Peer reviewed articles

smnjiaq8.w
ContentServer2.pdf

RESEARCH ARTICLE

Radio Electric Asymmetric Conveyer (REAC)

technology to obviate loss of T cell

responsiveness under simulated microgravity

Salvatore Rinaldi 1,2,3*, Maria Antonia Meloni1☯, Grazia Galleri4☯, Margherita Maioli2,3,5,6,

Gianfranco Pigliaru 5,6

, Giulia Cugia 7 , Sara Santaniello

5,6 , Alessandro Castagna

2 ,

Vania Fontani 1,2,3

1 Research Department, Rinaldi Fontani Foundation, Florence, Italy, 2 Department of Regenerative and

Anti-Aging Medicine, Rinaldi Fontani Institute, Florence, Italy, 3 IRF Shanghai Medical Sciences, Shanghai,

China, 4 Department of Clinical and Experimental Medicine, University of Sassari, Sassari, Italy,

5 Department of Biomedical Sciences, University of Sassari, Sassari, Italy, 6 Genetics and Biomedical

Research Institute, National Research Council (CNR), Monserrato, Cagliari, Italy, 7 ViroStatic S.r.l., Alghero,

Italy

☯ These authors contributed equally to this work. * srinaldi@irf.it

Abstract

Alterations of the gravitational environment are likely to modify cell behavior. Several studies

have proven that T cells are sensitive to gravity alterations and that microgravity conditions

may induce immunosuppression and weakened T cell immune response in humans during

spaceflights. The aim of this work was to elucidate if a specific treatment of Radio Electric

Asymmetric Conveyer (REAC) technology could restore, after mitogenic activation (Con A),

a correct expression of cytokine IL2 gene and its receptor IL2R alpha, which are inhibited in

T cells under microgravity conditions, as demonstrated in several studies. The results of this

study, conducted in microgravity simulated with Random Positioning Machine (RPM), con-

firm the T cell activation recovery and offer the evidence that REAC technology could con-

tribute to the understanding of T cell growth responsiveness in space, reducing the impact

of weightlessness on the immune system experienced by humans in long duration space

missions.

Introduction

The REAC technology (acronym for Radio Electric Asymmetric Conveyor) is a technology

platform for neuro- and bio-modulation. Previous studies have proven that REAC technology

is able to induce direct cell reprogramming of murine embryonal[1] and human differentiated

adult cells toward cardiac, neuronal, and skeletal muscle-like lineages[2, 3]. Moreover, REAC

technology has shown to be able to counteract aging processes [4, 5], acting also on telome-

rase-independent and telomerase-dependent pathways [6] and on endogenous Hyaluronic

Acid (HA) and HA-binding proteins. Through its mechanism of action, REAC technology

creates an interesting network that acts on the modulation of cell polarity and intracellular

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 1 / 16

a1111111111

a1111111111

a1111111111

a1111111111

a1111111111

OPEN ACCESS

Citation: Rinaldi S, Meloni MA, Galleri G, Maioli M,

Pigliaru G, Cugia G, et al. (2018) Radio Electric

Asymmetric Conveyer (REAC) technology to

obviate loss of T cell responsiveness under

simulated microgravity. PLoS ONE 13(7):

e0200128. https://doi.org/10.1371/journal.

pone.0200128

Editor: Joshua J. Obar, Dartmouth College, Geisel

School of Medicine, UNITED STATES

Received: October 4, 2017

Accepted: June 20, 2018

Published: July 6, 2018

Copyright: © 2018 Rinaldi et al. This is an open access article distributed under the terms of the

Creative Commons Attribution License, which

permits unrestricted use, distribution, and

reproduction in any medium, provided the original

author and source are credited.

Data Availability Statement: All relevant data are

within the paper and its Supporting Information

file.

Funding: Virostatic s.r.l. provided support in the

form of salaries for G.C., but did not have any

additional role in the study design, data collection

and analysis, decision to publish, or preparation of

the manuscript. The specific role of this author is

articulated in the ‘author contributions’ section.

environment [7]. On the basis of REAC efficacy as cell polarity optimizer[7], the purpose of

this study was the evaluation of REAC technology and in particular of its RGN-S treatment

protocol[1–3, 6], as a potential countermeasure to win the impact of spaceflight stress on the

alteration of the immune system experienced by humans in the space environment. In fact,

one focus of today’s research on cells in space is the signal transduction and the underlying

mechanism of cell polarity modulation[8].

