Methods

Deam
embj.201489050.pdf

Article

Regulation of Drosophila intestinal stem cell maintenance and differentiation by the transcription factor Escargot Mariano A Loza-Coll1,2, Tony D Southall3,†, Sharsti L Sandall1, Andrea H Brand3 & D Leanne Jones1,2,4,*

Abstract

Tissue stem cells divide to self-renew and generate differentiated cells to maintain homeostasis. Although influenced by both intrin- sic and extrinsic factors, the genetic mechanisms coordinating the decision between self-renewal and initiation of differentiation remain poorly understood. The escargot (esg) gene encodes a tran- scription factor that is expressed in stem cells in multiple tissues in Drosophila melanogaster, including intestinal stem cells (ISCs). Here, we demonstrate that Esg plays a pivotal role in intestinal homeostasis, maintaining the stem cell pool while influencing fate decisions through modulation of Notch activity. Loss of esg induced ISC differentiation, a decline in Notch activity in daughter enteroblasts (EB), and an increase in differentiated enteroendo- crine (EE) cells. Amun, an inhibitor of Notch in other systems, was identified as a target of Esg in the intestine. Decreased expression of esg resulted in upregulation of Amun, while downregulation of Amun rescued the ectopic EE cell phenotype resulting from loss of esg. Thus, our findings provide a framework for further compara- tive studies addressing the conserved roles of Snail factors in coor- dinating self-renewal and differentiation of stem cells across tissues and species.

Keywords Amun; Drosophila; Escargot; Notch; stem cell

Subject Categories Development & Differentiation; Stem Cells; Transcription

DOI 10.15252/embj.201489050 | Received 21 May 2014 | Revised 20 October

2014 | Accepted 27 October 2014 | Published online 28 November 2014

The EMBO Journal (2014) 33: 2983–2996

See also: J Korzelius et al (December 2014)

Introduction

During homeostasis, tissue stem cells maintain the stem cell popula-

tion through self-renewal and give rise to differentiating progeny to

replace cells lost to normal turnover of the tissue (Biteau et al,

2011; Simons & Clevers, 2011; Wang & Jones, 2011). In response to

acute and chronic stress (infection, wounding, aging, metabolic

challenges), tissue stem cells can undergo dynamic waves of

symmetric self-renewing or differentiating divisions to quickly prop-

agate and replace damaged tissue (Morrison & Kimble, 2006; Egger

et al, 2010; O’Brien et al, 2011; Piccin & Morshead, 2011; Simons &

Clevers, 2011). While significant progress has been made in the

identification, isolation and manipulation of tissue stem cells in

organisms ranging from plants to vertebrates (Amatruda & Zon,

1999; Gentile et al, 2011; Takashima et al, 2013), our understanding

of conserved mechanisms that regulate the choice between self-

renewal and the onset of differentiation in vivo is lacking. In this

regard, model organisms such as Caenorhabditis elegans and

Drosophila melanogaster have been instrumental for the character-

ization of basic regulatory mechanisms in stem cells, such as the

role of asymmetric divisions (Yamashita et al, 2003; Wu et al, 2008;

Egger et al, 2010; Inaba & Yamashita, 2012) and the interaction

between stem cells and their niche (Wong et al, 2005; Spradling

et al, 2008; Losick et al, 2011; Resende & Jones, 2012).

The identification and characterization of stem cells in the

posterior midgut of adult flies (Micchelli & Perrimon, 2006; Ohlstein

& Spradling, 2006) has revealed numerous regulatory mechanisms

conserved between flies and vertebrates (Biteau et al, 2011; Jiang &

Edgar, 2012). The Drosophila midgut epithelium is composed of

intestinal stem cells (ISCs), enteroblasts (EBs), secretory enteroen-

docrine (EE) cells and absorptive enterocytes (ECs) (Fig 1A).

Through cell division, ISCs self-renew to maintain the ISC pool and

generate progenitor cells, which adopt either an EE or an EC fate. In

addition, ISCs can divide symmetrically to generate either two

daughter ISCs or two cells that will differentiate (O’Brien et al,

2011; Goulas et al, 2012; de Navascues et al, 2012). Indeed, it has

been proposed that intestinal homeostasis in flies is maintained

through a neutral drift between all possible mitotic outcomes

(de Navascues et al, 2012).

ISCs express the ligand Delta (Dl), which activates Notch (N)

signaling in adjacent EBs to promote differentiation and influence

cell fate decisions: a weak N signal specifies EE fate, whereas

1 Laboratory of Genetics, The Salk Institute for Biological Studies, La Jolla, CA, USA 2 Department of Molecular, Cell, and Developmental Biology, University of California Los Angeles, Los Angeles, CA, USA 3 The Gurdon Institute, University of Cambridge, Cambridge, UK 4 Eli and Edythe Broad Center of Regenerative Medicine and Stem Cell Research, University of California Los Angeles, Los Angeles, CA, USA

*Corresponding author. Tel: +1 310 206 7066; E-mail: leannejones@ucla.edu †Present address: Department of Life Sciences, Imperial College London, London, UK

ª 2014 The Authors The EMBO Journal Vol 33 | No 24 | 2014 2983

stronger N signaling generates ECs (Micchelli & Perrimon, 2006;

Ohlstein & Spradling, 2006, 2007). Accordingly, strong loss-of-function

mutations in the N pathway cause an accumulation of ISC-like cells,

due to lack of EB differentiation, whereas weaker loss-of-function

mutations of Notch generate clusters of ISC-like cells and EEs, due

to a combination of impaired EB differentiation and a bias toward

the EE fate. In contrast, ectopic activation of N in ISCs results in

precocious differentiation, with a bias toward the EC fate (Micchelli

& Perrimon, 2006; Ohlstein & Spradling, 2006, 2007). While the

regulation of the ISC lineage by the Notch pathway and its down-

stream effectors has been well established previously (Micchelli &

Perrimon, 2006; Ohlstein & Spradling, 2006; Bardin et al, 2010;

Perdigoto et al, 2011), little is known about upstream mechanisms

that control the levels of Notch activity in this system.

The expression of esg reporter transgenes has been used to mark

ISCs and EBs since their initial characterization (Micchelli & Perri-

mon, 2006). Subsequently, the restricted expression of endogenous

esg mRNA in ISC/EB nests was confirmed by fluorescence in situ

hybridization in combination with immunofluorescence staining

(FISH/IF) (Fig 1B; Toledano et al, 2012). To date, however, whether

esg plays any specific role in the regulation of ISCs remains

unknown.

Esg is a member of the Snail family of transcription factors that

act primarily through competition with transcriptional activators for

access to a consensus-binding site, the E-box, within the promoter

region of target genes (Hemavathy et al, 2000; Nieto, 2002; Barrallo-

Gimeno & Nieto, 2005). The Snail factors were first characterized in

Drosophila and are conserved from mollusks to humans (Nieto,

2002). In addition to expression in ISCs, Esg is expressed in germ-

line stem cells (GSCs) and cyst stem cells (CySCs) of the testis (Kiger

et al, 2000; Voog et al, 2014) and, during development, in neural

stem cells and imaginal disks (Hayashi et al, 1993; Ashraf et al,

1999; Cai et al, 2001). Moreover, our previous work demonstrated

that Esg is required for the maintenance of CySCs and hub cells, a

critical component of the stem cell niche in the adult testis (Voog

et al, 2014).

Given the restricted expression of esg in ISC/EBs of the Drosoph-

ila intestine, we sought to characterize the function of Esg in these

cells. Here, we demonstrate that Esg is required for maintenance of

ISCs and an important regulator of Notch signaling within EBs.

Furthermore, DNA binding analysis by DamID identified Amun, a

previously characterized negative regulator of Notch signaling

(Abdelilah-Seyfried et al, 2000; Shalaby et al, 2009), as a putative

target of Esg in the gut. Accordingly, Esg knockdown in ISC/EBs

caused an upregulation in Amun expression in these cells. Further-

more, abrogating the increase in Amun rescued the reduction in

Notch activity and accumulation of EE cells caused by loss of Esg.

