Sachs disease.
93 99 100 104 110 118
M04_SILV5197_08_SE_C04.indd 93 12/1/17 12:08 AM
94 CHAPTER 4 Energy and Cellular Metabolism
Transport work enables cells to move ions, molecules, and larger particles through the cell membrane and through the mem- branes of organelles in the cell. Transport work is particularly useful for creating concentration gradients, distributions of molecules in which the concentration is higher on one side of a membrane than on the other. For example, certain types of endo- plasmic reticulum [p. 70] use energy to import calcium ions from the cytosol. This ion transport creates a high calcium concentra- tion inside the organelle and a low concentration in the cytosol. If calcium is then released back into the cytosol, it creates a “calcium signal” that causes the cell to perform some action, such as muscle contraction.
Mechanical work in animals is used for movement. At the cellular level, movement includes organelles moving around in a cell, cells changing shape, and cilia and flagella beating [p. 68]. At the macroscopic level in animals, movement usually involves muscle contraction. Most mechanical work is mediated by motor proteins that make up certain intracellular fibers and filaments of the cytoskeleton [p. 68].
Energy Comes in Two Forms: Kinetic and Potential Energy can be classified in various ways. We often think of energy in terms we deal with daily: thermal energy, electrical energy, mechanical energy. We speak of energy stored in chemical bonds. Each type of energy has its own characteristics. However, all types of energy share an ability to appear in two forms: as kinetic energy or as potential energy.
Animals extract energy from biomolecules through the process of respiration, which consumes oxygen and produces carbon dioxide and water. If animals ingest more energy than they need for imme- diate use, the excess energy is stored in chemical bonds, just as it is in plants. Glycogen (a glucose polymer) and lipid molecules are the main energy stores in animals [p. 31]. These storage molecules are available for use at times when an animal’s energy needs exceed its food intake.
Concept Check
1. Which biomolecules always include nitrogen in their chemical makeup?
FIG. 4.1 Energy transfer in the environment
Photosynthesis takes place in
plant cells, yielding:
Radiant energy
O2O2
Energy lost to environment
Heat energy
Energy stored in biomolecules
Sun
CO2 Respiration
takes place in human cells, yielding:
Energy for work
Energy stored in biomolecules
CO2H2O +
+
Transfer of radiant or heat energy
Transfer of energy in chemical bonds
H2O
N2
KEY
Plants trap radiant energy from the sun and store it in the chemical bonds of biomolecules.
Animals eat the plants and either use the energy or store it.
Energy Is Used to Perform Work All living organisms obtain, store, and use energy to fuel their activities. Energy can be defined as the capacity to do work, but what is work? We use this word in everyday life to mean various things, from hammering a nail to sitting at a desk writing a paper. In biological systems, however, the word means one of three spe- cific things: chemical work, transport work, or mechanical work.
Chemical work is the making and breaking of chemical bonds. It enables cells and organisms to grow, maintain a suitable internal environment, and store information needed for reproduc- tion and other activities. Forming the chemical bonds of a protein is an example of chemical work.
M04_SILV5197_08_SE_C04.indd 94 12/1/17 12:08 AM
C H
A P
TER
4
4.1 Energy in Biological Systems 95
2. Potential energy is stored in the stationary ball at the top of the ramp (Fig. 4.2b). No work is being performed, but the capacity to do work is stored in the position of the ball.
3. The potential energy of the ball becomes kinetic energy when the ball rolls down the ramp (Fig. 4.2c). Some kinetic energy is lost to the environment as heat due to friction between the ball and the air and ramp.
In biological systems, potential energy is stored in concentra- tion gradients and chemical bonds. It is transformed into kinetic energy when needed to do chemical, transport, or mechanical work.
Thermodynamics Is the Study of Energy Use Two basic rules govern the transfer of energy in biological systems and in the universe as a whole. The first law of thermodynamics, also known as the law of conservation of energy, states that the total amount of energy in the universe is constant. The universe is considered to be a closed system—nothing enters and nothing leaves. Energy can be converted from one type to another, but the total amount of energy in a closed system never changes.
The human body is not a closed system, however. As an open system, it exchanges materials and energy with its surroundings. Because our bodies cannot create energy, they import it from out- side in the form of food. By the same token, our bodies lose energy, especially in the form of heat, to the environment. Energy that stays within the body can be changed from one type to another or can be used to do work.
The second law of thermodynamics states that natu- ral spontaneous processes move from a state of order (non-ran- domness) to a condition of randomness or disorder, also known as entropy. Creating and maintaining order in an open system such as the body requires the input of energy. Disorder occurs when open systems lose energy to their surroundings without regaining it. When this happens, we say that the entropy of the open system has increased.
Kinetic energy is the energy of motion 5kinetikos, motion6. A ball rolling down a hill, perfume molecules spreading through the air, electric charge flowing through power lines, heat warming a frying pan, and molecules moving across bio- logical membranes are all examples of bodies that have kinetic energy.
Potential energy is stored energy. A ball poised at the top of a hill has potential energy because it has the potential to start mov- ing down the hill. A molecule positioned on the high-concentration side of a concentration gradient stores potential energy because it has the potential energy to move down the gradient. In chemical bonds, potential energy is stored in the position of the electrons that form the bond [p. 33]. To learn more about kinetic and poten- tial energy, see Appendix B.
A key feature of all types of energy is the ability of potential energy to become kinetic energy and vice versa.
Energy Can Be Converted from One Form to Another Recall that a general definition of energy is the capacity to do work. Work always involves movement and therefore is associated with kinetic energy. Potential energy can also be used to perform work, but the potential energy must first be converted to kinetic energy. The conversion from potential energy to kinetic energy is never 100% efficient, and a certain amount of energy is lost to the environment, usually as heat.
The amount of energy lost in the transformation depends on the efficiency of the process. Many physiological processes in the human body are not very efficient. For example, 70% of the energy used in physical exercise is lost as heat rather than trans- formed into the work of muscle contraction.
FIGURE 4.2 summarizes the relationship of kinetic energy and potential energy:
1. Kinetic energy of the moving ball is transformed into potential energy as work is used to push the ball up the ramp (Fig. 4.2a).
FIG. 4.2 Kinetic and potential energy
(a) Work is used to push a ball up a ramp. Kinetic energy of movement up the ramp is being stored in the potential energy of the ball’s position.
(c) The ball rolling down the ramp is converting the potential energy to kinetic energy. However, the conversion is not totally efficient, and some energy is lost as heat due to friction between the ball, ramp, and air.
(b) The ball sitting at the top of the ramp has potential energy, the potential to do work.
Kinetic energy Kinetic energyPotential energy
M04_SILV5197_08_SE_C04.indd 95 12/1/17 12:08 AM
96 CHAPTER 4 Energy and Cellular Metabolism
energy than the carbon dioxide and water from which it was synthesized. The high free energy of complex molecules such as glycogen is the reason that these molecules are used to store energy in cells.
To understand how chemical reactions transfer energy between molecules, we should answer two questions. First, how do reactions get started? The energy required to initiate a reac- tion is known as the activation energy for the reaction. Second, what happens to the free energy of the products and reactants during a reaction? The difference in free energy between reactants and products is the net free energy change of the reaction.
Activation Energy Gets Reactions Started Activation energy is the initial input of energy required to bring reactants into a position that allows them to react with one another. This “push” needed to start the reaction is shown in FIGURE 4.3a as the little hill up which the ball must be pushed before it can roll by itself down the slope. A reaction with low activation energy proceeds spontaneously when the reactants are brought together. You can demonstrate a sponta- neous reaction by pouring a little vinegar onto some baking soda and watching the two react to form carbon dioxide. Reactions with high activation energies either do not proceed spontane- ously or else proceed too slowly to be useful. For example, if you pour vinegar over a pat of butter, no observable reaction takes place.
Energy Is Trapped or Released during Reactions One characteristic property of any chemical reaction is the free energy change that occurs as the reaction proceeds. The prod- ucts of a reaction have either a lower free energy than the reac- tants or a higher free energy than the reactants. A change in free energy level means that the reaction has either released or trapped energy.
If the free energy of the products is lower than the free energy of the reactants, as in Figure 4.3b, the reaction releases energy and is called an exergonic reaction 5ex@, out + ergon, work6. The energy released by an exergonic, or energy-producing, reaction may be used by other molecules to do work or may be given off as
The ghost town analogy mentioned earlier illustrates the sec- ond law. When people put all their energy into activities away from town, the town slowly falls into disrepair and becomes less organized (its entropy increases). Similarly, without continual input of energy, a cell is unable to maintain its ordered internal environ- ment. As the cell loses organization, its ability to carry out normal functions disappears, and it dies.
In the remainder of this chapter, you will learn how cells obtain energy from and store energy in the chemical bonds of bio- molecules. Using chemical reactions, cells transform the potential energy of chemical bonds into kinetic energy for growth, mainte- nance, reproduction, and movement.
Concept Check
2. Name two ways animals store energy in their bodies. 3. What is the difference between potential energy and kinetic
energy? 4. What is entropy?
4.2 Chemical Reactions Living organisms are characterized by their ability to extract energy from the environment and use it to support life processes. The study of energy flow through biological systems is a field known as bioenergetics 5bios, life + en@, in + ergon, work6. In a biological system, chemical reactions are a critical means of transferring energy from one part of the system to another.
Energy Is Transferred between Molecules during Reactions In a chemical reaction, a substance becomes a different sub- stance, usually by the breaking and/or making of covalent bonds. A reaction begins with one or more molecules called reactants and ends with one or more molecules called products (TBL. 4.2). In this discussion, we consider a reaction that begins with two reac- tants and ends with two products:
A + B S C + D
The speed with which a reaction takes place, the reaction rate, is the disappearance rate of the reactants (A and B) or the appearance rate of the products (C and D). Reaction rate is mea- sured as change in concentration during a certain time period and is often expressed as molarity per second (M/sec).
The purpose of chemical reactions in cells is either to transfer energy from one molecule to another or to use energy stored in reactant molecules to do work. The potential energy stored in the chemical bonds of a molecule is known as the free energy of the molecule. Generally, complex molecules have more chemical bonds and therefore higher free energies.
For example, a large glycogen molecule has more free energy than a single glucose molecule, which in turn has more free
Reaction Type Reactants (Substrates) Products
Combination A + B ¡ C
Decomposition C ¡ A + B
Single displacement*
L + MX ¡ LX + M
Double displacement*
LX + MY ¡ LY + MX
*X and Y represent atoms, ions, or chemical groups.
TABLE 4.2 Chemical Reactions
M04_SILV5197_08_SE_C04.indd 96 12/1/17 12:08 AM
C H
A P
TER
4
4.2 Chemical Reactions 97
heat. In a few cases, the energy released in an exergonic reaction is stored as potential energy in a concentration gradient.
An important biological example of an exergonic reaction is the combination of ATP and water to form ADP, inorganic phosphate (Pi) and H
+. Energy is released during this reaction when the high-energy phosphate bond of the ATP molecule is broken:
ATP + H2O S ADP + Pi + H+ + energy
Now contrast the exergonic reaction of Figure 4.3b with the reaction represented in Figure 4.3c. In the latter, products retain part of the activation energy that was added, making their free energy greater than that of the reactants. These reactions that require a net input of energy are said to be endergonic 5end(o), within + ergon, work6, or energy-utilizing, reactions.
Some of the energy added to an endergonic reaction remains trapped in the chemical bonds of the products. These energy-con- suming reactions are often synthesis reactions, in which complex molecules are made from smaller molecules. For example, an end- ergonic reaction links many glucose molecules together to create the glucose polymer glycogen. The complex glycogen molecule has more free energy than the simple glucose molecules used to make it.
If a reaction traps energy as it proceeds in one direction (A + B S C + D), it releases energy as it proceeds in the reverse direction (C + D S A + B). (The naming of forward and reverse directions is arbitrary.) For example, the energy trapped in the bonds of glycogen during its synthesis is released when glycogen is broken back down into glucose.
Coupling Endergonic and Exergonic Reactions Where does the activation energy for metabolic reactions come from? The sim- plest way for a cell to acquire activation energy is to couple an exergonic reaction to an endergonic reaction. Some of the most familiar coupled reactions are those that use the energy released by breaking the high-energy bond of ATP to drive an endergonic reaction:
E + F G + H
In this type of coupled reaction, the two reactions take place simultaneously and in the same location, so that the energy from ATP can be used immediately to drive the endergonic reaction between reactants E and F.
However, it is not always practical for reactions to be directly coupled like this. Consequently, living cells have developed ways to trap the energy released by exergonic reactions and save it for later use. The most common method is to trap the energy in the form of high-energy electrons carried on nucleotides [p. 34]. The nucleotide molecules NADH, FADH2, and NADPH all capture energy in the electrons of their hydrogen atoms (FIG. 4.4). NADH and FADH2 usually transfer most of this energy to ATP, which can then be used to drive endergonic reactions.
FIG. 4.3 Activation energy in exergonic and endergonic reactions
Reactants
Starting free energy level
Final free energy level
Activation energy
Activation energy
Activation energy
Products
Time
Net free energy change
C+D
A+B
G+H
Fr ee
e n er
g y
o f
m o
le cu
le Fr
ee e
n er
g y
o f
m o
le cu
le
Time
Net free energy change
E+F
Reactants Activation of reaction
Reaction process
Products
(b) Exergonic reactions release energy because the products have less energy than the reactants.
(c) Endergonic reactions trap some activation energy in the products, which then have more free energy than the reactants.
(a) Activation energy is the “push” needed to start a reaction.
KEY
ATP ADP + Pi
M04_SILV5197_08_SE_C04.indd 97 12/1/17 12:08 AM
98 CHAPTER 4 Energy and Cellular Metabolism
4.3 Enzymes Enzymes are proteins that speed up the rate of chemical reac- tions. During these reactions, the enzyme molecules are not changed in any way, meaning they are biological catalysts. Without enzymes, most chemical reactions in a cell would go so slowly that the cell would be unable to live. Because an enzyme is not perma- nently changed or used up in the reaction it catalyzes, we might write it in a reaction equation this way:
A + B + enzyme S C + D + enzyme
This way of writing the reaction shows that the enzyme par- ticipates with reactants A and B but is unchanged at the end of the reaction. A more common shorthand for enzymatic reactions shows the name of the enzyme above the reaction arrow, like this:
A + B ¡ enzyme
C + D
In enzymatically catalyzed reactions, the reactants A and B are called substrates.
Net Free Energy Change Determines Reaction Reversibility The net free energy change of a reaction plays an important role in determining whether that reaction can be reversed, because the net free energy change of the forward reaction contributes to the activation energy of the reverse reaction. A chemical reaction that can proceed in both directions is called a reversible reaction. In a reversible reaction, the forward reaction A + B S C + D and its reverse reaction C + D S A + B are both likely to take place. If a reaction proceeds in one direction but not the other, it is an irreversible reaction.
For example, look at the activation energy of the reaction C + D S A + B in FIGURE 4.5. This reaction is the reverse of the reaction shown in Figure 4.3b. Because a lot of energy was released in the forward reaction A + B S C + D, the activa- tion energy of the reverse reaction is substantial (Fig. 4.5). As you will recall, the larger the activation energy, the less likely it is that the reaction will proceed spontaneously. Theoretically, all reactions can be reversed with enough energy input, but
FIG. 4.4 Energy in biological reactions
ENERGY released
Heat energy
ENERGY
NADPH
NADH
FADH2
A+B C+D + G+H E+F
High-energy electrons
Exergonic reactions release energy.
ATP
+
Nucleotides capture and transfer energy and electrons. Endergonic reactions will not
occur without input of energy.
Energy released by exergonic reactions can be trapped in the high-energy electrons of NADH, FADH2, or NADPH. Energy that is not trapped is given off as heat.
Concept Check
5. What is the difference between endergonic and exergonic reactions? 6. If you mix baking soda and vinegar together in a bowl, the mix-
ture reacts and foams up, releasing carbon dioxide gas. Name the reactant(s) and product(s) in this reaction.
7. Do you think the reaction of question 6 is endergonic or exer- gonic? Do you think it is reversible? Defend your answers.
FIG. 4.5 Some reactions have large activation energies
Net free energy change
C+D
A+B
Time
Is this an endergonic or exergonic reaction?
Activation energy
Reactants Activation of reaction
Reaction process
Products
KEY
Fr ee
e n er
g y
o f
m o
le cu
le
GRAPH QUESTION
some reactions release so much energy that they are essentially irreversible.
In your study of physiology, you will encounter a few irrevers- ible reactions. However, most biological reactions are reversible: if the reaction A + B S C + D is possible, then so is the reaction C + D S A + B. Reversible reactions are shown with arrows that point in both directions: A + B ∆ C + D. One of the main reasons that many biological reactions are reversible is that they are aided by the specialized proteins known as enzymes.
M04_SILV5197_08_SE_C04.indd 98 12/1/17 12:08 AM
C H
A P
TER
4
4.3 Enzymes 99
temperature to be essentially constant. This leaves enzyme amount and substrate concentration as the two main variables that affect reaction rate.
In protein-binding interactions, if the amount of protein (in this case, enzyme) is constant, the reaction rate is proportional to the substrate concentration [see Fig. 2.13b, p. 52]. One strategy cells use to control reaction rates is to regulate the amount of enzyme in the cell. In the absence of appropriate enzyme, many biological reactions go very slowly or not at all. If enzyme is present, the rate of the reaction is proportional to the amount of enzyme and the amount of substrate. If there is so much substrate that all enzyme binding sites are saturated and working at maximum capacity, the reaction rate will reach a maximum [see Fig. 2.13c, p. 52].
This seems simple until you consider a reversible reaction that can go in both directions. In that case, what determines in which direction the reaction goes? The answer is that reversible reactions go to a state of equilibrium, where the rate of the reaction in the forward direction (A + B S C + D) is equal to the rate of the reverse reac- tion (C + D S A + B). At equilibrium, there is no net change in the amount of substrate or product, and the ratio [C][D]/[A][B] is equal to the reaction’s equilibrium constant, Keq [p. 47].
If substrates or products are added or removed by other reac- tions in a pathway, the reaction rate increases in the forward or reverse direction as needed to restore the ratio [C][D]/[A][B]. According to the law of mass action, the ratio of [C] and [D] to [A] and [B] is always the same at equilibrium.
Enzymes May Be Activated, Inactivated, or Modulated Enzyme activity, like the activity of other soluble proteins, can be altered by various factors. Some enzymes are synthesized as inac- tive molecules (proenzymes or zymogens) and activated on demand by proteolytic activation [Fig. 2.12a, p. 50]. Others require the binding of inorganic cofactors, such as Ca2+ or Mg2+ before they become active.
Enzymes Are Proteins Most enzymes are large proteins with complex three-dimensional shapes, although recently researchers discovered that RNA can sometimes act as a catalyst. Like other proteins that bind to sub- strates, protein enzymes exhibit specificity, competition, and satu- ration [p. 46].
A few enzymes come in a variety of related forms (isoforms) and are known as isozymes 5iso@, equal6 of one another. Iso- zymes are enzymes that catalyze the same reaction but under dif- ferent conditions or in different tissues. The structures of related isozymes are slightly different from one another, which causes the variability in their activity. Many isozymes have complex structures with multiple protein chains.
For example, the enzyme lactate dehydrogenase (LDH) has two kinds of subunits, named H and M, that are assembled into tetramers—groups of four. LDH isozymes include H4, H2M2, and M4. The different LDH isozymes are tissue specific, including one found primarily in the heart and a second found in skeletal muscle and the liver.
Isozymes have an important role in the diagnosis of certain medical conditions. For example, in the hours following a heart attack, damaged heart muscle cells release enzymes into the blood. One way to determine whether a person’s chest pain was indeed due to a heart attack is to look for elevated levels of heart isozymes in the blood. Some diagnostically important enzymes and the dis- eases of which they are suggestive are listed in TABLE 4.3.
Reaction Rates Are Variable We measure the rate of an enzymatic reaction by monitoring either how fast the products are synthesized or how fast the substrates are consumed. Reaction rate can be altered by a number of factors, including changes in temperature, the amount of enzyme present, and substrate concentrations [p. 51]. In mammals, we consider
TABLE 4.3 Diagnostically Important Enzymes Elevated blood levels of these enzymes are suggestive of the pathologies listed.
Enzyme Related Diseases
Acid phosphatase* Cancer of the prostate
Alkaline phosphatase Diseases of bone or liver
Amylase Pancreatic disease
Creatine kinase (CK) Myocardial infarction (heart attack), muscle disease
Lactate dehydrogenase (LDH) Tissue damage to heart, liver, skeletal muscle, red blood cells
*A newer test for a molecule called prostate specific antigen (PSA) has replaced the test for acid phosphatase in the diagnosis of prostate cancer.
RUNNING PROBLEM Tay-Sachs disease is a devastating condition. Normally, lyso- somes in cells contain enzymes that digest old, worn-out parts of the cell. In Tay-Sachs and related lysosomal storage diseases, genetic mutations result in lysosomal enzymes that are ineffec- tive or absent. Tay-Sachs disease patients lack hexosaminidase A, an enzyme that digests glycolipids called gangliosides. As a result, gangliosides accumulate in nerve cells in the brain, caus- ing them to swell and function abnormally. Infants with Tay-Sachs disease slowly lose muscle control and brain function. There is currently no treatment or cure for Tay-Sachs disease, and affected children usually die before age 4.
Q1: Hexosaminidase A is also required to remove gangliosides from the light-sensitive cells of the eye. Based on this information, what is another symptom of Tay-Sachs disease besides loss of muscle control and brain function?
93 99 100 104 110 118
M04_SILV5197_08_SE_C04.indd 99 12/1/17 12:08 AM
100 CHAPTER 4 Energy and Cellular Metabolism
binding to their substrates and bringing them into the best position for reacting with each other. Without enzymes, the reaction would depend on random collisions between substrate molecules to bring them into alignment.
The rate of a reaction catalyzed by an enzyme is much more rapid than the rate of the same reaction taking place without the enzyme. For example, consider carbonic anhydrase, which facilitates conversion of CO2 and water to carbonic acid. This enzyme plays a critical role in the transport of waste CO2 from cells to lungs. Each molecule of carbonic anhydrase takes one second to catalyze the conversion of 1 million molecules of CO2 and water to car- bonic acid. In the absence of enzyme, it takes more than a minute for one molecule of CO2 and water to be converted to carbonic
Organic cofactors for enzymes are called coenzymes. Coen- zymes do not alter the enzyme’s binding site as inorganic cofactors do. Instead, coenzymes act as receptors and carriers for atoms or functional groups that are removed from the substrates during the reaction. Although coenzymes are needed for some metabolic reactions to take place, they are not required in large amounts.
Many of the substances that we call vitamins are the precur- sors of coenzymes. The water-soluble vitamins, such as the B vita- mins, vitamin C, folic acid, biotin, and pantothenic acid, become coenzymes required for various metabolic reactions. For example, vitamin C is needed for adequate collagen synthesis.
Enzymes may be inactivated by inhibitors or by becoming denatured [Fig. 2.13a, p. 52]. Enzyme activity can be modu- lated by chemical factors or by changes in temperature and pH. FIGURE 4.6 shows how enzyme activity can vary over a range of pH values. Cells can regulate the flow of biomolecules through dif- ferent synthetic and energy-producing pathways by turning reac- tions on and off or by increasing and decreasing the rate at which reactions take place.
FIG. 4.6 pH affects enzyme activity
R at
e o
f en
zy m
e ac
tiv ity
5 6 7 8 9 pH
Most enzymes in humans have optimal activity near the body's internal pH of 7.4.
If the pH falls from 8 to 7.4, what happens to the activity of the enzyme?
GRAPH QUESTION
Concept Check
8. What is a biological advantage of having multiple isozymes for a given reaction rather than only one form of the enzyme?
9. The four protein chains of an LDH isozyme are an example of what level of protein structure? (a) primary (b) secondary (c) tertiary (d) quaternary
Enzymes Lower Activation Energy of Reactions How does an enzyme increase the rate of a reaction? In thermody- namic terms, it lowers the activation energy, making it more likely that the reaction will start (FIG. 4.7). Enzymes accomplish this by
FIG. 4.7 Enzymes lower the activation energy of reactions
Lower activation energy in presence
of enzyme
Activation energy without enzyme
Time
C+D
A+B
Fr ee
e n er
g y
o f
m o
le cu
le
Reactants Activation of reaction
Reaction process
Products
KEY
In the absence of enzyme, the reaction (curved dashed line) would have much greater activation energy.
RUNNING PROBLEM Tay-Sachs disease is a recessive genetic disorder caused by a defect in the gene that directs synthesis of hexosaminidase A. Recessive means that for a baby to be born with Tay-Sachs dis- ease, it must inherit two defective genes, one from each parent. People with one Tay-Sachs gene and one normal gene are called carriers of the disease. Carriers do not develop the disease but can pass the defective gene on to their children. People who have two normal genes have normal amounts of hexosaminidase A in their blood. Carriers have lower-than-normal levels of the enzyme, but this amount is enough to prevent excessive accumu- lation of gangliosides in cells.
Q2: How could you test whether Sarah and David are carriers of the Tay-Sachs gene?
93 99 100 104 110 118
M04_SILV5197_08_SE_C04.indd 100 12/1/17 12:08 AM
C H
A P
TER
4
4.3 Enzymes 101
molecule. Conversely, molecules that lose electrons are said to be oxidized. Use the mnemonic OIL RIG to remember what hap- pens: Oxidation Is Loss (of electrons), Reduction Is Gain.
Hydrolysis-Dehydration Reactions Hydrolysis and dehydration reactions are important in the breakdown and synthesis of large bio- molecules. In dehydration reactions 5de@, out + hydr@, water6, a water molecule is one of the products. In many dehydration reac- tions, two molecules combine into one, losing water in the process. For example, the monosaccharides glucose and fructose join to make one sucrose molecule [p. 31]. In the process, one substrate molecule loses a hydroxyl group - OH and the other substrate molecule loses a hydrogen to create water, H2O. When a dehydra- tion reaction results in the synthesis of a new molecule, the process is known as dehydration synthesis.
In a hydrolysis reaction 5hydro, water + lysis, to loosen or dissolve6, a substrate changes into one or more products through the addition of water. In these reactions, the covalent bonds of the water molecule are broken (“lysed”) so that the water reacts as a hydroxyl group OH- and a hydrogen ion H+. For example, an amino acid can be removed from the end of a peptide chain through a hydrolysis reaction.
When an enzyme name consists of the substrate name plus the suffix -ase, the enzyme causes a hydrolysis reaction. One exam- ple is lipase, an enzyme that breaks up large lipids into smaller lipids by hydrolysis. A peptidase is an enzyme that removes an amino acid from a peptide.
Addition-Subtraction-Exchange Reactions An addition reaction adds a functional group to one or more of the substrates. A subtraction reaction removes a functional group from one or
acid. Without carbonic anhydrase and other enzymes in the body, biological reactions would go so slowly that cells would be unable to live.
Enzymatic Reactions Can Be Categorized Most reactions catalyzed by enzymes can be classified into four categories: oxidation-reduction, hydrolysis-dehydration, exchange- addition-subtraction, and ligation reactions. TABLE 4.4 summarizes these categories and gives common enzymes for different types of reactions.
An enzyme’s name can provide important clues to the type of reaction the enzyme catalyzes. Most enzymes are instantly rec- ognizable by the suffix -ase. The first part of the enzyme’s name (everything that precedes the suffix) usually refers to the type of reaction, to the substrate upon which the enzyme acts, or to both. For example, glucokinase has glucose as its substrate, and as a kinase it will add a phosphate group [p. 33] to the substrate. Addition of a phosphate group is called phosphorylation.
A few enzymes have two names. These enzymes were discov- ered before 1972, when the current standards for naming enzymes were first adopted. As a result, they have both a new name and a commonly used older name. Pepsin and trypsin, two digestive enzymes, are examples of older enzyme names.
Oxidation-Reduction Reactions Oxidation-reduction reac- tions are the most important reactions in energy extraction and transfer in cells. These reactions transfer electrons from one molecule to another. A molecule that gains electrons is said to be reduced. One way to think of this is to remember that add- ing negatively charged electrons reduces the electric charge on the
Reaction Type What Happens Representative Enzymes
1. Oxidation-reduction (a) Oxidation
(b) Reduction
Add or subtract electrons Transfer electrons from donor to oxygen Remove electrons and H+
Gain electrons
Class:* oxidoreductase Oxidase Dehydrogenase Reductase
2. Hydrolysis-dehydration (a) Hydrolysis (b) Dehydration
Add or subtract a water molecule Split large molecules by adding water Remove water to make one large molecule from
several smaller ones
Class:* hydrolase Peptidases, saccharidases, lipases Dehydratases
3. Transfer chemical groups
(a) Exchange reaction
(b) Addition
(c) Subtraction
Exchange groups between molecules Add or subtract groups
Phosphate Amino group (transamination) Phosphate (phosphorylation) Amino group (amination) Phosphate (dephosphorylation) Amino group (deamination)
Class:* transferases Class:* lyases
Kinase Transaminase Phosphorylase Aminase Phosphatase Deaminase
4. Ligation Join two substrates using energy from ATP Class:* ligases Synthetase
*Enzyme classes as defined by the Nomenclature Committee of the International Union of Biochemistry and Molecular Biology.
TABLE 4.4 Classification of Enzymatic Reactions
M04_SILV5197_08_SE_C04.indd 101 12/1/17 12:08 AM
102 CHAPTER 4 Energy and Cellular Metabolism
is the same as a Calorie, with a capital C, used for quantifying the energy content of food. One kilocalorie is also equal to 1,000 calories (small c).
Much of the energy released during catabolism is trapped in the high-energy phosphate bonds of ATP or in the high-energy electrons of NADH, FADH2, or NADPH. Anabolic reactions then transfer energy from these temporary carriers to the covalent bonds of biomolecules.
Metabolism is a network of highly coordinated chemical reactions in which the activities taking place in a cell at any given moment are matched to the needs of the cell. Each step in a meta- bolic pathway is a different enzymatic reaction, and the reactions of a pathway proceed in sequence. Substrate A is changed into product B, which then becomes the substrate for the next reaction in the pathway. B is changed into C, and so forth:
A S B S C S D
We call the molecules of the pathway intermediates because the products of one reaction become the substrates for the next. You will sometimes hear metabolic pathways called inter- mediary metabolism. Certain intermediates, called key intermediates, participate in more than one pathway and act as the branch points for channeling substrate in one direction or another. Glucose, for instance, is a key intermediate in several metabolic pathways.