In the last 30 years, more than 230 experiments conducted in space have shown that dra-

matic changes occur in several types of cells during their exposure to microgravity, and several

studies evidenced microgravity effects onto Immune System and lymphocytes.

T lymphocytes in microgravity were investigated in numerous experiments following

Cogoli’s first observation that revealed that the failure of Concanavalin A in stimulating prolif-

eration of lymphocytes was clearly due to the lack of gravity[9]. Concanavalin A activates T

Lymphocytes by initiating a complex mechanism, which requires two further signals until the

T cells start replicating their DNA. Crucial points of this process are the production of inter-

leukin 2 (IL-2) by T cells and the autocrine interaction of IL-2 with the IL-2 receptor alpha

(IL2Rα) expressed at the surface of activated T lymphocytes [10–13]. These experiments con- cluded that disturbed T cell function in weightlessness is the result of an altered architecture

and function of the cytoskeleton, changing the secretion of cytokines and the expression of IL-

1/IL-2 receptors[14, 15]. This is why one focus of today’s research on cells in space is the signal

transduction.

T cells are a good model to study signal transduction pathways, because three extracellular

signals (mitogen, IL-1 and IL-2) are required for full activation, and two classical pathways

(via proteins G and PKC, PKA) are activated within the cell[16]. In addition, low molecular

weight GTP-binding proteins (Ras and Rap) are interacting with the cytoskeleton[15]. The

data at 0g support the notion that the expression of IL-2 receptor is inhibited, while mitogen binding and the transmission of IL-1 by accessory cells occur normally. Moreover, Hughes–

Fulford’s group analyzed induction of early genes expression in Concanavalin A activated

human T cells [17, 18] and discovered that the protein kinase A (PKA) signaling pathway is

downregulated under microgravity. Transcription factors as NF-κB, AP-1, and CREB are all regulated by PKA and they all suffer dysfunction under altered gravity. These findings indicate

that PKA is a key player in gravity-mediated modulation of T cell activation and not just the

PKC as believed as far[19].

A systematic approach to understand the causes of the loss of T cell activation was conducted

in real microgravity conditions in space and in microgravity conditions simulated by ground

facilities, as Fast Rotating Clinostat (FRC)[20] and Random Positioning Machine (RPM)[21, 22].

The results obtained in ground facilities were in agreement with those obtained in space. There-

fore, for our work we used the Random Positioning Machine, reproducing the experimental

model already used in many studies[23, 24] for the investigation of T cell activation as well as cell

differentiation in the immune system[25]. The results obtained revealed that REAC technology

effectively reduces the loss of T cell activity in the space and improves the gene expression of IL2

and its IL2-Rα, under simulated microgravity conditions. REAC technology RGN-S treatment protocol could be a potential countermeasure to win the impact of spaceflight stress on the alter-

ation of the immune system experienced by humans in the space environment.

Materials and methods

Ethics

The institutional review board of the Local Public Health Authority, the Ethic Committee of

Azienda Sanitaria Locale (ASL) N˚ 1, Sassari, Italy, approved all experimental protocols (Prot.

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 2 / 16

Competing interests: Salvatore Rinaldi and Vania

Fontani invented REAC technology. Giulia Cugia is

affiliated with the commercial organization

Virostatic s.r.l., Alghero, Italy. This does not alter

our adherence to PLOS ONE policies on sharing

data and materials.

N.2074/CE). Informed consent was obtained from all subjects. The methods were carried out

according to the principles expressed in the Declaration of Helsinki.