Based on our data, we conclude that Esg positively modulates Notch

signaling within EBs through repression of Amun, influencing the

decision between EC and EE fates. Therefore, we propose that Esg

plays a pivotal role in intestinal homeostasis, simultaneously

promoting stem cell maintenance and regulating the differentiation

of EBs.

Results

Loss of Escargot function in ISC/EBs leads to loss of ISCs and a bias toward the enteroendocrine cell fate

Most esg alleles result in lethality during development when homo-

zygous; however, the shutoff (shof) allele of esg is a homozygous

viable mutation in the esg locus, which permits investigation of

adult phenotypes (Voog et al, 2014). FISH/IF analysis revealed that

esgshof homozygotes express normal levels of esg mRNA in ISC/EBs

(Supplementary Fig S1A), and intestines from these flies appeared

normal. Therefore, in order to probe the role of Esg in the intestine,

FRT-mediated recombination was used to generate ISCs homozy-

gous mutant for a null allele of esg, esgG66 (Whiteley et al, 1992; Lee

& Luo, 1999; Voog et al, 2014). In this experiment, a heat shock-

induced recombination generates esg mutant cells that become

permanently labeled by expression of GFP. Progeny derived from

marked ISCs are similarly marked, permitting characterization of

cells derived from esg mutant ISCs (or that of corresponding wild-

type counterparts, in control animals). Clones of esgG66 mutant cells

did not appear grossly different from wild-type clones at early time

▸Figure 1. Loss of Escargot induces ISC loss and a bias toward the enteroendocrine cell fate.A Drosophila posterior midgut epithelium. Schematic representation of cell types and their lineage relationships (see text for details; Micchelli & Perrimon, 2006; Ohlstein & Spradling, 2006). Intestinal stem cells (ISCs) and enteroblasts (EBs) can be usually identified by an esg-GFP reporter, or expression of GFP under control of ISC/EB-specific drivers. ISCs express Delta (Dl, which results in a characteristic punctate staining of ISCs), which activates Notch in EBs (revealed by b-GAL staining of flies that carry a Su(H)-lacZ reporter of Notch activity (Bray & Furriols, 2001)). Enteroendocrine cells (EE) are identified by nuclear Prospero (Pros) staining, whereas enterocytes (ECs) can be distinguished based on their large polyploidy nuclei (as revealed by DAPI staining of DNA).

B esg mRNA is restricted to ISC/EB cells. FISH/IF staining for esg mRNA (red, gray) and GFP protein (green) in midguts of 3- to 5-day-old adults carrying an ISC/EB- specific reporter (“esg > GFP” = esg-Gal4, UAS-GFP).

C Clonal analysis of esg mutant ISCs. Representative images of wild-type (control) and esg mutant (esgG66) MARCM clones stained as indicated with DAPI, Pros and GFP, 4 or 10 days after heat shock (dphs). esgG66 mutant clones are smaller and contain EE cells more frequently than controls (arrows).

D, E Loss of esg results in loss of ISCs and an increase in EE cells. A CellProfiler analysis of images as those in (C) confirmed that esgG66 mutant clones are significantly enriched for EE cells (D) and have significantly less cells (E) than their control counterparts (***P < 0.001 and **P < 0.01, Kruskal–Wallis/Dunn test).

F, G Phenotypes induced by RNAi-mediated depletion of esg in ISC/EBs. (F) RNAi-mediated knockdown of Esg in ISC/EBs caused an accumulation of EE cells and a noticeable change in the morphology and size of some ISC/EBs (arrows in bottom panel; e.g. compare the large GFP+ cell identified by the rightmost arrow to its two smaller neighbors). Midguts from adults of the indicated genotypes were stained with DAPI (all nuclei), GFP (ISC/EB) and Pros (EE cells) following a 6-day incubation at 25°C on 10 lg/ml RU486 or EtOH-containing food (as indicated). (G) Images as those in (F) were processed with CellProfiler to quantify the relative proportion of EE cells in the indicated genotypes/treatments (see Materials and Methods for details). Each data point is an average proportion calculated from four independent images per midgut, and the bars are the geometric mean � SEM of those averages. *** denotes a significant enrichment of EE cells following Esg knockdown in ISC/EBs compared to either control group (P < 0.001, Kruskal–Wallis/Dunn test).

Data information: Scale bars = 20 lm.

The EMBO Journal Vol 33 | No 24 | 2014 ª 2014 The Authors

The EMBO Journal Regulation of intestinal stem cells by Escargot Mariano A Loza-Coll et al

2984

A B

C

F

D

E

G

Figure 1.

ª 2014 The Authors The EMBO Journal Vol 33 | No 24 | 2014

Mariano A Loza-Coll et al Regulation of intestinal stem cells by Escargot The EMBO Journal

2985

points (Fig 1C, 4 dphs); however, quantification of Prospero-

expressing (Pros+) cells within esgG66 clones revealed a significant

enrichment of EE cells (Fig 1D). At later time points, esgG66 clones

were significantly smaller than control clones (Fig 1C and E,

10 dphs) and remained significantly enriched for EE cells (Fig 1D).

We used CellProfiler (Carpenter et al, 2006; Kamentsky et al,

2011) to automatically classify and quantify cells within GFP+

esgG66 and control clones (Supplementary Fig S1B and Supplemen-

tary Table S1; see Materials and Methods for details). Our analysis

showed a higher prevalence of multicellular esgG66 clones that

contained only differentiated cells, consistent with a role for Esg in

ISC maintenance (polyploid ECs, EE cells or combinations thereof,

examples are shown in Supplementary Fig S1C, insets iv and v).

The proportion of esgG66 that did not contain ISCs or EBs was

approximately double that of wild-type counterparts, both at 4 and

10 dphs (Supplementary Fig S1D). In addition, esgG66 clones lacking

ISC/EBs had a significantly larger proportion of EE cells compared

to controls (Supplementary Fig S1E). Of note, the frequency of wild-

type clones that lost the ISC at 4 dphs (12.5%) is in close agreement

with previously reported rates of symmetric/differentiating ISC divi-

sions (O’Brien et al, 2011; Goulas et al, 2012; de Navascues et al,

2012). Particularly evident among esgG66 GFP+ clones were

instances of Pros+ doublets (Supplementary Fig S1C, inset v), which

were only rarely observed in control clones (3.13% of esgG66 clones

with more than one cell vs. 0.26% of control clones, Supplementary

Table S1).

To confirm these findings, we used the GAL4-UAS system to

induce RNAi-mediated knockdown of Esg expression. Specifically,

a UAS-esgRNAi construct (referred to as esgRNAi hereafter) was

expressed under control of a drug-inducible GAL4 driver, 5961GS,

whose expression pattern recapitulates esg expression in the diges-

tive tract (Biteau et al, 2010; Mathur et al, 2010). Esg knockdown

caused an alteration in the morphology of ISC/EBs, some of which

appeared larger and had an overall morphology reminiscent of ECs

(arrows in Fig 1F). In addition, a striking accumulation of Pros+

EE cells was observed (Fig 1F and G), with the total proportion

doubling after 6 days of esgRNAi induction. Similar results were

obtained with an independent UAS-esgRNAi line (Supplementary Fig

S1F) and with another inducible and considerably stronger ISC/

EB-specific GAL4 driver (esg-Gal4, tub-Gal80ts, referred to as

“esgts” hereafter) (Supplementary Fig S3C and D). Taken together,

these data indicate that loss of esg function in ISC/EBs leads to a

progressive loss of ISCs and a shift in differentiation toward the EE

lineage.

To determine in which cell type Esg is required to influence cell

fates, we directed the expression of UAS-esgRNAi to ISCs or EBs.

Restricted expression of UAS-esgRNAi and a UAS-2xYFP reporter to

ISCs (Wang et al, 2014) revealed morphological changes in YFP+

cells consistent with the induction of ISC differentiation (Fig 2A,

Supplementary Fig S2A). In addition, a significant accumulation of

EE cells (Fig 2C) was also observed. Depletion of Esg exclusively in

EBs, with a temperature-sensitive version of a Su(H)-Gal4 driver

(referred to as Su(H)-Gal4ts, Supplementary Fig S2B) (Zeng et al,

2010), also led to an alteration in the size and morphology of EBs,

including some cells that resembled polyploid ECs (Fig 2B, arrows).