In many ways, a group of metabolic pathways is similar to a detailed road map (FIG. 4.8). Just as a map shows a network of roads that connect various cities and towns, you can think of metabolism as a network of chemical reactions connecting various intermediate products. Each city or town is a different chemical intermediate. One-way roads are irreversible reactions, and big cities with roads to several destinations are key intermediates. Just as there may be more than one way to get from one place to another, there can be several pathways between any given pair of chemical intermediates.
Cells Regulate Their Metabolic Pathways How do cells regulate the flow of molecules through their meta- bolic pathways? They do so in five basic ways:
1. By controlling enzyme concentrations 2. By producing modulators that change reaction rates 3. By using two different enzymes to catalyze reversible reactions 4. By compartmentalizing enzymes within intracellular
organelles 5. By maintaining an optimum ratio of ATP to ADP
We discussed the effects of changing enzyme concentration in the discussion of protein-binding reactions: as enzyme concentra- tion increases, the reaction rate increases [p. 51]. The sections that follow examine the remaining four items on the list.
Enzyme Modulation Modulators, which alter the activity of a pro- tein, were introduced in the discussion of protein binding [p. 49]. For enzymes, the production of modulators is frequently controlled by hormones and other signals coming from outside the cell. This type of outside regulation is a key element in the integrated control
more of the substrates. Functional groups are exchanged between or among substrates during exchange reactions.
For example, phosphate groups may be transferred from one molecule to another during addition, subtraction, or exchange reactions. The transfer of phosphate groups is an important means of covalent modulation [p. 49], turning reactions on or off or increasing or decreasing their rates. Several types of enzymes catalyze reactions that transfer phosphate groups. Kinases trans- fer a phosphate group from a substrate to an ADP molecule to create ATP, or from an ATP molecule to a substrate. For example, creatine kinase transfers a phosphate group from creatine phos- phate to ADP, forming ATP and leaving behind creatine.
The addition, subtraction, and exchange of amino groups [p. 32] are also important in the body’s use of amino acids. Removal of an amino group from an amino acid or peptide is a deamination reaction. Addition of an amino group is amina- tion, and the transfer of an amino group from one molecule to another is transamination.
Ligation Reactions Ligation reactions join two molecules together using enzymes known as synthetases and energy from ATP. An example of a ligation reaction is the synthesis of acetyl coenzyme A (acetyl CoA) from fatty acids and coenzyme A. Acetyl CoA is an important molecule in the body, as you will learn in the next section.
Concept Check
10. Name the substrates for the enzymes lactase, peptidase, lipase, and sucrase.
11. Match the reaction type or enzyme in the left column to the group or particle involved.
(a) kinase 1. amino group
(b) oxidation 2. electrons
(c) hydrolysis 3. phosphate group
(d) transaminase 4. water
4.4 Metabolism Metabolism refers to all chemical reactions that take place in an organism. These reactions (1) extract energy from nutrient biomolecules (such as proteins, carbohydrates, and lipids) and (2) either synthesize or break down molecules. Metabolism is often divided into catabolism, reactions that release energy through the breakdown of large biomolecules, and anabolism, energy- utilizing reactions that result in the synthesis of large biomolecules. Anabolic and catabolic reactions take place simultaneously in cells throughout the body, so that at any given moment, some biomol- ecules are being synthesized while others are being broken down.
The energy released from or stored in the chemical bonds of biomolecules during metabolism is commonly measured in kilocal- ories (kcal). A kilocalorie is the amount of energy needed to raise the temperature of 1 liter of water by 1 °Celsius. One kilocalorie
M04_SILV5197_08_SE_C04.indd 102 12/1/17 12:08 AM
C H
A P
TER
4
4.4 Metabolism 103
(FIG. 4.10a). Such a reaction, therefore, cannot be closely regulated except by modulators and by controlling the amount of enzyme.
However, if a reversible reaction requires two different enzymes, one for the forward reaction and one for the reverse reaction, the cell can regulate the reaction more closely (Fig. 4.10b). If no enzyme for the reverse reaction is present in the cell, the reac- tion is irreversible (Fig. 4.10c).
Compartmentalizing Enzymes in the Cell Many enzymes of metabolism are isolated in specific subcellular compartments. Some, like the enzymes of carbohydrate metabolism, are dissolved in the cytosol, whereas others are isolated within specific organ- elles. Mitochondria, endoplasmic reticulum, Golgi apparatus, and lysosomes all contain enzymes that are not found in the cytosol. This separation of enzymes means that the pathways controlled by the enzymes are also separated. That allows the cell to control metabolism by regulating the movement of substrate from one cellular compartment to another. The isolation of enzymes within organelles is an important example of structural and functional compartmentation [p. 8].
Ratio of ATP to ADP The energy status of the cell is one final mech- anism that can influence metabolic pathways. Through complex regulation, the ratio of ATP to ADP in the cell determines whether pathways that result in ATP synthesis are turned on or off. When ATP levels are high, production of ATP decreases. When ATP levels are low, the cell sends substrates through pathways that result in more ATP synthesis. In the next section, we look further into the role of ATP in cellular metabolism.
of the body’s metabolism following a meal or during periods of fasting between meals.
In addition, some metabolic pathways have their own built- in form of modulation, called feedback inhibition. In this form of modulation, the end product of a pathway, shown as Z in FIGURE 4.9, acts as an inhibitory modulator of the pathway. As the pathway proceeds and Z accumulates, end product Z feeds back and inhibits the enzyme catalyzing the conversion of A to B. Inhibition of the enzyme slows down production of Z until the cell can use it up. Once the levels of Z fall, feedback inhibition on enzyme 1 is removed and the pathway starts to run again. Because Z is the end product of the pathway, this type of feedback inhibi- tion is sometimes called end-product inhibition.
Reversible Reactions Cells can use reversible reactions to regu- late the rate and direction of metabolism. If a single enzyme can catalyze the reaction in either direction, the reaction will go to a state of equilibrium, as determined by the law of mass action
FIG. 4.8 Metabolic pathways resemble a road map
17 Glucose
GlycogenFlagstaff Winslow
Holbrook Sedona
Williams
Seligman
Prescott
Wickenburg Payson
Globe
Superior
Scottsdale
Carefree
Mesa
Tucson Three Points
Glendale
Tempe
Ajo
Florence
PHOENIX
Glucose 6-phosphate
Fructose Fructose 1-phosphate bisphosphate
Fructose 6- phosphate
Ribose 5-
Glycerol
Glucose 3-phosphateDHAP
DHAP = dihydroxyacetone phosphate
(b) Metabolic Pathways Drawn Like a Road Map (a) Section of Road Map
Fructose 1,6- phosphate
Cities on the map are equivalent to intermediates in metabolism. In metabolism, there may be more than one way to go from one intermediate to another, just as on the map, there may be many ways to get from one city to another.
Casa Grande
Maricopa Gila Bend
10
10
10
8
17
17
40 40
FIG. 4.9 Feedback inhibition
Feedback inhibition
A B C Z enzyme 3enzyme 2enzyme 1
The accumulation of end product Z inhibits the first step of the pathway. As the cell consumes Z in another metabolic reaction, the inhibition is removed and the pathway resumes.
M04_SILV5197_08_SE_C04.indd 103 12/1/17 12:08 AM
104 CHAPTER 4 Energy and Cellular Metabolism
To provide that much ATP, cells constantly recycle ADP from ATP hydrolysis, transferring chemical bond energy from complex biomolecules to the high-energy bonds of ATP, as shown above. In a few cases, the energy is used to make high-energy bonds of a related nucleotide guanosine triphosphate, GTP. The body stores its energy, therefore, in the chemical bonds of lipids or the glucose polymer glycogen.
The metabolic pathways that yield the most ATP molecules are those that require oxygen—the aerobic, or oxidative, pathways. Anaerobic 5an@, without + aer, air6 pathways, which are those that can proceed without oxygen, also produce ATP molecules but in much smaller quantities. The lower ATP yield of anaerobic pathways means that most animals (including humans) are unable to survive for extended periods on anaerobic metabolism alone. In the next section, we consider how biomolecules are metabolized to transfer energy to ATP.
ATP Transfers Energy between Reactions The usefulness of meta- bolic pathways as suppliers of energy is often measured in terms of the net amount of ATP the pathways can yield. ATP is a nucleo- tide containing three phosphate groups [p. 34]. One of the three phosphate groups is attached to ADP by a covalent bond in an energy-requiring reaction. Energy is stored in this high-energy phosphate bond and then released when the bond is broken during removal of the phosphate group. This relationship is shown by the following reaction:
ADP + Pi + energy ∆ ADP ∼ P (= ATP)
The squiggle ∼ indicates a high-energy bond, and Pi is the abbreviation for an inorganic phosphate group. Estimates of the amount of free energy released when a high-energy phosphate bond is broken range from 7 to 12 kcal per mole of ATP.
ATP is more important as a carrier of energy than as an energy-storage molecule. For one thing, the body contains only a limited amount of ATP, estimated at 50 g. But a resting adult human requires 40,000 g (88 pounds!) of ATP to supply the energy for one day’s worth of metabolic activity.
FIG. 4.10 Enzymes control reversibility of metabolic reactions
H2OCO2 PO4 PO4
(a) Some reversible reactions use one enzyme for both directions.
Carbonic acid Glucose 6-phosphate
Glucose Glucose
Glucose 6-phosphate
(b) Reversible reactions requiring two enzymes allow more control over the reaction.
carbonic anhydrase
carbonic anhydrase
glucose 6- phosphatase
hexokinasehexokinase
+ + +
What is the difference between a kinase and a phosphatase? (Hint: See Tbl. 4.4.)
(c) Irreversible reactions lack the enzyme for the reverse direction.
Reversible Reactions Irreversible Reactions
FIGURE QUESTION
RUNNING PROBLEM In 1989, researchers discovered three genetic mutations respon- sible for Tay-Sachs disease. This discovery paved the way for a new carrier screening test that detects the presence of one of the three genetic mutations in blood cells rather than testing for lower-than-normal hexosaminidase A levels. David and Sarah will undergo this genetic test.
Q3: Why might the genetic test for mutations in the Tay-Sachs gene be more accurate than the test that detects decreased amounts of hexosaminidase A?
Q4: Can you think of a situation in which the enzyme test might be more accurate than the genetic test?
93 99 100 104 110 117
Concept Check
12. Name five ways in which cells regulate the movement of sub- strates through metabolic pathways.
13. In which part of an ATP molecule is energy trapped and stored? In which part of a NADH molecule is energy stored?
14. What is the difference between aerobic and anaerobic pathways?
Catabolic Pathways Produce ATP FIGURE 4.11 summarizes the catabolic pathways that extract energy from biomolecules and transfer it to ATP. Aerobic production of ATP from glucose commonly follows two pathways: glycolysis 5glycol@, sweet + lysis, dissolve6 and the citric acid cycle (also known as the tricarboxylic acid cycle). The citric acid cycle was first described by Hans A. Krebs, so it is sometimes called the Krebs cycle. Because Dr. Krebs described other metabolic cycles, we will avoid confusion by using the term citric acid cycle.
Carbohydrates enter glycolysis in the form of glucose (top of Fig. 4.11). Lipids are broken down into glycerol and fatty acids [p. 30], which enter the pathway at different points: glycerol feeds into glycolysis, and fatty acids are metabolized to acetyl CoA.
M04_SILV5197_08_SE_C04.indd 104 12/1/17 12:08 AM
105
FIG. 4.11 ESSENTIALS ATP Production
Glucose 1 O2 1 ADP 1 Pi CO2 1 H2O 1 ATP
C6H12O6 1 6 O2
30232 ADP + Pi 30232 ATP
6 CO2 1 6 H2O
High-energy electrons
Acetyl CoA
Glucose
Pyruvate
ETS
Citric acid cycle
The catabolic pathways that extract energy from biomolecules and transfer it to ATP are summarized in this overview figure of aerobic respiration of glucose.
Glycolysis and the citric acid cycle produce small amounts of ATP directly, but their most important contributions to ATP synthesis are high-energy electrons carried by NADH and FADH2 to the electron transport system in the mitochondria.
The energy production from one glucose molecule can be summarized in the following two equations.
Aerobic Metabolism of Glucose
H2OO2
Glycerol
ATP
ADP
NAD1
NAD+
G L Y C O L Y S I S
Fatty acids
Amino acids
Amino acids
Amino acids
High-energy electrons and H1
ELECTRON TRANSPORT SYSTEM
CO2
ADP
ATP
ADP
Pyruvate
Acetyl CoA
CITRIC ACID
CYCLE
Cytosol
Mitochondrion
Glucose
ATP This icon represents the different steps in the metabolic summary figure. Look for it in the figures that follow to help you navigate your way through metabolism.
NADH
NADH
Proteins are broken down into amino acids, which also enter at various points. Carbons from glycolysis and other nutrients enter the citric acid cycle, which makes a never-ending circle. At each turn, the cycle adds carbons and produces ATP, high-energy elec- trons, and carbon dioxide.
Both glycolysis and the citric acid cycle produce small amounts of ATP directly, but their most important contribution to ATP synthesis is trapping energy in electrons carried by NADH and FADH2. These compounds transfer the electrons to the electron transport system (ETS) in the mitochondria. The electron trans- port system, in turn, uses energy from those electrons to make the high-energy phosphate bond of ATP. At various points, the process
produces carbon dioxide and water. Cells can use the water, but car- bon dioxide is a waste product and must be removed from the body.
Because glucose is the only molecule that follows both path- ways in their entirety, in this chapter, we look at only glucose catabolism.
• FIGURE 4.12 summarizes the key steps of glycolysis, the conver- sion of glucose to pyruvate.
• FIGURE 4.13 shows how pyruvate is converted to acetyl CoA and how carbons from acetyl CoA go through the citric acid cycle.
• FIGURE 4.14 illustrates the energy-transferring pathway of the electron transport system.
M04_SILV5197_08_SE_C04.indd 105 12/1/17 12:08 AM
FIG. 4.12 ESSENTIALS Glycolysis
Steps 5–9 occur twice for each glucose that begins the pathway.
= Carbon = Oxygen
= Phosphate group
(side groups not shown)
Glucose is phosphorylated to glucose 6-phosphate. (The “6” in glucose 6-phosphate tells you that the phosphate group has been attached to carbon 6 of the glucose molecule.)
Pyruvate is the branch point for aerobic and anaerobic metabolism of glucose.
1. Overall, is glycolysis an endergonic or exergonic pathway? 2. Which steps of glycolysis (a) use ATP? (b) make ATP or NADH? (c) are catalyzed by kinases? (d) are catalyzed by dehydrogenases? (Hint: See Tbl. 4.4.) 3. What is the net energy yield (ATP and NADH) for one glucose?
During glycolysis, one molecule of glucose is converted by a series of enzymatically catalyzed reactions into two pyruvate molecules, producing a net release of energy.
• In glycolysis, one 6-carbon molecule of glucose becomes two 3-carbon pyruvate molecules.
• Two steps of glycolysis require energy input from ATP. Other steps trap energy in ATP and the high-energy electrons of NADH.
• Glycolysis does not require oxygen. It is the common pathway for aerobic and anaerobic catabo- lism of glucose.
Key Features of Glycolysis
Glucose 6-phosphate
Fructose 6-phosphate
Fructose 1,6- bisphosphate
Dihydroxyacetone phosphate
ATP
ADP
ATP
ADP
2 Glyceraldehyde 3-phosphate
2 1,3-Bisphosphoglycerate
2 3-Phosphoglycerate
2 2-Phosphoglycerate
2 Phosphoenol pyruvate
2 Pyruvate
ADP
GLUCOSE
H2O
NADH
ATP
ATP
NAD+
ADP
KEY
Glucose
Pyruvate
P
P
P P
P
P
P
P
P
P
P 2
2
2
2
2
2
P
P
1
3
2
4
5
6
7
8
9FIGURE QUESTIONS
M04_SILV5197_08_SE_C04.indd 106 12/1/17 12:08 AM
107
FIG. 4.13 ESSENTIALS Pyruvate, Acetyl CoA, and the Citric Acid Cycle
1
1
3
5
6
8
7
4
2
If the cell has adequate oxygen, pyruvate is transported into the mitochondria.
2 Pyruvate reacts with coenzyme A to produce acetyl CoA, one NADH, and one CO2.
3 Acetyl CoA has two parts: a 2-carbon acyl unit, derived from pyruvate, and coenzyme A.
4 Coenzyme A is made from the vitamin pantothenic acid. Coenzymes, like enzymes, are not changed during reactions and can be reused.
5 The 2-carbon acyl unit enters the cycle by combining with a 4-carbon oxaloacetate molecule.
7 Two carbons are removed in the form of CO2.
8 Most of the energy released is captured as high-energy electrons on three NADH and one FADH2. Some energy goes into the high-energy phosphate bond of one ATP. The remaining energy is given off as heat.
6 The 6-carbon citrate molecule goes through a series of reactions until it completes the cycle as another oxaloacetate molecule.
KEY
If the cell has adequate oxygen, each 3-carbon pyruvate formed during glycolysis reacts with coenzyme A (CoA) to form one acetyl CoA and one carbon dioxide (CO2).
The 2-carbon acyl unit of acetyl CoA enters the citric acid cycle pathway, allowing coenzyme A to recycle and react with another pyruvate.
The citric acid cycle makes a never-ending circle, adding carbons from acetyl CoA with each turn of the cycle and producing ATP, high-energy electrons, and carbon dioxide.
Acetyl CoA
Acyl unit
CoA
CoA
Cytosol
Mitochondrial matrix
Pyruvate
Pyruvate
NAD+
CO2
NADH
High-energy electrons
Acetyl CoA
Pyruvate
Citric acid cycle
Citrate (6C)
Isocitrate (6C)
α Ketoglutarate (5C)
Succinyl CoA (4C)Succinate (4C)
Fumarate (4C)
Malate (4C)
Oxaloacetate (4C)
H2O
ATP
Side groups not shown
CO2
CO2 FADH2
NADH
NADH
NADH
NAD+
FAD
NAD+
ADP
CITRIC ACID CYCLE
NAD+
GDP + Pi GTP
CoA
CoA= Carbon = Oxygen
= Coenzyme A
CoA
CoA
1. Overall, is the citric acid cycle an endergonic or exergonic pathway? 2. What is the net energy yield (ATP, FADH2, and NADH) for one pyruvate completing the cycle? 3. How many CO2 are formed from one pyruvate? Compare the number of carbon atoms in the pyruvate and CO2s.
FIGURE QUESTIONS
M04_SILV5197_08_SE_C04.indd 107 12/1/17 12:08 AM
FIG. 4.14 ESSENTIALS The Electron Transport System
+ + + + + ++
+ +
+ +
+ +
+ +
+ +
+ +
– – – – – – – –
– – – –
–
– –
– –
1. What is phosphorylation? What is phosphorylated in oxidative phosphorylation? 2. Is the movement of electrons through the electron transport system endergonic or exergonic? 3. What is the role of oxygen in oxidative phosphorylation?
The final step in aerobic ATP production is energy transfer from high-energy electrons of NADH and FADH2 to ATP. This energy transfer requires mitochondrial proteins known as the electron transport system (ETS), located in the inner mitochondrial membrane.
• ETS proteins include enzymes and iron-containing cytochromes.
• The synthesis of ATP using the ETS is called oxidative phosphorylation because the system requires oxygen to act as the final acceptor of electrons and H+.
• The chemiosmotic theory says that potential energy stored by concentrating H+ in the intermembrane space is used to make the high-energy bond of ATP.
H+ H+
H+
H+
H+
H+H+
Cytosol
Mitochondrial matrix
Matrix pool of H+
4e-
e-
Inner mitochondrial
membrane
Outer mitochondrial
membrane
ADP + Pi
High-energy electrons from glycolysis
1
2
4
5
ELECTRON TRANSPORT SYST EM conc
entrate s H
+ in th e inte
rmem bran
e sp ace
.
CITRIC ACID
CYCLE
High-energy electrons
H+
H+ H+
H+ H+
H+
H+
H+
O2 +H2O2 ATP
3
1 2NADH and FADH2 release high- energy electrons and H+ to the ETS. NAD+ and FAD are coenzymes that recycle.
Energy released when pairs of high-energy electrons pass along the transport system is used to concentrate H+ from the mitochondrial matrix in the intermembrane space. The H+ concentration gradient is a source of potential energy.
3 As H+ move down their concentration gradient through a protein known as ATP synthase, the synthase transfers their kinetic energy to the high-energy phosphate bond of ATP.
• Each 3 H+ that shuttle through the ATP synthase make a maximum of
1 ATP.
• A portion of the kinetic energy is released as heat.
Each pair of electrons released by the ETS combines with two H+ and an oxygen atom, creating a molecule of water, H2O.
By the end of the ETS, the electrons have given up their stored energy.
4 5
FIGURE QUESTIONS
ATP synthase
108
M04_SILV5197_08_SE_C04.indd 108 12/2/17 12:52 AM
C H
A P
TER
4
4.4 Metabolism 109
that a certain number of H+ ions leak from the intermembrane space back into the mitochondrial matrix without producing an ATP.
A second source of variability in the number of ATP pro- duced per glucose comes from the two cytosolic NADH molecules produced during glycolysis. These NADH molecules are unable to enter mitochondria and must transfer their electrons through membrane carriers. Inside a mitochondrion, some of these elec- trons go to FADH2, which has a potential average yield of only 1.5 ATP rather than the 2.5 ATP made by mitochondrial NADH. If cytosolic electrons go to mitochondrial NADH instead, they produce two additional ATP molecules.
Anaerobic Metabolism Makes Two ATP The metabolism of glucose just described assumes that the cells have adequate oxygen to keep the electron transport system func- tioning. But what happens to a cell whose oxygen supply cannot keep pace with its ATP demand, such as often happens during stren- uous exercise? In that case, the metabolism of glucose shifts from aerobic to anaerobic metabolism, starting at pyruvate (FIG. 4.16).
In anaerobic glucose metabolism, pyruvate is converted to lac- tate instead of being transported into the mitochondria:
Pyruvate Lactate
Lactate dehydrogenase
Pyruvate is a branch point for metabolic pathways, like a hub city on a road map. Depending on a cell’s needs and oxygen content, pyruvate can be shuttled into the citric acid cycle or diverted into lactate production until oxygen supply improves.
The conversion of pyruvate to lactate changes one NADH back to NAD+ when a hydrogen atom and an electron are trans- ferred to the lactate molecule. As a result, the net energy yield for the anaerobic metabolism of one glucose molecule is 2 ATP and 0 NADH (Fig. 4.15a), a very puny yield when compared to the 30–32 ATP/glucose that result from aerobic metabolism (Fig. 4.15b). The low efficiency of anaerobic metabolism severely limits its usefulness in most vertebrate cells, whose metabolic energy demand is greater than anaerobic metabolism can provide. Some cells, such as exercising muscle cells, can tolerate anaero- bic metabolism for a limited period of time. Eventually, however, they must shift back to aerobic metabolism. Aerobic and anaerobic metabolism in muscle are discussed further in Chapters 12 and 25.
NADH NAD+
We will examine protein and lipid catabolism and synthetic pathways for lipids and glucose when we look at the fate of the nutrients we eat (see Chapter 22).
The aerobic pathways for ATP production are a good exam- ple of compartmentation within cells. The enzymes of glycolysis are located in the cytosol, and the enzymes of the citric acid cycle are in the mitochondria. Within mitochondria, concentration of H+ in the intermembrane compartment stores the energy needed to make the high-energy bond of ATP.
Concept Check
15. Match each component on the left to the molecule(s) it is part of:
(a) amino acids 1. carbohydrates
(b) fatty acids 2. lipids
(c) glycerol 3. polysaccharides
(d) glucose 4. proteins
5. triglycerides
16. Do endergonic reactions release energy or trap it in the products?
One Glucose Molecule Can Yield 30–32 ATP Recall from Figure 4.11 that the aerobic metabolism of one glu- cose molecule produces carbon dioxide, water, and 30–32 ATP. Let’s review the role of glycolysis and the citric acid cycle in that ATP production.
In glycolysis (Fig. 4.12), metabolism of one glucose molecule C6H12O6 has a net yield of two 3-carbon pyruvate molecules, 2 ATP, and high-energy electrons carried on 2 NADH:
Glucose + 2 NAD+ + 2 ADP + 2 Pi S 2 Pyruvate + 2 ATP + 2 NADH + 2 H+ + 2 H2O
In the next phase, the conversion of pyruvate to acetyl CoA produces one NADH (Fig. 4.13). Carbons from one acetyl CoA going through the citric acid cycle trap energy in 3 NADH mol- ecules, 1 FADH2 and 1 ATP. These steps happen twice for each glucose, giving a total yield of 8 NADH, 2 FADH2, and 2 ATP for the pyruvate-citric acid cycle phase of glucose metabolism.
In the final step, high-energy electrons of NADH and FADH2 passing along the proteins of the electron transport system use their energy to concentrate H+ in the intermembrane compart- ment of the mitochondria (Fig. 4.14). When the H+ move down their concentration gradient through a channel in the ATP syn- thase, the energy released is transferred to the high-energy phos- phate bond of ATP. On average, the NADH and FADH2 from one glucose produce 26–28 ATP.
When we tally the maximum potential energy yield for the catabolism of one glucose molecule through aerobic pathways, the total comes to 30–32 ATP (FIG. 4.15b). These numbers are the potential maximum because often the mitochondria do not work up to capacity. There are various reasons for this, including the fact
Concept Check
17. How is the separation of mitochondria into two compartments essential to ATP synthesis?
18. Lactate dehydrogenase acts on lactate by (adding or removing?) a(n) and a(n) . This process is called (oxidation or reduction?).
19. Describe two differences between aerobic and anaerobic metab- olism of glucose.
M04_SILV5197_08_SE_C04.indd 109 12/1/17 12:08 AM
110 CHAPTER 4 Energy and Cellular Metabolism
of carbohydrates, lipids, structural proteins, and signal molecules. Protein transporters and pores in the cell membrane and in organ- elle membranes regulate the movement of molecules into and out of compartments. Other proteins form the structural skeleton of cells and tissues. In these and other ways, protein synthesis is criti- cal to cell function.
The power of proteins arises from their tremendous vari- ability and specificity. Protein synthesis using 20 amino acids can be compared to creating a language with an alphabet of 20 letters. The “words” vary in length from three letters to hundreds of letters, spelling out the structure of thousands of different proteins with different functions. A change in one amino acid during protein synthesis can alter the protein’s function, just as changing one letter turns the word “foot” into “food.”
The classic example of an amino acid change causing a problem is sickle cell disease. In this inherited condition, when the amino acid valine replaces one glutamic acid in the protein chain, the change alters the shape of hemoglobin. As a result, red blood cells containing the abnormal hemoglobin take on a crescent
Proteins Are the Key to Cell Function As you have seen, proteins are the molecules that run a cell from day to day. Protein enzymes control the synthesis and breakdown
FIG. 4.15 Energy yields from catabolism of one glucose molecule
2 Acetyl CoA
Citric acid cycle
NADH ATP CO2FADH2 G L Y C O L Y S I S
ELECTRON TRANSPORT SYSTEM
2 Pyruvate
1 Glucose
High-energy electrons and H+
6 O2
2* +4
–2
2 2
6 2 2
26–28
30–32 ATP
6 H2O
6 CO2
4
(b) Aerobic Metabolism C6H12O6 + 6 O2 6 CO2 + 6 H2O
* Cytoplasmic NADH sometimes yields only 1.5 ATP/NADH instead of 2.5 ATP/NADH.
TOTALS
NADH ATP CO2FADH2 G L Y C O L Y S I S
2 Pyruvate
2 Lactate
1 Glucose
2 4
–2
–2
2 ATP
0 NADH
(a) Anaerobic Metabolism C6H12O6 2 C3H5O3 – + 2 H+
TOTALS
One glucose metabolized anaerobically yields only 2 ATP.
One glucose metabolized aerobically through the citric acid cycle yields 30–32 ATP.
1. How many NADH enter the electron transport system when glucose is metabolized to lactate? 2. Some amino acids can be converted to pyruvate. If one amino acid becomes one pyruvate, what is the ATP yield from aerobic metabolism of that amino acid?
FIGURE QUESTIONS
RUNNING PROBLEM David and Sarah had their blood drawn for the genetic test sev- eral weeks ago and have been anxiously awaiting the results. Today, they returned to the hospital to hear the news. The tests show that Sarah carries the gene for Tay-Sachs disease but David does not. This means that although some of their children may be carriers of the Tay-Sachs gene like Sarah, none of the children will develop the disease.
Q5: The Tay-Sachs gene is a recessive gene (t). If Sarah is a carrier of the gene (Tt) but David is not (TT), what is the chance that any child of theirs will be a carrier? (Consult a general biol- ogy or genetics text if you need help solving this problem.)
93 99 100 104 110 117
M04_SILV5197_08_SE_C04.indd 110 12/1/17 12:08 AM
C H
A P
TER
4
4.4 Metabolism 111
(sickle) shape, which causes them to get tangled up and block small blood vessels.
The Protein “Alphabet” One of the mysteries of biology until the 1960s was the question of how only four nitrogenous bases in the DNA molecule—adenine (A), guanine (G), cytosine (C), and thymine (T)—could code for more than 20 different amino acids. If each base controlled the synthesis of one amino acid, a cell could make only four different amino acids. If pairs of bases represented different amino acids, the cell could make 42 or 16 different amino acids. Because we have 20 amino acids, this is still not satisfactory. If triplets of bases were the codes for dif- ferent molecules, however, DNA could create 43 or 64 different amino acids. These triplets, called codons, are indeed the way information is encoded in DNA and RNA. FIGURE 4.17 shows the genetic code as it appears in one form of RNA. Remember that RNA substitutes the base uracil (U) for the DNA base thy- mine [p. 35].
Of the 64 possible triplet combinations, one DNA codon (TAC) acts as the initiator or start codon that signifies the begin- ning of a coding sequence. Three codons serve as terminator or stop codons that show where the sequence ends. The remain- ing 60 triplets all code for amino acids. Methionine and tryp- tophan have only one codon each, but the other amino acids have between two and six different codons each. Thus, like letters
spelling words, the DNA base sequence determines the amino acid sequence of proteins.
Unlocking DNA’s Code How does a cell know which of the thou- sands of bases present in its DNA sequence to use in making a protein? It turns out that the information a cell needs to make a particular protein is contained in a segment of DNA known as a gene. What exactly is a gene? The definition keeps changing, but for this text we will say that a gene is a region of DNA that contains the information needed to make a functional piece of RNA, which in turn can make a protein.