Microgravity simulation–The Random Positioning Machine (RPM)

The Random Positioning Machine (RPM) was developed by T. Hoson in Japan and manufac-

tured by Dutch Space (former Fokker Space) in the 1990s[26] to simulate weightlessness, in

order to study the effects on plants as well as various other cell types. The RPM provided con-

ditions similar to those that occur during exposure of cells to real microgravity inside an Inter-

national Space Station (10 −2

/ 10 −4

)[25]. The RPM is an instrument designed to provide an

experiment with continuous random orientation changes in 3-dimensional space relatively to

Earth’s gravity vector. This three-dimensional movement is achieved by two independently

rotating frames. The frames are controlled by a computer, which randomly generates the

speed and direction of the frames regardless of the gravity force vector. Biological samples con-

nected to a platform in the middle of the frames experience weightlessness, since they have no

time to orient themselves according to the gravity force vector. In our study, the RPM was

accommodated in a temperature-controlled room at 37˚C, at Biomedical Science Department,

University of Sassari, Italy. A box containing the cell cultures sealed in 2 ml Eppendorf tubes,

was placed and fixed, as close as possible, at the center of the inner frame of the machine.

Eppendorf tubes were used to allow the Asymmetric Conveyer Probe of the REAC device to be

immersed in the suspended cells and they were completely filled to avoid the presence of air

bubbles, which could lead to shear force damage of the cells on the RPM. A control experiment

on ground was also performed: cell cultures, in parallel, were placed at the basement of the

RPM, at 1g gravity in thermostatic room at 37˚C, in static position but continuously turned to prevent them from settling.

Description of Radio Electric Asymmetric Conveyer (REAC) Technology

Radio Electric Asymmetric Conveyer Technology (REAC) is a technological platform for

neuro- and bio-modulation. Its mechanism of action is described in details in Maioli 2016 [7].

REAC is an asymmetric technology since there is only one single physical pole (asymmetrical

circuit), while a normal electric circuit has two physical poles: one positive and one negative

(symmetrical circuit). This unique pole in REAC Technology is the Asymmetric Conveyer

Probe (ACP), which becomes the attractor of the currents induced in the body or in cell cul-

ture by the radio electric field emitted by the device. The aim of this scheme is to create an

asymmetric circuit, which better interacts with the asymmetric mechanism underlying the cell

polarity. Acting on cell polarity and optimizing its functions, REAC technology can modulate

the current flows both at cellular and body level, when these are altered, exerting a therapeutic

effect. Moreover, in order to induce current flows of intensity comparable with those of cell

polarity, REAC Technology uses radio electric emission of low power level, because higher

power levels would disturb the adjustment mechanisms of cell polarity. The REAC treatment

protocol used in this study was the Regenerative (RGN) treatment type S. The radio electric

field was generated by a 2.4 GHz emitter. With the ACP immerged in the cell cultures at a dis-

tance of 35 cm from the emitter, we measured a radiated power of approximately 400 μW/m2

Electric fieldσ = 0.4 V/m, magnetic field = 1 mA/m, specific absorption rate (SAR) = 0.128 μW/g; given J = 1 A/Vm, and ρ = 1,000 kg/m3, the density of radio electric current flow- ing in the culture medium during a single radiofrequency burst by the REAC is J = 30 μA/cm2. The model of REAC device used in this study was B.E.N.E. (Bio-Enhancer Neuro-Enhancer,

manufactured by ASMED S.r.l., Florence, Italy).

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 3 / 16

Peripheral blood mononuclear cells

For each independent experiment, Peripheral Blood Mononuclear Cells (PBMCs) were sepa-

rated for every different donor, to overcome the individual variation. Each buffy-coat prepara-

tion (45ml) of a blood sample (450 ml) drawn from the antecubital vein of a volunteer healthy

donor and collected into blood bag containing citrate phosphate dextrose as anticoagulant

(obtained from Centro Trasfusionale, Ospedale Civile–Sassari, Italy), was diluted 1:10 with

Hank’s buffer (Gibco) just before the separation. PBMCs were separated as resting cells from

the peripheral fresh blood according to the Boyum method[27], based on gradient centrifuga-

tion at 300xg, by means of the density separation medium Histopaque-1077 (SIGMA) and leading to a cell population consisting of (80%) T lymphocytes, (10%) B cells, (5%) monocytes

and (5%) granulocytes, indicated as a whole as Peripheral Blood Mononuclear cells (PBMCs).

PBMCs were stored overnight at 37˚C inside thermostatic room, in the dark, prior to activa-

tion, to avoid causing non-specific activation. This allows the cells to recover from the stress of

the isolation. In fact, centrifugation steps lasting 10–30 min at 200xg or more may activate cer- tain genes and thus cause artefacts due to hyper gravity stress.