Interestingly, there was an even more striking and significant

enrichment of EE cells (Fig 2B and D), indicating that the loss Esg

function in EBs is sufficient to accelerate their differentiation and

bias their fate toward the EE lineage.

Loss of Escargot function in ISC/EBs correlates with reduced Notch activity in EBs

Numerous reports have established a connection between activation

of the Notch signaling pathway and cell fate decisions in the intes-

tine (Micchelli & Perrimon, 2006; Ohlstein & Spradling, 2006, 2007;

Maeda et al, 2008; Bardin et al, 2010; Perdigoto et al, 2011). Notch

is a transmembrane receptor that, upon binding to its ligands Delta

or Serrate, undergoes a series of proteolytic cleavages leading to the

cytoplasmic release of its intracellular domain (NICD or Nintra). Nintra

translocates into the nucleus and binds Suppressor of Hairless,

Su(H), a co-factor through which Notch activates the expression of

its target genes (Koch et al, 2013). Targeted depletion of Esg in ISC/

EBs caused a noticeable reduction in the expression of a Su(H)-lacZ

reporter of Notch activation in EBs (Supplementary Fig S3A),

including those adjacent to ISCs that continued to express Delta

(Fig 3A). These data indicate that loss of Esg leads to a decrease in

N signaling between ISCs and EBs. In support of these observations,

a modest induction of esgRNAi expression in flies heterozygous for a

null allele of Notch (N81K1) noticeably enhanced the accumulation

of EE cells, which was not obvious in either the esgRNAi or the

N81K1/+ background (Fig 3B). In 17% of midguts examined

(n = 18), supernumerary esg-GFP+ diploid cells were observed,

along with a striking accumulation of EE cells, reminiscent of the

characteristic phenotypes caused by Notch loss-of-function muta-

tions (Supplementary Fig S3B).

If the accumulation of EE cells upon Esg knockdown was due to

a reduction in Notch activity within EBs, then ectopic activation of

▸Figure 2. Loss of Esg function causes an accumulation of EE cells and an altered EB morphology.A Phenotypes caused by depletion of esg in ISCs. Midguts of the indicated genotype were stained with DAPI (all nuclei), YFP (primarily ISCs) and Pros (EE cells) following 6 days of incubation at the indicated temperatures (control = outcross to w1118 flies).

B Phenotypes caused by depletion of esg in EBs. Midguts of the indicated genotypes were stained with DAPI (all nuclei), GFP (EBs) and Pros (EE cells) following 6 days of incubation at 29°C to allow the EB-restricted expression of UAS-esgRNAi or a UAS-GFPnls (control). Notice the stronger nuclear GFP staining in control samples due to GFPnls expression. Arrows point to examples of EBs with a wider cytoplasm, dimmer GFP staining and seemingly polyploid nuclei following Esg knockdown.

C EE cell accumulation induced by depletion of esg in ISCs. CellProfiler was used as in Fig 1G to quantify the relative proportions of EE cells in midguts in images as those in (A). *** and * denote a statistically significant difference in the relative proportion of EE cells in pairwise post-test comparisons indicated by the corresponding bars (P < 0.001 and P < 0.05 Kruskal–Wallis/Dunn test).

D EE cell accumulation induced by depletion of esg in EBs. CellProfiler was used as in (C). *** denotes a statistically significant accumulation of EE cells following EB-specific Esg knockdown, as compared to all other samples (P < 0.001, Kruskal–Wallis/Dunn test).

Data information: Scale bars = 20 lm.

The EMBO Journal Vol 33 | No 24 | 2014 ª 2014 The Authors

The EMBO Journal Regulation of intestinal stem cells by Escargot Mariano A Loza-Coll et al

2986

A

B

C D

Figure 2.

ª 2014 The Authors The EMBO Journal Vol 33 | No 24 | 2014

Mariano A Loza-Coll et al Regulation of intestinal stem cells by Escargot The EMBO Journal

2987

the Notch pathway through forced expression of a constitutively

active Notch construct should preserve the normal balance between

EEs and ECs. Expression of UAS-Nintra in ISCs and EBs with the

inducible 5961GS driver resulted in strong activation of the Su(H)-

lacZ reporter in both ISC and EBs (Fig 3C). Furthermore, as

predicted, co-expression of Nintra and esgRNAi in ISC/EBs resulted in

a suppression of ectopic EE cells (Fig 3C and D). Similar results

were obtained by expressing both transgenes with the esgts driver

(Supplementary Fig S3C and D). Restricted expression of Nintra and

esgRNAi to EBs, using the Su(H)-Gal4ts driver, resulted in lethality,

even at the restrictive temperature (18°C), likely due to leaky

expression in other tissues during development.

Interestingly, expression of Nintra alone in ISC/EBs led to an

expected trend toward EC enrichment, which became highly

significant when Nintra was expressed in combination with esgRNAi

(Supplementary Fig S3E). Similarly, there was a significant accumu-

lation of ECs following expression of esgRNAi alone, likely a conse-

quence of ISC depletion due to loss of Esg. To address whether the

proposed accumulation of EE cells reflected the non-specific, relative

accumulation of ECs and EEs as a result of ISC/EB loss, we calcu-

lated the relative proportion of EEs to ECs (Supplementary Fig S3F).

However, this analysis confirmed the enrichment of EE cells, relative

to ECs. Furthermore, the co-expression of Nintra and esgRNAi fully

reversed this trend, as predicted by the model that activated Notch

rescues the bias toward the EE fate in favor of EC differentiation. In

summary, reduced activation of the Su(H)-lacZ reporter following

esg knockdown (Fig 3A and Supplementary Fig S3A), together with

the observation that Nintra is epistatic to esgRNAi (Fig 3C and D and

Supplementary Fig S3D), strongly suggests that Notch functions

downstream of Esg to regulate cell fate decisions in the intestine.

Amun is a candidate Esg target in ISCs/EBs

In order to identify mediators of Esg function in ISC/EBs, we used

DamID to conduct a genome-wide in vivo mapping of Esg binding to

DNA (van Steensel & Henikoff, 2000; Southall & Brand, 2009). A

fusion of Esg and the bacterial DNA methylase Dam was expressed

in flies, which led to the methylation of DNA surrounding Esg bind-

ing sites in vivo. Genomic DNA was then extracted from midguts,

and the methylated regions were labeled and hybridized to whole-

genome tiling arrays (see the Supplementary Materials and Methods

for further details). Putative targets of Esg in the intestine were then

identified by proximity to the methylated regions identified via

DamID, or “Esg binding regions” (EBRs) (Supplementary Table S2).

We then used FlyMine to cross-reference genetic interactors of

Notch with a list of in vivo DamID targets of Esg (Supplementary

Table S2). From this approach, we identified Amun as a putative

candidate (Fig 4A). Amun is a nuclear protein with a predicted DNA

glycosylation domain, which has been shown to suppress Delta

gain-of-function phenotypes when overexpressed in the eye and the

wing (Shalaby et al, 2009) and to cause the formation of extra

scutellar bristles when overexpressed in wing imaginal disks

(Abdelilah-Seyfried et al, 2000). Both phenotypes are consistent with

Amun acting as an inhibitor of Notch signaling. Accordingly, when we

overexpressed Amun in ISC/EBs using esg-Gal4ts, we observed a down-

regulation in Su(H)-lacZ expression (Fig 4B) and a corresponding

enrichment of EE cells (Fig 4C). We confirmed these observations using

the 5961GS driver, which led to more subtle, but reproducible, pheno-

types (Supplementary Fig S4).