FIGURE 4.18 shows the five major steps from gene to RNA to functional protein. First, a section of DNA containing a gene must be activated so that its code can be read 1 . Genes that are con- tinuously being read and converted to RNA messages are said to be constitutively active. Usually these genes code for proteins that are essential to ongoing cell functions. Other genes are regulated—that is, their activity can be turned on (induced) or turned off (repressed) by regulatory proteins.
Once a gene is activated, the DNA base sequence of the gene is used to create a piece of RNA in the process known as transcription 5trans, over + scribe, to write6 (Fig. 4.18 2 ). Human cells have three major forms of RNA: messenger RNA (mRNA), transfer RNA (tRNA), and ribosomal RNA (rRNA). Messenger RNA is processed in the nucleus after it is made 3 . It may either undergo alternative splicing (discussed shortly) before leaving the nucleus or be “silenced” and destroyed by enzymes through RNA interference. Processed mRNA leaves the nucleus and enters the cytosol. There it works with tRNA and rRNA to direct translation, the assembly of amino acids into a protein chain 4 .
FIG. 4.16 Aerobic and anaerobic metabolism
Acetyl CoA
Acyl unit
CoA
CoA
CoA
Cytosol
Mitochondrial matrix
Pyruvate
Pyruvate
Lactate
H and –OH not shown
= Carbon
= Oxygen
= Coenzyme A
NADHNAD+
Anaerobic Aerobic
CITRIC ACID CYCLE
KEY
Pyruvate is the branch point between aerobic and anaerobic metabolism of glucose.
FIG. 4.17 The genetic code as it appears in the codons of mRNA
UUU UUC UUA UUG
U C A G U C A G U C A G U C A G
Phe
Leu
CUU CUC CUA CUG
Leu
AUU AUC AUA AUG
IIe
Start
Stop Stop
Met
GUU GUC GUA GUG
Val Ala
UCU UCC UCA UCG
CCU CCC CCA CCG
ACU ACC ACA ACG
GCU GCC GCA GCG
UAU UAC UAA UAG
Tyr
CAU CAC CAA CAG
His
Gln
AAU AAC AAA AAG
Asn
Lys
GAU GAC GAA GAG
Asp
Glu
UGU UGC UGA UGG
Cys
Trp
CGU CGC CGA CGG
AGU AGC AGA AGG
Ser
Arg
GGU GGC GGA GGG
U
U
C
A
G
C
Second base of codon
T h ird
b ase o
f co d
o nF
ir st
b as
e o
f co
d o
n
A G
Arg
Gly
Thr
Pro
Ser
The three-letter abbreviations to the right of the brackets indicate the amino acid each codon represents. The start and stop codons are also marked.
M04_SILV5197_08_SE_C04.indd 111 12/1/17 12:08 AM
FIG. 4.18 ESSENTIALS Overview of Protein Synthesis
Gene Regulatory proteins
Constitutively active
Induction
Alternative splicing
Processed mRNA
Interference
mRNA
Protein chain
Repression
Regulated activity
siRNA
mRNA “silenced”
• rRNA in ribosomes • tRNA • Amino acids
Folding and cross-links
Assembly into polymeric proteins
Addition of groups: • sugars • lipids • -CH3 • phosphate
Cleavage into smaller peptides
Cytosol
Nucleus
The major steps required to convert the genetic code of DNA into a functional protein.
GENE ACTIVATION
TRANSCRIPTION (see Fig. 4.19)
mRNA PROCESSING (see Fig. 4.20)
TRANSLATION (see Fig. 4.21)
POSTTRANSLATIONAL MODIFICATION
1
2
3
4
5
112
M04_SILV5197_08_SE_C04.indd 112 12/2/17 12:52 AM
C H
A P
TER
4
4.4 Metabolism 113
Newly synthesized proteins are then subject to posttrans- lational modification (Fig. 4.18 5 ). They fold into complex shapes, may be split by enzymes into smaller peptides, or have various chemical groups added to them. The remainder of this chapter looks at transcription, RNA processing, translation, and p o s t t r a n s l a t i o n a l modification in more detail.
DNA Guides the Synthesis of RNA The first steps in protein synthesis are compartmentalized within the nucleus because DNA is a very large molecule that cannot pass through the nuclear envelope. Transcription uses DNA as a template to create a small single strand of RNA that can leave
the nucleus (FIG. 4.19). The synthesis of RNA from the double- stranded DNA template requires an enzyme known as RNA poly- merase, plus magnesium or manganese ions and energy in the form of high-energy phosphate bonds:
DNA template + nucleotides A, U, C, G RNA polymerase, Mg 2 + or Mn2 + , and energy
DNA template + mRNA
A promoter region that precedes the gene must be activated before transcription can begin. Regulatory-protein transcription factors bind to DNA and activate the promoter. The active promoter tells the RNA polymerase where to bind to the DNA
FIG. 4.19 Transcription
RNA polymerase binds to DNA.
The section of DNA that contains the gene unwinds.
RNA bases bind to DNA, creating a single strand of mRNA.
mRNA and the RNA polymerase detach from DNA, and the mRNA goes to the cytosol after processing.
RNA polymerase
RNA polymerasemRNA strand
released
mRNA transcript
RNA polymerase
DNA
Template strand
Site of nucleotide assembly
Leaves nucleus after processing
Lengthening mRNA strand
RNA bases
1
2
3
4
A gene is a segment of DNA that can produce a functional piece of RNA, which in turn can make a protein. Base pairing is the same as in DNA synthesis, except that the base uracil (U) substitutes for thymine (T).
Play BioFlix Animation
@Mastering Anatomy & Physiology
M04_SILV5197_08_SE_C04.indd 113 12/1/17 12:08 AM
114 CHAPTER 4 Energy and Cellular Metabolism
mRNA Translation Links Amino Acids Protein synthesis requires cooperation and coordination among all three types of RNA: mRNA, rRNA, and tRNA. Upon arrival in the cytosol, processed mRNA binds to ribosomes, which are small particles of protein and several types of rRNA [p. 35]. Each ribo- some has two subunits, one large and one small, that come together when protein synthesis begins (FIG. 4.21 3 ). The small ribosomal subunit binds the mRNA, then adds the large subunit so that the mRNA is sandwiched in the middle. Now the ribosome-mRNA complex is ready to begin translation.
During translation, the mRNA codons are matched to the proper amino acid. This matching is done with the assistance of a tRNA molecule (Fig. 4.21 4 ). One region of each tRNA contains a three-base sequence called an anticodon that is complementary
(Fig. 4.19 1 ). The polymerase moves along the DNA molecule and “unwinds” the double strand by breaking the hydrogen bonds between paired bases 2 . One strand of DNA, called the template strand, serves as the guide for RNA synthesis 3 . The promoter region is not transcribed into RNA.
During transcription, each base in the DNA template strand pairs with the complementary RNA base (G-C, C-G, T-A, A-U). This pairing of complementary bases is similar to the process by which a double strand of DNA forms (see Appendix C for a review of DNA synthesis). For example, a DNA segment containing the base sequence AGTAC is transcribed into the RNA sequence UCAUG.
As the RNA bases bind to the DNA template strand, they also bond with one another to create a single strand of RNA. During transcription, bases are linked at an average rate of 40 per sec- ond. In humans, the largest RNAs may contain as many as 5,000 bases, and their transcription may take more than a minute—a long time for a cellular process. When RNA polymerase reaches the stop codon, it stops adding bases to the growing RNA strand and releases the strand (Fig. 4.19 4 ).
EMERGING CONCEPTS Purple Petunias and RNAi
Who could have guessed that research to develop a deep purple petunia would lead the way to a whole new area of molecular biology research? RNA interference (RNAi) was first observed in 1990, when botanists who intro- duced purple pigment genes into petunias ended up with plants that were white or striped with white instead of the deeper purple color they expected. This observation did not attract attention until 1998, when scientists doing research in animal biology and medicine had similar problems in experiments on a nematode worm. Now RNAi is one of the newest tools in biotechnology research.
In very simple terms, RNA “silencing” of mRNA is a naturally occurring event accomplished through the produc- tion or introduction of small interfering RNA (siRNA) mol- ecules. These short RNA strands bind to mRNA and keep it from being translated. They may even target the mRNA for destruction.
RNAi is a naturally occurring RNA-processing mecha- nism that may have evolved as a means of blocking the replication of RNA viruses. Now researchers are using it to selectively block the production of single proteins within a cell. The scientists’ ultimate goal is to create technologies that can be used for the diagnosis and treatment of disease.
Concept Check
20. Use the genetic code in Figure 4.17 to write the DNA codons that correspond to the three mRNA stop codons.
21. What does the name RNA polymerase tell you about the func- tion of this enzyme?
Alternative Splicing Creates Multiple Proteins from One DNA Sequence The next step in the process of protein synthesis is mRNA processing, which takes two forms (Fig. 4.18 3 ). In RNA interfer- ence, newly synthesized mRNA is inactivated or destroyed before it can be translated into proteins (see the Emerging Concepts box). In alternative splicing, enzymes clip segments out of the middle or off the ends of the mRNA strand. Other enzymes then splice the remaining pieces of the strand back together.
Alternative splicing is necessary because a gene contains both segments that encode proteins (exons) and noncoding segments called introns (FIG. 4.20). That means the mRNA initially made from the gene’s DNA contains noncoding segments that must be removed before the mRNA leaves the nucleus. The result of alter- native splicing is a smaller piece of mRNA that now contains only the coding sequence for a specific protein.
One advantage of alternative splicing is that it allows a single base sequence on DNA to code for more than one protein. The designation of segments as coding or noncoding is not fixed for a given gene. Segments of mRNA that are removed one time can be left in the next time, producing a finished mRNA with a different sequence. The closely related forms of a single enzyme known as isozymes are probably made by alternative splicing of a single gene.
Concept Check
22. Explain in one or two sentences the relationship of mRNA, nitrogenous bases, introns, exons, mRNA processing, and proteins.
After mRNA has been processed, it exits the nucleus through nuclear pores and goes to ribosomes in the cytosol. There mRNA directs the construction of protein.
M04_SILV5197_08_SE_C04.indd 114 12/1/17 12:08 AM
C H
A P
TER
4
4.4 Metabolism 115
to an mRNA codon. A different region of the tRNA molecule binds to a specific amino acid.
As translation begins, the anticodons of tRNAs carrying amino acids attach to the complementary codons of ribosomal mRNA. For example, a tRNA with anticodon sequence UUU carries the amino acid lysine. The UUU anticodon pairs with an AAA codon, one of two codons for lysine, on mRNA. The pairing between mRNA and tRNA puts newly arrived amino acids into the correct orientation to link to the growing peptide chain.
Dehydration synthesis links amino acids by creating a peptide bond between the amino group ( - NH2) of the newly arrived amino acid and the carboxyl end ( - COOH) of the peptide chain [p. 32]. Once this happens, mRNA releases the “empty” tRNA. The tRNA can then attach to another amino acid molecule with the aid of a cytosolic enzyme and ATP.
When the last amino acid has been joined to the newly syn- thesized peptide chain, the termination stage has been reached (Fig. 4.21 5 ). The mRNA, the peptide, and the ribosomal sub- units separate. The ribosomes are ready for a new round of protein synthesis, but the mRNA is broken down by enzymes known as ribonucleases. Some forms of mRNA are broken down quite rapidly, while others may linger in the cytosol and be translated many times.
Protein Sorting Directs Proteins to Their Destination One of the amazing aspects of protein synthesis is the way specific proteins go from the ribosomes directly to where they are needed in the cell, a process called protein sorting. Many newly made proteins carry a sorting signal, an address label that tells the cell where the protein should go. Some proteins that are synthesized on cytosolic ribosomes do not have sorting signals. Without a “delivery tag,” they remain in the cytosol when they are released from the ribosome [Fig. 3.7, p. 72].
The sorting signal is a special segment of amino acids known as a signal sequence. The signal sequence tag directs the protein to the proper organelle, such as the mitochondria or peroxisomes, and allows it to be transported through the organelle membrane. Peptides synthesized on ribosomes attached to the rough endoplasmic reticu- lum have a signal sequence that directs them through the membrane of the rough ER and into the lumen of this organelle. Once a protein enters the ER lumen, enzymes remove the signal sequence.
Proteins Undergo Posttranslational Modification The amino acid sequence that comes off a ribosome is the primary structure of a newly synthesized protein [p. 32], but not the final form.
FIG. 4.20 mRNA processing
Introns removed Introns removed
Transcribed sectionPromoter
DNA
mRNA Processing may produce two proteins from one
gene by alternative splicing.
Unprocessed mRNA
Exons for protein #1 Exons for protein #2
a b c d e f g h
A B C D E F G H
A
B D E
G I
C
F H
B
A C E
i
I
F
D
G I
H
Gene
Template strand
TRANSCRIPTION
In mRNA processing, segments of the newly created mRNA strand called introns are removed. The remaining exons are spliced back together to form the mRNA that codes for a functional protein.
Removing different introns from mRNA allows a single gene to code for multiple proteins. For protein #1, introns A, C, G, and I were removed. For protein #2, segments B, D, F, and H became the introns.
The promoter segment of DNA is not transcribed into RNA.
M04_SILV5197_08_SE_C04.indd 115 12/1/17 12:08 AM
116 CHAPTER 4 Energy and Cellular Metabolism
FIG. 4.21 Translation
Transcription
mRNA processing
Attachment of ribosomal subunits
Translation
Termination
Ribosome
Outgoing “empty” tRNA
RNA polymerase
tRNA
DNA
Nuclear membrane
mRNA
Amino acid
Ribosomal subunits
Completed peptide
Asp
Growing peptide chain
Incoming tRNA bound to an amino acid
Anticodon
mRNA
Trp
Lys
Each tRNA molecule attaches at one end to a specific amino acid. The anticodon of the tRNA molecule pairs with the appropriate codon on the mRNA, allowing amino acids to be linked in the order specified by the mRNA code.
Processed mRNA leaves the nucleus and associates with ribosomes.
1
2
3
4
5
GC UUUU AA
A A GG
A GA C CA
U AC
Translation matches the codons of RNA with amino acids to create a protein.
Phe
U U
U
The newly made protein can now form different types of covalent and noncovalent bonds, a process known as posttranslational modification. Cleavage of the amino acid chain, attachment of molecules or groups, and cross-linkages are three general types of posttranslational modification. More than 100 different types of posttranslational modification have been described so far.
In some common forms of posttranslational modification, the amino acid chain can:
1. fold into various three-dimensional shapes. Protein folding creates the tertiary structure of the protein.
2. create cross-links between different regions of its amino acid chain. 3. be cleaved (split) into fragments. 4. add other molecules or groups. 5. assemble with other amino acid chains into a polymeric
(many-part) protein. Assembly of proteins into polymers cre- ates the quaternary structure of the protein.
M04_SILV5197_08_SE_C04.indd 116 12/1/17 12:08 AM
C H
A P
TER
4
4.4 Metabolism 117
most common chemical groups added to proteins are phosphate groups, PO4
2- and methyl groups, - CH3. (Addition of a methyl group is called methylation.)
Assembly into Polymeric Proteins Many complex proteins have a quaternary structure with multiple subunits, in which protein chains assemble into dimers, trimers, or tetramers. One exam- ple is the enzyme lactate dehydrogenase (described on p. 99). Another example is the hemoglobin molecule, with four protein chains [Fig. 2.3, p. 32].
Protein Folding Peptides released from ribosomes are free to take on their final three-dimensional shape. Each peptide first forms its secondary structure, which may be an a@helix or a b@strand [p. 32]. The molecule then folds into its final shape when hydrogen bonds, covalent bonds, and ionic bonds form between amino acids in the chain. Studies show that some protein folding takes place spontaneously, but it is often facilitated by helper proteins called molecular chaperones.
The three-dimensional shape of proteins is often essential for proper function. Misfolded proteins, along with other proteins the cell wishes to destroy, are tagged with a protein called ubiquitin and sent to proteasomes, cylindrical cytoplasmic enzyme complexes that break down proteins.
Cross-Linkage Some protein folding is held in place by relatively weak hydrogen bonds and ionic bonds. However, other proteins form strong covalent bonds between different parts of the amino acid chain. These bonds are often disulfide bonds (S–S) between two cysteine amino acids, which contain sulfur atoms. For example, the three chains of the digestive enzyme chymotrypsin are held together by disulfide bonds.
Cleavage Some biologically active proteins, such as enzymes and hormones, are synthesized initially as inactive molecules that must have segments removed before they become active. The enzyme chymotrypsin must have two small peptide frag- ments removed before it can catalyze a reaction [Fig. 2.12a, p. 50]. Posttranslational processing also activates some peptide hormones.
Addition of Other Molecules or Groups Proteins can be modified by the addition of sugars (glycosylation) to create glycoproteins, or by combination with lipids to make lipoproteins [p. 29]. The two
Concept Check
23. What is the removal of a phosphate group called? 24. List three general types of posttranslational modification of
proteins. 25. Is hemoglobin a monomer, dimer, trimer, or tetramer?
The many ways that proteins can be modified after synthesis add to the complexity of the human body. We must know not only the sequence of a protein but also how it is processed, where the protein occurs in or outside the cell, and what it does. Scientists working on the Human Genome Project initially predicted that our DNA would code for about 30,000 proteins, but they were not taking into account alternative splicing or posttranslational modifications. Scientists working on the Human Proteome Project (https://www.hupo.org/human-proteome-project) are now predicting that we will find more than a million different proteins. The magnitude of this project means that it will continue for many years into the future.
RUNNING PROBLEM CONCLUSION Tay-Sachs Disease
In this running problem, you learned that Tay-Sachs disease is an incurable, recessive genetic disorder in which the enzyme that breaks down gangliosides in cells is missing. One in 27 Ameri- cans of Eastern European Jewish descent in the United States carries the gene for this disorder. Other high-risk populations include French Canadians, Louisiana “Cajuns,” and Irish Ameri- cans. By one estimate, about one person in every 250 in the gen- eral American population is a carrier of the Tay-Sachs gene.
Blood tests and newer saliva tests can detect the presence of genetic mutations that cause this deadly disease. Check your understanding of this running problem by comparing your answers to those in the summary table. To read more on Tay-Sachs disease, see the NIH reference page (www.ninds .nih.gov/disorders/taysachs/taysachs.htm) or the website of the National Tay-Sachs & Allied Diseases Association (www .ntsad.org).
Question Facts Integration and Analysis
Q1: What is another symptom of Tay-Sachs disease besides loss of muscle control and brain function?
Hexosaminidase A breaks down gangliosides. In Tay-Sachs disease, this enzyme is absent, and ganglio- sides accumulate in cells, including light-sensitive cells of the eye, and cause them to function abnormally.
Damage to light-sensitive cells of the eye could cause vision problems and even blindness.
– Continued next page
M04_SILV5197_08_SE_C04.indd 117 12/1/17 12:08 AM
118 CHAPTER 4 Energy and Cellular Metabolism
CHAPTER SUMMARY The major theme of this chapter is energy in biological systems and how it is acquired, transferred, and used to do biological work. Energy is stored in large biomolecules such as fats and glycogen and is extracted from them through the processes of metabolism. Extracted energy is often stored temporarily in the high-energy phosphate bonds of ATP. Reac- tions and processes that require energy often use ATP as the energy source. This is a pattern you will see repeated as you learn more about the organ systems of the body.
Other themes in the chapter involve two kinds of structure-function relationships: molecular interactions and compartmentation. Molecular inter- actions are important in enzymes, where the ability of an enzyme to bind to its substrate influences the enzyme’s activity or in protein synthesis, where nucleic acids direct the assembly of amino acids into larger mol- ecules. Compartmentation of enzymes allows cells to direct energy flow by separating functions. Glycolysis takes place in the cytosol of the cell, but the citric acid cycle is isolated within mitochondria, requiring transport of substrates across the mitochondrial membrane. Modulation of enzyme activity and the separation of pathways into subcellular compartments are essential for organizing and separating metabolic processes.
4.1 Energy in Biological Systems 1. Energy is the capacity to do work. Chemical work enables cells and
organisms to grow, reproduce, and carry out normal activities. Trans- port work enables cells to move molecules to create concentration gradients. Mechanical work is used for movement. (p. 94)
2. Kinetic energy is the energy of motion. Potential energy is stored energy. (p. 95; Fig. 4.2)
4.2 Chemical Reactions 3. A chemical reaction begins with one or more reactants and ends
with one or more products (Tbl. 4.2). Reaction rate is measured as the change in concentration of products with time. (p. 96)
4. The energy stored in the chemical bonds of a molecule and avail- able to perform work is the free energy of the molecule. (p. 96)
5. Activation energy is the initial input of energy required to begin a reaction. (p. 96; Fig. 4.3)
6. Exergonic reactions are energy-producing. Endergonic reac- tions are energy-utilizing. (p. 96, 97; Fig. 4.3)
7. Metabolic pathways couple exergonic reactions to endergonic reac- tions. (p. 96, 97, 102; Fig. 4.4)
8. Energy for driving endergonic reactions is stored in ATP. (p. 97) 9. Reversible reactions can proceed in both directions. Irrevers-
ible reactions can go in one direction but not the other. The net free energy change of a reaction determines whether that reaction is reversible. (p. 98)
4.3 Enzymes 10. Enzymes are biological catalysts that speed up the rate of chemi-
cal reactions without themselves being changed. In reactions cata- lyzed by enzymes, the reactants are called substrates. (p. 98)
11. Like other proteins that bind ligands, enzymes exhibit saturation, specificity, and competition. Related isozymes may have different activities. (p. 99)
RUNNING PROBLEM CONCLUSION Continued
93 99 100 104 110 117
Question Facts Integration and Analysis
Q2: How could you test whether Sarah and David are carriers of the Tay-Sachs gene?
Carriers of the gene have lower- than-normal levels of hexosamini- dase A.
Run tests to determine the average enzyme levels in known carriers of the disease (i.e., people who are parents of children with Tay- Sachs disease) and in people who have little likelihood of being carriers. Compare the enzyme levels of suspected carriers such as Sarah and David with the averages for the known carriers and noncarriers.
Q3: Why might the genetic test for mutations in the Tay-Sachs gene be more accurate than the test that detects decreased amounts of hexosaminidase A?
The genetic test detects three mutations in the gene. The enzyme test analyzes levels of the enzyme produced by the gene.
The genetic test is a direct way to test if a person is a carrier. The enzyme test is an indirect indicator. It is possible for factors other than a defective gene to alter a person’s enzyme level. Can you think of some? (The answer can be found in Appendix C, p. C-0.)
Q4: Can you think of a situation in which the enzyme activity test might be more accu- rate than the genetic test?
The genetic test looks for three mutations in the Tay-Sachs gene.
There are more than three mutations that can cause Tay-Sachs disease. If the person does not have one of the three mutations being tested, the result will appear to be normal.
Q5: The Tay-Sachs gene is a recessive gene (t). What is the chance that any child of a carrier (Tt) and a noncarrier (TT) will be a carrier? What are the chances that a child of two car- riers will have the disease or be a carrier?
Mating of Tt * TT results in the following offspring: TT, Tt, TT, Tt. Mating of Tt * Tt results in the fol- lowing offspring: TT, Tt, Tt, tt.
If only one parent is a carrier, each child has a 50% chance of being a carrier (Tt). If both parents are carriers, there is a 25% chance that a child will have Tay-Sachs disease and a 50% chance a child will be a carrier.
M04_SILV5197_08_SE_C04.indd 118 12/1/17 12:08 AM
C H
A P
TER
4
12. Some enzymes are produced as inactive precursors and must be activated. This may require the presence of a cofactor. Organic cofactors are called coenzymes. (p. 100)
13. Enzyme activity is altered by temperature, pH, and modulator molecules. (p. 100)
14. Enzymes work by lowering the activation energy of a reaction. (p. 100; Fig. 4.7)
15. Most reactions can be classified as oxidation-reduction, hydrolysis-dehydration, addition-subtraction-exchange, or ligation reactions. (p. 101, 102; Tbl. 4.4)
4.4 Metabolism 16. All the chemical reactions in the body are known collectively as
metabolism. Catabolic reactions release energy and break down large biomolecules. Anabolic reactions require a net input of energy and synthesize large biomolecules. (p. 102)
17. Cells regulate the flow of molecules through their metabolic path- ways by (1) controlling enzyme concentrations, (2) producing alloste- ric and covalent modulators, (3) using different enzymes to catalyze reversible reactions, (4) isolating enzymes in intracellular organelles, or (5) maintaining an optimum ratio of ATP to ADP. (p. 102)
18. Aerobic pathways require oxygen and yield the most ATP. Anaerobic pathways can proceed without oxygen but produce ATP in much smaller quantities. (p. 104)
19. Through glycolysis, one molecule of glucose is converted into two pyruvate molecules, and yields 2 ATP, 2 NADH, and 2 H+. Glycoly- sis does not require the presence of oxygen. (p. 104; Fig. 4.12)
20. Aerobic metabolism of pyruvate through the citric acid cycle yields ATP, carbon dioxide, and high-energy electrons captured by NADH and FADH2. (p. 104; Fig. 4.13)
21. High-energy electrons from NADH and FADH2 give up their energy as they pass through the electron transport system. Their energy is trapped in the high-energy bonds of ATP. (p. 105; Fig. 4.14)
22. Maximum energy yield for aerobic metabolism of one glucose molecule is 30–32 ATP. (p. 109; Fig. 4.15)
23. In anaerobic metabolism, pyruvate is converted into lactate, with a net yield of 2 ATP for each glucose molecule. (p. 109; Fig. 4.15)
24. Protein synthesis is controlled by nuclear genes made of DNA. The code represented by the base sequence in a gene is transcribed into a complementary base code on RNA. Alternative splicing of mRNA in the nucleus allows one gene to code for multiple pro- teins. (p. 113; Figs. 4.18, 4.19, 4.20)
25. mRNA leaves the nucleus and goes to the cytosol where, with the assistance of transfer RNA and ribosomal RNA, it assembles amino acids into a designated sequence. This process is called translation. (p. 111; Fig. 4.21)
26. Posttranslational modification converts the newly synthesized protein to its finished form. (p. 113)
REVIEW QUESTIONS In addition to working through these questions and checking your answers on p. A-4, review the Learning Outcomes at the beginning of this chapter.
Level One Reviewing Facts and Terms 1. List the three basic forms of work and give a physiological example
of each.
2. Explain the difference between potential energy and kinetic energy.
3. State the two laws of thermodynamics in your own words.
4. The sum of all chemical processes through which cells obtain and store energy is called .
5. In the reaction CO2 + H2O S H2CO3, water and carbon dioxide are the reactants, and H2CO3 is the product. Because this reaction is catalyzed by an enzyme, it is also appropriate to call water and carbon dioxide . The speed at which this reaction occurs is called the reaction , often expressed as molarity/second.
6. are protein molecules that speed up chemical reactions by (increasing or decreasing?) the activation energy of the reaction.
7. Match each definition in the left column with the correct term from the right column (you will not use all the terms):
(a) reaction that can run either direction 1. exergonic
2. endergonic
3. activation energy
4. reversible
5. irreversible
6. specificity
7. free energy
8. saturation
(b) reaction that releases energy
(c) ability of an enzyme to catalyze one reaction but not another
(d) boost of energy needed to get a reaction started
8. Since 1972, enzymes have been designated by adding the suffix to their name.
9. Organic molecules that must be present in order for an enzyme to function are called . The precursors of these organic mol- ecules come from in our diet.
10. In an oxidation-reduction reaction, in which electrons are moved between molecules, the molecule that gains an electron is said to be , and the one that loses an electron is said to be .
11. The removal of H2O from reacting molecules is called . Using H2O to break down polymers, such as starch, is called .
12. The removal of an amino group - NH2 from a molecule (such as an amino acid) is called . Transfer of an amino group from one molecule to the carbon skeleton of another molecule (to form a different amino acid) is called .
13. In metabolism, reactions release energy and result in the breakdown of large biomolecules, and reactions require a net input of energy and result in the synthesis of large biomolecules. In what units do we measure the energy of metabolism?
14. Metabolic regulation in which the last product of a metabolic pathway (the end product) accumulates and slows or stops reactions earlier in the pathway is called .
15. Explain how H+ movement across the inner mitochondrial mem- brane results in ATP synthesis.
16. List two carrier molecules that deliver high-energy electrons to the electron transport system.
Review Questions 119
M04_SILV5197_08_SE_C04.indd 119 12/1/17 12:08 AM
120 CHAPTER 4 Energy and Cellular Metabolism
Level Two Reviewing Concepts 17. Create maps using the following terms.
Map 1: Metabolism
• acetyl CoA • glycolysis
• ATP • high-energy electrons
• citric acid cycle • lactate
• CO2 • mitochondria
• cytosol • NADH
• electron transport system • oxygen
• FADH2 • pyruvate
• glucose • water
Map 2: Protein Synthesis
• alternative splicing • ribosome
• base pairing • RNA polymerase
• bases (A, C, G, T, U) • RNA processing
• DNA • start codon
• exon • stop codon
• gene • template strand
• intron • transcription
• promoter • transcription factors
• mRNA • translation
• tRNA
18. When bonds are broken during a chemical reaction, what are the three possible fates for the potential energy found in those bonds?
19. Match the metabolic processes with the letter of the biological theme that best describes the process:
(a) biological energy use
(b) compartmentation
(c) molecular interactions
1. Glycolysis takes place in the cytosol; oxidative phos- phorylation takes place in mitochondria.
2. The electron transport system traps energy in a hydrogen ion concentration gradient.
3. Proteins are modified in the endoplasmic reticulum.
4. Metabolic reactions are often coupled to the reaction ATP S ADP + Pi.
5. Some proteins have S–S bonds between nonadjacent amino acids.
6. Enzymes catalyze biological reactions.
20. Explain why it is advantageous for a cell to store or secrete an enzyme in an inactive form.
21. Compare the following: (a) the energy yield from the aerobic break- down of one glucose to CO2 and H2O, and (b) the energy yield from one glucose going through anaerobic glycolysis ending with lactate. What are the advantages of each pathway?
22. Briefly describe the processes of transcription and translation. Which organelles are involved in each process?
23. On what molecule does the anticodon appear? Explain the role of this molecule in protein synthesis.
24. Is the energy of ATP’s phosphate bond an example of potential or kinetic energy?
25. If ATP releases energy to drive a chemical reaction, would you suspect the activation energy of that reaction to be large or small? Explain.