Cell activation

PBMCs activation can offer a good model for the study of cell differentiation as well as of the

cellular aspect of the immune system. For these experiments, PBMCs were resuspended at a

density of 6 x 10^6 cells/ml into RPMI-1640 culture medium (GlutaMAXTM, Gibco, Paisley,

UK) supplemented with 10% heat-inactivated fetal calf serum (FCS, mycoplasma free, Gibco),

20 mM 4-(2-hydroxyethyl) piperazine-1-ethanesulfonic acid (HEPES), 5 mM sodium bicar-

bonate, 50 μg /ml gentamycin (all purchased from Gibco, Invitrogen, Carlsbad, USA). Cells were activated by addition of a mitogenic drug, Concanavalin A (Con A, Sigma), at a final con-

centration of 10 μg /ml and aliquoted into 2ml Eppendorf tubes to a final concentration of 6 x 10^6cells/ml. Con A is a mitogenic drug from lentil seeds of Canavalia ensiformis and is known for its ability to stimulate mouse T cell subsets, giving rise to four functionally distinct

T cell populations, including precursors to suppressor T cell. Also one subset of human sup-

pressor T cells is sensitive to Con A[28]. Con A was added immediately before the start of the

experiment. Upon exposure to mitogen Con A in culture, T lymphocytes can be selectively

activated polyclonally to proliferate and to produce a number of lymphokines. T lymphocytes

are activated by mitogens of different origin. Most of the results on T cells activation were

obtained with the lectin Con A[28].

Experiment layout of each buffy coat preparation

For the REAC treatment experiment, cell culture units were prepared, loading aliquots of 2ml

into each culture tube, to provide the samples divided into two experimental sets: REAC pre-

treated cells and REAC post-treated cells. REAC pre-treated cells were divided in 6 subsets,

each of which consisted of a pair of samples (Fig 1).

The first 3 subsets for each health donor were respectively treated with REAC technology

for 2, 4 and 12 hours and then exposed to simulated microgravity (RPM), at 37˚C for the same

period. The second 3 subsets were respectively treated with REAC technology for 2, 4 and 12

hours and then exposed to 1g ground gravity for the same period and in same temperature condition (37˚C). Control cells were defined as 6 subsets of cells untreated with REAC: among

them, 3 subsets were kept at 1g gravity conditions for respectively 2, 4 and 12 hours and then exposed to simulated microgravity for the same period, while the other 3 subsets were kept at

1g for respectively 2, 4 and 12 hours and subsequently kept still at 1g for the same period. In a similar way, REAC post-treated cells were divided in 6 subsets. The first 3 subsets were

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 4 / 16

exposed to RPM for respectively 2, 4 and 12 hours at 37˚C, and then treated with REAC tech-

nology for the same period of time. The other 3 subsets were exposed to 1g gravity for respec- tively 2, 4 and 12 hours, and then treated with REAC technology for the same period of time.

As for the control of REAC pre-treatment, even for REAC post-treatment control cells were

defined as 6 subsets of cells untreated with REAC: among them, 3 subsets were exposed to sim-

ulated microgravity for respectively 2, 4 and 12 hours and then kept at 1g gravity for the same period, while the other 3 subsets were exposed to 1g ground gravity for respectively 2, 4 and 12 hours and subsequently kept still at 1g for the same period. Cell cultures either during REAC pre-treatment or during REAC post-treatment, were placed into a thermostatically-controlled

water bath at 37˚C, and kept in a static 1g gravity condition for each time required (2-4-12 h), as provided by experiment schedule (Fig 1). The culture medium was not changed during the

hours of culturing. The samples placed on the RPM bar in 1g gravity condition were

Fig 1. Schematic representation of the experiment profile, REAC treatment of cells and their exposition to simulated microgravity on Random Positioning

Machine (RPM) or to 1g ground conditions. (A) Flow chart showing the experiment layout of REAC treatment before and after exposition to simulated microgravity (RPM) or 1g ground conditions. The Eppendorf tubes were lying on their side. One of the two samples from each experimental set and for each time, named A, was destined for gene expression analysis, placed into ice and subsequently resuspended in 2ml RNAlater; the other sample, named B, was prepared for flow cytometry

analysis, centrifuged and after removing cell culture medium, resuspended in freezing medium and subsequently stored at -80˚C until processing. (B) Representative

image of REAC apparatus during samples treatment at 1g gravity. (C) Photographs capturing some steps of cells exposition to simulated microgravity on RPM.

https://doi.org/10.1371/journal.pone.0200128.g001

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 5 / 16

continuously turned to prevent them from settling. For each experimental subset of cells, one

sample was destined for gene expression analysis, placed into ice and subsequently resus-

pended in 2ml RNAlater. The other sample was centrifuged and after removing cell culture

medium, resuspended in freezing medium (10% DMSO in 90% FCS) and subsequently stored

at -80˚C until staining and acquisition for flow cytometry analysis.