To further explore the relationship between Esg and Amun, we

tested the hypothesis that Esg knockdown would lead to upregula-

tion (de-repression) of Amun. Analysis of Amun mRNA expression

in whole intestines by reverse transcriptase (RT)–qPCR showed a

modest but statistically significant upregulation in Amun following

Esg knockdown (Supplementary Fig S5A). Because such slight

upregulation could be a consequence of ISC/EBs representing only a

very small proportion of the intestinal biomass, RT–qPCR measure-

ments were repeated in ISC/EBs purified by FACS sorting from

dissociated intestines (Dutta et al, 2013) (Supplementary Fig S5B).

This complementary approach confirmed the upregulation in Amun

mRNA levels following Esg knockdown (Fig 4D). We also assayed

Amun expression in posterior midguts via fluorescent in situ hybrid-

ization/immunofluorescence (FISH/IF) staining (Toledano et al,

2012). Although Amun mRNA was undetectable in ISC/EBs of

control guts using this method, some expression could be detected

within esg-GFP+ progenitor cells following RNAi-mediated depletion

of esg (Supplementary Fig S5C).

If Amun de-repression mediates the downregulation of Notch

signaling in EBs caused by Esg depletion, then the co-expression of

an AmunRNAi construct along with esgRNAi should rescue the bias in

cell fates toward the EE cell lineage. We tested this prediction by co-

expressing esgRNAi and AmunRNAi in EBs using the Su(H)-Gal4ts

▸Figure 3. Loss of Esg function in ISC/EBs leads to decreased Notch activity in EBs.A Esg knockdown in ISC/EBs causes reduced Notch reporter activity in EBs. Use of a Notch (N) activity reporter (Su(H)-lacZ; Bray & Furriols, 2001) reveals a noticeable reduction in N signaling within EBs, despite of seemingly unaltered Delta expression in ISCs. Midguts of the indicated genotypes were stained with DAPI (all nuclei), Delta (ISCs) and b-GAL (EBs) following 4 days of incubation in 10 lg RU486/ml or ethanol-containing food as indicated.

B Epistasis analysis between Esg (esgRNAi) and Notch (N81K1). Midguts of the indicated genotypes were stained with DAPI (all nuclei), GFP (esg+ cells) and Pros (EE cells) following 6 days of incubation in 5 lg/ml RU or ethanol, as indicated. Notice that a lower concentration of RU486, resulting in a more moderate induction of esgRNAi expression, did not produce the larger and dimmer GFP+ nuclei or EE cell accumulation typically observed with higher doses of RU486. Approximately 83% (15/18) of the N81K1/+; esgRNAi guts showed a noticeable accumulation of EE cells in an otherwise normal-looking epithelium (right column, middle panel), whereas the remaining 17% showed a drastic expansion of diploid, esg+ and EE cells (right column, lower panel), reminiscent of stronger Notch loss-of-function mutations (compare with Supplementary Fig S3B).

C, D Constitutively active Notch signaling rescues the EE cell enrichment phenotype caused by Esg knockdown. (C) An esgRNAi construct and a constitutively active Notch construct (Nintra) were expressed alone or in combination in ISC/EBs using the 5961GS driver. Midguts of the indicated genotypes were stained for GFP, b-GAL (EBs) and Pros (EE cells) following 7 days of incubation in ethanol or 25 lg/ml RU486 as indicated. (D) Images as those in (C) were processed with CellProfiler to quantify the relative proportion of EE cells. Midguts overexpressing the esgRNAi construct alone were the only sample that showed a significant EE enrichment relative to the corresponding EtOH control (***P < 0.001, one-way ANOVA/Bonferroni test).

Data information: Scale bars = 20 lm.

The EMBO Journal Vol 33 | No 24 | 2014 ª 2014 The Authors

The EMBO Journal Regulation of intestinal stem cells by Escargot Mariano A Loza-Coll et al

2988

A

C

D

B

Figure 3.

ª 2014 The Authors The EMBO Journal Vol 33 | No 24 | 2014

Mariano A Loza-Coll et al Regulation of intestinal stem cells by Escargot The EMBO Journal

2989

A

B

D

C

Figure 4. Amun is a candidate target of Esg.

A Esg DamID profile surrounding the Amun locus. Data are displayed as custom UCSC Genome Browser tracks. Green/red bars represent the average log2 (intensity ratio) between the Esg:Dam and Dam-control samples, mapped to the genomic regions � 10 kb from Amun (see Supplementary Materials and Methods for further details). The yellow shading highlights an Esg-bound region (EBR), which includes a consensus Esg E-box ([G/A]CAGGTG; Fuse et al, 1994).

B, C Amun overexpression in ISC/EBs resembles a reduction in N signalling. (B) Midguts of the indicated genotype were stained with DAPI (nuclei), GFP (ISC/EB) and b-GAL (N activation). (C) CellProfiler quantification of the relative proportion of EE cells in midguts from (B). A similar result was obtained using the milder 5961GS

driver (Supplementary Fig S4). ***P < 0.001, Mann–Whitney U-test. Scale bars = 20 lm. D Amun mRNA upregulation following Esg knockdown in ISC/EBs. qPCR measurements of relative transcript abundances for the indicated genes from esg-GFP+ and

esg-GFP� cells isolated by FACS sorting from esg-GFP, 5961GS > UAS-esgRNAi flies incubated on ethanol or RU486 (25 lg/ml for 3 days) to induce RNAi expression. Shown are means (� SEM) of efficiency-corrected relative quantities for each primer set, normalized to the corresponding GFP+/EtOH sample and to RpL32 levels (used as reference). * denotes a significant reduction in esg and an increase in Amun transcript levels, respectively (P < 0.05, two-tailed unpaired Student’s t-test).

The EMBO Journal Vol 33 | No 24 | 2014 ª 2014 The Authors

The EMBO Journal Regulation of intestinal stem cells by Escargot Mariano A Loza-Coll et al

2990

driver. While expression of AmunRNAi alone had no effect on the

proportion of EE cells or morphology of EBs, the overexpression of

AmunRNAi rescued the EE enrichment phenotype induced by Esg

knockdown (Fig 5A and B). Similar results were obtained with two

independent genomic insertions of the UAS-AmunRNAi construct

(Supplementary Fig S6A and B). Importantly, the co-expression of

AmunRNAi also rescued the downregulation of Notch activity in EBs

induced by Esg knockdown (Supplementary Fig S7). Altogether, our

data support a model in which downregulation of Esg led to a de-

repression of Amun, which results in reduced Notch signaling and

biased differentiation of the EB toward the EE fate.

Discussion

Our data indicate that the transcription factor Escargot, a marker

of intestinal stem cells and enteroblasts in Drosophila, plays a

significant, dual role in maintaining intestinal homeostasis. Through

clonal analysis of a null allele of esg and induced RNAi-mediated

knockdown in ISC/EBs, we conclude that Esg is required for ISC

maintenance. In addition, loss of esg biases the differentiation of

EBs toward the EE lineage (Fig 1 and Supplementary Fig S1).

Together with data from our colleagues, who evaluated gene expres-

sion changes upon modulation of Esg (Korzelius et al, 2014), our

A

B

Figure 5. RNAi-mediated downregulation of Amun in EBs rescues the EE cell bias caused by loss of esg.

A Immunostaining of midguts following EB-restricted co-downregulation of Amun and esg. Midguts from flies of the indicated genotypes were incubated for 6 days at 29°C and stained for DAPI (all nuclei), GFP (EBs) and Pros (EE cells). “Control” = the Su(H)ts driver stock outcrossed to wild-type flies. The AmunRNAi construct shown is inserted on chromosome II (“line1”; Supplementary Fig S6A and B shows the same experiment with an independent insertion of the same AmunRNAi construct on chromosome X, or “line2”). The esgRNAi flies also carry a UAS-GFPnls construct in the background (to control for GAL4 titration), which explains the nuclear GFP staining of EBs in these midguts. Notice that the alterations in EB morphology caused by Esg knockdown (arrowheads) are only partially rescued by the co-expression of AmunRNAi (arrows; see also Supplementary Fig S6A). Scale bars = 20 lm.