Level Three Problem Solving 26. Given the following strand of DNA: (1) Find the first start codon
in the DNA sequence. Hint: The start codon in mRNA is AUG. (2) For the triplets that follow the start codon, list the sequence of corresponding mRNA bases. (3) Give the amino acids that corre- spond to those mRNA triplets. (See Fig. 4.17.)
DNA: CGCTACAAGTCACGTACCGTAACGACT
mRNA:
Amino acids:
Level Four Quantitative Problems 27. The graph shows the free energy change for the reaction
A + B S D. Is this an endergonic or exergonic reaction?
Answers to Concept Checks, Figure and Graph Questions, and end-of-chapter Review Questions can be found in Appendix A [p. A-1].
Time
A1B D
F re
e en
er g
y
28. If the protein-coding portion of a piece of processed mRNA is 450 bases long, how many amino acids will be in the correspond- ing polypeptide? (Hint: The start codon is translated into an amino acid, but the stop codon is not.)
M04_SILV5197_08_SE_C04.indd 120 12/1/17 12:08 AM
Transcytosis (purple) across endothelium
5
5.1 Osmosis and Tonicity 124 LO 5.1.1 Explain how the body can be in
osmotic equilibrium but electrical and chemical disequilibrium.
LO 5.1.2 Describe the distribution of body water among compartments and the effect of age and sex on total body water.
LO 5.1.3 Compare and contrast molarity, osmolarity, osmolality, osmotic pressure, and tonicity.
LO 5.1.4 List the rules for determining osmolarity and tonicity of a solution.
5.2 Transport Processes 131 LO 5.2.1 Compare bulk flow to solute
movement across membranes. LO 5.2.2 Create a map to compare simple
diffusion, protein-mediated transport, and vesicular transport across membranes.
5.3 Diffusion 132 LO 5.3.1 Explain the differences between
diffusion in an open system and diffusion across biological membranes.
Membrane Dynamics
5.4 Protein-Mediated Transport 136 LO 5.4.1 Compare movement through channels
to movement on facilitated diffusion and active transport carriers.
LO 5.4.2 Apply the principles of specificity, competition, and saturation to carrier- mediated transport.
5.5 Vesicular Transport 146 LO 5.5.1 Compare phagocytosis, endocytosis,
and exocytosis.
5.6 Epithelial Transport 149 LO 5.6.1 Explain transcellular transport,
paracellular transport, and transcytosis as they apply to epithelial transport.
5.7 The Resting Membrane Potential 152
LO 5.7.1 Explain what it means for a cell to have a resting membrane potential difference.
LO 5.7.2 Explain how changes in ion permeability change membrane potential, giving examples.
Organisms could not have evolved without relatively impermeable membranes to surround the cell constituents. E. N. Harvey, in H. Davson and J. F. Danielli’s The Permeability of Natural Membranes, 1952
BACKGROUND BASICS 39 Polar and nonpolar molecules 32,30 Protein and lipid structure 73 Cell junctions 43 Molarity and solutions 61 Membrane structure 68 Cytoskeleton 75 Types of epithelia 99 Enzymes
5.8 Integrated Membrane Processes: Insulin Secretion 158
LO 5.8.1 Describe the sequence of membrane transport-associated steps that link increased blood glucose to insulin secretion from pancreatic beta cells.
M05_SILV5197_08_SE_C05.indd 121 12/1/17 12:18 AM
122 CHAPTER 5 Membrane Dynamics
I n 1992, the medical personnel at isolated Atoifi Hospital in the Solomon Islands of the South Pacific were faced with a dilemma. A patient was vomiting and needed intravenous (IV)
fluids, but the hospital’s supply had run out, and it would be several days before a plane could bring more. Their solution was to try something they had only heard about—make an IV of coconut water, the sterile solution that forms in the hollow center of developing coconuts. For two days, the patient received a slow drip of fluid into his veins directly from young coconuts sus- pended next to his bed. He soon recovered and was well enough to go home.*
No one knows who first tried coconut water as an IV solution, although stories have been passed down that both the Japanese and the British used it in the Pacific Theater of Operations during World War II. Choosing the appropriate IV solution is more than a matter of luck, however. It requires a solid understanding of the body’s compartments and of the ways different solutes pass between them, topics you will learn about in this chapter.
Homeostasis Does Not Mean Equilibrium The body has two distinct fluid compartments: the cells and the fluid that surrounds the cells (FIG. 5.1). The extracellular fluid (ECF) outside the cells is the buffer between the cells and the envi- ronment outside the body. Everything that enters or leaves most cells passes through the ECF.
Water is essentially the only molecule that moves freely between cells and the extracellular fluid. Because of this free move- ment of water, the extracellular and intracellular compartments reach a state of osmotic equilibrium 5osmos, push or thrust6, in which the fluid concentrations are equal on the two sides of the cell membrane. (Concentration is expressed as amount of sol- ute per volume of solution [Fig. 2.7, p. 42].) Although the overall
*D. Campbell-Falck et al. The intravenous use of coconut water. Am J Emerg Med 18: 108–111, 2000.
concentrations of the ECF and intracellular fluid (ICF) are equal, some solutes are more concentrated in one of the two body com- partments than in the other (Fig. 5.1d). This means the body is in a state of chemical disequilibrium.
Figure 5.1d shows the uneven distribution of major solutes among the body fluid compartments. For example, sodium, chlo- ride, and bicarbonate (HCO3
-) ions are more concentrated in extracellular fluid than in intracellular fluid. Potassium ions are more concentrated inside the cell. Calcium (not shown in the fig- ure) is more concentrated in the extracellular fluid than in the cytosol, although many cells store Ca2+ inside organelles such as the endoplasmic reticulum and mitochondria.
Even the extracellular fluid is not at equilibrium between its two subcompartments, the plasma and the interstitial fluid (IF) [p. 61]. Plasma is the liquid matrix of blood and is found inside the circulatory system. Proteins and other large anions are concentrated in the plasma but cannot cross the leaky exchange epithelium of blood vessels [p. 77], so they are mostly absent from the interstitial fluid (Fig. 5.1d). On the other hand, smaller molecules and ions such as Na+ and Cl- are small enough to pass freely between the endothelial cells and therefore have the same concentrations in plasma and interstitial fluid.
The concentration differences of chemical disequilibrium are a hallmark of a living organism, as only the continual input of energy keeps the body in this state. If solutes leak across the cell membranes dividing the intracellular and extracellular compart- ments, energy is required to return them to the compartment they left. For example, K+ ions that leak out of the cell and Na+ ions that leak into the cell are returned to their original compartments by an energy-utilizing enzyme known as the Na +@K +@ATPase, or the sodium-potassium pump. When cells die and cannot use energy, they obey the second law of thermodynamics [p. 95] and return to a state of randomness that is marked by loss of chemical disequilibrium.
Many body solutes mentioned so far are ions, and for this reason we must also consider the distribution of electrical charge between the intracellular and extracellular compart- ments. The body as a whole is electrically neutral, but a few extra negative ions are found in the intracellular fluid, while their matching positive ions are located in the extracellular fluid. As a result, the inside of cells is slightly negative relative to the extracellular fluid. This ionic imbalance results in a state of electrical disequilibrium. Changes in this disequilib- rium create electrical signals. We discuss this topic in more detail later in this chapter.
In summary, note that homeostasis is not the same as equilibrium. The intracellular and extracellular compartments of the body are in osmotic equilibrium, but in chemical and electrical disequilibrium. Furthermore, osmotic equilibrium and the two disequilibria are dynamic steady states. The goal of homeostasis is to maintain the dynamic steady states of the body’s compartments.
In the remainder of this chapter, we discuss these three steady states, and the role transport mechanisms and the selective perme- ability of cell membranes play in maintaining these states.
RUNNING PROBLEM Cystic Fibrosis Over 100 years ago, midwives performed an unusual test on the infants they delivered: The midwife would lick the infant’s forehead. A salty taste meant that the child was destined to die of a mysterious disease that withered the flesh and robbed the breath. Today, a similar “sweat test” will be performed in a major hospital—this time, with state-of-the-art techniques—on Daniel Biller, an 18-month-old with a history of weight loss and respi- ratory problems. The name of the mysterious disease? Cystic fibrosis.
122 131 138 151 152 159
M05_SILV5197_08_SE_C05.indd 122 12/1/17 12:18 AM
123
FIG. 5.1 ESSENTIALS Body Fluid Compartments
Cell membrane
Na+
K+
Cl−
HCO3 −
Proteins
KEY
1. Using the ECF volume shown in (b), calculate the volumes of the plasma and interstitial fluid. 2. What is this person’s total body water volume? 3. Use your answers from the two questions above to calculate the percentage of total body water in the plasma and interstitial fluid. 4. A woman weighs 121 pounds. Using the standard proportions for the fluid compartments, calculate her ECF, ICF, and plasma volumes. (2.2 lb = 1 kg. 1 kg water = 1 L)
5. How does the ion composition of plasma differ from that of the IF? 6. What ions are concentrated in the ECF? In the ICF?
(a) The body fluids are in two compartments: the extracellular fluid (ECF) and intracellular fluid (ICF). The ECF and ICF are in osmotic equilibrium but have very different chemical composition.
(b) This figure shows the compartment volumes for the “standard” 70-kg man.
(c) Fluid compartments are often illustrated with box diagrams like this one.
20%
40%
60%
80%
100%
P er
ce n t
o f
to ta
l b o
d y
w at
er
Intracellular fluid (ICF)
Intracellular fluid
Interstitial fluid
P la
sm a
ECF 1/3
ICF 2/3
Extracellular fluid (ECF)
Plasma (25% of ECF)
Interstitial Fluid (75% of ECF)
28 L
14 L
(d) The body compartments are in a state of chemical disequilibrium. The cell membrane is a selectively permeable barrier between the ECF and ICF.
20
40
60
80
100
120
140
160
Io n c
o n ce
n tr
at io
n (m
m o
l/ L )
Intracellular fluid Interstitial fluid Plasma
Intracellular fluid is 2/3 of the total body water volume.
Extracellular fluid is 1/3 of the total body water volume. The ECF consists of:
Substances moving between the plasma and interstitial fluid must cross the leaky
exchange epithelium of the capillary wall.
Material moving into and out of the ICF must cross
the cell membrane.
BODY FLUID COMPARTMENTS
Extracellular Fluid (ECF)Cells (Intracellular Fluid, ICF)
Blood plasma is the liquid matrix of blood.
Interstitial fluid lies between the circulatory system and the cells.
GRAPH QUESTIONS
GRAPH QUESTIONS
M05_SILV5197_08_SE_C05.indd 123 12/1/17 12:18 AM
124 CHAPTER 5 Membrane Dynamics
in adipose tissue occupy most of the cell’s volume, displacing the more aqueous cytoplasm [see Fig. 3.13e, p. 83]. Age also influences body water content. Infants have relatively more water than adults, and water content decreases as people grow older than 60.
TABLE 5.1 shows water content as a percentage of total body weight in people of various ages and both sexes. In clinical prac- tice, it is necessary to allow for the variability of body water content when prescribing drugs. Because women and older people have less body water, they will have a higher concentration of a drug in the plasma than will young men if all are given an equal dose per kilogram of body mass.
The distribution of water among body compartments is less variable. When we look at the relative volumes of the body com- partments, the intracellular compartment contains about two- thirds (67%) of the body’s water (Fig. 5.1b, c). The remaining third (33%) is split between the interstitial fluid (which contains about 75% of the extracellular water) and the plasma (which contains about 25% of the extracellular water).
The Body Is in Osmotic Equilibrium Water is able to move freely between cells and the extracellular fluid and distributes itself until water concentrations are equal throughout the body—in other words, until the body is in a state of osmotic equilibrium. The movement of water across a membrane in response to a solute concentration gradient is called osmosis. In osmosis, water moves to dilute the more concentrated solution. Once concentrations are equal, net movement of water stops.
Look at the example shown in FIGURE 5.2 in which a selec- tively permeable membrane separates two compartments of equal
5.1 Osmosis and Tonicity The distribution of solutes in the body depends on whether a substance can cross cell membranes. Water, on the other hand, is able to move freely in and out of nearly every cell in the body by traversing water-filled ion channels and special water channels cre- ated by the protein aquaporin (AQP). In this section, we examine the relationship between solute movement and water movement across cell membranes. A sound understanding of this topic provides the foundation for the clinical use of IV fluid therapy.
The Body Is Mostly Water Water is the most important molecule in the human body because it is the solvent for all living matter. As we look for life in distant parts of the solar system, one of the first questions scientists ask about a planet is, “Does it have water?” Without water, life as we know it cannot exist.
How much water is in the human body? Because one individual differs from the next, there is no single answer. However, in human physiology we often speak of standard values for physiological func- tions based on “the 70-kg man.” These standard values are derived from data published in the mid-twentieth century by the Interna- tional Commission on Radiological Protection (ICRP). The ICRP was setting guidelines for permissible radiation exposure, and they selected a young (age 20–30) white European male who weighed 70 kilograms (kg) or 154 pounds as their “reference man,” or “stan- dard man.” In 1984, Reference Man was joined by Reference Woman, a young, 58-kg (127.6 lb) female. The U.S. population is getting larger and heavier, however, and in 1990, the equivalent Reference Man had grown to 77.5 kg and was 8 cm taller.
The 70-kg Reference Man has 60% of his total body weight, or 42 kg (92.4 lb), in the form of water. Each kilogram of water has a volume of 1 liter, so his total body water is 42 liters. This is the equivalent of 21 two-liter soft drink bottles!
Adult women have less water per kilogram of body mass than men because women have more adipose tissue. Large fat droplets
Concept Check
1. Using what you learned about the naming conventions for enzymes [p. 101], explain what the name Na +@K +@ATPase tells you about this enzyme’s actions.
2. The intracellular fluid can be distinguished from the extracellular fluid by the ICF’s high concentration of _____ ions and low concentration of _____, _____, and _____ ions.
3. In clinical situations, we monitor homeostasis of various substances such as ions, blood gases, and organic solutes by taking a blood sample and analyzing its plasma. For each of the following substances, predict whether knowing its plasma concentration also tells you its concentration in the ECF and the ICF. Defend your answer. (a) Na+
(b) K+
(c) water (d) proteins
Concept Check
4. If the 58-kg Reference Woman has total body water equivalent to 50% of her body weight, what are (a) her total body water volume, (b) her ECF and ICF volumes, and (c) her plasma volume?
TABLE 5.1 Water Content as Percentage of Total Body Weight by Age and Sex
Age Male Female
Infant 65% 65%
1–9 62% 62%
10–16 59% 57%
17–39 61% 51%
40–59 55% 47%
60 + 52% 46%
Adapted from I. S. Edelman and J. Leibman, Anatomy of body water and electrolytes, Am J Med 27(2): 256–277, 1959.
M05_SILV5197_08_SE_C05.indd 124 12/1/17 12:18 AM
C H
A P
TER
5
5.1 Osmosis and Tonicity 125
the osmotic movement of water into compartment B is known as the osmotic pressure of solution B. The units for osmotic pressure, just as with other pres- sures in physiology, are atmospheres (atm) or millimeters of mercury (mm Hg). A pressure of 1 mm Hg is equivalent to the pressure exerted on a 1@cm2 area by a 1-mm-high column of mercury.
Osmolarity Describes the Number of Particles in Solution Another way to predict the osmotic movement of water quantitatively is to know the concentrations of the solu- tions with which we are dealing. In chemistry, concentra- tions are often expressed as molarity (M), which is defined as number of moles of dissolved solute per liter of solu- tion (mol/L). Recall that one mole is 6.02 * 1023 mol- ecules [Fig. 2.7, p. 42].
However, using molarity to describe biological concentrations can be misleading. The important fac- tor for osmosis is the number of osmotically active particles in a given volume of solution, not the number of molecules. Because some molecules dissociate into ions when they dissolve in a solution, the number of particles in solution is not always the same as the num- ber of molecules.
For example, one glucose molecule dissolved in water yields one particle, but one NaCl dissolved in water theoretically yields two ions (particles): Na+ and Cl-. Water moves by osmosis in response to the total concentration of all particles in the solution. The particles may be ions, uncharged molecules, or a mixture of both.
Consequently, for biological solutions we express the concentration as osmolarity, the number of osmoti- cally active particles (ions or intact molecules) per liter of solution. Osmolarity is expressed in osmoles per liter
(osmol/L or OsM) or, for very dilute physiological solutions, mil- liosmoles/liter (mOsM). To convert between molarity and osmo- larity, use the following equation:
molarity (mol/L) * particles>molecule (osmol/mol) = osmolarity (osmol>L)
Let us look at two examples, glucose and sodium chloride, and compare their molarities with their osmolarities.
One mole of glucose molecules dissolved in enough water to create 1 liter of solution yields a 1 molar solution (1 M). Because glucose does not dissociate in solution, the solution has only one mole of osmotically active particles:
1 M glucose * 1 osmole>mole glucose = 1 OsM glucose
Sodium chloride, however, dissociates when placed in solution. At body temperature, a few NaCl ions fail to separate, so instead of 2 ions per NaCl, the dissociation factor is about 1.8. Thus, one
FIG. 5.2 Osmosis and osmotic pressure
H2O
H2O
H2O
Volume increased
Volume decreased
Pure water
Glucose molecules
Selectively permeable membrane
3
1
2 A B
A B
A B
Two compartments are separated by a membrane that is permeable to water but not glucose. Solution B is more concentrated than solution A.
Water moves by osmosis into the more concentrated solution. Osmosis stops when concentrations are equal.
Compartment A is pure water, and compartment B is a glucose solution. Osmotic pressure is the pressure that must be applied to oppose osmosis.
Force is applied to exactly oppose
osmosis from A to B.
volume. The membrane is permeable to water but does not allow glucose to cross. In 1 , compartments A and B contain equal volumes of glucose solution. Compartment B has more solute (glucose) per volume of solution and therefore is the more con- centrated solution. A concentration gradient across the membrane exists for glucose. However, because the membrane is not perme- able to glucose, glucose cannot move to equalize its distribution.
Water, by contrast, can cross the membrane freely. It will move by osmosis from compartment A, which contains the dilute glucose solution, to compartment B, which contains the more concentrated glucose solution. Thus, water moves to dilute the more concen- trated solution (Fig. 5.2 2 ).
How can we make quantitative measurements of osmosis? One method is shown in Figure 5.2 3 . The solution to be mea- sured is placed in compartment B with pure water in compart- ment A. Because compartment B has a higher solute concentration than compartment A, water will flow from A to B. However, by pushing down on the piston, you can keep water from entering compartment B. The pressure on the piston that exactly opposes
M05_SILV5197_08_SE_C05.indd 125 12/1/17 12:18 AM
126 CHAPTER 5 Membrane Dynamics
mole of NaCl dissociates in solution to yield 1.8 moles of particles (Na+, Cl-, and NaCl). The result is a 1.8 OsM solution:
1 mole NaCl>L * 1.8 osmol>mol NaCl = 1.8 osmol>L NaCl
Osmolarity describes only the number of particles in the solution. It says nothing about the composition of the particles. A 1 OsM solution could be composed of pure glucose or pure Na+ and Cl- or a mixture of all three solutes.
The normal osmolarity of the human body ranges from 280 to 296 milliosmoles per liter (mOsM). In this book, to simplify calculations, we will round that number up slightly to 300 mOsM.
A term related to osmolarity is osmolality. Osmolality is concen- tration expressed as osmoles of solute per kilogram of water. Because biological solutions are dilute and little of their weight comes from solute, physiologists often use the terms osmolarity and osmolality inter- changeably. Osmolality is usually used in clinical situations because it is easy to estimate people’s body water content by weighing them.
Clinicians estimate a person’s fluid loss in dehydration by equating weight loss to fluid loss. Because 1 liter of pure water weighs 1 kilogram, a decrease in body weight of 1 kg (or 2.2 lbs.) is considered equivalent to the loss of 1 liter of body fluid. A baby with diarrhea can easily be weighed to estimate its fluid loss. A decrease of 1.1 lbs. (0.5 kg) of body weight is assumed to mean the loss of 500 mL of fluid. This calculation provides a quick estimate of how much fluid needs to be replaced.
Comparing Osmolarities of Two Solutions Osmolarity is a prop- erty of every solution. You can compare the osmolarities of dif- ferent solutions as long as the concentrations are expressed in the same units—for example, as milliosmoles per liter. If two solutions contain the same number of solute particles per unit volume, we say that the solutions are isosmotic 5iso@, equal6. If solution A has a higher osmolarity (contains more particles per unit volume, is more concentrated) than solution B, we say that solution A is hyperosmotic to solution B. In the same example, solution B, with fewer osmoles per unit volume, is hyposmotic to solution A. TABLE 5.2 shows some examples of comparative osmolarities.
Osmolarity is a colligative property of solutions, meaning it depends strictly on the number of particles per liter of solution. Osmolarity says nothing about what the particles are or how they behave. Before we can predict whether osmosis will take place between any two solutions divided by a membrane, we must know the properties of the membrane and of the solutes on each side of it.
If the membrane is permeable only to water and not to any solutes, water will move by osmosis from a less concentrated
(hyposmotic) solution into a more concentrated (hyperosmotic) solution, as illustrated in Figure 5.2. Most biological systems are not this simple, however. Biological membranes are selectively permeable and allow some solutes to cross in addition to water. To predict the movement of water into and out of cells, you must know the tonicity of the solution, explained in the next section.
Tonicity Describes the Volume Change of a Cell Tonicity 5tonikos, pertaining to stretching6 is a physiological term used to describe a solution and how that solution would affect cell volume if the cell were placed in the solution and allowed to come to equilibrium (TBL. 5.3).
• If a cell placed in the solution gains water at equilibrium and swells, we say that the solution is hypotonic to the cell.
• If the cell loses water and shrinks at equilibrium, the solution is said to be hypertonic.
• If the cell in the solution does not change size at equilibrium, the solution is isotonic.
By convention, we always describe the tonicity of the solution relative to the cell. How, then, does tonicity differ from osmolarity?
1. Osmolarity describes the number of solute particles dissolved in a volume of solution. It has units, such as osmoles/liter. The osmolarity of a solution can be measured by a machine called an osmometer. Tonicity has no units; it is only a compara- tive term.
2. Osmolarity can be used to compare any two solutions, and the relationship is reciprocal (solution A is hyperosmotic to solution B; therefore, solution B is hyposmotic to solution A). Tonicity always compares a solution and a cell, and by
Concept Check
5. A mother brings her baby to the emergency room because he has lost fluid through diarrhea and vomiting for two days. The staff weighs the baby and finds that he has lost 2 lbs. If you assume that the reduction in weight is due to water loss, what volume of water has the baby lost (2.2 lbs. = 1 kg)?
TABLE 5.2 Comparing Osmolarities
Solution A = 1 OsM Glucose
Solution B = 2 OsM Glucose
Solution C = 1 OsM NaCl
A is hyposmotic to B
B is hyperosmotic to A
C is isosmotic to A
A is isosmotic to C B is hyperosmotic to C
C is hyposmotic to B
TABLE 5.3 Tonicity of Solutions
Solution
Cell Behavior When Placed in the Solution
Description of the Solution Relative to the Cell
A Cell swells Solution A is hypotonic
B Cell doesn’t change size
Solution B is isotonic
C Cell shrinks Solution C is hypertonic
M05_SILV5197_08_SE_C05.indd 126 12/1/17 12:18 AM
C H
A P
TER
5
5.1 Osmosis and Tonicity 127
the cell. If all solutes in the isosmotic solution are nonpenetrat- ing, then the solution is also isotonic. If there are any penetrating solutes in the isosmotic solution, the solution will be hypotonic.
Hyperosmotic solutions may be hypertonic, isotonic, or hypotonic. Their tonicity depends on the relative concentration of nonpenetrating solutes in the solution compared to the cell, as described previously.
Often tonicity is explained using a single cell that is placed into a solution, but here we will use a more physiologically appro- priate system: a two-compartment box model that represents the total body divided into ECF and ICF (see Fig. 5.1c). To simplify the calculations, we will use a 3-liter body, with 2 liters in the ICF and 1 liter in the ECF. We assume that the starting osmolarity is 300 mOsM (0.3 OsM) and that solutes in each compartment are nonpenetrating (NP) and cannot move into the other compartment. By defining volumes and concentrations, we can use the equation solute/volume = concentration (S>V = C ) to mathematically deter- mine changes to volumes and osmolarity. Concentration is osmolarity.
Always begin by defining the starting conditions. This may be the person’s normal state or it may be the altered state that you are trying to return to normal. An example of this would be trying to restore normal volume and osmolarity in a person who has become dehydrated through sweat loss.
FIGURE 5.4 shows the starting conditions for the 3-liter body both as a compartment diagram and in a table. The table format allows you to deal with an example mathematically if you know the volumes and concentration of the body and of the solution added or lost.
The body’s volumes and concentration will change as the result of adding or losing solutes, water, or both—the law of mass bal- ance [p. 10]. Additions to the body normally come through the inges- tion of food and drink. In medical situations, solutions can be added directly to the ECF through IV infusions. Significant solute and water loss may occur with sweating, vomiting and diarrhea, or blood loss.
Once you have defined the starting conditions, you add or subtract volume and solutes to find the body’s new osmolarity. The final step is to determine whether the ECF and ICF volumes change as a result of the water and solute gain or loss. In this last step, you must separate the added solutes into penetrating solutes and nonpenetrating solutes.
In our examples, we use three solutes: NaCl, urea, and glu- cose. NaCl is considered nonpenetrating. Any NaCl added to the
convention, tonicity is used to describe only the solution—for example, “Solution A is hypotonic to red blood cells.”
3. Osmolarity alone does not tell you what happens to a cell placed in a solution. Tonicity by definition tells you what happens to cell volume at equilibrium when the cell is placed in the solution.
This third point is the one that is most confusing to students. Why can’t osmolarity be used to predict tonicity? The reason is that the tonicity of a solution depends not only on its concentra- tion (osmolarity) but also on the nature of the solutes in the solution.
By nature of the solutes, we mean whether the solute par- ticles can cross the cell membrane. If the solute particles (ions or molecules) can enter the cell, we call them penetrating solutes. We call particles that cannot cross the cell membrane nonpenetrating solutes. Tonicity depends on the concentra- tion of nonpenetrating solutes only. Let’s see why this is true.
First, some preliminary information. The most important nonpenetrating solute in physiology is NaCl. If a cell is placed in a solution of NaCl, the Na+ and Cl- ions do not enter the cell. This makes NaCl a nonpenetrating solute. (In reality, a few Na+ ions may leak across, but they are immediately transported back to the extracellular fluid by the Na+@K+@ATPase. For this reason, NaCl is considered a functionally nonpenetrating solute.)
By convention, we assume that cells are filled with other types of nonpenetrating solutes. In other words, the solutes inside the cell are unable to leave as long as the cell membrane remains intact. Now we are ready to see why osmolarity alone cannot be used to predict tonicity.
Suppose you know the composition and osmolarity of a solu- tion. How can you figure out the tonicity of the solution without actually putting a cell in it? The key lies in knowing the relative con- centrations of nonpenetrating solutes in the cell and in the solution. Water will always move until the concentrations of nonpenetrating solutes in the cell and the solution are equal.
Here are the rules for predicting tonicity:
1. If the cell has a higher concentration of nonpenetrating solutes than the solution, there will be net movement of water into the cell. The cell swells, and the solution is hypotonic.
2. If the cell has a lower concentration of nonpenetrating solutes than the solution, there will be net movement of water out of the cell. The cell shrinks, and the solution is hypertonic.
3. If the concentrations of nonpenetrating solutes are the same in the cell and the solution, there will be no net movement of water at equilib- rium. The solution is isotonic to the cell.
How does tonicity relate to osmolarity? FIGURE 5.3 shows the possible combinations of osmolarity and tonicity, and why osmo- larity alone cannot predict tonicity. There is one exception to this statement: A hyposmotic solution is always hypotonic, no matter what its composition. The cell will always have a higher concen- tration of nonpenetrating solutes than the solution, and water will move into the cell (rule 1 above).
As you can see in Figure 5.3, an isosmotic solution may be isotonic or hypotonic. It can never be hypertonic because it can never have a higher concentration of nonpenetrating solutes than
FIG. 5.3 The relationship between osmolarity and tonicity
The osmolarity of a solution is not an accurate predictor of its tonicity.
Hyposmotic Isosmotic Hyperosmotic
Hypotonic
Isotonic
Hypertonic √ √ √
√ √√
TONICITY OSMOLARITY
M05_SILV5197_08_SE_C05.indd 127 12/1/17 12:18 AM
FIG. 5.4 ESSENTIALS: Osmolarity and Tonicity
For all problems, define your starting conditions. Assume that all initial body solutes are nonpenetrating (NP) and will remain in either the ECF or ICF.
to solve the problems. You will know two of the three variables and can calculate the third.
Remember that body compartments are in osmotic equilibrium. Once you know the total body’s osmolarity (concentration), you also know the ECF and ICF osmolarity because they are the same.
In the tables below and on the following page, the yellow boxes indicate the unknowns that must be calculated.
We have a 3-liter body that is 300 mOsM. The ECF is 1 liter and the ICF is 2 liters. Use S/V = C to find out how much solute is in each of the two compartments. Rearrange the equation to solve for S: S = CV.
We can also do these calculations using the following table format. This table has been filled in with the values for the starting body. Remember that the ECF + ICF must always equal the total body values, and that once you know the total body osmolarity, you know the ECF and ICF osmolarity.
To see the effect of adding a solution or losing fluid, start with this table and add or subtract volume and solute as appropriate. You cannot add and subtract concentrations. You must use volumes and solute amounts.
• Work the total body column first, adding or subtracting solutes and volume. Once you calculate the new total body osmolarity, carry that number across the bottom row to the ECF and ICF columns. (The compartments are in osmotic equilibrium.)
• Distribute nonpenetrating solutes to the appropriate compartment. NaCl stays in the ECF. Glucose goes into the cells. Use V = S/C to calculate the new compartment volumes.
Starting Condition:
Solute/volume = concentration (S/V = C)
Use the equation
SICF = 300 mosmol/L X 2 L = 600 mosmol NP solute in the ICF
SECF = 300 mosmol/L X 1 L = 300 mosmol NP solute in the ECF
Solute (mosmoles)
900 mosmol 300 mosmol 600 mosmol
300 mOsM 300 mOsM 300 mOsM
3 L 1 L 2 L Volume
(L)
Osmolarity (mOsM)
Total Body ECF ICF
Solute (mosmoles)
900 + 300 = 1200 mosmol
1200/4 = 300 mOsM
3 + 1 = 4 L Volume
(L)
Osmolarity (mOsM)
Total Body
Solute (mosmoles)
1200 mosmol 300 + 300 = 600 600 mosmol
300 mOsM 300 mOsM 300 mOsM
4 L 2 L 2 L Volume
(L)
Osmolarity (mOsM)
Total Body ECF ICF
AnswerAdd an IV solution of 1 liter of 300 mOsM NaCl to this body. This solution adds 1 liter of volume and 300 mosmoles of NaCl.