Gene expression—Quantitative real-time Polymerase Chain Reaction

(qPCR)

We selectively performed qRT-PCR to quantitatively detect gene expression of Il-2 and IL2Rα, in order to verify their different expression in REAC-pre-treated cells before exposition to simulated

microgravity (RPM) or in REAC-post-treated cells after exposition to RPM, versus their respec-

tive no-treated controls either on simulated microgravity (0g-RPM) and on 1g gravity conditions (1g-ground). Cells from each sample of each experimental set and of each time (Fig 1A) were placed into ice and subsequently resuspended in 2ml RNAlater, according to the manufacturer’s

instruction (Sigma-Aldrich, Milan, Italy). Total RNA was isolated from cells exposed to different

experimental conditions, as indicated in experimental profile, using Trizol reagent according to

the manufacturer’s instruction (Invitrogen, Carlsbad, USA). Total RNA was dissolved in RNA-

ase-free water for RT-PCR and quantified by Nanodrop. The cDNA was synthesized in a 50-μl- reaction volume with 1μg of total RNA and MMLV reverse transcriptase (RT) according to the manufacturer’s instruction (Invitrogen, Carlsbad, USA). Quantitative real-time PCR was per-

formed using an iCycler Thermal Cycler (Bio-Rad, Segrate, Italy). 2-μl cDNA were amplified in 50-μl reactions using Platinum Supermix UDG (Invitrogen, Carlsbad, USA), 200 nM of each primer, 10 nM fluorescein (Bio-Rad, Segrate, Italy) and Sybr Green. After an initial denaturation

step at 94˚C for 10 min, temperature cycling was initiated. Each cycle consisted of 94˚C for 15s,

55–59˚C for 30s and 60˚C for 30s, the fluorescence being read at the end of this step. All the

primers used were purchased from Invitrogen, Carlsbad, USA and reported in Table 1.

To evaluate the quality of product of real-time PCR assays, melting curve analysis was per-

formed after each assay (data not shown). Relative expression was determined using the

“delta-CT method” with GAPDH as reference gene[29].

Flow cytometry

Flow cytometry analysis of Peripheral Blood Mononuclear Cells (PBMCs) collected at different

time intervals were performed for each sample. In particular, one of the two samples from

each experimental set and for each time (Fig 1B) was destined to flow cytometry. Cells from

each sample were centrifuged and after removing cell culture medium, were resuspended in

freezing medium (10% DMSO in 90% FCS) and subsequently stored at -80˚C and they were

left until staining.

Cell viability assay

Before the experiment, Trypan blue exclusion test was made, as isolation laboratory “routine”

test, in order to assess cell viability. This dye exclusion test is used to determine the number of

Table 1. Primers used in the study.

GENE FORWARD REVERSE

IL-2 CAGGATGCAACTCCTGTCTTG ATGCTCCAGTTGTAGCTGTGT

IL-2 RA TTCTCAGCCGCTTCTGACTG CCTGACATTGCCTCATGGGT

GAPDH CAGCCTCAAGATCATCAGCA TGTGGTCATGAGTCCTTCCA

https://doi.org/10.1371/journal.pone.0200128.t001

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 6 / 16

viable cells present in a cell suspension. Cell suspension is simply mixed with dye and then

visually examined to determine whether cells take up or exclude dye, so that a viable cell will

have a clear cytoplasm whereas a nonviable cell will have a blue cytoplasm.