B Abrogation of EE cell enrichment by co-downregulation of Esg and Amun. CellProfiler was used to quantify relative EE cell proportions (as before). Genotype-matched controls were kept for 10–11 days at 18°C. *** denotes the only sample that was significantly different from all other samples in the set, including its genotype match at 18°C (P < 0.001, one-way ANOVA/Bonferroni test).

ª 2014 The Authors The EMBO Journal Vol 33 | No 24 | 2014

Mariano A Loza-Coll et al Regulation of intestinal stem cells by Escargot The EMBO Journal

2991

findings suggest that Esg represses differentiation in ISCs to support

stem cell maintenance and enhances N signaling in EBs to influence

differentiation (Fig 6). Interestingly, we have found that Esg may

play analogous roles in the Drosophila testis, where it regulates

maintenance of somatic cyst stem cells (CySCs) and maintains

somatic niche support cells in a differentiated state (Voog et al,

2008, 2014). Therefore, Esg appears to act at central nodes to regu-

late the behavior of stem cells, as well as differentiated cell types, in

multiple tissues.

In addition to an accumulation of EE cells, loss of Esg also

resulted in decreased expression of a Notch signaling reporter,

Su(H)-lacZ, in EBs, suggesting that Esg modulates Notch activity in

the intestine. Alternatively, the decreased expression of the Su(H)-

lacZ reporter could be due to the induced differentiation of ISC/EBs.

However, the reduced activity of this reporter occurred in diploid

cells that maintained ISC/EB marker expression (Supplementary

Figs S3A and S7). In addition, the co-expression of both Nintra and

AmunRNAi together with esgRNAi in ISC/EBs rescued the Notch

signaling defect, as reflected by this reporter, without affecting the

changes in morphology consistent with differentiation (Fig 3C and

Supplementary Fig S7). Therefore, the effects of esg depletion on the

Su(H)-lacZ reporter and induction of differentiation can be uncou-

pled. Perhaps the strongest evidence that Esg interacts genetically

with Notch in this system is that moderate knockdown of esg in a

Notch heterozygous mutant background led to a phenotype reminis-

cent of strong Notch loss–of-function mutations: accumulation of

ISC-like cells and EEs (Fig 3B). In these cases, the loss of Esg func-

tion must have led to a decrease in Notch signaling that preceded

the commitment of progenitor cells to differentiate.

EB-specific expression of esgRNAi with Su(H)-Gal4 was sufficient

to cause a bias in differentiation toward the EE fate. However,

restricting the expression of esgRNAi to ISCs using the esg-Gal4/Su(H)-

Gal80 system also led to a significant accumulation of EE cells

(Fig 2A and C), which would indicate that the loss of Esg in stem

cells is sufficient to bias the fate choice of the EB. However, as

expression of the Su(H)-Gal80 transgene is under control of Notch

signaling, one caveat of this experiment is that expression of the

RNAi construct may not be fully restricted to ISCs, as the ability of

GAL80 to repress GAL4 in the EB could be partially blocked by the

reduction in Notch signaling induced by the loss of Esg (Supple-

mentary Fig S2A). Regardless, a recent report suggested that the EE

fate is indeed pre-determined in a small proportion of esg+ ISCs

that co-express Prospero (Biteau & Jasper, 2014). Therefore, one

interpretation of these data is that Esg is required in the ISC to

repress commitment to the EE fate. Indeed, we noted a rather

striking frequency of esg+ cells that also expressed Prospero in

samples where esgRNAi expression was restricted to ISCs (Supple-

mentary Fig S2A, yellow arrowheads). Intriguingly, we have not

observed a similar increase in the frequency of esg/Pros double-

positive cells in any other genotypes that express esgRNAi in ISCs

and cause EE cell enrichment. One interesting explanation for the

difference in results when esg depletion is restricted to ISCs versus

expressed in ISC/EBs might be that an Esg-dependent feedback

signal emanating from EBs induces the ISC to express Pros, which

is inhibited in crosses involving ISC/EB drivers (e.g., esg-Gal4,

5961GS, etc.).

Genome-wide mapping of Esg binding to DNA identified Amun as

a putative target of Esg. Amun overexpression has been shown to

suppress Delta gain-of-function phenotypes, as well as Notch-

mediated lateral inhibition during scutellar bristle development

(Abdelilah-Seyfried et al, 2000; Shalaby et al, 2009). Here, we show

that Amun overexpression in ISC/EBs also caused a moderate, but

reproducible, decrease in Notch activity within EBs, and a conse-

quent enrichment in EE cells (Fig 4B and C). Quantitative RT–PCR

revealed that Amun is indeed upregulated upon Esg knockdown

(Fig 4D), and the simultaneous downregulation of Amun and esg

suppressed the bias toward EE cell fate. Also consistent with our

data, Amun expression was downregulated approximately 1.5-fold

upon overexpression of Esg in S2 cells, as determined by gene

expression microarrays (Sandall and Jones, unpublished observa-

tions). Therefore, we conclude that Esg represses Amun expression

in ISC/EBs, thereby positively regulating Notch signaling to influence

EB fate decisions.

Interestingly, the direct overexpression of Amun in ISC/EBs

caused a modest, yet significant, accumulation of EE cells (Fig 4B

and C and Supplementary Fig S4B and C), whereas knocking down

esg expression caused a more striking EE enrichment, accompanied

by a slight increase in Amun mRNA levels (Fig 4D). These observa-

tions indicate that the downregulation of Amun by Esg is only one

of diverse mechanisms, both Notch dependent and independent, by

which Esg regulates the biology of ISCs and differentiating progeni-

tor cells. Accordingly, the manipulation of Esg in ISC/EBs revealed

significant differences in mRNA levels of other Notch pathway regu-

lators, including some members of the Enhancer of split Complex

(E(spl)-C) and Notch itself (Korzelius et al, 2014).

Altogether, our data support a model whereby Esg inhibits differ-

entiation directly in the ISC, whereas the positive regulation of

Notch signaling by Esg in EBs influences differentiation along the EC

lineage (Fig 6). As Notch signaling should only occur after the ISC

has divided (which permits the binding between Delta and Notch in

opposing membranes), this allows Esg to influence signaling in the

EB only after ISC division. Therefore, our data suggest that Esg plays

a critical role in the regulation of ISCs, maintaining the undifferenti-

ated state of the stem cell while setting up a series of regulatory

mechanisms that, once the stem cell divides, promote and regulate

the differentiation of its progeny (Fig 6). Given our data for Esg in

Figure 6. Dual regulation of intestinal stem cells and their progeny by Escargot. Schematic summary of the findings. Esg is required for ISC maintenance by inhibiting differentiation. In addition, Esg influences EB differentiation by inhibiting the expression of Amun, a Notch inhibitor, which indirectly leads to the positive modulation of Notch activity within EBs (dashed gray arrow).

The EMBO Journal Vol 33 | No 24 | 2014 ª 2014 The Authors

The EMBO Journal Regulation of intestinal stem cells by Escargot Mariano A Loza-Coll et al

2992

both the testis and intestine (Voog et al, 2014), we hypothesize that

the ability of core stem cell factors to serve dual roles in stem and

differentiating cells is a rather general mode of action.

Integrating Esg transcriptional profiling and genome mapping

data will likely lead to more comprehensive testable models of ISC

regulation by Esg and thus provide a basis for comparative studies

involving other stem cell systems, both in flies and across species.

Indeed, recent studies have demonstrated that mammalian Snail1 is

expressed in and regulates the maintenance of murine intestinal

stem cells (crypt base columnar (CBC) cells) (Horvay et al, 2011)

(Horvay et al, in preparation). Upon conditional loss of Snai1,

Horvay et al observed a bias toward the secretory lineages, similar

to our observations in the fly, suggesting that the Snail family may

be evolutionarily conserved regulators of intestinal homeostasis. In

addition to CBC cells, Snail family members are expressed in other

mammalian stem/progenitor cell populations (Guo et al, 2012;

Nassour et al, 2012; Soleimani et al, 2012), and Snail1 has an estab-

lished role in regulating epithelial–mesenchymal transitions (EMT)

during development, initiation of metastasis and de-differentiation of

cells back to a stem cell-like state (Mani et al, 2008). Therefore,

understanding the mechanisms by which Esg simultaneously

regulates stem cell maintenance and progenitor cell differentiation

will likely provide insights into the role of the Snail family during

normal development, as well as cancer initiation and progression.