Work total body first. Add solute and volume, then calculate new osmolarity (yellow box).
Carry the new osmolarity across to the ECF and ICF boxes (arrows). All of the added NaCl will stay in the ECF, so add that solute amount to the ECF box. ICF solute amount is unchanged. Use V = S/C to calculate the new ECF and ICF volumes (yellow boxes).
The added solution was isosmotic (300 mOsM) and its nonpenetrating concentration was the same as that of the body’s (300 mOsM NP). You would predict that the solution was isotonic, and that is confirmed with these calculations, which show no water entering or leaving the cells (no change in ICF volume).
Solute (mosmoles)
900 + 500 = 1400 mosmol
600 mosmol NP300 mosmol NP
1 L 2 L
1400/5 = 280 mOsM
3 + 2 = 5 L Volume
(L)
Osmolarity (mOsM)
Total Body
Solute (mosmoles)
1400 mosmol 300 + 500 = 800 600
280 mOsM 280 mOsM 280 mOsM
5 L 2.857 L 2.143 L Volume
(L)
Osmolarity (mOsM)
Total Body ECF ICF
AnswerAdd 2 liters of a 500 mOsM solution. The solution is equal parts NaCl (nonpenetrating) and urea (penetrating), so it has 250 mosmol/L NaCl and 250 mosmol/L urea.
Step 1: Add 2 liters and 500 mosmoles NaCl. Do total body column first.
Step 2: Carry the new osmolarity across to ECF and ICF. All NaCl remains in the ECF so add that solute to the ECF column. Calculate new ECF and ICF volumes.
• Notice that ICF volume + ECF volume = total body volume.
This solution has both penetrating and nonpenetrating solutes, but only nonpenetrating solutes contribute to tonicity and cause water to shift between compartments.
Before working this problem, answer the following questions:
Now work the problem using the starting conditions table as your starting point. What did you add? 2 L of (250 mosmol/L urea and 250 mosmol/L NaCl) = 2 liters of volume + 500 mosmol urea + 500 mosmol NaCl. Urea does not contribute to tonicity, so we will set the 500 mosmol of urea aside and only add the volume and NaCl in the first step:
(a) This solution is __________ osmotic to the 300 mOsM body. (b) What is the concentration of nonpenetrating solutes [NP] in the solution? _______________ (c) What is the [NP] in the body? ________ (d) Using the rules for tonicity in Table 5.4, will there be water movement into or out of the cells? If so, in what direction? (e) Based on your answer in (d), this solution is ________ tonic to this body’s cells.
Answer the following questions from the values in the table:
Compare your answers in (f) and (g) to your answers for (a)–(e). Do they match? They should.
If you know the starting conditions of the body and you know the composition of a solution you are adding, you should be able to describe the solution’s osmolarity and tonicity relative to the body by asking the questions in (a)–(e). Now test yourself by working Concept Check questions 8 and 9.
(f) What happened to the body osmolarity after adding the solution? _____________ This result means the added solution was ___________osmotic to the body’s starting osmolarity.
(g) What happened to the ICF volume? ________________________ This means the added solution was
____________tonic to the cells.
Solute (mosmoles)
1400 + 500 = 1900
1900/5 = 380 mOsM 380 mOsM 380 mOsM
5 L 2.857 L 2.143 L Volume
(L)
Osmolarity (mOsM)
Total Body ECF ICF Step 3: Now add the reserved urea solute to the whole body solute to get the final osmolarity. That osmolarity carries over to the ECF and ICF compartments. Urea will distribute itself throughout the body until its concentration everywhere is equal, but it will not cause any water shift between ECF and ICF, so the ECF and ICF volumes remain as they were in Step 2.
ECF ICF
Example 1
Example 2
1
2
Play Phys in Action
@Mastering Anatomy & Physiology
M05_SILV5197_08_SE_C05.indd 128 12/2/17 1:02 AM
129
For all problems, define your starting conditions. Assume that all initial body solutes are nonpenetrating (NP) and will remain in either the ECF or ICF.
to solve the problems. You will know two of the three variables and can calculate the third.
Remember that body compartments are in osmotic equilibrium. Once you know the total body’s osmolarity (concentration), you also know the ECF and ICF osmolarity because they are the same.
In the tables below and on the following page, the yellow boxes indicate the unknowns that must be calculated.
We have a 3-liter body that is 300 mOsM. The ECF is 1 liter and the ICF is 2 liters. Use S/V = C to find out how much solute is in each of the two compartments. Rearrange the equation to solve for S: S = CV.
We can also do these calculations using the following table format. This table has been filled in with the values for the starting body. Remember that the ECF + ICF must always equal the total body values, and that once you know the total body osmolarity, you know the ECF and ICF osmolarity.
To see the effect of adding a solution or losing fluid, start with this table and add or subtract volume and solute as appropriate. You cannot add and subtract concentrations. You must use volumes and solute amounts.
• Work the total body column first, adding or subtracting solutes and volume. Once you calculate the new total body osmolarity, carry that number across the bottom row to the ECF and ICF columns. (The compartments are in osmotic equilibrium.)
• Distribute nonpenetrating solutes to the appropriate compartment. NaCl stays in the ECF. Glucose goes into the cells. Use V = S/C to calculate the new compartment volumes.
Starting Condition:
Solute/volume = concentration (S/V = C)
Use the equation
SICF = 300 mosmol/L X 2 L = 600 mosmol NP solute in the ICF
SECF = 300 mosmol/L X 1 L = 300 mosmol NP solute in the ECF
Solute (mosmoles)
900 mosmol 300 mosmol 600 mosmol
300 mOsM 300 mOsM 300 mOsM
3 L 1 L 2 L Volume
(L)
Osmolarity (mOsM)
Total Body ECF ICF
Solute (mosmoles)
900 + 300 = 1200 mosmol
1200/4 = 300 mOsM
3 + 1 = 4 L Volume
(L)
Osmolarity (mOsM)
Total Body
Solute (mosmoles)
1200 mosmol 300 + 300 = 600 600 mosmol
300 mOsM 300 mOsM 300 mOsM
4 L 2 L 2 L Volume
(L)
Osmolarity (mOsM)
Total Body ECF ICF
AnswerAdd an IV solution of 1 liter of 300 mOsM NaCl to this body. This solution adds 1 liter of volume and 300 mosmoles of NaCl.
Work total body first. Add solute and volume, then calculate new osmolarity (yellow box).
Carry the new osmolarity across to the ECF and ICF boxes (arrows). All of the added NaCl will stay in the ECF, so add that solute amount to the ECF box. ICF solute amount is unchanged. Use V = S/C to calculate the new ECF and ICF volumes (yellow boxes).
The added solution was isosmotic (300 mOsM) and its nonpenetrating concentration was the same as that of the body’s (300 mOsM NP). You would predict that the solution was isotonic, and that is confirmed with these calculations, which show no water entering or leaving the cells (no change in ICF volume).
Solute (mosmoles)
900 + 500 = 1400 mosmol
600 mosmol NP300 mosmol NP
1 L 2 L
1400/5 = 280 mOsM
3 + 2 = 5 L Volume
(L)
Osmolarity (mOsM)
Total Body
Solute (mosmoles)
1400 mosmol 300 + 500 = 800 600
280 mOsM 280 mOsM 280 mOsM
5 L 2.857 L 2.143 L Volume
(L)
Osmolarity (mOsM)
Total Body ECF ICF
AnswerAdd 2 liters of a 500 mOsM solution. The solution is equal parts NaCl (nonpenetrating) and urea (penetrating), so it has 250 mosmol/L NaCl and 250 mosmol/L urea.
Step 1: Add 2 liters and 500 mosmoles NaCl. Do total body column first.
Step 2: Carry the new osmolarity across to ECF and ICF. All NaCl remains in the ECF so add that solute to the ECF column. Calculate new ECF and ICF volumes.
• Notice that ICF volume + ECF volume = total body volume.
This solution has both penetrating and nonpenetrating solutes, but only nonpenetrating solutes contribute to tonicity and cause water to shift between compartments.
Before working this problem, answer the following questions:
Now work the problem using the starting conditions table as your starting point. What did you add? 2 L of (250 mosmol/L urea and 250 mosmol/L NaCl) = 2 liters of volume + 500 mosmol urea + 500 mosmol NaCl. Urea does not contribute to tonicity, so we will set the 500 mosmol of urea aside and only add the volume and NaCl in the first step:
(a) This solution is __________ osmotic to the 300 mOsM body. (b) What is the concentration of nonpenetrating solutes [NP] in the solution? _______________ (c) What is the [NP] in the body? ________ (d) Using the rules for tonicity in Table 5.4, will there be water movement into or out of the cells? If so, in what direction? (e) Based on your answer in (d), this solution is ________ tonic to this body’s cells.
Answer the following questions from the values in the table:
Compare your answers in (f) and (g) to your answers for (a)–(e). Do they match? They should.
If you know the starting conditions of the body and you know the composition of a solution you are adding, you should be able to describe the solution’s osmolarity and tonicity relative to the body by asking the questions in (a)–(e). Now test yourself by working Concept Check questions 8 and 9.
(f) What happened to the body osmolarity after adding the solution? _____________ This result means the added solution was ___________osmotic to the body’s starting osmolarity.
(g) What happened to the ICF volume? ________________________ This means the added solution was
____________tonic to the cells.
Solute (mosmoles)
1400 + 500 = 1900
1900/5 = 380 mOsM 380 mOsM 380 mOsM
5 L 2.857 L 2.143 L Volume
(L)
Osmolarity (mOsM)
Total Body ECF ICF Step 3: Now add the reserved urea solute to the whole body solute to get the final osmolarity. That osmolarity carries over to the ECF and ICF compartments. Urea will distribute itself throughout the body until its concentration everywhere is equal, but it will not cause any water shift between ECF and ICF, so the ECF and ICF volumes remain as they were in Step 2.
ECF ICF
Example 1
Example 2
1
2
M05_SILV5197_08_SE_C05.indd 129 12/1/17 12:18 AM
130 CHAPTER 5 Membrane Dynamics
body remains in the ECF. Urea is freely penetrating and behaves as if the cell membranes dividing the ECF and ICF do not exist. An added load of urea distributes itself until the urea concentration is the same throughout the body.
Glucose (also called dextrose) is an unusual solute. Like all solutes, it first goes into the ECF. Over time, however, 100% of added glucose will enter the cells. When glucose enters the cells, it is phosphorylated to glucose 6-phosphate (G-6-P) and cannot leave the cell again. So although glucose enters cells, it is not freely penetrating because it stays in the cell and adds to the cell’s nonpenetrating solutes.
Giving someone a glucose solution is the same as giving them a slow infusion of pure water because glucose 6-phosphate is the first step in the aerobic metabolism of glucose [p. 106]. The end products of aerobic glucose metabolism are CO2 and water.
The examples shown in Figure 5.4 walk you through the pro- cess of adding and subtracting solutions to the body. Ask the fol- lowing questions when you are evaluating the effects of a solution on the body:
1. What is the osmolarity of this solution relative to the body? (Tbl. 5.2)
2. What is the tonicity of this solution? (Use Fig. 5.3 to help eliminate possibilities.) To determine tonicity, compare the concentration of the nonpenetrating solutes in the solution to the body concentration. (All body solutes are considered to be nonpenetrating.)
For example, consider a solution that is 300 mOsM— isosmotic to a body that is 300 mOsM. The solution’s tonicity depends on the concentration of nonpenetrating solutes in the solution. If the solution is 300 mOsM NaCl, the solution’s nonpenetrating solute concentration is equal to that of the body. When the solution mixes with the ECF, the ECF nonpenetrating concentration and osmo- larity do not change. No water will enter or leave the cells (the ICF compartment), and the solution is isotonic. You can calculate this for yourself by working through Example 1 in Figure 5.4.
Now suppose the 300 mOsM solution has urea as its only solute. Urea is a penetrating solute, so this solution has zero non- penetrating solutes. When the 300 mOsM urea solution mixes with the ECF, the added volume of the urea solution dilutes the nonpenetrating solutes of the ECF. (S/V = C: The same amount of NP solute in a larger volume means a lower NP concentration.)
Now the nonpenetrating concentration of the ECF is less than 300 mOsM. The cells still have a nonpenetrating solute concentra- tion of 300 mOsM, so water moves into the cells to equalize the nonpenetrating concentrations. (Rule: Water moves into the com- partment with the higher concentration of NP solutes.) The cells gain water and volume. This means the urea solution is hypotonic, even though it is isosmotic.
Example 2 in Figure 5.4 shows how combining penetrating and nonpenetrating solutes can complicate the situation. This example asks you to describe the solution’s osmolarity and tonicity based on its composition before you do the mathematical calculations. This skill is important for clinical situations, when you will not know exact body fluid volumes for the person needing an IV. TABLE 5.4 lists some rules to help you distinguish between osmolarity and tonicity.
Understanding the difference between osmolarity and tonicity is critical to making good clinical decisions about intravenous fluid therapy. The choice of IV fluid depends on how the clinician wants the solutes and water to distribute between the extracellular and intracellular fluid compartments. If the problem is dehydrated cells, the appropriate IV solution is hypotonic because the cells need fluid. If the situation requires fluid that remains in the extracellular fluid to replace blood loss, an isotonic IV solution is used. In medicine, the tonicity of a solution is usually the most important consideration.
TABLE 5.5 lists some common IV solutions and their approxi- mate osmolarity and tonicity relative to the normal human cell.
1. Assume that all intracellular solutes are nonpenetrating.
2. Compare osmolarities before the cell is exposed to the solution. (At equilibrium, the cell and solution are always isosmotic.)
3. Tonicity of a solution describes the volume change of a cell at equilibrium (Tbl. 5.3).
4. Determine tonicity by comparing nonpenetrating solute con- centrations in the cell and the solution. Net water movement is into the compartment with the higher concentration of non- penetrating solutes.
5. Hyposmotic solutions are always hypotonic.
TABLE 5.4 Rules for Osmolarity and Tonicity
TABLE 5.5 Intravenous Solutions
Solution Also Known as Osmolarity Tonicity
0.9% saline* Normal saline Isosmotic Isotonic
5% dextrose** in 0.9% saline D5–normal saline Hyperosmotic Isotonic
5% dextrose in water D5W Isosmotic Hypotonic
0.45% saline Half-normal saline Hyposmotic Hypotonic
5% dextrose in 0.45% saline D5–half-normal saline Hyperosmotic Hypotonic
* Saline = NaCl ** Dextrose = glucose
M05_SILV5197_08_SE_C05.indd 130 12/1/17 12:18 AM
C H
A P
TER
5
5.2 Transport Processes 131
between compartments usually means a molecule must cross one or more cell membranes. Movement within a compartment is less restricted. For this reason, biological transport is another theme that you will encounter repeatedly as you study the organ systems.
The most general form of biological transport is the bulk flow of fluids within a compartment. Although many people equate fluids with liquids, in physics both gases and liquids are considered fluids because they flow. The main difference between the two fluids is that gases are compressible because their mol- ecules are so far apart in space. Liquids, especially water, are not compressible. (Think of squeezing on a water balloon.)
In bulk flow, a pressure gradient causes fluid to flow from regions of higher pressure to regions of lower pressure. As the fluid flows, it carries with it all of its component parts, including substances dissolved or suspended in it. Blood moving through the circula- tory system is an excellent example of bulk flow. The heart acts as a pump that creates a region of high pressure, pushing plasma with its dissolved solutes and the suspended blood cells through the blood vessels. Air flow in the lungs is another example of bulk flow that you will encounter as you study physiology.
Other forms of transport are more specific than bulk flow. When we discuss them, we must name the molecule or molecules that are moving. Transport mechanisms you will learn about in the following sections include diffusion, protein- mediated trans- port, and vesicular transport.
What about the coconut water described at the start of the chapter? Chemical analysis shows that it is not an ideal IV solu- tion, although it is useful for emergencies. It is isosmotic to human plasma but is hypotonic, with Na+ concentrations much lower than normal ECF [Na+] and high concentrations of glucose and fruc- tose, along with amino acids.
Concept Check
6. Which of the following solutions has/have the most water per unit volume: 1 M glucose, 1 M NaCl, or 1 OsM NaCl?
7. Two compartments are separated by a membrane that is perme- able to water and urea but not to NaCl. Which way will water move when the following solutions are placed in the two com- partments? (Hint: Watch the units!)
Compartment A Membrane Compartment B
(a) 1 M NaCl | 1 OsM NaCl
(b) 1 M urea | 2 M urea
(c) 1 OsM NaCl | 1 OsM urea
8. Use the same 3-liter, 300 mOsM body as in Figure 5.4 for this problem. Add 1 liter of 260 mOsM glucose to the body and calculate the new body volumes and osmolarity once all the glucose has entered the cells and been phosphorylated. Before you do the calculations, make the following predictions: This solution is _____osmotic to the body and is _____tonic to the body’s cells.
9. Use the same 3-liter, 300 mOsM body as in Figure 5.4 for this problem. A 3-liter person working in the hot sun loses 500 mL of sweat that is equivalent to a 130 mOsM NaCl solution. Assume all NaCl loss comes from the ECF.
(a) The sweat lost is _____osmotic to the body. This means the osmolarity of the body after the sweat loss will (increase/decrease/not change)?
(b) As a result of this sweat loss, the body’s cell volume will (increase/decrease/not change)?
(c) Using the table, calculate what happens to volume and osmolarity as a result of this sweat loss. Do the results of your calculations match your answers in (a) and (b)?
10. You have a patient who lost 1 liter of blood, and you need to restore volume quickly while waiting for a blood transfusion to arrive from the blood bank. (a) Which would be better to administer: 5% dextrose in water
or 0.9% NaCl in water? (Hint: Think about how these sol- utes distribute in the body.) Defend your choice.
(b) How much of your solution of choice would you have to administer to return blood volume to normal?
RUNNING PROBLEM Daniel’s medical history tells a frightening story of almost con- stant medical problems since birth: recurring bouts of respiratory infections, digestive ailments, and, for the past six months, a his- tory of weight loss. Then, last week, when Daniel began having trouble breathing, his mother rushed him to the hospital. A culture taken from Daniel’s lungs raised a red flag for cystic fibrosis: The mucus from his airways was unusually thick and dehydrated. In cystic fibrosis, this thick mucus causes life-threatening respiratory congestion and provides a perfect breeding ground for infection- causing bacteria.
Q1: In people with cystic fibrosis, movement of sodium chlo- ride into the lumen of the airways is impaired. Why would failure to move NaCl into the airways cause the secreted mucus to be thick? (Hint: Remember that water moves into hyperosmotic regions.)
122 131 138 151 152 159
Cell Membranes Are Selectively Permeable Many materials move freely within a body compartment, but exchange between the intracellular and extracellular compartments is restricted by the cell membrane. Whether or not a substance enters a cell depends on the properties of the cell membrane and those of the substance. Cell membranes are selectively permeable, which means that some molecules can cross them but others cannot.
Play A&P Flix Animation
@Mastering Anatomy & Physiology
5.2 Transport Processes Water moves freely between body compartments, but what about other body components? Humans are large complex organ- isms, and the movement of material within and between body compartments is necessary for communication. This movement requires a variety of transport mechanisms. Some require an outside source of energy, such as that stored in the high-energy bond of ATP [p. 104], while other transport processes use only the kinetic or potential energy already in the system [p. 94]. Movement
M05_SILV5197_08_SE_C05.indd 131 12/1/17 12:18 AM
132 CHAPTER 5 Membrane Dynamics
The lipid and protein composition of a given cell membrane determines which molecules will enter the cell and which will leave [p. 44]. If a membrane allows a substance to pass through it, the membrane is said to be permeable to that substance 5permeare, to pass through6. If a membrane does not allow a substance to pass, the membrane is said to be impermeable 5im@, not6 to that substance.
Membrane permeability is variable and can be changed by altering the proteins or lipids of the membrane. Some molecules, such as oxygen, carbon dioxide, and lipids, move easily across most cell membranes. On the other hand, ions, most polar molecules, and very large molecules (such as proteins), enter cells with more difficulty or may not enter at all.
Two properties of a molecule influence its movement across cell membranes: the size of the molecule and its lipid solubility. Very small molecules and those that are lipid soluble can cross directly through the phospholipid bilayer. Larger and less lipid- soluble molecules usually do not enter or leave a cell unless the cell has specific membrane proteins to transport these molecules across the lipid bilayer. Very large lipophobic molecules cannot be trans- ported on proteins and must enter and leave cells in vesicles [p. 70].
There are multiple ways to categorize how molecules move across membranes. One scheme, just described, separates movement according to physical requirements: whether it moves by diffusion directly through the phospholipid bilayer, crosses with the aid of a membrane protein, or enters the cell in a vesicle (FIG. 5.5). A second scheme classifies movement according to its energy requirements. Passive transport does not require the input of energy other than the potential energy stored in a concentration gradient. Active transport requires the input of energy from some outside source, such as the high-energy phosphate bond of ATP.
The following sections look at how cells move material across their membranes. The principles discussed here also apply to movement across intracellular membranes, when substances move between organelles.
5.3 Diffusion Passive transport across membranes uses the kinetic energy [p. 94] inherent in molecules and the potential energy stored in concentra- tion gradients. Gas molecules and molecules in solution constantly move from one place to another, bouncing off other molecules or off the sides of any container holding them. When molecules start out concentrated in one area of an enclosed space, their motion causes them to spread out gradually until they distribute evenly throughout the available space. This process is known as diffusion.
Diffusion 5diffundere, to pour out6 may be defined as the movement of molecules from an area of higher concentration of the molecules to an area of lower concentration of the molecules.* If you leave a bottle of cologne open and later notice its fragrance across the room, it is because the aromatic molecules in the cologne have diffused from where they are more concentrated (in the bottle) to where they are less concentrated (across the room).
Diffusion has the following seven properties:
1. Diffusion is a passive process. By passive, we mean that diffusion does not require the input of energy from some outside source. Dif- fusion uses only the kinetic energy possessed by all molecules.
* Some texts use the term diffusion to mean any random movement of molecules, and they call molecular movement along a concentration gradient net diffusion. To simplify matters, we will use the term diffusion to mean movement down a concentration gradient.
FIG. 5.5 Transport across membranes
TRANSPORT ACROSS MEMBRANES
Protein-Mediated
Active Passive
Vesicular transport (ATP)
Exocytosis
Endocytosis
Phagocytosis
Indirect or secondary active transport (concentration gradient created by ATP)
Direct or primary active transport (ATP)
Simple diffusion (concentration gradient)
Facilitated diffusion (concentration gradient)
Ion channel (electrochemical gradient)
Aquaporin channel (osmosis)
Movement of substances across membranes can be classified by the energy requirements of transport (in parentheses) or by the physical pathway (through the membrane layer, through a membrane protein, or in a vesicle).
M05_SILV5197_08_SE_C05.indd 132 12/1/17 12:18 AM
C H
A P
TER
5
5.3 Diffusion 133
molecular movement, the rate of diffusion increases as temperature increases. Generally, changes in temperature do not significantly affect diffusion rates in humans because we maintain a relatively constant body temperature.
6. Diffusion rate is inversely related to molecular weight and size. Smaller molecules require less energy to move over a distance and therefore diffuse faster. Einstein showed that friction between the surface of a particle and the medium through which it dif- fuses is a source of resistance to movement. He calculated that diffusion is inversely proportional to the radius of the mol- ecule: the larger the molecule, the slower its diffusion through a given medium. The experiment in FIGURE 5.6 shows that the smaller and lighter potassium iodide (KI) molecules diffuse more rapidly through the agar gel than the larger and heavier Congo red molecules.
7. Diffusion can take place in an open system or across a partition that separates two compartments. Diffusion of cologne within a room is an example of diffusion taking place in an open system. There are no barriers to molecular movement, and the molecules spread out to fill the entire system. Diffusion can also take place between two compartments, such as the intracellular and extracellular compartments, but only if the partition dividing the two compartments allows the diffusing molecules to cross.
For example, if you close the top of an open bottle of cologne, the molecules cannot diffuse out into the room because neither the bottle nor the cap is permeable to the cologne. However, if you replace the metal cap with a plastic bag that has tiny holes in it, you will begin to smell the cologne in the room because the bag is permeable to the molecules. Similarly, if a cell membrane is permeable to a molecule, that molecule can enter or leave the cell by diffusion. If the membrane is not permeable to that particular molecule, the molecule cannot cross.
TABLE 5.6 summarizes these points. An important point to note: ions do not move by diffusion, even though you will read and hear about ions “diffusing across membranes.” Diffusion is ran- dom molecular motion down a concentration gradient. Ion move- ment is influenced by electrical gradients because of the attraction of opposite charges and repulsion of like charges. For this rea- son, ions move in response to combined electrical and concen- tration gradients, or electrochemical gradients. This electrochemical
2. Molecules move from an area of higher concentration to an area of lower concentration. A difference in the concentration of a substance between two places is called a concentration gradient, also known as a chemical gradient. We say that molecules dif- fuse down the gradient, from higher concentration to lower concentration.
The rate of diffusion depends on the magnitude of the concentration gradient. The larger the concentration gradi- ent, the faster diffusion takes place. For example, when you open a bottle of cologne, the rate of diffusion is most rapid as the molecules first escape from the bottle into the air. Later, when the cologne has spread evenly throughout the room, the rate of diffusion has dropped to zero because there is no longer a concentration gradient.
3. Net movement of molecules occurs until the concentration is equal everywhere. Once molecules of a given substance have distrib- uted themselves evenly, the system reaches equilibrium and diffusion stops. Individual molecules are still moving at equi- librium, but for each molecule that exits an area, another one enters. The dynamic equilibrium state in diffusion means that the concentration has equalized throughout the system but molecules continue to move.
4. Diffusion is rapid over short distances but much slower over long distances. Albert Einstein studied the diffusion of molecules in solution and found that the time required for a molecule to diffuse from point A to point B is proportional to the square of the distance from A to B. In other words, if the distance doubles from 1 to 2, the time needed for diffusion increases from 12 to 22 (from 1 to 4).
What does the slow rate of diffusion over long distances mean for biological systems? In humans, nutrients take 5 sec- onds to diffuse from the blood to a cell that is 100 mm from the nearest capillary. At that rate, it would take years for nutrients to diffuse from the small intestine to cells in the big toe, and the cells would starve to death.
To overcome the limitations of diffusion over distance, organisms use various transport mechanisms that speed up the movement of molecules. Most multicellular animals have some form of circulatory system to bring oxygen and nutrients rapidly from the point at which they enter the body to the cells.
5. Diffusion is directly related to temperature. At higher tempera- tures, molecules move faster. Because diffusion results from
FIG. 5.6 Diffusion experiment
(a) Wells in an agar gel plate are filled with two dyes of equal concentration: potassium iodide (Kl, 166 daltons) and Congo red (697 daltons).
(b) Ninety minutes later, the smaller and lighter Kl has diffused through the gel to stain a larger area.
KI Congo red
Time = 0 minutes Time = 90 minutes
M05_SILV5197_08_SE_C05.indd 133 12/1/17 12:18 AM
134 CHAPTER 5 Membrane Dynamics
movement is a more complex process than diffusion resulting solely from a concentration gradient, and the two processes should not be confused. We discuss ions and electrochemical gradients in more detail at the end of this chapter.
In summary, diffusion is the passive movement of uncharged molecules down their concentration gradient due to random molecu- lar movement. Diffusion is slower over long distances and slower for large molecules. When the concentration of the diffusing molecules is the same throughout a system, the system has come to chemical equi- librium, although the random movement of molecules continues.
Lipophilic Molecules Cross Membranes by Simple Diffusion Diffusion across membranes is a little more complicated than dif- fusion in an open system. Only lipid-soluble (lipophilic) molecules can diffuse through the phospholipid bilayer. Water and the many vital nutrients, ions, and other molecules that dissolve in water are lipo phobic as a rule: they do not readily dissolve in lipids. For these substances, the hydrophobic lipid core of the cell membrane acts as a barrier that prevents them from crossing.
Lipophilic substances that can pass through the lipid center of a membrane move by diffusion. Diffusion directly across the phospholipid bilayer of a membrane is called simple diffusion
and has the following properties in addition to the properties of diffusion listed earlier.
1. The rate of diffusion depends on the ability of the diffusing molecule to dissolve in the lipid layer of the membrane. Another way to say this is that the diffusion rate depends on how permeable the mem- brane is to the diffusing molecules. Most molecules in solution can mingle with the polar phosphate-glycerol heads of the bilayer [p. 61], but only nonpolar molecules that are lipid- soluble (lipophilic) can dissolve in the central lipid core of the membrane. As a rule, only lipids, steroids, and small lipophilic molecules can move across membranes by simple diffusion.
One important exception to this statement concerns water. Water, although a polar molecule, may diffuse slowly across some phospholipid membranes. For years, it was thought that the polar nature of the water molecule prevented it from moving through the lipid center of the bilayer, but experiments done with artificial membranes have shown that the small size of the water molecule allows it to slip between the lipid tails in some membranes.
How readily water passes through the membrane depends on the composition of the phospholipid bilayer. Membranes with high cholesterol content are less permeable to water than those with low cholesterol content, presumably because the lipid- soluble cholesterol molecules fill spaces between the fatty acid tails of the lipid bilayer and thus exclude water. For example, the cell membranes of some sections of the kidney are essentially impermeable to water unless the cells insert special water chan- nel proteins into the phospholipid bilayer. Most water movement across membranes takes place through protein channels.
Concept Check
11. If the distance over which a molecule must diffuse triples from 1 to 3, diffusion takes how many times as long?
TABLE 5.6 Rules for Diffusion of Uncharged Molecules
General Properties of Diffusion
1. Diffusion uses the kinetic energy of molecular movement and does not require an outside energy source.
2. Molecules diffuse from an area of higher concentration to an area of lower concentration.
3. Diffusion continues until concentrations come to equilibrium. Molecular movement continues, however, after equilibrium has been reached.
4. Diffusion is faster —along higher concentration gradients. — over shorter distances. — at higher temperatures. — for smaller molecules.
5. Diffusion can take place in an open system or across a partition that separates two systems.
Simple Diffusion across a Membrane
6. The rate of diffusion through a membrane is faster if — the membrane’s surface area is larger. — the membrane is thinner. — the concentration gradient is larger. — the membrane is more permeable to the molecule.