Moreover, after cells thawing, we stained with live/dead cell marker 7-aminoactinomicyn-

D (7AAD, from Becton Dickinson (BD), San Jose, CA, USA) in the presence of Annexin V,

which evaluates PBMCs apoptosis. Then cells were analyzed using flow cytometer FACS CAN-

TOII (BD Biosciences) and, in the "gating" strategy, the non-colored cells with either 7AAD

(dead) or with Annexin V (apoptotic) were considered alive, by exclusion. A total of 30.000

events for each sample were acquired and data were analyzed using the Diva 6.2 software (Bec-

ton-Dickinson).

Protein expression analysis

Live cells were quickly thawed in water at 37˚ C before staining and washed once in phosphate

buffer saline (PBS) at 37˚ C inside thermostatic room. For each sample, 2×10^6 cells were added with the mix of antibodies in a 100μl final volume of FACS flow buffer, for the staining, and incubated for 30 min in the dark. After staining, samples were washed adding 2mL of FACS flow

solution, centrifuging for 10 min at 1200 rpm at 37˚C and discarded the supernatant by inver-

sion. Then they were resuspended in 300 μl of FACS Flow buffer and the samples were ready for acquisition in flow cytometry. No single T cells were tested but PBMC, a mixture of immune

cells in order to maintain intact the conditions of physiological interaction between the immune

cells. CD3, CD4, CD8 and CD14 were not the target of our study, but they have been used only

in the population isolation T-cell gating strategy in FCS, but they were not analyzed. Stained

cells, after washing, were analyzed on a FACS CANTOII (Becton-Dickinson) flow cytometer; a

total of 10.000 events for each sample were acquired and the data were analyzed using the Diva

6.2 software (Becton-Dickinson). Unstained cells underwent staining controls as well.

The chemicals used in this study came from the following sources: mAb CD25-phycoery-

thrin-cyanine (PE-Cy7) was used to detect IL2Rα on the membrane protein. To determine the phenotype of cellular subpopulations of PBMCs, CD3-fluorescein iso-

thiocyanate (FITC), CD14-phycoerythrin (PE), CD4-alloficocyanine (APC), D8-alloficocya-

nin-7 (APC-Cy7) were used. 7-Aminoactinomycyn-D (7AAD), BD (Becton Dickinson

Biosciences, San Jose, CA, USA) and Annexin V-FITC were used by Life Technologies (Grand

Island, NY, USA) for apoptosis analysis. In addition, Fetal Calf Serum (FCS) and Dimethyl

sulfoxide (DMSO) were from Gibco Life Technologies (Grand Island, NY, USA) as long as

they were purchased. All buffers and other solutions were prepared from analytical grade

chemicals available locally.

Flow cytometry analysis was performed by means of a FACSCANTOII (Becton Dickinson,

San Jose, CA, USA), flow cytometer equipped with a three-laser excitation system.

Statistical analysis

Comparisons of outcome data during time were performed. The statistical analysis of the data

was performed by using the Graph Pad Prism 5 software. For this study, descriptive analyses

included the computation of means, standard deviation (SD) and paired Student’ t test to eval-

uate the distribution and homogeneity of variance of each group at different times of observa-

tion and subsequent Wilcoxon test to evaluate the variant for two independent groups. Tests

and all results p<0.05 have been considered statistically significant.

Results

In this study three independent experiments for each of three donors were performed.

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 7 / 16

The data shown in this paper are consistent with three analogous experiments.

In the scheme of Fig 1 is shown the layout of a single experiment.

Effects of REAC-RGN-S treatment on cells apoptosis

REAC-RGN-S treatment had no toxic effect on Peripheral Blood Mononuclear Cells

(PBMCs). In general, in the percentage values of graphs C and D (Fig 2), we can observe that

REAC treatment influences positively the cells exposed to simulated microgravity, reducing

apoptosis compared to the untreated samples in simulated microgravity.