Materials and Methods

Fly stocks and GAL4/UAS systems

A detailed list of fly stocks and their origin is provided in the Supple-

mentary Materials and Methods section. Two inducible GAL4/UAS

systems were used in this study: the GeneSwitch system (Osterwalder

et al, 2001; Roman et al, 2001) and the Target system (McGuire

et al, 2003, 2004). All crosses with the GeneSwitch driver were

carried out at 25°C. Crosses with the TARGET system were set up

and maintained at 18°C until eclosion. In both cases, adults were

kept for an additional 2–3 days and induced at 3–4 days after eclosion

by placement on RU food (in concentrations ranging between 5

and 25 lg/ml, as indicated) or at 29°C and flipped every 2 days thereafter (see the Supplementary Information for more details.)

Antibodies and immunofluorescence (IF)

Based on a recent characterization of anatomical and functional

compartments of the posterior midgut (Marianes & Spradling, 2013),

all of our experiments were carried out in the P3-P4 regions, located

by centering the pyloric ring in a 40× field of view (fov) and moving

1–2 fov toward the anterior. In FISH/IF experiments, and given that

guts are more easily damaged, images typically correspond to the

region just anterior to the pyloric ring. Posterior midguts were

dissected in ice-cold PBS/4% formaldehyde and incubated for an

additional 30 min in fixative at room temperature. Samples were

then washed four times, for 5 min each, in PBS containing 0.1%

Triton X-100 (PBT-1), blocked for 30 min in PBT-1/3% bovine

serum albumin and immunostained with primary antibodies

overnight at 4°C. Samples were then washed 4 × 5 min at room

temperature in PBT-1, incubated with secondary antibodies at room

temperature for 2 h, washed again as before and mounted in Vecta-

Shield/DAPI (Vector Laboratories, H-1200). A detailed list of anti-

bodies, their source and concentration is provided in the

Supplementary Information.

Fluorescence in situ hybridization/immunofluorescence staining (FISH/IF)

We have previously published a detailed version of the FISH/IF

protocol used in this study (Toledano et al, 2012). Briefly, posterior

midguts were dissected in ice-cold PBS/DEPC, fixed in 4% formalde-

hyde for 30 min at room temperature and incubated with the

primary antibodies overnight at 4°C in a buffer containing yeast

tRNA, heparin and RNase inhibitors. The midguts were then washed,

incubated with secondary antibodies, post-fixed and, following

a series of washes and buffer equilibration steps, incubated with

1 lg/ml of the corresponding DIG-labeled RNA probes at 65°C overnight. Following additional washes and buffer equilibration

steps, the midguts were incubated with an anti-DIG antibody conju-

gated to horseradish peroxidase (HRP, Roche, 11207733910) at 4°C

overnight. Finally, probes were detected using a TSATM Cy3 kit

(NEL704A001KT), following the manufacturer’s instructions. The

esg probe was made from full-length cDNA, following the labeling

protocol in Toledano et al (2012). The Amun probe corresponds to

nucleotides 869–1821 in the CDS region of the Amun mRNA.

MARCM clonal analysis

yw,hs-flp122; esgG66, FRT40A/tub-Gal80, FRT40; UAS-2xGFP/tub-

Gal4 flies were heat-shocked twice in a 12-h period (1 h at 37°C

each), 3–4 days after eclosion. Flies were returned to 25°C and their

midguts dissected 4 or 10 days later. Control clones were obtained

by replacing esgG66, FRT40 with a wild-type FRT40 chromosome.

CellProfiler quantification

Images were originally obtained as z-stacks with a typical slice

thickness of 750 nm. ImageJ was used to generate maximum or

average projections from each channel, which were saved as indi-

vidual TIFF or JPEG files. The images were then processed using ad

hoc CellProfiler pipelines (available upon request). Four images were

taken per gut, two on each side (top and bottom), from contiguous

fov, starting at 1 fov from the pylorus (as explained above). For

measurements of EE cell proportions, the Pros+/total cell ratios were

determined for each image and average ratios from the four images

corresponding to a single gut were used in subsequent analyses.

Statistical analysis

All our statistical analysis and graphical display of the data were

performed using Prism5 (GraphPad). Datasets were subjected to a

D’Agostino normality test, and parametric or non-parametric testing

was used accordingly (and as indicated in figure legends).

In vivo DamID

Whole midguts were dissected from flies expressing ubiquitous low

levels of a Dam:Esg fusion protein (or control flies expressing Dam

ª 2014 The Authors The EMBO Journal Vol 33 | No 24 | 2014

Mariano A Loza-Coll et al Regulation of intestinal stem cells by Escargot The EMBO Journal

2993

alone), immediately frozen on dry ice and transferred to �80°C. Genomic DNA was isolated from approximately 50 midguts per

genotype and processed following the protocol in Choksi et al (2006)

(see Supplementary Materials and Methods for details). Triplicate

samples of labeled DNA were hybridized with a dye-swap to Nimble-

Gen 2.1 M whole-genome tiling arrays (Roche) at the FlyChip facility

(www.flychip.org.uk). Original data are deposited in NCBI’s Gene

Expression Omnibus under accession number GSE55226. DamID

data were analyzed to identify Esg binding regions (EBRs) with

minor modifications to the protocol in Southall and Brand (2009).

RT–qPCR on whole guts

Whole guts from Su(H)-lacZ; esg-GFP, 5961-Gal4GS; UAS-esgRNAi

females incubated on 10 lg/ml RU or EtOH food for 4 days were dissected and immediately frozen at �80°C, until approximately 250 guts per treatment group had been collected. Total RNA was

extracted with TRIzol (Life Technologies, cat#15596026), following

the manufacturer’s instructions. After confirming the integrity of the

RNA sample by gel electrophoresis, 2 lg of RNA were treated with DNase Q1 (Promega, cat#M610A) in a 20 ll reaction volume. 10 ll of the DNase Q1-treated RNA were reverse-transcribed using the iScript

kit (Bio-Rad, cat#170-8841, 2.5 ll were used to make a corresponding no-RT control sample). Standard qPCRs were carried out on a

Bio-Rad CFX96/C1000 Touch system (Bio-Rad), using SsoAdvanced

SYBRGreen (Bio-Rad, cat#1725-264). The following are the primer

sequences used: RpL32 Fwd: ATCGTGAAGAAGCGCACCAA; RpL32

Rev: TGTCGATACCCTTGGGCTTG; GFP Fwd: TCCGCCCTGAGCAAA

GAC; GFP Rev: GAACTCCAGCAGGACCATGTG; Amun Fwd: TAAA

CACCAGCCGGTCACTT; Amun Rev: GATGCGGATGTGTCGTTGTC.

RT–qPCR on FACS-purified intestinal cells

The protocol for gut dissociation and FACS sorting was carried

out with minor modifications from Dutta et al (2013) (see

the Supplementary Information for more details). Whole guts from

Su(H)-lacZ; esg-GFP, 5961GS; UAS-esgRNAi females incubated on

25 lg/ml RU or EtOH food for 3 days were dissected in ice-cold DEPC/PBS and immediately digested with trypsin and elastase.

Dissociated intestinal cells were collected by gentle centrifugation,

filtered and sorted by FACS. Ten thousand GFP+ or GFP� cells were sorted directly into 30 ll of lysis buffer. Total RNA was extracted using the ArrayPureTM Nano-scale RNA Purification Kit (Epicentre,

cat# MPS04050) and amplified using the MessageBOOSTERTM cDNA

Synthesis Kit (Epicentre, cat# MB060124). The cDNA obtained was

diluted 30× and used directly for qPCR measurements, using the

following primer sequences: RpL32 Fwd: GCCGCTTCAAGGGACAG

TAT; RpL32 Rev: ACTTCTTGAATCCGGTGGGC; esg Fwd: CGCCAG

ACAATCAATCGTAAGC; esg Rev: TGTGTACGCGAAAAAGTAGTG

G; Amun Fwd: CCCGATCCAGAAGGCAGTAA; Amun Rev: TCTGCT

GCTTGTTCTTCGGAT.