7. Membrane permeability to a molecule depends on — the molecule’s lipid solubility. — the molecule’s size. — the lipid composition of the membrane.
M05_SILV5197_08_SE_C05.indd 134 12/1/17 12:18 AM
C H
A P
TER
5
5.3 Diffusion 135
Membrane permeability is the most complex of the terms in Fick’s law because several factors influence it:
1. The size (and shape, for large molecules) of the diffusing mol- ecule. As molecular size increases, membrane permeability decreases.
2. The lipid-solubility of the molecule. As lipid solubility of the diffusing molecule increases, membrane permeability to the molecule increases.
3. The composition of the lipid bilayer across which it is dif- fusing. Alterations in lipid composition of the membrane change how easily diffusing molecules can slip between the individual phospholipids. For example, cholesterol molecules in membranes pack themselves into the spaces between the fatty acids tails and retard passage of molecules through those spaces [Fig. 3.2, p. 63], making the membrane less permeable.
We can rearrange the Fick equation to read:
diffusion rate surface area
= concentration
gradient *
membrane permeability
This equation now describes the flux of a molecule across the membrane, because flux is defined as the diffusion rate per unit surface area of membrane:
flux = concentration gradient * membrane permeability
2. The rate of diffusion across a membrane is directly proportional to the surface area of the membrane. In other words, the larger the membrane’s surface area, the more molecules can diffuse across per unit time. This fact may seem obvious, but it has important implications in physiology. One striking exam- ple of how a change in surface area affects diffusion is the lung disease emphysema. As lung tissue breaks down and is destroyed, the surface area available for diffusion of oxy- gen decreases. Consequently, less oxygen can move into the body. In severe cases, the oxygen that reaches the cells is not enough to sustain any muscular activity and the patient is confined to bed.
The rules for simple diffusion across membranes are summa- rized in Table 5.6. They can be combined mathematically into an equation known as Fick’s law of diffusion, a relationship that involves the factors just mentioned for diffusion across membranes plus the factor of concentration gradient. In an abbreviated form, Fick’s law says that the diffusion rate increases with an increase in surface area, the concentration gradient, or the membrane permeability:
rate of diffusion
∝ surface
area *
concentration gradient
* membrane
permeability
FIGURE 5.7 illustrates the principles of Fick’s law.
A re
a in
m 2
Human
RBC surface area
Area covered by lipids
Goat
0.25
0.50
0.75
1.00
1.25
Guinea pig Rabbit Dog
Adapted from data in E. Gorter and F. Grendel, On biomolecular layers of lipoids on the chromocytes of the blood. J Exp Med 41: 439-446, 1925.
GRAPH QUESTIONS • What was Gorter and Grendel’s conclusion? • Can you think of a simpler way to present these data that
makes the conclusion more obvious? • Why were mature erythrocytes the ideal cell for the study
of the cell membrane lipid thickness? How would Gorter and Grendel’s results have been different if they had used different cells, such as liver cells?
KEY
Most Americans recognize Benjamin Franklin as one of the founding fathers of the United States, but did you know that one of his scientific experiments was the basis for early stud- ies on the composition of the cell membrane? In 1757 Franklin observed how cooking oil released from a ship smoothed the water in its wake, and he began talking with sea captains and fishermen about the calming effect of pouring oil on agitated water. In 1762 he carried out the first of several experiments in which he poured a small amount of oil on a pond’s surface and watched as the oil spread out into a very large, thin, almost invisible layer. His calculation of the thickness of the oil layer was remarkably accurate. Franklin’s test inspired two Dutch scientists more than 150 years later to do a similar experiment with lipids extracted from the membranes of erythrocytes, or red blood cells (RBCs). Evert Gorter and his student F. Gren- del extracted lipids from the RBC cell membranes of humans and several animals. When they dropped the lipid mixture onto water, it spread out to create a thin film that was one molecule thick. Gorter and Grendel then compared the surface area covered by the membrane lipids to the total membrane surface area of the RBCs in the sample. Their data are shown in the graph on the right.
TRY IT! Membrane Models
Instructors: A version of this Try It! Activity can be assigned in @
M05_SILV5197_08_SE_C05.indd 135 12/1/17 12:18 AM
136 CHAPTER 5 Membrane Dynamics
In other words, the flux of a molecule across a membrane depends on the concentration gradient and the membrane’s per- meability to the molecule.
Remember that the principles of diffusion apply to all biologi- cal membranes, not just to the cell membrane. Diffusion of materi- als in and out of organelles follows the same rules.
5.4 Protein-Mediated Transport In the body, simple diffusion across membranes is limited to lipo- philic molecules. The majority of molecules in the body are either lipophobic or electrically charged and therefore cannot cross mem- branes by simple diffusion. Instead, the vast majority of solutes cross membranes with the help of membrane proteins, a process we call mediated transport.
If mediated transport is passive and moves molecules down their concentration gradient, and if net transport stops when con- centrations are equal on both sides of the membrane, the process is facilitated diffusion (Fig. 5.5). If protein-mediated transport requires energy from ATP or another outside source and moves a substance against its concentration gradient, the process is known as active transport.
Membrane Proteins Have Four Major Functions Protein-mediated transport across a membrane is carried out by membrane-spanning transport proteins. For physiologists, classify- ing membrane proteins by their function is more useful than clas- sifying them by their structure. Our functional classification scheme recognizes four broad categories of membrane proteins: (1) struc- tural proteins, (2) enzymes, (3) receptors, and (4) transport proteins. FIGURE 5.8 is a map comparing the structural and functional classifi- cations of membrane proteins. These groupings are not completely distinct, and as you will learn, some membrane proteins have more than one function, such as receptor-channels and receptor-enzymes.
Concept Check
12. Where does the energy for diffusion come from? 13. Which is more likely to cross a cell membrane by simple diffu-
sion: a fatty acid molecule or a glucose molecule? 14. What happens to the flux of molecules in each of the following
cases?
(a) Molecular size increases. (b) Concentration gradient increases. (c) Surface area of membrane decreases.
15. Two compartments are separated by a membrane that is per- meable only to water and to yellow dye molecules. Compart- ment A is filled with an aqueous solution of yellow dye, and compartment B is filled with an aqueous solution of an equal concentration of blue dye. If the system is left undisturbed for a long time, what color will compartment A be: yellow, blue, or green? (Remember, yellow plus blue makes green.) What color will compartment B be?
16. What keeps atmospheric oxygen from diffusing into our bodies across the skin? (Hint: What kind of epithelium is skin?)
FIG. 5.7 Fick’s law of diffusion
Rate of diffusion surface area 3 concentration gradient 3 membrane permeability
Extracellular fluid
Membrane surface area
Intracellular fluid
Composition of lipid layer
Lipid solubility
Molecular size
Concentration outside cell
Concentration inside cell
Concentration gradient
Fick's Law of Diffusion
lipid solubility molecular size
Membrane permeability
Changing the composition of the lipid layer can increase or decrease membrane permeability.
Factors affecting rate of diffusion through a cell membrane:
• Lipid solubility • Molecular size • Concentration gradient • Membrane surface area • Composition of lipid layer
Membrane Permeability
~
Diffusion of an uncharged solute across a membrane is proportional to the concentration gradient of the solute, the membrane surface area, and the membrane permeability to the solute.
M05_SILV5197_08_SE_C05.indd 136 12/1/17 12:18 AM
C H
A P
TER
5
5.4 Protein-Mediated Transport 137
(FIG. 5.9). Sometimes the ligand remains on the cell surface, and the receptor-ligand complex triggers an intracellular response. In other instances, the receptor-ligand complex is brought into the cell in a vesicle [p. 70]. Membrane receptors also play an impor- tant role in some forms of vesicular transport, as you will learn later in this chapter.
Transport Proteins The fourth group of membrane proteins— transport proteins—moves molecules across membranes. There are several different ways to classify transport proteins. Sci- entists have discovered that the genes for most membrane transport proteins belong to one of two gene “superfamilies”: the ATP-binding cassette (ABC) superfamily or the solute carrier (SLC) superfamily. The ABC family proteins use ATP’s energy to transport small molecules or ions across membranes. The 52 families of the SLC superfamily include most facilitated diffusion transporters as well as some active transporters.*
A second way to classify transport recognizes two main types of transport proteins: channels and carriers (FIG. 5.10). Channel proteins create water-filled passageways that directly link the intracellular and extracellular compartments. Carrier proteins, also just called transporters, bind to the substrates that they carry but
* The Transporter Classification System, retrieved from www.tcdb.org.
Structural Proteins The structural proteins of membranes have three major roles.
1. They help create cell junctions that hold tissues together, such as tight junctions and gap junctions [Fig. 3.8, p. 74].
2. They connect the membrane to the cytoskeleton to maintain the shape of the cell [Fig. 3.2, p. 63]. The microvilli of trans- porting epithelia are one example of membrane shaping by the cytoskeleton [Fig. 3.4b, p. 66].
3. They attach cells to the extracellular matrix by linking cyto- skeleton fibers to extracellular collagen and other protein fibers [p. 68].
Enzymes Membrane enzymes catalyze chemical reactions that take place either on the cell’s external surface or just inside the cell. For example, enzymes on the external surface of cells lining the small intestine are responsible for digesting peptides and carbohydrates. Enzymes attached to the intracellular surface of many cell membranes play an important role in transferring signals from the extracellular environment to the cytoplasm (see Chapter 6).
Receptors Membrane receptor proteins are part of the body’s chemical signaling system. The binding of a receptor with its ligand usually triggers another event at the membrane
FIG. 5.8 Map of membrane proteins
MEMBRANE PROTEINS
Integral proteins
Peripheral proteins
Membrane transport
Structure
are part of
form
are active in
are active in
activate
change conformation
Carrier proteins
Channel proteins
Cell junctions
Gated channelsOpen channels
Cytoskeleton
Function
Structural proteins
Membrane enzymes
Signal transfer
Metabolism
Receptor- mediated
endocytosis
Chemically gated
channel
Voltage-gated channel
Mechanically gated
channel
can be categorized according to
open and close
Membrane receptors
Functional categories of membrane proteins include transporters, structural proteins, enzymes, and receptors.
M05_SILV5197_08_SE_C05.indd 137 12/1/17 12:18 AM
138 CHAPTER 5 Membrane Dynamics
never form a direct connection between the intracellular fluid and extracellular fluid. As Figure 5.10 shows, carriers are open to one side of the membrane or the other, but not to both at once the way channel proteins are.
Why do cells need both channels and carriers? The answer lies in the different properties of the two transport proteins. Chan- nel proteins allow more rapid transport across the membrane but generally are limited to moving small ions and water. Carriers, while slower, can move larger molecules than channels can. There is some overlap between the two types, both structurally and func- tionally. For example, the aquaporin protein AQP has been shown to act both as a water channel and as a carrier for certain small organic molecules.
Channel Proteins Form Open, Water-Filled Passageways Channel proteins are made of membrane-spanning protein subunits that create a cluster of cylinders with a tunnel or pore through the center. Nuclear pore complexes [p. 71] and gap junctions (Fig. 3.8b, p. 74) can be considered very large forms of channels. In this text, we restrict use of the term channel to smaller channels whose centers are narrow, water-filled pores (FIG. 5.11). Movement through these smaller channels is mostly restricted to water and ions. When water-filled ion channels are open, tens of millions of ions per second can whisk through them unimpeded.
Channel proteins are named according to the substances that they allow to pass. Most cells have water channels made from a protein called aquaporin. In addition, more than 100 types of ion channels have been identified. Ion channels may be specific for one ion or may allow ions of similar size and charge to pass. For example, there are Na+ channels, K+ channels, and nonspecific monovalent (“one-charge”) cation channels that transport Na+, K+, and lithium ions Li+. Other ion channels you will encounter fre- quently in this text are Ca2+ channels and Cl- channels. Ion chan- nels come in many subtypes, or isoforms.
The selectivity of a channel is determined by the diameter of its central pore and by the electrical charge of the amino acids that line the channel. If the channel amino acids are positively charged, positive ions are repelled and negative ions can pass through the channel. On the other hand, a cation channel must have a nega- tive charge that attracts cations but prevents the passage of Cl- or other anions.
Channel proteins are like narrow doorways into the cell. If the door is closed, nothing can go through. If the door is open, there is a continuous passage between the two rooms connected by the doorway. The open or closed state of a channel is determined by regions of the protein molecule that act like swinging “gates.”
According to current models, channel “gates” take several forms. Some channel proteins have gates in the middle of the pro- tein’s pore. Other gates are part of the cytoplasmic side of the mem- brane protein. Such a gate can be envisioned as a ball on a chain that swings up and blocks the mouth of the channel (Fig. 5.10a). One type of channel in neurons has two different gates.
Channels can be classified according to whether their gates are usually open or usually closed. Open channels spend most of their time with their gate open, allowing ions to move back and forth across the membrane without regulation. These gates may occasionally flicker closed, but for the most part these channels behave as if they have no gates. Open channels are sometimes called either leak channels or pores, as in water pores.
Gated channels spend most of their time in a closed state, which allows these channels to regulate the movement of ions through them. When a gated channel opens, ions move through the channel just as they move through open channels. When a gated channel is closed, which it may be much of the time, it allows no ion movement between the intracellular and extracellular fluid.
What controls the opening and closing of gated channels? For chemically gated channels, the gating is controlled by
FIG. 5.9 Membrane receptors bind extracellular ligands
Cell membrane
Ligand binds to a cell membrane receptor protein.
Receptor
Receptor-ligand complex triggers intracellular response.
Receptor-ligand complex brought into the cell
Cytoplasmic vesicle
Events in the cell
Extracellular fluid
Intracellular fluid
RUNNING PROBLEM Cystic fibrosis is a debilitating disease caused by a defect in a membrane channel protein that normally transports chloride ions (Cl-). The channel—called the cystic fibrosis transmembrane conductance regulator (CFTR)—is located in epithelia lining the airways, sweat glands, and pancreas. A gate in the CFTR channel opens when the nucleotide ATP binds to the protein. In the lungs, this open channel transports Cl- out of the epithelial cells and into the airways. In people with cystic fibrosis, CFTR is nonfunctional or absent. As a result, chloride transport across the epithelium is impaired, and thickened mucus is the result.
Q2: Is the CFTR a chemically gated, a voltage-gated, or a mechanically gated channel protein?
122 131 138 151 152 159
M05_SILV5197_08_SE_C05.indd 138 12/1/17 12:18 AM
139
Carrier Proteins Change Conformation to Move Molecules The second type of transport protein is the carrier protein (Fig. 5.10b). Carrier proteins bind with specific substrates and carry them across the membrane by changing conformation. Small organic molecules (such as glucose and amino acids) that are too large to pass through channels cross membranes using carriers. Ions such as Na+ and K+ may move by carriers as well as through channels. Carrier proteins move solutes and ions into and out of cells as well as into and out of intracellular organelles, such as the mitochondria.
Some carrier proteins move only one kind of molecule and are known as uniport carriers. However, it is common to find
intracellular messenger molecules or extracellular ligands that bind to the channel protein. Voltage-gated channels open and close when the electrical state of the cell changes. Finally, mechanically gated channels respond to physical forces, such as increased temperature or pressure that puts tension on the membrane and pops the channel gate open. You will encounter many variations of these channel types as you study physiology.
Membrane transporters are membrane-spanning proteins that help move lipophobic molecules across membranes.
MEMBRANE TRANSPORTERS
(a) Channel proteins create a water-filled pore. (b) Carrier proteins never form an open channel between the two sides of the membrane.
can be classifiedcan be classified
Gated channels open and close in
response to signals.
Close-up views of transporters are shown in the top two rows and distant views in the bottom row. Primary active transport is indicated by ATP on the protein.
Open channels or pores
are usually open.
Uniport carriers transport only one kind of substrate.
Antiport carriers move substrates in opposite directions.
Symport carriers move two or more substrates in the same
direction across the membrane.
Cotransporters
ECF
ICF
Cell membrane
Carrier open to ICF
Same carrier open to ECF
GluGlu
ATP
ATP
Open Closed
Na+ Na +
K+
FIG. 5.10 ESSENTIALS Membrane Transporters
Concept Check
17. Positively charged ions are called _____, and negatively charged ions are called _____.
M05_SILV5197_08_SE_C05.indd 139 12/1/17 12:18 AM
140 CHAPTER 5 Membrane Dynamics
carriers that move two or even three kinds of molecules. A carrier that moves more than one kind of molecule at one time is called a cotransporter. If the molecules being transported are moving in the same direction, whether into or out of the cell, the carrier pro- teins are symport carriers 5sym@, together + portare, to carry6. (Sometimes, the term cotransport is used in place of symport.) If the molecules are being carried in opposite directions, the carrier pro- teins are antiport carriers 5anti, opposite + portare, to carry6, also called exchangers. Symport and antiport carriers are shown in Figure 5.10b.
Carriers are large, complex proteins with multiple sub- units. The conformation change required of a carrier protein makes this mode of transmembrane transport much slower than
movement through channel proteins. A carrier protein can move only 1,000 to 1,000,000 molecules per second, in contrast to tens of millions of ions per second that move through a channel protein.
Carrier proteins differ from channel proteins in another way: carriers never create a continuous passage between the inside and outside of the cell. If channels are like doorways, then carriers are like revolving doors that allow movement between inside and outside without ever creating an open hole. Carrier proteins can transport molecules across a membrane in both directions, like a revolving door at a hotel, or they can restrict their transport to one direction, like the turnstile at an amusement park that allows you out of the park but not back in.
One side of the carrier protein always creates a barrier that prevents free exchange across the membrane. In this respect, car- rier proteins function like the Panama Canal (FIG. 5.12). Picture the canal with only two gates, one on the Atlantic side and one on the Pacific side. Only one gate at a time is open.
When the Atlantic gate is closed, the canal opens into the Pacific. A ship enters the canal from the Pacific, and the gate closes behind it. Now the canal is isolated from both oceans with the ship trapped in the middle. Then the Atlantic gate opens, making the canal continuous with the Atlantic Ocean. The ship sails out of the gate and off into the Atlantic, having crossed the barrier of the land without the canal ever forming a continuous connection between the two oceans.
Movement across the membrane through a carrier protein is similar (Fig. 5.12b). The molecule being transported binds to the carrier on one side of the membrane (the extracellular side in our example). This binding changes the conformation of the carrier pro- tein so that the opening closes. After a brief transition in which both sides are closed, the opposite side of the carrier opens to the other
FIG. 5.11 The structure of channel proteins
Channel through center of
membrane protein
Channel through center of membrane protein (viewed from above)
One protein subunit
of channel
Many channels are made of multiple protein subunits that assemble in the membrane. Hydrophilic amino acids in the protein line the channel, creating a water-filled passage that allows ions and water to pass through.
FIG. 5.12 Carrier proteins
Membrane
Pacific Ocean
Atlantic Ocean
Pacific Ocean
Atlantic Ocean
Pacific Ocean
Atlantic Ocean
Transition state with both gates
closed
Passage open to one side
Passage open to
other side
Intracellular fluid
Molecule to be transported
Gate closed
Gate closed
Gate closed
Carrier
Extracellular fluid
(a) Carrier proteins, like the canal illustrated, never form a continuous passageway between the extracellular and intracellular fluids.
(b) The ligand binding sites change affinity when the protein conformation changes.
M05_SILV5197_08_SE_C05.indd 140 12/1/17 12:18 AM
C H
A P
TER
5
5.4 Protein-Mediated Transport 141
diffusion. For example, the family of carrier proteins known as GLUT transporters move glucose and related hexose sugars across membranes.
Facilitated diffusion has the same properties as simple diffusion (see Tbl. 5.6). The transported molecules move down their concen- tration gradient, the process requires no input of outside energy, and net movement stops at equilibrium, when the concentration inside the cell equals the concentration outside the cell (FIG. 5.13):
[glucose]ECF = [glucose]ICF*
Facilitated diffusion carriers always transport molecules down their concentration gradient. If the gradient reverses, so does the direction of transport.
Cells in which facilitated diffusion takes place can avoid reaching equilibrium by keeping the concentration of substrate in the cell low. With glucose, for example, this is accomplished by phosphorylation (Fig. 5.13c). As soon as a glucose molecule enters the cell on the GLUT carrier, it is phosphorylated to glucose 6-phosphate, the first step of glycolysis [p. 106]. Addition of the phosphate group prevents buildup of glucose inside the cell and also prevents glucose from leaving the cell.
* In this text, the presence of brackets around a solute’s name indicates concentration.
side of the membrane. The carrier then releases the transported molecule into the opposite compartment, having brought it through the membrane without creating a continuous connection between the extracellular and intracellular compartments.
Carrier proteins can be divided into two categories according to the energy source that powers the transport. As noted earlier, facili- tated diffusion is protein-mediated transport in which no outside source of energy except a concentration gradient is needed to move molecules across the cell membrane. Active transport is protein- mediated transport that requires an outside energy source, either ATP or the potential energy stored in a concentration gradient that was created using ATP. We will look first at facilitated diffusion.
Facilitated Diffusion Uses Carrier Proteins Some polar molecules appear to move into and out of cells by diffusion, even though we know from their chemical properties that they are unable to pass easily through the lipid core of the cell membrane. The solution to this seeming contradiction is that these polar molecules cross the cell membrane by facilitated diffu- sion, with the aid of specific carriers. Sugars and amino acids are examples of molecules that enter or leave cells using facilitated
FIG. 5.13 Facilitated diffusion of glucose into cells
High glucose concentration
Glucose
Glucose
in
out =
(a) Facilitated diffusion brings glucose into the cell down its concentration gradient using a GLUT transporter.
(b) Diffusion reaches equilibrium when the glucose concentrations inside and outside the cell are equal.
(c) In most cells, conversion of imported glucose into glucose 6-phosphate (G-6-P) keeps intra- cellular glucose concentrations low so that diffusion never reaches equilibrium.
Glucose out
Glucose in
high
ATP
ADP
G-6-P Glycogen
Glycolysis
stays lowGLUT
Low glucose concentration
Concept Check
23. Liver cells (hepatocytes) are able to convert glycogen to glu- cose, thereby making the intracellular glucose concentration higher than the extracellular glucose concentration. In what direction do the hepatic GLUT2 transporters carry glucose when this occurs?
Concept Check
18. Name four functions of membrane proteins. 19. Which kinds of particles pass through open channels? 20. Name two ways channels differ from carriers. 21. If a channel is lined with amino acids that have a net positive
charge, which of the following ions is/are likely to move freely through the channel? Na+, Cl-, K+, Ca2+
22. Why can’t glucose cross the cell membrane through open channels?
M05_SILV5197_08_SE_C05.indd 141 12/1/17 12:18 AM
142 CHAPTER 5 Membrane Dynamics
Active Transport Moves Substances against Their Concentration Gradients Active transport is a process that moves molecules against their concentration gradient—that is, from areas of lower concentra- tion to areas of higher concentration. Rather than creating an equilibrium state, where the concentration of the molecule is equal throughout the system, active transport creates a state of dis equilibrium by making concentration differences more pro- nounced. Moving molecules against their concentration gradient requires the input of outside energy, just as pushing a ball up a hill requires energy [see Fig. 4.2, p. 95]. The energy for active transport comes either directly or indirectly from the high-energy phosphate bond of ATP.
Active transport can be divided into two types. In primary (direct) active transport, the energy to push molecules against their concentration gradient comes directly from the high- energy phosphate bond of ATP. Secondary (indirect) active transport uses potential energy [p. 94] stored in the concentra- tion gradient of one molecule to push other molecules against their concentration gradient. All secondary active transport ultimately depends on primary active transport because the concentration gradients that drive secondary transport are created using energy from ATP.
The mechanism for both types of active transport appears to be similar to that for facilitated diffusion. A substrate to be transported binds to a membrane carrier and the carrier then changes conformation, releasing the substrate into the opposite compartment. Active transport differs from facilitated diffusion because the conformation change in the carrier protein requires energy input.
Primary Active Transport Because primary active transport uses ATP as its energy source, many primary active transporters are known as ATPases. You may recall that the suffix -ase signifies an enzyme, and the stem (ATP) is the substrate upon which the enzyme is acting [p. 101]. These enzymes hydrolyze ATP to ADP and inorganic phosphate (Pi), releasing usable energy in the pro- cess. Most of the ATPases you will encounter in your study of physiology are listed in TABLE 5.7. ATPases are sometimes called pumps, as in the sodium-potassium pump, or Na+@K+@ATPase, mentioned earlier in this chapter.
The sodium-potassium pump is probably the single most important transport protein in animal cells because it main- tains the concentration gradients of Na+ and K+ across the cell membrane (FIG. 5.14). The transporter is arranged in the cell membrane so that it pumps 3 Na+ out of the cell and 2 K+ into the cell for each ATP consumed. In some cells, the energy needed to move these ions uses 30% of all the ATP produced by the cell. FIGURE 5.15 illustrates the current model of how the Na+@K+@ATPase works.
Secondary Active Transport The sodium concentration gradi- ent, with Na+ concentration high in the extracellular fluid and low inside the cell, is a source of potential energy that the cell can harness for other functions. For example, nerve cells use the sodium gradient to transmit electrical signals, and epithelial cells use it to drive the uptake of nutrients, ions, and water. Membrane transporters that use potential energy stored in con- centration gradients to move molecules are called secondary active transporters.
Secondary active transport uses the kinetic energy of one molecule moving down its concentration gradient to push other molecules against their concentration gradient. The cotransported molecules may go in the same direction across the membrane (symport) or in opposite directions (antiport). The most common secondary active transport systems are driven by the sodium con- centration gradient.
TABLE 5.7 Primary Active Transporters
Names Type of Transport
Na+@K+@ATPase or sodium- potassium pump
Antiport
Ca2+@ATPase Uniport
H+@ATPase or proton pump Uniport
H+@K+@ATPase Antiport
FIG. 5.14 The sodium-potassium pump, Na+@K+@ATPase
Na+
K+ ATP
Extracellular fluid: High [Na+] Low [K+]Intracellular fluid:
Low [Na+] High [K+]
The Na+-K+-ATPase uses energy from ATP to pump Na+ out of the cell and K+ into the cell.
*
*In this book, carrier proteins that hydrolyze ATP have the letters ATP written on the membrane protein.
M05_SILV5197_08_SE_C05.indd 142 12/1/17 12:18 AM
C H
A P
TER
5
5.4 Protein-Mediated Transport 143
loss of Na+ from the protein changes the binding site for glucose back to a low-affinity site, so glucose is released and follows Na+ into the cytoplasm. The net result is the entry of glucose into the cell against its concentration gradient, coupled to the movement of Na+ into the cell down its concentration gradient. The SGLT transporter can only move glucose into cells because glucose must follow the Na+ gradient.
In contrast, GLUT transporters are reversible and can move glucose into or out of cells depending on the concentration gra- dient. For example, when blood glucose levels are high, GLUT transporters on liver cells bring glucose into those cells. During times of fasting, when blood glucose levels fall, liver cells convert their glycogen stores to glucose. When the glucose concentration inside the liver cells builds up and exceeds the glucose concentra- tion in the plasma, glucose leaves the cells on the reversible GLUT transporters. GLUT transporters are found on all cells of the body.
As one Na+ moves into the cell, it either brings one or more molecules with it or trades places with molecules exiting the cell. The major Na+@dependent transporters are listed in TABLE 5.8. Notice that the cotransported substances may be either other ions or uncharged molecules, such as glucose. As you study the different systems of the body, you will find these secondary active transport- ers taking part in many physiological processes.
The mechanism of the Na+@glucose secondary active transporter (SGLT) is illustrated in FIGURE 5.16. Both Na+ and glucose bind to the SGLT protein on the extracellular fluid side. Sodium binds first and causes a conformational change in the pro- tein that creates a high-affinity binding site for glucose 1 . When glucose binds to SGLT 2 , the protein changes conformation again and opens its channel to the intracellular fluid side 3 . Sodium is released to the ICF as it moves down its concentration gradient. The
FIG. 5.15 Mechanism of the Na+@K+@ATPase
2 K+ from ECF bind to high-affinity sites.
ADP + energy
ATP
ATPase is phosphorylated with Pi from ATP.
Protein changes conformation.
High-affinity binding sites for K+ appear.
34
3 Na+ from ICF bind to high-affinity sites.
P
PP
P
ICF
ECF
Protein changes conformation.
1
2 5
[Na+] high
[Na+] low
[K+] low
[K+] high
Na-binding sites lose their affinity for Na+ and release 3 Na+ into ECF.
Pi released.
K-binding sites lose their affinity for K+ and release 2 K+ into ICF.
High-affinity binding sites for Na+ appear.
This figure presents one model of how the Na+-K+-ATPase uses energy and inorganic phosphate (Pi) from ATP to move ions across a membrane. Phosphorylation and dephosphorylation of the ATPase change its conformation and the binding sites’ affinity for ions.
M05_SILV5197_08_SE_C05.indd 143 12/1/17 12:18 AM
144 CHAPTER 5 Membrane Dynamics
FIG. 5.16 Sodium-glucose cotransport
Na+
[Na+] low [glucose] high
[glucose] low
[Na+] high
[glucose] high
[Na+] low
SGLT protein
Glu
G lu
Glu
Glu
Lumen of intestine or kidney
Intracellular fluid
Na+
Na+
Na+
Glucose binding changes carrier conformation so that binding sites now face the ICF.
Na+ is released into cytosol, where [Na+] is low. Release changes glucose-binding site to low affinity. Glucose is released.
Na+ binding creates a high-affinity site for glucose.
Na+ binds to carrier.1
2
3
4
ICFLumen
ICFLumen
ICFLumen
The SGLT transporter uses the potential energy stored in the Na+ concentration gradient to move glucose against its concentration gradient.
TABLE 5.8 Examples of Secondary Active Transporters
Symport Carriers Antiport Carriers
Sodium-Dependent Transporters
Na+@K+@2Cl- (NKCC) Na+@H+ (NHE)
Na+@glucose (SGLT) Na+@Ca2+ (NCX)
Na+@Cl-
Na+@HCO3 -
Na+@amino acids (several types)
Na+@bile salts (small intestine)
Na+@choline uptake (nerve cells)
Na+@neurotransmitter uptake (nerve cells)
Nonsodium-Dependent Transporters
H+@peptide symporter (pepT) HCO3 -@Cl-
If GLUT transporters are everywhere, then why does the body need the SGLT Na+@glucose symporter? The simple answer is that both SGLT and GLUT are needed to move glucose from one side of an epithelium to the other. Consequently, SGLT trans- porters are found on certain epithelial cells, such as intestinal and kidney cells, that bring glucose into the body from the external environment. We discuss the process of transepithelial transport of glucose later in this chapter.