It is important to note that REAC pre-treatment prevents the apoptotic effect of simulated

microgravity even at 2h, as shown in the comparison between REAC+RPM and noREAC

+RPM (p <0.01). This difference is not observed in the comparison between REAC+GC and

noREAC+GC at 2h. (D) The graph shows the total apoptosis of cells post-treated with REAC

or untreated, and previously exposed to RPM (blue bars) or left to 1g (GC) (green bars) at dif- ferent experimental time (2–4–12 h). With lowercase letters the significance ratios are indi-

cated respectively between RPM+REAC (a), GC+REAC (b), RPM +noREAC (c) and GC+

Fig 2. Morphology of PBMCs not activated and activated and subjected to simulated microgravity and analysis of REAC RGN-S treatment effect on cell death

programming. (A) PBMCs not treated with mitogen, simulated microgravity exposure for 12h; (B) The cells show typical activation clusters of mitogenic treatment,

exposed to simulated microgravity (scale bar represents 100 μm). (C-D) Apoptosis analysis in pre- and post-REAC treated cells and in noREAC treated cells, in simulated RPM microgravity conditions or in Ground Control (GC), at different experimental time (2-4-12 h). (C) The graph shows the total apoptosis of cells post-

treated with REAC or untreated, and subsequently exposed to RPM (blue bars) or left to 1g (GC) (green bars) at different experimental time (2-4-12 h). With lowercase letters the significance ratios are indicated respectively between REAC+RPM (a), REAC+GC (b), noREAC+RPM (c) and noREAC+GC (d). In particular, at

experimental times of 4 h and 12 h apoptosis is significantly lower in REAC+RPM compared both to noREAC+RPM (4h p <0.001; 12h p <0.01) and noREAC+GC (4h

p <0.001).

https://doi.org/10.1371/journal.pone.0200128.g002

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 8 / 16

noREAC (d). In post-treatment, the effect of REAC is more evident, especially in the samples

exposed to microgravity in comparison to Ground Control. The difference between RPM+

REAC and RPM+noREAC is statistically significant (2h p <0.001; 12h p<0.0001). In RPM+

REAC sample, apoptotic cells decrease about 20% at 12 h, compared to RPM+noREAC. In

samples left at 1g, no difference is observed between REAC or noREAC post-treated cells. This show that REAC is more effective where there is a insult damage. In the apoptosis plots, the

data describe the total cells in apoptosis, with mean ± SD (with n = 3) �p <0.01, ��p <0.001, ���p <0.0001, compared all against all. The data were analyzed by DIVA 6.1 software (BD).

Effect of REAC RGN-S on IL2Rα and IL2 gene expression of cells pre- treated before exposition to simulated microgravity model (RPM) or post-

treated after exposition to RPM

REAC-RGN-S affects IL2Rα and IL 2 gene expression. Figs 3 and 4 show the effect of REAC-RGN-S treatment on the mRNA levels of both IL2Rα (Fig 3) and IL2 (Fig 4).

Fig 3. Quantitative real-time qPCR: REAC/microgravity. (A) IL2Rα gene expression at different time (2-4-12h) of cells pre-treated with REAC before exposition to RPM simulated microgravity (REAC+RPM) for 2-4-12h in comparison to noREAC treated cells before exposition to RPM simulated microgravity (noREAC+RPM); (B)

REAC pre-treated cells subsequently kept for 2-4-12h at 1g gravity conditions (REAC+GC), compared to 1g gravity conditions not REAC pre-treated (noREAC+GC). (C) IL2Rα gene expression at different time (2-4-12h) of REAC post-treatment after exposition to RPM simulated microgravity (RPM+REAC) for 2-4-12h, compared to REAC untreated cells after exposition to RPM simulated microgravity (RPM+noREAC). (D) REAC post-treated cells after exposure to 1g gravity conditions (GC +REAC) compared to 1g gravity conditions without REAC post-treated (GC+noREAC). To evaluate the quality of product of real-time PCR assays, melting curve analysis was performed after each assay (data not shown). Relative expression was determined using the “delta-CT method” with GAPDH. Data are expressed as

mean ± S.D. of independent triplicate samples for each treatment.

https://doi.org/10.1371/journal.pone.0200128.g003

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 9 / 16

Effect of REAC treatment on IL2Rα gene expression As regards REAC pre-treatment (Fig 3A), we observed that the onset of genetic expression of

the IL-2Rα chain in Con A-activated cells begins at a lower level approximately 2 hours after exposure to the mitogen; up to 4 hours, the amount of mRNA remained unchanged and there

was no significant difference in the different experimental conditions. Starting from 12 hours,