Supplementary information for this article is available online:

http://emboj.embopress.org

Acknowledgements We thank H. Jasper, B. Ohlstein, L. Cooley, A. Christiansen, B. Baker, B. Edgar,

S. Hou, N. Perrimon, GH. Baeg, B. Glise, the Vienna Drosophila RNAi Center

(VDRC), Harvard Transgenic RNAi Project (TRiP) and Bloomington Stock Center

for reagents and fly stocks. We are also grateful to Allison Bardin, Jerome

Korzelius and Bruce Edgar for critical reading of the manuscript, and to Katia

Horvay, Gary Hime and Helen Abud for sharing unpublished work related to

this manuscript. We thank Cecilia D’Alterio for assistance and reagents used in

our FISH/IF analysis, William Ansari for valuable experimental assistance, Jia

Wu for help with the Perl script used in our DamID analysis, Pavan Kendale for

guidance using CellProfiler, Haibin Xi for assistance with qPCR and the David

Walker laboratory for assistance with GeneSwitch experiments. We also thank

Felicia Codrea and Jessica Scholes from the UCLA Broad Stem Cell Research

Center Flow Cytometry Core Resource for their technical support and advice

for FACS sorting. S.L.S. was supported by a postdoctoral fellowship from the

Damon Runyon Cancer Research Foundation and the UCSD IRACDA program.

This work was supported by the American Cancer Society, the California

Institute for Regenerative Medicine, the Eli and Edythe Broad Center of

Regenerative Medicine and Stem Cell Research at the University of California,

Los Angeles, and the NIH (D.L.J).

Author contributions MLC and DLJ planned experiments. MLC performed the experiments and data

analysis. TDS and AB generated the reagents used for DamID analysis; MLC

and TDS carried out the DamID protocol and data analysis. SLS generated

reagents used in the study. MLC and DLJ wrote and edited the manuscript.

Conflict of interest The authors declare that they have no conflict of interest.

References

Abdelilah-Seyfried S, Chan YM, Zeng C, Justice NJ, Younger-Shepherd S, Sharp

LE, Barbel S, Meadows SA, Jan LY, Jan YN (2000) A gain-of-function screen

for genes that affect the development of the Drosophila adult external

sensory organ. Genetics 155: 733 – 752

Amatruda JF, Zon LI (1999) Dissecting hematopoiesis and disease using the

zebrafish. Dev Biol 216: 1 – 15

Ashraf SI, Hu X, Roote J, Ip YT (1999) The mesoderm determinant snail

collaborates with related zinc-finger proteins to control Drosophila

neurogenesis. EMBO J 18: 6426 – 6438

Bardin AJ, Perdigoto CN, Southall TD, Brand AH, Schweisguth F (2010)

Transcriptional control of stem cell maintenance in the Drosophila

intestine. Development 137: 705 – 714

Barrallo-Gimeno A, Nieto MA (2005) The Snail genes as inducers of cell

movement and survival: implications in development and cancer.

Development 132: 3151 – 3161

Biteau B, Karpac J, Supoyo S, Degennaro M, Lehmann R, Jasper H (2010)

Lifespan extension by preserving proliferative homeostasis in Drosophila.

PLoS Genet 6: e1001159

Biteau B, Hochmuth CE, Jasper HCPCN (2011) Maintaining tissue

homeostasis: dynamic control of somatic stem cell activity. Cell Stem Cell

9: 402 – 411

Biteau B, Jasper H (2014) Slit/Robo signaling regulates cell fate decisions in

the intestinal stem cell lineage of Drosophila. Cell Rep 7: 1867 – 1875

Bray S, Furriols M (2001) Notch pathway: making sense of suppressor of

hairless. Curr Biol 11: R217 – R221

Cai Y, Chia W, Yang X (2001) A family of snail-related zinc finger proteins

regulates two distinct and parallel mechanisms that mediate Drosophila

neuroblast asymmetric divisions. EMBO J 20: 1704 – 1714

The EMBO Journal Vol 33 | No 24 | 2014 ª 2014 The Authors

The EMBO Journal Regulation of intestinal stem cells by Escargot Mariano A Loza-Coll et al

2994

Carpenter AE, Jones TR, Lamprecht MR, Clarke C, Kang IH, Friman O, Guertin

DA, Chang JH, Lindquist RA, Moffat J, Golland P, Sabatini DM (2006) Cell

Profiler: image analysis software for identifying and quantifying cell

phenotypes. Genome Biol 7: R100

Choksi SP, Southall TD, Bossing T, Edoff K, de Wit E, Fischer BE, van Steensel

B, Micklem G, Brand AH (2006) Prospero acts as a binary switch between

self-renewal and differentiation in Drosophila neural stem cells. Dev Cell

11: 775 – 789

Dutta D, Xiang J, Edgar BA (2013) RNA expression profiling from FACS-isolated

cells of the Drosophila intestine. Curr Protoc Stem Cell Biol 27: Unit 2F.2

Egger B, Gold KS, Brand AH (2010) Notch regulates the switch from

symmetric to asymmetric neural stem cell division in the Drosophila optic

lobe. Development 137: 2981 – 2987

Fuse N, Hirose S, Hayashi S (1994) Diploidy of Drosophila imaginal cells is

maintained by a transcriptional repressor encoded by escargot. Genes Dev

8: 2270 – 2281

Gentile L, Cebria F, Bartscherer K (2011) The planarian flatworm: an in vivo

model for stem cell biology and nervous system regeneration. Dis Models

Mech 4: 12 – 19

Goulas S, Conder R, Knoblich JA (2012) The Par complex and integrins direct

asymmetric cell division in adult intestinal stem cells. Cell Stem Cell 11:

529 – 540

Guo W, Keckesova Z, Donaher JL, Shibue T, Tischler V, Reinhardt F, Itzkovitz S,

Noske A, Zurrer-Hardi U, Bell G, Tam WL, Mani SA, van Oudenaarden A,

Weinberg RA (2012) Slug and Sox9 cooperatively determine the mammary

stem cell state. Cell 148: 1015 – 1028

Hayashi S, Hirose S, Metcalfe T, Shirras AD (1993) Control of imaginal cell

development by the escargot gene of Drosophila. Development 118:

105 – 115

Hemavathy K, Guru SC, Harris J, Chen JD, Ip YT (2000) Human Slug is a

repressor that localizes to sites of active transcription. Mol Cell Biol 20:

5087 – 5095

Horvay K, Casagranda F, Gany A, Hime GR, Abud HE (2011) Wnt signaling

regulates Snai1 expression and cellular localization in the mouse

intestinal epithelial stem cell niche. Stem Cells Dev 20: 737 – 745

Inaba M, Yamashita YM (2012) Asymmetric stem cell division: precision for

robustness. Cell Stem Cell 11: 461 – 469

Jiang H, Edgar BA (2012) Intestinal stem cell function in Drosophila and mice.

Curr Opin Genet Dev 22: 354 – 360

Kamentsky L, Jones TR, Fraser A, Bray MA, Logan DJ, Madden KL, Ljosa V,

Rueden C, Eliceiri KW, Carpenter AE (2011) Improved structure, function

and compatibility for Cell Profiler: modular high-throughput image

analysis software. Bioinformatics 27: 1179 – 1180

Kiger AA, White-Cooper H, Fuller MT (2000) Somatic support cells restrict

germline stem cell self-renewal and promote differentiation. Nature 407:

750 – 754

Koch U, Lehal R, Radtke F (2013) Stem cells living with a Notch. Development

140: 689 – 704

Korzelius J, Naumann SK, Loza-Coll MA, Chan JS, Dutta D, Oberheim J, Glasser

C, Southall TD, Brand AH, Jones DL, Edgar BA (2014) Escargot maintains

stemness and suppresses differentiation in Drosophila intestinal stem cells.