Carrier-Mediated Transport Exhibits Specificity, Competition, and Saturation Both passive and active forms of carrier-mediated transport dem- onstrate specificity, competition, and saturation—three properties that result from the binding of a substrate to a protein [p. 46].
Specificity Specificity refers to the ability of a transporter to move only one molecule or only a group of closely related mol- ecules [p. 46]. One example of specificity is found in the GLUT family of transporters, which move 6-carbon sugars (hexoses), such as glucose, mannose, galactose, and fructose [p. 31], across cell membranes. GLUT transporters have binding sites that recognize and transport hexoses, but they will not trans- port the disaccharide maltose or any form of glucose that is not found in nature (FIG. 5.17b). For this reason we can say that GLUT transporters are specific for naturally occurring 6-carbon monosaccharides.
For many years, scientists assumed that there must be differ- ent isoforms of the glucose-facilitated diffusion carrier because they had observed that glucose transport was regulated by hor- mones in some cells but not in others. However, it was not until the 1980s that the first glucose transporter was isolated. To date,
Concept Check
24. Name two ways active transport by the Na+@K+@ATPase (Fig. 5.15) differs from secondary transport by the SGLT (Fig. 5.16).
M05_SILV5197_08_SE_C05.indd 144 12/1/17 12:18 AM
C H
A P
TER
5
5.4 Protein-Mediated Transport 145
GLUT transporters to different tissues is an important feature in the metabolism and homeostasis of glucose.
Competition The property of competition is closely related to specificity. A transporter may move several members of a related group of substrates, but those substrates compete with one another for binding sites on the transporter. For example, GLUT transport- ers move the family of hexose sugars, but each different GLUT transporter has a “preference” for one or more hexoses, based on its binding affinity.
The results of an experiment demonstrating competition are shown in Figure 5.17d. The graph shows glucose transport rate as a function of glucose concentration. The top line (red) shows trans- port when only glucose is present. The lower line (black) shows that glucose transport decreases if galactose is also present. Galactose competes for binding sites on the GLUT transporters and displaces some glucose molecules. With fewer glucose molecules able to bind to the GLUT protein, the rate of glucose transport into the cell decreases.
Sometimes, the competing molecule is not transported but merely blocks the transport of another substrate. In this case, the competing molecule is a competitive inhibitor [p. 49]. In the glucose transport system, the disaccharide maltose is a competitive inhibi- tor (Fig. 5.17b). It competes with glucose for the binding site, but once bound, it is too large to be moved across the membrane.
Competition between transported substrates has been put to good use in medicine. An example involves gout, a disease caused by elevated levels of uric acid in the plasma. One method of decreasing uric acid in plasma is to enhance its excretion in the urine. Normally, the kidney’s organic anion transporter (OAT) reclaims urate (the anion form of uric acid) from the urine and returns the acid to the plasma. However, if an organic acid called probenecid is administered to the patient, OAT binds to probenecid instead of to urate, preventing the reabsorption of urate. As a result, more urate leaves the body in the urine, lowering the uric acid concen- tration in the plasma.
Saturation The rate of substrate transport depends on the sub- strate concentration and the number of carrier molecules, a prop- erty that is shared by enzymes and other binding proteins [p. 51]. For a fixed number of carriers, however, as substrate concentration increases, the transport rate increases up to a maximum, the point at which all carrier binding sites are filled with substrate. At this point, the carriers are said to have reached saturation. At satura- tion, the carriers are working at their maximum rate, and a fur- ther increase in substrate concentration has no effect. Figure 5.17c represents saturation graphically.
As an analogy, think of the carriers as doors into a concert hall. Each door has a maximum number of people that it can allow to enter the hall in a given period of time. Suppose that all the doors together can allow a maximum of 100 people per minute to enter the hall. This is the maximum transport rate, also called the transport maximum. When the concert hall is empty, three maintenance people enter the doors every hour. The transport rate is 3 people/60 minutes, or 0.05 people/minute, well under the
14 SCL2A (GLUT) genes have been identified. The important GLUT proteins you will encounter in this book include GLUT1, found in most cells of the body; GLUT2, found in liver and in kid- ney and intestinal epithelia; GLUT3, found in neurons; GLUT4, the insulin-regulated transporter of skeletal muscle; and GLUT5, the intestinal fructose transporter. The restriction of different
FIG. 5.17 Transporter saturation and competition
(b) Maltose is a competitive inhibitor that binds to the GLUT transporter but is not itself carried across the membrane.
(a) The GLUT transporter brings glucose across cell membranes.
(d) Competition. This graph shows glucose transport rate as a function of glucose concentration. In one experiment, only glucose was present. In the second experiment, a constant concentration of galactose was present.
(c) Saturation. This graph shows that transport can reach a maximum rate when all the carrier binding sites are filled with substrate.
Glucose Glucose
Maltose
GLUT transporter
Intracellular fluid
Extracellular fluid
Transport rate is proportional to substrate concentration until the carriers are saturated.
R at
e o
f tr
an sp
o rt
in to
c el
l
Extracellular substrate concentration
Transport maximum
G lu
co se
t ra
n sp
o rt
r at
e
Glucose concentration (mM)
Glucose only
Glucose and galactose (1 mM)
5 10 15
Can you tell from this graph if galactose is being transported?
How could the cell increase its transport rate in this example?
GRAPH QUESTION
GRAPH QUESTION
M05_SILV5197_08_SE_C05.indd 145 12/1/17 12:18 AM
146 CHAPTER 5 Membrane Dynamics
FIG. 5.18 Phagocytosis
Bacterium
Lysosome Phagocyte
The phagocytic white blood cell encounters a bacterium that binds to the cell membrane.
The phagocyte uses its cytoskeleton to push its cell membrane around the bacterium, creating a large vesicle, the phagosome.
The phagosome containing the bacterium separates from the cell membrane and moves into the cytoplasm.
The phagosome fuses with lysosomes containing digestive enzymes.
The bacterium is killed and digested within the vesicle.
1
2
3
4
5
Phagocytosis uses actin microfilaments and myosin motor proteins to engulf particles in large vesicles.
maximum. For a local dance recital, about 50 people per minute go through the doors, still well under the maximum. When the most popular rock group of the day appears in concert, however, thou- sands of people gather outside. When the doors open, thousands of people are clamoring to get in, but the doors allow only 100 people/ minute into the hall. The doors are working at the maximum rate, so it does not matter whether there are 1,000 or 3,000 people trying to get in. The transport rate saturates at 100 people/minute.
How can cells increase their transport capacity and avoid satu- ration? One way is to increase the number of carriers in the mem- brane. This would be like opening more doors into the concert hall. Under some circumstances, cells are able to insert additional carriers into their membranes. Under other circumstances, a cell may withdraw carriers to decrease movement of a molecule into or out of the cell.
All forms of carrier-mediated transport show specificity, com- petition, and saturation, but as you learned earlier in the chapter, they also differ in one important way: passive mediated transport— better known as facilitated diffusion—requires no input of energy from an outside source. Active transport requires energy input from ATP, either directly or indirectly.
5.5 Vesicular Transport What happens to the many macromolecules that are too large to enter or leave cells through protein channels or carriers? They move in and out of the cell with the aid of bubble-like vesicles [p. 70] created from the cell membrane. Cells use two basic pro- cesses to import large molecules and particles: phagocytosis and endocytosis. Some scientists consider phagocytosis to be a type of endocytosis, but mechanistically the two processes are different. Material leaves cells by the process known as exocytosis, a process that is similar to endocytosis run in reverse.
Phagocytosis Creates Vesicles Using the Cytoskeleton If you studied Amoeba in your biology laboratory, you may have watched these one-cell creatures ingest their food by surrounding it and enclosing it within a vesicle that is brought into the cytoplasm. Phagocytosis 5phagein, to eat + cyte, cell + @sis, process6 is the actin-mediated process by which a cell engulfs a bacterium or other particle into a large membrane-bound vesicle called a phagosome {soma, body} (FIG. 5.18). The phagosome pinches off from the cell
Concept Check
25. What would you call a carrier that moves two substrates in opposite directions across a membrane?
26. In the concert-hall door analogy, we described how the maximum transport rate might be increased by increasing the number of doors leading into the hall. Using the same analogy, can you think of another way a cell might increase its maximum transport rate?
M05_SILV5197_08_SE_C05.indd 146 12/1/17 12:18 AM
C H
A P
TER
5
5.5 Vesicular Transport 147
Caveolae Some endocytosis uses small flask-shaped indenta- tions called caveolae (“little caves”) rather than clathrin-coated pits to concentrate and bring receptor-bound molecules into the cell. Caveolae are membrane regions with lipid rafts [p. 64], membrane receptor proteins, and specialized membrane pro- teins named caveolins and cavins. The receptors in caveolae are lipid-anchored proteins [p. 64]. In many cells, caveolae appear as small indented pockets on the cell membrane, which is how they acquired their name.
Caveolae have several functions: to concentrate and internalize small molecules, to help in the transfer of macromolecules across the capillary endothelium, and to participate in cell signaling. Caveolae appear to be involved in some disease processes, includ- ing viral and parasitic infections. Two forms of the disease muscular dystrophy are associated with abnormalities in the protein caveolin. Scientists are currently trying to discover more details about the role of caveolae in normal physiology and pathophysiology.
Exocytosis Releases Molecules Too Large for Transport Proteins Exocytosis is the opposite of endocytosis. In exocytosis, intracel- lular vesicles move to the cell membrane, fuse with it (Fig. 5.19 8 ), and then release their contents to the extracellular fluid 9 . Cells use exocytosis to export large lipophobic molecules, such as proteins synthesized in the cell, and to get rid of wastes left in lysosomes from intracellular digestion.
membrane and moves to the interior of the cell, where it fuses with a lysosome [p. 71], whose digestive enzymes destroy the bacterium. Phagocytosis requires energy from ATP for the movement of the cytoskeleton and for the intracellular transport of the vesicles. In humans, phagocytosis occurs in certain types of white blood cells called phagocytes, which specialize in “eating” bacteria and other foreign particles.
Endocytosis Creates Smaller Vesicles Endocytosis, the second process by which large molecules or par- ticles move into cells, differs from phagocytosis in two important ways. First, in endocytosis the membrane surface indents rather than pushes out. Second, the vesicles formed from endocytosis are much smaller. In addition, some endocytosis is constitutive; that is, it is an essential function that is always taking place. In contrast, phagocytosis must be triggered by the presence of a substance to be ingested.
Endocytosis is an active process that requires energy from ATP. It can be nonselective, allowing extracellular fluid to enter the cell—a process called pinocytosis 5pino@, drink6—or it can be highly selective, allowing only specific molecules to enter the cell. In receptor-mediated endocytosis, a ligand binds to a membrane receptor protein to activate the process.
Receptor-Mediated Endocytosis Receptor-mediated endo- cytosis takes place in regions of the cell membrane known as coated pits, indentations where the cytoplasmic side of the mem- brane has high concentrations of protein. The most common pro- tein found in coated pits is clathrin, illustrated in FIGURE 5.19. In the first step of the process, extracellular ligands that will be brought into the cell bind to their membrane receptors 1 . The receptor- ligand complex migrates along the cell surface until it encounters a coated pit 2 . Once the receptor-ligand complex is in the coated pit, the membrane draws inward, or invaginates 3 , then pinches off from the cell membrane and becomes a cytoplasmic vesicle. The clathrin molecules are released and recycle back to the mem- brane 4 . In the vesicle, the receptor and ligand separate, leaving the ligand inside an endosome 5 . The endosome moves to a lyso- some if the ligand is to be destroyed, or to the Golgi complex if the ligand is to be processed 6 .
Meanwhile, the ligand’s membrane-bound receptors may be reused in a process known as membrane recycling. The vesicle with the receptors moves to the cell membrane 7 and fuses with it 8 . The vesicle membrane then is incorporated back into the cell membrane by exocytosis 9 . Notice in Figure 5.19 that the cytoplasmic face of the membrane remains the same throughout endocytosis and recycling. The extracellular surface of the cell membrane becomes the inside face of the vesicle membrane.
Receptor-mediated endocytosis transports a variety of sub- stances into the cell, including protein hormones, growth factors, antibodies, and plasma proteins that serve as carriers for iron and cholesterol. Elevated plasma cholesterol levels and cardiovascular disease are associated with abnormalities in receptor-mediated removal of cholesterol from the blood (see Clinical Focus box on LDL: The Lethal Lipoprotein).
CLINICAL FOCUS LDL: The Lethal Lipoprotein
“Limit the amount of cholesterol in your diet!” has been the recommendation for many years. So why is too much cholesterol bad for you? After all, cholesterol molecules are essential for membrane structure and for making steroid hormones (such as the sex hormones). But elevated cholesterol levels in the blood also lead to heart disease. One reason some people have too much cholesterol in their blood (hypercholesterolemia) is not diet but the failure of cells to take up the cholesterol. In the blood, hydrophobic cholesterol is bound to a lipoprotein carrier molecule to make it water soluble. The most common form of carrier is low-density lipoprotein (LDL). When the LDL-cholesterol complex (LDL-C) binds to LDL receptors, the complex then enters the cell in a vesicle. When people do not have adequate numbers of LDL receptors on their cell membranes, LDL-C remains in the blood. Hypercholesterolemia due to high levels of LDL-C predisposes these people to develop atherosclerosis, also known as hardening of the arteries 5atheroma, a tumor + skleros, hard + @sis, condition6. In this condition, the accumulation of cholesterol in blood vessels blocks blood flow and contributes to heart attacks (see Chapter 15).
M05_SILV5197_08_SE_C05.indd 147 12/1/17 12:18 AM
FIG. 5.19 ESSENTIALS Endocytosis, Exocytosis, and Membrane Recycling
The process by which the cell and vesicle membranes fuse is similar in a variety of cell types, from neurons to endocrine cells. Exocytosis involves two families of proteins: Rabs, which help vesi- cles dock onto the membrane, and SNAREs, which facilitate mem- brane fusion. In regulated exocytosis, the process usually begins with an increase in intracellular Ca2+ concentration that acts as a signal. The Ca2+ interacts with a calcium-sensing protein, which in turn initiates secretory vesicle docking and fusion. When the fused area of membrane opens, the vesicle contents diffuse into the extracellular fluid while the vesicle membrane stays behind and becomes part of the cell membrane. Exocytosis, like endocytosis, requires energy in the form of ATP.
Exocytosis takes place continuously in some cells, making it a constitutive process. For example, goblet cells [p. 79] in the intes- tine continuously release mucus by exocytosis, and fibroblasts in
connective tissue release collagen [p. 80]. In other cell types, exocy- tosis is an intermittent process that is initiated by a signal. In many endocrine cells, hormones are stored in secretory vesicles in the cytoplasm and released in response to a signal from outside the cell. Cells also use exocytosis to insert proteins into the cell membrane, as shown in Figure 5.19. You will encounter many examples of exocytosis in your study of physiology.
Concept Check
27. How does phagocytosis differ from endocytosis? 28. Name the two membrane protein families associated with
endocytosis. 29. How do cells move large proteins into the cell? Out of the cell?
Membrane removed from the cell surface by endocytosis is recycled back to the cell surface by exocytosis.
Ligand binds to membrane receptor.
Clathrin-coated pit
Receptor
Extracellular fluid
Intracellular fluid
To lysosome or Golgi complex
Receptor-ligand migrates to clathrin-coated pit.
Endocytosis
Vesicle loses clathrin coat.
Ligands go to lysosomes or Golgi for processing.
Transport vesicle with receptors moves to the cell membrane.
Transport vesicle and cell membrane fuse (membrane recycling).
Exocytosis
Clathrin
Endosome
1
2
3
4
5
6
7
8
9
Receptors and ligands separate.
148
M05_SILV5197_08_SE_C05.indd 148 12/1/17 12:18 AM
C H
A P
TER
5
5.6 Epithelial Transport 149
Epithelial Transport May Be Paracellular or Transcellular
Movement across an epithelium, or epithelial transport, may take place either as paracellular transport 5para@, beside6 through the junctions between adjacent cells or as transcellular transport through the epithelial cells themselves (Fig. 5.20). In “tight” epithelia, the cell-cell junctions act as barriers to minimize the unregulated diffusion of material between the cells, so there is very little paracellular transport. In recent years, however, scien- tists have learned that some epithelia have the ability to change the “tightness” of their junctions. It appears that some junctional proteins such as claudins can form large holes or pores that allow water, ions, and a few small uncharged solutes to move by the paracellular pathway. In certain pathological states, increased movement through the paracellular route is a hallmark of the disease.
In contrast, substances moving by the transcellular route must cross two cell membranes. Molecules cross the first mem- brane when they move into the epithelial cell from one com- partment. They cross the second membrane when they leave the epithelial cell to enter the second compartment. Transcellular transport uses a combination of active and passive transport mechanisms.
Protein-mediated transcellular transport is usually a two- step process, with one “uphill” step that requires energy and one “downhill” step in which the molecule moves passively down its gradient. You will see these steps in the example of glucose transport that follows. Molecules that are too large to be moved by membrane proteins can be transported across the cell in vesicles.
5.6 Epithelial Transport All the transport processes described in the previous sections deal with the movement of molecules across a single membrane, that of the cell. However, molecules entering and leaving the body or moving between certain compartments within the body must cross a layer of epithelial cells [p. 75] that are connected to one another by adhesive junctions and tight junctions [p. 75].
The tight junctions of epithelia separate the cell membrane into two regions, or poles. The surface of the epithelial cell that faces the lumen of an organ is called the apical 5apex, the highest point6 membrane (FIG. 5.20). It is often folded into microvilli that increase its surface area. Below the tight junctions, the three surfaces of the cell that face the extracellular fluid are collectively called the baso- lateral membrane 5basal, base + latus, side6. The apical mem- brane is also called the mucosal membrane. The corresponding term for the basolateral membrane is serosal membrane.
Transporting epithelial cells are said to be polarized because their apical and basolateral membranes have very different proper- ties. Certain transport proteins, such as the Na+@K+@ATPase, are usually found only on the basolateral membrane. Others, like the Na+@glucose symporter SGLT, are restricted to the apical mem- brane. This polarized distribution of transporters allows the one- way movement of certain molecules across the epithelium.
Transport of material from the lumen of an organ to the extracellular fluid is called absorption (Fig. 5.20). For example, the intestinal epithelium absorbs digested nutrients. When material moves from the ECF to the lumen, the process is called secretion. For example, the salivary glands secrete saliva to help moisten the food you eat. Note that the term secretion is also used more broadly to mean the release of a substance from a cell.
FIG. 5.20 Transporting epithelia are polarized
Apical membrane with microvilli
faces the lumen.
Tight junction limits movement of substances
between the cells.
Transporting epithelial cell
Basolateral membrane faces the ECF.
Lumen of intestine or kidney
Extracellular fluid
Transport proteins
Absorption (transcellular)
Secretion
Absorption (paracellular)
The apical membrane and the basolateral membrane are the two poles of the cell. Polarized epithelia have different transport proteins on apical and basolateral membranes. This allows selective directional transport across the epithelium. Transport from lumen to ECF is called absorption. Transport from ECF to lumen is called secretion.
M05_SILV5197_08_SE_C05.indd 149 12/1/17 12:18 AM
150 CHAPTER 5 Membrane Dynamics
The cells of transporting epithelia can alter their permeability by selectively inserting or withdrawing membrane proteins. Trans- porters pulled out of the membrane may be destroyed in lyso- somes, or they may be stored in vesicles inside the cell, ready to be reinserted into the membrane in response to a signal (another example of membrane recycling). Most epithelial transport you will study in this book involves the transporting epithelia of intes- tine and kidney, which are specialized to selectively transport mol- ecules into and out of the body.
Transcellular Transport of Glucose Uses Membrane Proteins The absorption of glucose from the lumen of the kidney tubule or intestine to the extracellular fluid is an important example of direc- tional movement across a transporting epithelium. Transepithe- lial movement of glucose involves three transport systems: (1) the SGLT-mediated secondary active transport of glucose with Na+
from the lumen into the epithelial cell at the apical membrane, followed by the movement of Na+ and glucose out of the cell and into the extracellular fluid on separate transporters; (2) sodium moves out by primary active transport via a Na+@K+@ATPase; and (3) glucose leaves the cell by facilitated diffusion on GLUT carriers.
FIGURE 5.21 shows the process in detail. The glucose concen- tration in the transporting epithelial cell is higher than the glucose concentration in the lumen of the kidney or intestine. For this reason, moving glucose from the lumen into the cell requires the input of energy—in this case, energy stored in the Na+ concentra- tion gradient. Sodium ions in the lumen bind to the SGLT carrier, as previously described (see Fig. 5.16), and bring glucose with them into the cell. The energy needed to move glucose against its con- centration gradient comes from the kinetic energy of Na+ moving down its concentration gradient (Fig. 5.21 1 ).
Once glucose is in the epithelial cell, it leaves by moving down its concentration gradient on the facilitated diffusion GLUT trans- porter in the basolateral membrane (Fig. 5.21 2 ). Na+ is pumped
FIG. 5.21 Transepithelial absorption of glucose
[Glucose]low
[Glucose]high
[Glucose]low
[Na+]high
[Na+]low
[Na+]high
Apical membrane
Glu
Glu
Glu
Na+
Na+
Na+
Na+
K+
K+
Basolateral membrane
Extracellular fluid
Lumen of kidney or intestine
Glu
GLUT transporter transfers glucose to ECF by facilitated diffusion.
Na+-K+-ATPase pumps Na+ out of the cell, keeping ICF Na+ concentration low.
Na+-glucose symporter brings glucose into cell against its gradient using energy stored in the Na+ concentration gradient.
ATP
Epithelial cell
1. Match each transporter to its location. 1. GLUT 2. Na+-glucose symporter 3. Na+-K+-ATPase 2. Is glucose movement across the basolateral membrane active or passive? Explain. 3. Why doesn’t Na+ movement at the apical membrane require ATP?
1
1
2
2
3
3
Absorbing glucose from intestinal or kidney tubule lumen involves indirect (secondary) active transport of glucose across the apical membrane and glucose diffusion across the basolateral membrane.
(a) apical membrane (b) basolateral
membrane
Choose either
FIGURE QUESTIONS
M05_SILV5197_08_SE_C05.indd 150 12/1/17 12:18 AM
C H
A P
TER
5
5.6 Epithelial Transport 151
Transcytosis Uses Vesicles to Cross an Epithelium Some molecules, such as proteins, are too large to cross epithelia on membrane transporters. Instead they are moved across epi- thelia by transcytosis, which is a combination of endocytosis, vesicular transport across the cell, and exocytosis (FIG. 5.22). In this process, the molecule is brought into the epithelial cell via receptor-mediated endocytosis. The resulting vesicle attaches to microtubules in the cell’s cytoskeleton and is moved across the cell by a process known as vesicular transport. At the opposite side of the epithelium, the contents of the vesicle are expelled into the interstitial fluid by exocytosis.
Transcytosis makes it possible for large proteins to move across an epithelium and remain intact. It is the means by which infants absorb maternal antibodies in breast milk. The antibodies are absorbed on the apical surface of the infant’s intestinal epithelium and then released into the extracellular fluid.
Now that we have considered how solutes move between the body’s compartments, we will examine how the transport of ions creates an electrical disequilibrium between the intracellular and extracellular compartments.
Concept Check
30. Why does Na+ movement from the cytoplasm to the extracellular fluid require energy?
31. Ouabain, an inhibitor of the Na+@K+@ATPase, cannot pass through cell membranes. What would happen to the transepithelial glucose transport shown in Figure 5.21 if ouabain were applied to the apical side of the epithelium? To the basolateral side of the epithelium?
32. Which GLUT transporter is illustrated in Figure 5.21?
FIG. 5.22 Transcytosis across the capillary endothelium
Plasma proteins
Red blood cell
Endocytosis
Vesicular transport
Exocytosis
Caveolae
Interstitial fluid
1
2
3
Capillary endothelium
Plasma proteins are concentrated in caveolae, which then undergo endocytosis and form vesicles.
Vesicles cross the cell with help from the cytoskeleton.
Vesicle contents are released into interstitial fluid by exocytosis.
1 2 3
Concept Check
33. If you apply a poison that disassembles microtubules to a capil- lary endothelial cell, what happens to transcytosis?
RUNNING PROBLEM The sweat test that Daniel will undergo analyzes levels of NaCl in sweat. Sweat—a mixture of ions and water—is secreted into ducts by the epithelial cells of sweat glands. As sweat moves toward the skin’s surface through the ducts, CFTR and Na+ chan- nels move Cl- and Na+ out of the sweat and back into the body. The duct cells are not permeable to water, so that normal reab- sorption of NaCl creates sweat with a low salt content. However, without functioning CFTR channels in the epithelium, salt is not reabsorbed. In cystic fibrosis, salt concentrations in the sweat can be four times the normal amount.
Q3: Based on the information given, is CFTR protein on the apical or basolateral surface of the sweat gland epithelium?
122 131 138 151 152 159
out of the cell on the basolateral side using Na+@K+@ATPase 3 . This step requires energy provided by ATP because sodium is more concentrated in the extracellular fluid than in the cell.
The removal of Na+ from the cell is essential if glucose is to continue to be absorbed from the lumen. The potential energy to run the SGLT symporter comes from the sodium concentration gradient, which depends on low intracellular concentrations of Na+. If the basolateral Na+@K+@ATPase is poisoned with ouabain (pronounced wah-bane—a compound related to the heart drug digitalis), Na+ that enters the cell cannot be pumped out. The Na+ concentration inside the cell gradually increases until it is equal to that in the lumen. With- out a sodium gradient, there is no energy source to run the SGLT symporter, and the absorption of glucose across the epithelium stops.
Transepithelial transport can use ion movement through channels in addition to carrier-mediated transport. For example, the apical membrane of a transporting epithelium may use the Na+@K+@2Cl- (NKCC) symporter to bring K+ into the cell against its concentration gradient, using energy from the Na+ gradient. Because the K+ concentration inside the cell is higher than in the extracellular fluid, K+ can move out of the cell on the basolateral side through open K+ leak channels. Na+ must be pumped out by Na+@K+@ATPase. By this simple mechanism, the body can absorb Na+ and K+ at the same time from the lumen of the intestine or the kidney.
M05_SILV5197_08_SE_C05.indd 151 12/1/17 12:18 AM
152 CHAPTER 5 Membrane Dynamics
RUNNING PROBLEM Three days after Daniel’s sweat test, the lab returns the grim results: salt levels in his sweat are more than twice the normal concentration. Daniel is diagnosed with cystic fibrosis. Now, along with antibiotics to prevent lung infections and therapy to loosen the mucus in his airways, Daniel must begin a regimen of pancre- atic enzymes to be taken whenever he eats, for the rest of his life. In cystic fibrosis, thick mucus in the pancreatic ducts blocks the secretion of digestive enzymes into the intestine. Without artificial enzymes, he would starve.
Q4: Why will Daniel starve if he does not take artificial pancreatic enzymes?
122 131 138 151 152 159
5.7 The Resting Membrane Potential Many of the body’s solutes, including organic compounds such as pyruvate and lactate, are ions and, therefore, carry a net electrical charge. Potassium (K+) is the major cation within cells, and sodium (Na+) dominates the extracellular fluid (see Fig. 5.1, p. 123). On the anion side, chloride ions (Cl-) mostly remain with Na+ in the extracellular fluid. Phosphate ions and negatively charged proteins are the major anions of the intracellular fluid.
Overall, the body is electrically neutral: for every cation, there is a matching anion. However, ions are not distributed evenly between the ECF and the ICF (FIG. 5.23a). The intracellular com- partment contains some anions that do not have matching cations, giving the cells a net negative charge. At the same time, the extra- cellular compartment has the “missing” cations, giving the ECF a net positive charge. One consequence of this uneven distribution of ions is that the intracellular and extracellular compartments are not in electrical equilibrium. Instead, the two compartments exist in a state of electrical disequilibrium (p. 122).
The concept of electrical disequilibrium traditionally is taught in chapters on nerve and muscle function because those tissues generate electrical signals known as action potentials. Yet one of the most exciting discoveries in physiology is the realization that other kinds of cells also use electrical signals for communication. In fact, all living organisms, including plants, use electrical signals! This section reviews the basic principles of electricity and discusses what creates electrical disequilibrium in the body. The chapter ends with a look at how the endocrine beta cells of the pancreas use electrical signaling to trigger insulin secretion.
Electricity Review Atoms are electrically neutral [p. 36]. They are composed of positively charged protons, negatively charged electrons, and uncharged neutrons, but in balanced proportions, so that an atom
is neither positive nor negative. The removal or addition of elec- trons to an atom creates the charged particles we know as ions. We have discussed several ions that are important in the human body, such as Na+, K+, and H+. For each of these positive ions, somewhere in the body there is a matching electron, usually found as part of a negative ion. For example, when Na+ in the body enters in the form of NaCl, the “missing” electron from Na+ can be found on the Cl-.
Remember the following important principles when you deal with electricity in physiological systems:
1. The law of conservation of electrical charge states that the net amount of electrical charge produced in any process is zero. This means that for every positive charge on an ion, there is an electron on another ion. Overall, the human body is electrically neutral.
2. Opposite charges ( + and - ) are attracted to each other. The protons and electrons in an atom exhibit this attraction. Like charges (two charges of the same type, such as + / + , or - / - ) repel each other.
3. Separating positive charges from negative charges requires energy. For example, energy is required to separate the pro- tons and electrons of an atom.
4. When separated positive and negative charges can move freely toward each other, the material through which they move is called a conductor. Water is a good conductor of electri- cal charge. When separated charges cannot move through the material that separates them, the material is known as an insulator. The phospholipid bilayer of the cell membrane is a good insulator, as is the plastic coating on electrical wires.
The word electricity comes from the Greek word elektron, mean- ing “amber,” the fossilized resin of trees. The Greeks discovered that if they rubbed a rod of amber with cloth, the amber acquired the ability to attract hair and dust. This attraction (called static electricity) arises from the separation of electrical charge that occurs when electrons move from the amber atoms to the cloth. To separate these charged particles, energy (work) must be put into the system. In the case of the amber, work was done by rubbing the rod. In the case of biological systems, the work is usually done by energy stored in ATP and other chemical bonds.
The Cell Membrane Enables Separation of Electrical Charge in the Body In the body, separation of electrical charge takes place across the cell membrane. This process is shown in Figure 5.23b. The dia- gram shows an artificial cell system. The cell is filled with positive K+ and large negative ions. The cell is placed in an aqueous solu- tion of sodium chloride that has dissociated into Na+ and Cl-. The phospholipid bilayer of the artificial cell, like the membrane of a real cell, is not permeable to ions, so it acts as an insulator and prevents the ions from moving. Water can freely cross this cell membrane, making the extracellular and intracellular osmotic concentrations equal.
Play A&P Flix Animation
@Mastering Anatomy & Physiology
M05_SILV5197_08_SE_C05.indd 152 12/1/17 12:18 AM
C H
A P
TER
5
5.7 The Resting Membrane Potential 153
The Nernst equation assumes that the cell in question is freely permeable to only the ion being studied. This is not the usual situ- ation in living cells, however, as you will learn shortly.
All Living Cells Have a Membrane Potential As the beginning of this chapter pointed out, all living cells are in chemical and electrical disequilibrium with their environment. This electrical disequilibrium, or electrical gradient between the extracellular fluid and the intracellular fluid, is called the resting membrane potential difference, or membrane potential for short. Although the name sounds intimidating, we can break it apart to see what it means.
1. The resting part of the name comes from the fact that an elec- trical gradient is seen in all living cells, even those that appear to be without electrical activity. In these “resting” cells, the membrane potential has reached a steady state and is not changing.
2. The potential part of the name comes from the fact that the electrical gradient created by active transport of ions across the cell membrane is a form of stored, or potential, energy, just as concentration gradients are a form of potential energy. When oppositely charged molecules come back together, they release energy that can be used to do work, in the same way that molecules moving down their concentration gradient can do work (see Appendix B). The work done using electrical energy includes opening voltage-gated membrane channels and sending electrical signals.
3. The difference part of the name is to remind you that the membrane potential represents a difference in the amount of electrical charge inside and outside the cell. The word dif- ference is usually dropped from the name, as noted earlier, but it is important for remembering what a membrane potential means.
In living systems, we cannot measure absolute electrical charge, so we describe electrical gradients on a relative scale instead. Figure 5.23f compares the two scales. On an absolute scale, the extracellular fluid in our simple example has a net charge of + 1 from the positive ion it gained, and the intracellular fluid has a net charge of - 1 from the negative ion that was left behind. On the number line shown, this is a difference of two units.
In real life, because we cannot measure electrical charge as numbers of electrons gained or lost, we use a device that mea- sures the difference in electrical charge between two points. This device artificially sets the net electrical charge of one side of the membrane to 0 and measures the net charge of the second side relative to the first. In our example, resetting the extracellular fluid net charge to 0 on the number line gives the intracellular fluid a net charge of - 2. We call the ICF value the resting membrane potential (difference) of the cell.
In Figure 5.23b, both the cell and the solution are electrically neutral, and the system is in electrical equilibrium. However, it is not in chemical equilibrium. There are concentration gradients for all four types of ions in the system, and they would all diffuse down their respective concentration gradients if they could cross the cell membrane.
In Figure 5.23c, a leak channel for K+ is inserted into the membrane. Now the cell is permeable to K+, but only to K+. Because of the K+ concentration gradient, K+ moves out of the cell. The negative ions in the cell attempt to follow the K+ because of the attraction of positive and negative charges. But because the membrane is impermeable to negative ions, the anions remain trapped in the cell.
As soon as the first positive K+ leaves the cell, the electrical equilibrium between the extracellular fluid and intracellular fluid is disrupted: the cell’s interior has developed a net charge of - 1 while the cell’s exterior has a net charge of + 1. The movement of K+ out of the cell down its concentration gradient has created an electrical gradient—that is, a difference in the net charge between two regions. In this example, the inside of the cell has become negative relative to the outside.
If the only force acting on K+ were the concentration gradi- ent, K+ would leak out of the cell until the K+ concentration inside the cell equaled the K+ concentration outside. The loss of posi- tive ions from the cell creates an electrical gradient, however. The combination of electrical and concentration gradients is called an electrochemical gradient.
Because opposite charges attract each other, the negative pro- teins inside the cell try to pull K+ back into the cell (Fig. 5.23d). At some point in this process, the electrical force attracting K+ into the cell becomes equal in magnitude to the chemical concentration gradient driving K+ out of the cell. At that point, net movement of K+ across the membrane stops (Fig. 5.23e). The rate at which K+ ions move out of the cell down the concentration gradient is exactly equal to the rate at which K+ ions move into the cell down the electrical gradient. The system has reached electrochemical equilibrium.
For any given concentration gradient of a single ion, the membrane potential that exactly opposes the concentration gra- dient is known as the equilibrium potential, or E ion (where the subscript ion is replaced by the symbol for whichever ion we are looking at). For example, when the concentration gradient is 150 mM K+ inside and 5 mM K+ outside the cell, the equilibrium potential for potassium, or EK is - 90 mV.
The equilibrium potential for any ion at 37 °C (human body temperature) can be calculated using the Nernst equation:
Eion = 61 z
log [ion]out [ion]in
where 61 is 2.303 RT/F at 37 °C* z is the electrical charge on the ion ( + 1 for K+), (ion)out and (ion)in are the ion concentrations outside and
inside the cell, and Eion is measured in mV. * R is the ideal gas constant, T is absolute temperature, and F is the Faraday constant. For additional information, see Appendix B.
M05_SILV5197_08_SE_C05.indd 153 12/1/17 12:18 AM
FIG. 5.23 ESSENTIALS Membrane Potential
Sodium ion
Potassium ion
Chloride ion
Large anion
KEY
1. If the cell in (e) was made freely permeable to only Na+, which way would the Na+ move? Would the membrane potential become positive or negative?
2. If it became freely permeable to only Cl–, which way would Cl– move? Would the membrane potential become positive or negative?
3. Calculate the equilibrium potential for Na+ (ENa).
4. Calculate the ECl.
ICF ECF
150
15
5
145
K+
Na+
10 108Cl–
Approximate Values for Mammalian Cells
The electrical disequilibrium that exists between the extracellular fluid (ECF) and intracellular fluid (ICF) of living cells is called the membrane potential difference (Vm), or membrane potential for short. The membrane potential results from the uneven distribution of electrical charge (i.e., ions) between the ECF and ICF.
For any given concentration gradient [Ion]out – [Ion]in across a cell membrane, there is a membrane potential difference (i.e., electrical gradient) that exactly opposes ion movement down the concentration gradient. At this membrane potential, the cell is at electrochemical equilibrium: There is no net movement of ion across the cell membrane.
For any ion, the membrane potential that exactly opposes a given concentration gradient is known as the equilibrium potential (Eion). To calculate the equilibrium potential for any concentration gradient, we use the Nernst equation:
The Nernst equation is used for a cell that is freely permeable to only one ion at a time. Living cells, however, have limited permeability to several ions. To calculate the actual membrane potential of cells, we use a multi-ion equation called the Goldman-Hodgkin-Katz equation [discussed in Chapter 8].
What creates the membrane potential?
How much K+ will leave the cell?
To show how a membrane potential difference can arise from ion concentration gradients and a selectively permeable membrane, we will use an artificial cell system where we can control the membrane’s permeability to ions and the composition of the ECF and ICF.
If K+ was uncharged, like glucose, it would diffuse out of the cell until the concentration outside [K]out equaled the concentration inside [K]in. But K
+ is an ion, so we must consider its electrical gradient. Remember the rule for movement along electrical gradients: Opposite charges attract, like charges repel.
The ECF has a slight excess of cations (+).
We insert a leak channel for K+.
K+ starts to move out of the cell down its concentration gradient.
The A– cannot follow K+ out of the cell because the cell is not permeable to A–.
The ICF has a slight excess of anions (–).
Cell (ICF)
ECF + +
+
+
+
+ +
– –
– – –
– –––
– – – –
– –
+ +
+
+
+
+ + +
(a) In illustrations, this uneven distribution of charge is often shown by the charge symbols clustered on each side of the cell membrane. (e) In this example, the concentration gradient sending K+
out of the cell is exactly opposed by the electrical gradient pulling K+ into the cell. This is shown by the arrows that are equal in length but opposite in direction.
(f) In the first example, you saw that the membrane potential results from excess cations in the ECF and excess anions in the ICF. To measure this difference, we can place electrodes in the cell and surrounding fluid (equivalent to the ECF).
Using these values for K+ and the Nernst equation, the EK is ]90 mV.
(b) When we begin, the cell has no membrane potential: The ECF (composed of Na+ and Cl– ions) and the ICF (K+ and large anions, A– ) are electrically neutral.
The system is in chemical disequilibrium, with concentration gradients for all four ions. The cell membrane acts as an insulator to prevent free movement of ions between the ICF and ECF.
The transfer of just one K+ from the cell to the ECF creates an electrical disequilibrium: the ECF has a net positive charge (+1) while the ICF has a net negative charge (–1). The cell now has a membrane potential difference, with the inside of the cell negative relative to the outside.
(c) Now we insert a leak channel for K+ into the membrane, making the cell freely permeable to K+.
(d) As additional K+ ions leave the cell, going down their concentration gradient, the inside of the cell becomes more negative and the outside becomes more positive.
Creation of a Membrane Potential in an Artificial System
Electrochemical Equilibrium
Equilibrium Potential
Measuring Membrane Potential
+ +
++
+
+ +
–
–
–
+ –
–
– –
+ +
+
+
++
+
+
–
– –
–
–
––
–
+ +
+
+ +
–
– –
–
– –
+ +
+
+
++
+
–
–
–
–
––
–
++ + +
+
+
–
– –
–
– –
+ +
+
+
++
+
–
–
–
–
––
–
Additional K+ leaves the cell.
Now the negative charge inside the cell begins to attract ECF K+ back into the cell: an electrical gradient in the opposite direction from the concentration gradient.
+ +
+ + +
+
–
– –
–
– –
+ +
+
+
++
+
–
–
–
–
––
–
Efflux due to concentration gradient
Influx due to electrical gradient
1. Ion concentration gradients between the ECF and ICF 2. The selectively permeable cell membrane
K+
Na+
Cl–
A– K+
Eion = z [ion]in
61 where z is the charge on the ion. (i.e., K+ = +1)
[ion]outlog
]2 ]1 0 +1 +2
Intracellular fluid Extracellular fluid
Absolute charge scale
Intracellular fluid Extracellular fluid
]2 ]1 0 +1 +2
Relative charge scale extracellular fluid set to 0.
In real life, we cannot measure absolute numbers of ions, however. Instead, we measure the difference between the two electrodes. By convention, the ECF is set at 0 mV (the ground). This gives the ICF a relative charge of −2.
On a number line, the ECF would be at +1 and the ICF at −1.
(You will need the log function on a calculator.)
1
2
3
4
5
+
+
+
+ ++
+
+ +
+
– ––
– –
– –
–
–
–
– –
++
FIGURE QUESTIONS
FIGURE QUESTIONS
Play Phys in Action
@Mastering Anatomy & Physiology
M05_SILV5197_08_SE_C05.indd 154 12/2/17 1:02 AM
155
Sodium ion
Potassium ion
Chloride ion
Large anion
KEY
1. If the cell in (e) was made freely permeable to only Na+, which way would the Na+ move? Would the membrane potential become positive or negative?
2. If it became freely permeable to only Cl–, which way would Cl– move? Would the membrane potential become positive or negative?
3. Calculate the equilibrium potential for Na+ (ENa).
4. Calculate the ECl.
ICF ECF
150
15
5
145
K+
Na+
10 108Cl–
Approximate Values for Mammalian Cells
The electrical disequilibrium that exists between the extracellular fluid (ECF) and intracellular fluid (ICF) of living cells is called the membrane potential difference (Vm), or membrane potential for short. The membrane potential results from the uneven distribution of electrical charge (i.e., ions) between the ECF and ICF.
For any given concentration gradient [Ion]out – [Ion]in across a cell membrane, there is a membrane potential difference (i.e., electrical gradient) that exactly opposes ion movement down the concentration gradient. At this membrane potential, the cell is at electrochemical equilibrium: There is no net movement of ion across the cell membrane.
For any ion, the membrane potential that exactly opposes a given concentration gradient is known as the equilibrium potential (Eion). To calculate the equilibrium potential for any concentration gradient, we use the Nernst equation:
The Nernst equation is used for a cell that is freely permeable to only one ion at a time. Living cells, however, have limited permeability to several ions. To calculate the actual membrane potential of cells, we use a multi-ion equation called the Goldman-Hodgkin-Katz equation [discussed in Chapter 8].
What creates the membrane potential?
How much K+ will leave the cell?
To show how a membrane potential difference can arise from ion concentration gradients and a selectively permeable membrane, we will use an artificial cell system where we can control the membrane’s permeability to ions and the composition of the ECF and ICF.
If K+ was uncharged, like glucose, it would diffuse out of the cell until the concentration outside [K]out equaled the concentration inside [K]in. But K
+ is an ion, so we must consider its electrical gradient. Remember the rule for movement along electrical gradients: Opposite charges attract, like charges repel.
The ECF has a slight excess of cations (+).
We insert a leak channel for K+.
K+ starts to move out of the cell down its concentration gradient.
The A– cannot follow K+ out of the cell because the cell is not permeable to A–.
The ICF has a slight excess of anions (–).
Cell (ICF)
ECF + +
+
+
+
+ +
– –
– – –
– –––
– – – –
– –
+ +
+
+
+
+ + +
(a) In illustrations, this uneven distribution of charge is often shown by the charge symbols clustered on each side of the cell membrane. (e) In this example, the concentration gradient sending K+
out of the cell is exactly opposed by the electrical gradient pulling K+ into the cell. This is shown by the arrows that are equal in length but opposite in direction.
(f) In the first example, you saw that the membrane potential results from excess cations in the ECF and excess anions in the ICF. To measure this difference, we can place electrodes in the cell and surrounding fluid (equivalent to the ECF).
Using these values for K+ and the Nernst equation, the EK is ]90 mV.
(b) When we begin, the cell has no membrane potential: The ECF (composed of Na+ and Cl– ions) and the ICF (K+ and large anions, A– ) are electrically neutral.
The system is in chemical disequilibrium, with concentration gradients for all four ions. The cell membrane acts as an insulator to prevent free movement of ions between the ICF and ECF.
The transfer of just one K+ from the cell to the ECF creates an electrical disequilibrium: the ECF has a net positive charge (+1) while the ICF has a net negative charge (–1). The cell now has a membrane potential difference, with the inside of the cell negative relative to the outside.
(c) Now we insert a leak channel for K+ into the membrane, making the cell freely permeable to K+.
(d) As additional K+ ions leave the cell, going down their concentration gradient, the inside of the cell becomes more negative and the outside becomes more positive.
Creation of a Membrane Potential in an Artificial System
Electrochemical Equilibrium
Equilibrium Potential
Measuring Membrane Potential
+ +
++
+
+ +
–
–
–
+ –
–
– –
+ +
+
+
++
+
+
–
– –
–
–
––
–
+ +
+
+ +
–
– –
–
– –
+ +
+
+
++
+
–
–
–
–
––
–
++ + +
+
+
–
– –
–
– –
+ +
+
+
++
+
–
–
–
–
––
–
Additional K+ leaves the cell.
Now the negative charge inside the cell begins to attract ECF K+ back into the cell: an electrical gradient in the opposite direction from the concentration gradient.
+ +
+ + +
+
–
– –
–
– –
+ +
+
+
++
+
–
–
–
–
––
–
Efflux due to concentration gradient
Influx due to electrical gradient
1. Ion concentration gradients between the ECF and ICF 2. The selectively permeable cell membrane
K+
Na+
Cl–
A– K+
Eion = z [ion]in
61 where z is the charge on the ion. (i.e., K+ = +1)
[ion]outlog
]2 ]1 0 +1 +2
Intracellular fluid Extracellular fluid
Absolute charge scale
Intracellular fluid Extracellular fluid
]2 ]1 0 +1 +2
Relative charge scale extracellular fluid set to 0.
In real life, we cannot measure absolute numbers of ions, however. Instead, we measure the difference between the two electrodes. By convention, the ECF is set at 0 mV (the ground). This gives the ICF a relative charge of −2.
On a number line, the ECF would be at +1 and the ICF at −1.
(You will need the log function on a calculator.)
1
2
3
4
5
+
+
+
+ ++
+
+ +
+
– ––
– –
– –
–
–
–
– –
++
FIGURE QUESTIONS
FIGURE QUESTIONS
M05_SILV5197_08_SE_C05.indd 155 12/1/17 12:18 AM
156 CHAPTER 5 Membrane Dynamics
The equipment for measuring a cell’s membrane potential is depicted in FIGURE 5.24. Electrodes are created from hollow glass tubes drawn to very fine points. These micropipettes are filled with a liquid that conducts electricity and then connected to a voltme- ter, which measures the electrical difference between two points in units of either volts (V) or millivolts (mV). A recording electrode is inserted through the cell membrane into the cytoplasm of the cell. A reference electrode is placed in the external bath, which represents the extracellular fluid.
In living systems, by convention, the extracellular fluid is des- ignated as the ground and assigned a charge of 0 mV (Fig. 5.23f). When the recording electrode is placed inside a living cell, the voltmeter measures the membrane potential—in other words, the electrical difference between the intracellular fluid and the extra- cellular fluid. A recorder connected to the voltmeter can make a recording of the membrane potential versus time.
For resting nerve and muscle cells, the voltmeter usually records a membrane potential between - 40 and - 90 mV, indicating
that the intracellular fluid is negative relative to the extracellu- lar fluid (0 mV). (Throughout this discussion, remember that the extracellular fluid is not really neu- tral because it has exc e s s p o s i t i ve charges that exactly balance the excess negative charges inside the cell, as shown in Fig. 5.23. The total body remains electrically neutral at all times.)
The Resting Membrane Potential Is Due Mostly to Potassium Which ions create the resting membrane potential in animal cells? The artificial cell shown in Figure 5.23c used a potassium channel to allow K+ to leak across a membrane that was otherwise imper- meable to ions. But what processes go on in living cells to create an electrical gradient?
FIG. 5.24 Measuring membrane potential
The voltmeter measures the difference in electrical charge between the inside of a cell and the surrounding solution. This value is the membrane potential difference, or Vm.
Cell −70 mV
0 mV
Saline bath
A recording electrode is placed
inside the cell.
Input
Output
−70 −30 0 +30
In the laboratory, a cell’s membrane potential is measured by placing one electrode inside the cell and a second in the extracellular bath.
The membrane potential can change over time.
If the membrane potential becomes less negative than the resting potential, the cell depolarizes.
If the membrane potential becomes more negative, the cell hyperpolarizes.
The ground ( ) or reference electrode is placed in the bath and given a value of 0 millivolts (mV).
Repolarization
Hyperpolarization
Depolarization
Time (msec)
Vm
Vm
Membrane potential difference (Vm)
−60
−80
−100
−120
−40
−20
+20
+40
M em
b ra
n e
p o
te n tia
l ( m
V )
0
Play Interactive Physiology 2.0
@Mastering Anatomy & Physiology
M05_SILV5197_08_SE_C05.indd 156 12/1/17 12:18 AM
C H
A P
TER
5
5.7 The Resting Membrane Potential 157
Changes in Ion Permeability Change the Membrane Potential As you have just learned, two factors influence a cell’s membrane potential: (1) the concentration gradients of different ions across the membrane and (2) the permeability of the membrane to those ions. If the cell’s permeability to an ion changes, the cell’s membrane potential changes. We monitor changes in membrane potential using the same recording electrodes that we use to record resting membrane potential.
Figure 5.24 shows a recording of membrane potential plot- ted against time. The extracellular electrode is set at 0 mV, and the intracellular electrode records the membrane potential differ- ence. The membrane potential (Vm) begins at a steady resting value of - 70 mV. When the trace moves upward (becomes less nega- tive), the potential difference between the inside of the cell and the outside (0 mV) is less, and the cell is said to have depolarized. A return to the resting membrane potential is termed repolarization. If the resting potential becomes more negative, we say the cell has hyperpolarized.
A major point of confusion when we talk about changes in membrane potential is the use of the phrases “the membrane potential decreased” or “the membrane potential increased.” Nor- mally, we associate “increase” with becoming more positive and “decrease” with becoming more negative—the opposite of what is happening in our cell discussion. The best way to avoid trouble is to speak of the membrane potential becoming more or less nega- tive or the cell depolarizing or hyperpolarizing. Another way to avoid confusion is to add the word difference after membrane potential. If the membrane potential difference is increasing, the value of Vm must be moving away from the ground value of 0 and becoming more negative. If the membrane potential difference is decreasing, the value of Vm is moving closer to the ground value of 0 mV and is becoming less negative.
What causes changes in membrane potential? In most cases, membrane potential changes in response to movement of one of four ions: Na+, Ca2+, Cl-, and K+. The first three ions are more concentrated in the extracellular fluid than in the cytosol, and the resting cell is minimally permeable to them. If a cell suddenly becomes more permeable to any one of these ions, then those ions will move down their electrochemical gradient into the cell. Entry of Ca2+ or Na+ depolarizes the cell (makes the membrane potential more positive). Entry of Cl- hyperpolarizes the cell (makes the membrane potential more negative).
Most resting cells are fairly permeable to K+ but making them more permeable allows even more K+ to leak out. The cell hyper- polarizes until it reaches the equilibrium potential for K+. Making the cell less permeable to K+ allows fewer K+ ions to leak out of the cell. When the cell retains K+, it becomes more positive and
In reality, living cells are not permeable to only one ion. They have open channels and protein transporters that allow ions to move between the cytoplasm and the extracellular fluid. Instead of the Nernst equation, we use a related equation called the Goldman equation that considers concentration gradients of the permeable ions and the relative permeability of the cell to each ion. (For more detail on the Goldman equation, see Chapter 8.)
The real cell illustrated in FIGURE 5.25 has a resting membrane potential of - 70 mV. Most cells are about 40 times more permeable to K+ than to Na+. As a result, a cell’s resting membrane potential is closer to the EK of - 90 mV than to the ENa of + 60 mV. A small amount of Na+ leaks into the cell, making the inside of the cell less negative than it would be if Na+ were totally excluded. Additional Na+ that leaks in is promptly pumped out by the Na+@K+@ATPase. At the same time, K+ ions that leak out of the cell are pumped back in. The pump contributes to the membrane potential by pumping 3 Na+ out for every 2 K+ pumped in. Because the Na+@K+@ATPase helps maintain the electrical gradient, it is called an electrogenic pump.
Not all ion transport creates an electrical gradient. Many trans- porters, like the Na+@K+-2Cl- (NKCC) symporter, are electrically neutral. Some make an even exchange: for each charge that enters the cell, the same charge leaves. An example is the HCO3
-@Cl- anti- porter of red blood cells, which transports these ions in a one-for- one, electrically neutral exchange. Electrically neutral transporters have little effect on the resting membrane potential of the cell.
FIG. 5.25 The resting membrane potential of cells
Extracellular fluid 0 mV
1. What force(s) promote(s) Na+ leak into the cell?
2. What force(s) promote(s) K+ leak out of the cell?
Intracellular fluid –70 mV
Na+
Na+
K+K+ ATP
Most cells in the human body are about 40 times more permeable to K+ than to Na+, and the resting membrane potential is about –70 mV. The Na-K-ATPase helps maintain the resting membrane potential by removing Na+ that leaks into the cell and returning K+ that has leaked out.
FIGURE QUESTIONS
Concept Check
34. What would happen to the resting membrane potential of a cell poisoned with ouabain (an inhibitor of the Na+@K+@ATPase)?
M05_SILV5197_08_SE_C05.indd 157 12/1/17 12:18 AM
158 CHAPTER 5 Membrane Dynamics
depolarizes. You will encounter instances of all these permeability changes as you study physiology.
It is important to learn that a significant change in membrane potential requires the movement of very few ions. The concentration gradient does not have to reverse to change the membrane potential. For example, to change the membrane potential by 100 mV (the size of a typical electrical signal passing down a neuron), only one of every 100,000 K+ must enter or leave the cell. This is such a tiny fraction of the total number of K+ ions in the cell that the concentration gradient for K+ remains essentially unchanged.
5.8 Integrated Membrane Processes: Insulin Secretion
The movement of Na+ and K+ across cell membranes has been known to play a role in generating electrical signals in excitable tissues for many years. You will study these processes in detail when you learn about the ner- vous and muscular systems. Recently, however, we have come to understand that small changes in membrane potential act as signals in nonexcitable tissues, such as endocrine cells. One of the best-studied examples of this process involves the beta cell of the pancreas. Release of the hormone insulin by beta cells demon- strates how membrane processes—such as facilitated diffusion, exocytosis, and the opening and closing of ion channels by ligands and membrane potential—work together to regulate cell function.
The endocrine beta cells of the pancreas synthesize the protein hormone insulin and store it in cytoplas- mic secretory vesicles [p. 71]. When blood glucose lev- els increase, such as after a meal, the beta cells release insulin by exocytosis. Insulin then directs other cells of the body to take up and use glucose, bringing blood concentrations down to pre-meal levels.
A key question about the process that went unan- swered until recently was, “How does a beta cell ‘know’ that glucose levels have gone up and that it needs to release insulin?” The answer, we have now learned, links the beta cell’s metabolism to its electrical activity.
FIGURE 5.26a shows a beta cell at rest. Recall from earlier sections in this chapter that gated membrane channels can be opened or closed by chemical or elec- trical signals. The beta cell has two such channels that help control insulin release. One is a voltage-gated Ca2 + channel. This channel is closed at the cell’s rest- ing membrane potential ( 5 in Fig. 5.26a). The other is a K+ leak channel (that is, the channel is usually open) that closes when ATP binds to it. It is called an ATP- gated K+ channel (KATP channel). In the rest- ing cell, when glucose concentrations are low, the cell
FIG. 5.26 Insulin secretion and membrane transport
FIGURE QUESTIONS
Low glucose levels in blood.
No insulin secretion
Metabolism slows.
ATP decreases.
ATPMetabolismGlucose
Cell at resting membrane potential. No insulin is released.
KATP channels open.
Insulin in secretory vesicles
K+ leaks out
of cell Voltage-gated Ca2+ channel closed
Glycolysis and citric acid cycle
ATP
Ca2+ signal triggers exocytosis and insulin is secreted.
Ca2+
Ca2+
GLUT transporter
(a) Beta cell at rest. The KATP channel is open, and the cell is at its resting membrane potential.
(b) Beta cell secretes insulin. Closure of KATP channel depolarizes cell, triggering exocytosis of insulin.
High glucose levels in blood.
Metabolism increases.
ATP increases.
Glucose
Cell depolarizes and calcium channels open.
KATP channels close.
Ca2+ entry acts as an intracellular signal.
GLUT transporter
1 2 3 4 5
1 2 3 4 5
6
7
1. Which step shows facilitated diffusion?
2. What kind of gating do the beta cell ion channels have?
3. Does insulin secretion in (b) require energy input from ATP?
4. Why is insulin released by exocytosis and not through a carrier or channel?
K+
M05_SILV5197_08_SE_C05.indd 158 12/1/17 12:18 AM
C H
A P
TER
5
5.8 Integrated Membrane Processes: Insulin Secretion 159
makes less ATP (Fig. 5.26a, 1 – 3 ). There is little ATP to bind to the KATP channel, and the channel remains open, allowing K
+ to leak out of the cell 4 . At the resting membrane potential, the voltage-gated Ca2+ channels are closed, and there is no insulin secretion 5 .
Figure 5.26b shows how a beta cell secretes insulin in response to an increase in blood glucose. After a meal, plasma glucose lev- els increase as glucose is absorbed from the intestine 1 . Glucose reaching the beta cell diffuses into the cell with the aid of a GLUT transporter. Increased glucose in the cell stimulates the metabolic pathways of glycolysis and the citric acid cycle [p. 105], and ATP production increases 2 , 3 . When ATP binds to the KATP
channel, the gate to the channel closes, preventing K+ from leaking out of the cell 4 . Retention of K+ depolarizes the cell 5 , which then causes the voltage-sensitive Ca2+ channels to open 6 . Cal- cium ions enter the cell from the extracellular fluid, moving down their electrochemical gradient. The Ca2+ ions bind to proteins that initiate exocytosis of the insulin-containing vesicles, and insulin is released into the extracellular space 7 .
The discovery that cells other than nerve and muscle cells use changes in membrane potential as signals for physiological responses altered our traditional thinking about the role of the resting membrane potential. Next, we will look at other types of signals that the body uses for communication and coordination.
RUNNING PROBLEM CONCLUSION Cystic Fibrosis
In this running problem, you learned about cystic fibrosis (CF), one of the most common inherited diseases in the United States. By some estimates, more than 10 million people are symptomless carriers of a mutated CF gene. A person must inherit two copies of the mutated gene, one from each parent, before he or she will develop CF. Although there is no cure for this disease, treatments have become better, and the life span of CF patients continues to improve. Today, the median sur- vival age is nearly 40 years old.
Cystic fibrosis is caused by a defect in the transport of Cl- into and out of epithelial cells through the CFTR channel protein. In the most common variant of CF, the CFTR chan- nel protein does not fold correctly and cannot be inserted into the cell membrane. Because CFTR channels are found in
the epithelial cell membranes of several organs—the sweat glands, lungs, and pancreas—cystic fibrosis may affect many different body processes. Interestingly, the CFTR chloride channel is a member of the ABC transport family and is the only known ion channel in that gene superfamily. Some of the most interesting animal research on cystic fibrosis uses genetically altered mice, called CF mice. These model animals are bred to have CFTR channels with altered functions corre- sponding to the mutations of the CFTR gene in humans.
To learn more about current research in this disease, go to the Cystic Fibrosis Foundation website (www.cff.org) and click the Our Research tab. To check your understanding of the run- ning problem, compare your answers with the information in the following table.
Question Facts Integration and Analysis Q1: Why would failure to transport NaCl
into the airways cause the secreted mucus to be thick?
If NaCl is secreted into the lumen of the airways, the solute concentration of the airway fluid increases. Water moves into compartments with higher osmolarity.
Normally, movement of NaCl creates an osmotic gradient so that water also enters the airway lumen, creating a saline solution that thins the thick mucus. If NaCl cannot be secreted into the airways, there will be no fluid movement to thin the mucus.
Q2: Is the CFTR a chemically gated, a voltage-gated, or a mechanically gated channel protein?
Chemically gated channels open when a ligand binds to them. CFTRs open when ATP binds to the channel protein.
ATP is a chemical ligand, which means CFTRs are chemically gated channel proteins.
Q3: Based on the information given, is the CFTR protein on the apical or basolateral