EMBO J 33: 2967 – 2982

Lee T, Luo L (1999) Mosaic analysis with a repressible cell marker for

studies of gene function in neuronal morphogenesis. Neuron 22:

451 – 461

Losick VP, Morris LX, Fox DT, Spradling A (2011) Drosophila stem cell niches: a

decade of discovery suggests a unified view of stem cell regulation. Dev

Cell 21: 159 – 171

Maeda K, Takemura M, Umemori M, Adachi-Yamada T (2008) E-cadherin

prolongs the moment for interaction between intestinal stem cell and its

progenitor cell to ensure Notch signaling in adult Drosophila midgut.

Genes Cells 13: 1219 – 1227

Mani SA, Guo W, Liao MJ, Eaton EN, Ayyanan A, Zhou AY, Brooks M, Reinhard

F, Zhang CC, Shipitsin M, Campbell LL, Polyak K, Brisken C, Yang J,

Weinberg RA (2008) The epithelial-mesenchymal transition generates cells

with properties of stem cells. Cell 133: 704 – 715

Marianes A, Spradling AC (2013) Physiological and stem cell

compartmentalization within the Drosophila midgut. eLife 2: e00886

Mathur D, Bost A, Driver I, Ohlstein B (2010) A transient niche regulates

the specification of Drosophila intestinal stem cells. Science 327:

210 – 213

McGuire SE, Le PT, Osborn AJ, Matsumoto K, Davis RL (2003) Spatiotemporal

rescue of memory dysfunction in Drosophila. Science 302: 1765 – 1768

McGuire SE, Mao Z, Davis RL (2004) Spatiotemporal gene expression

targeting with the TARGET and gene-switch systems in Drosophila. Sci

STKE 2004: pl6

Micchelli CA, Perrimon N (2006) Evidence that stem cells reside in the adult

Drosophila midgut epithelium. Nature 439: 475 – 479

Morrison SJ, Kimble J (2006) Asymmetric and symmetric stem-cell divisions in

development and cancer. Nature 441: 1068 – 1074

Nassour M, Idoux-Gillet Y, Selmi A, Come C, Faraldo ML, Deugnier MA,

Savagner P (2012) Slug controls stem/progenitor cell growth dynamics

during mammary gland morphogenesis. PLoS ONE 7: e53498

de Navascues J, Perdigoto CN, Bian Y, Schneider MH, Bardin AJ,

Martinez-Arias A, Simons BD (2012) Drosophila midgut homeostasis

involves neutral competition between symmetrically dividing intestinal

stem cells. EMBO J 31: 2473 – 2485

Nieto MA (2002) The snail superfamily of zinc-finger transcription factors.

Nat Rev Mol Cell Biol 3: 155 – 166

O’Brien LE, Soliman SS, Li X, Bilder D (2011) Altered modes of stem cell

division drive adaptive intestinal growth. Cell 147: 603 – 614

Ohlstein B, Spradling A (2006) The adult Drosophila posterior midgut is

maintained by pluripotent stem cells. Nature 439: 470 – 474

Ohlstein B, Spradling A (2007) Multipotent Drosophila intestinal stem cells

specify daughter cell fates by differential notch signaling. Science 315:

988 – 992

Osterwalder T, Yoon KS, White BH, Keshishian H (2001) A conditional

tissue-specific transgene expression system using inducible GAL4. Proc

Natl Acad Sci U S A 98: 12596 – 12601

Perdigoto CN, Schweisguth F, Bardin AJ (2011) Distinct levels of Notch

activity for commitment and terminal differentiation of stem cells in the

adult fly intestine. Development 138: 4585 – 4595

Piccin D, Morshead CM (2011) Wnt signaling regulates symmetry of division

of neural stem cells in the adult brain and in response to injury. Stem

Cells 29: 528 – 538

Resende LP, Jones DL (2012) Local signaling within stem cell niches: insights

from Drosophila. Curr Opin Cell Biol 24: 225 – 231

Roman G, Endo K, Zong L, Davis RL (2001) P[Switch], a system for spatial and

temporal control of gene expression in Drosophila melanogaster. Proc Natl

Acad Sci U S A 98: 12602 – 12607

Shalaby NA, Parks AL, Morreale EJ, Osswalt MC, Pfau KM, Pierce EL,

Muskavitch MA (2009) A screen for modifiers of notch signaling uncovers

Amun, a protein with a critical role in sensory organ development.

Genetics 182: 1061 – 1076

Simons BD, Clevers H (2011) Strategies for homeostatic stem cell self-renewal

in adult tissues. Cell 145: 851 – 862

ª 2014 The Authors The EMBO Journal Vol 33 | No 24 | 2014

Mariano A Loza-Coll et al Regulation of intestinal stem cells by Escargot The EMBO Journal

2995

Soleimani VD, Yin H, Jahani-Asl A, Ming H, Kockx CE, van Ijcken WF, Grosveld

F, Rudnicki MA (2012) Snail regulates MyoD binding-site occupancy to

direct enhancer switching and differentiation-specific transcription in

myogenesis. Mol Cell 47: 457 – 468

Southall TD, Brand AH (2009) Neural stem cell transcriptional networks

highlight genes essential for nervous system development. EMBO J 28:

3799 – 3807

Spradling AC, Nystul T, Lighthouse D, Morris L, Fox D, Cox R, Tootle T, Frederick

R, Skora A (2008) Stem cells and their niches: integrated units that maintain

Drosophila tissues. Cold Spring Harb Symp Quant Biol 73: 49 – 57

van Steensel B, Henikoff S (2000) Identification of in vivo DNA targets of

chromatin proteins using tethered dam methyltransferase. Nat Biotechnol

18: 424 – 428

Takashima S, Gold D, Hartenstein V (2013) Stem cells and lineages of the

intestine: a developmental and evolutionary perspective. Dev Genes Evol

223: 85 – 102

Toledano H, D’Alterio C, Loza-Coll M, Jones DL (2012) Dual fluorescence

detection of protein and RNA in Drosophila tissues. Nat Protoc 7:

1808 – 1817

Voog J, D’Alterio C, Jones DL (2008) Multipotent somatic stem cells

contribute to the stem cell niche in the Drosophila testis. Nature 454:

1132 – 1136

Voog J, Sandall SL, Hime GR, Resende LP, Loza-Coll M, Aslanian A,

Yates JR 3rd, Hunter T, Fuller MT, Jones DL (2014) Escargot restricts

niche cell to stem cell conversion in the Drosophila testis. Cell Rep 7:

722 – 734

Wang L, Jones DLCPCN (2011) The effects of aging on stem cell behavior in

Drosophila. Exp Gerontol 46: 340 – 344

Wang L, Zeng X, Ryoo HD, Jasper H (2014) Integration of UPRER and

oxidative stress signaling in the control of intestinal stem cell

proliferation. PLoS Genet 10: e1004568

Whiteley M, Noguchi PD, Sensabaugh SM, Odenwald WF, Kassis JA (1992) The

Drosophila gene escargot encodes a zinc finger motif found in

snail-related genes. Mech Dev 36: 117 – 127

Wong MD, Jin Z, Xie T (2005) Molecular mechanisms of germline stem cell

regulation. Annu Rev Genet 39: 173 – 195

Wu PS, Egger B, Brand AH (2008) Asymmetric stem cell division: lessons from

Drosophila. Semin Cell Dev Biol 19: 283 – 293

Yamashita YM, Jones DL, Fuller MT (2003) Orientation of asymmetric stem

cell division by the APC tumor suppressor and centrosome. Science 301:

1547 – 1550

Zeng X, Chauhan C, Hou SX (2010) Characterization of midgut stem

cell- and enteroblast-specific Gal4 lines in drosophila. Genesis 48:

607 – 611

The EMBO Journal Vol 33 | No 24 | 2014 ª 2014 The Authors

The EMBO Journal Regulation of intestinal stem cells by Escargot Mariano A Loza-Coll et al

2996