IL-2Rα mRNA levels of REAC treated cells followed by RPM simulated microgravity (REAC+ RPM) were increased compared to untreated cells (noREAC+RPM) (p< 0.001). It was also

observed that treated samples at 1g (REAC+GC) (Fig 3B) showed IL-2Rα gene expression sta- tistically significant higher than noREAC+GC sample at all experimental time (2h p<0,01; 4h

p<0.001 and 12h p<0.01). We conclude that REAC pre-treatment induces an increase in IL-

2Rα gene expression in cells subsequently cultured under simulated microgravity at 12 hours. In fact, REAC pre-treatment seems to improve the adaptation to simulated microgravity in

samples exposed to RPM (REAC+RPM) compared to untreated samples also exposed to simu-

lated microgravity (noREAC+RPM) (p <0.001), in early experimental time (2, 4 h). As regards

the REAC post-treated subsets of cells (Fig 3C), we observed that cells exposed to simulated

Fig 4. Quantitative real-time qPCR: REAC/microgravity. (A) IL2 gene expression at different time (2-4-12h) of cells pre-treated with REAC before exposition to RPM

simulated microgravity (REAC+RPM) for 2-4-12h in comparison to noREAC treated cells before exposition to RPM simulated microgravity (noREAC+RPM); (B)

REAC pre-treated cells subsequently kept for 2-4-12h at 1g gravity conditions (REAC+GC), compared to 1g gravity conditions not REAC pre-treated (noREAC+GC). (C) IL2 gene expression at different time (2-4-12h) of REAC post-treatment after exposition to RPM simulated microgravity (RPM+REAC) for 2-4-12h as compared to

REAC untreated cells after exposition to RPM simulated microgravity (RPM+noREAC). (D) REAC post-treated cells after exposure to 1g gravity conditions (GC +REAC) compared to 1g gravity conditions without REAC post-treated (GC+noREAC). To evaluate the quality of product of real-time PCR assays, melting curve analysis was performed after each assay (data not shown). Relative expression was determined using the “delta-CT method” with GAPDH. Data are expressed as

mean ± S.D. of independent triplicate samples for each treatment.

https://doi.org/10.1371/journal.pone.0200128.g004

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 10 / 16

microgravity and subsequently REAC treated (RPM+REAC) showed an increase of IL-2Rα mRNA levels starting from 4 hours up to 12 hours in comparison with untreated samples that

show a higher level of mRNA at the earliest experimental 2 hours activation time but the lowest

at 12 hours (RPM+noREAC) (p< 0,0000001). (Fig 3D) No difference was observed between

samples kept at 1g gravity and then REAC treated (GC+REAC) or untreated (GC+noREAC)

at 12h, whereas we observed a significative difference at 4h (p<0.001). The same trend was

also observed with respect to IL 2 post- treated samples (Fig 4C and 4D), showing that gene

expression is not influenced by REAC treatment in samples before kept at 1g gravity condi-

tions during their activation. It can be deduced that REAC treatment is more effective in cells

subjected to a stress during their activation, as altered gravitational environment, (RPM+

REAC) compared to untreated cells (RPM+noREAC).

Effect of REAC treatment on IL2 gene expression

In another set of experiments, we evaluated the effect of REAC-RGN-S treatment after culturing

cells in simulated microgravity conditions for 2, 4 and 12 hours (REAC-post treatment in Fig 4C

and 4D. Fig 4A and 4B shows the effect of REAC treatment on IL-2 gene expression in cells

REAC treated before exposition to simulated microgravity (RPM) or normal gravity condition

(GC). REAC pre-treated cells subsequently exposed to simulated microgravity (REAC+RPM)

exhibited a higher level of IL-2 mRNA at 4 hours of culture in simulated microgravity, being still

higher also at 4,12 hours of simulated microgravity, as compared to the correspondent REAC

untreated cells (noREAC+RPM) (p<0.01). Also in this case, as expected according to our previ-

ous reports, IL-2 mRNA levels are decreased in RPM untreated cells (noREAC+RPM) in later

experimental time (4,12h). As regards REAC post-treatment effect, Fig 4C and 4D shows IL-2

gene expression analysis on cells cultured in different simulated microgravity conditions and

then treated with REAC technology. The genetic expression of the IL-2 begins at a lower level

approximately 2 hours after exposure to the mitogen; up to 4 hours, the amount of mRNA

remained unchanged also there was significant difference in the different experimental condi-

tions compared to untreated sample (RPM+noREAC). Starting from 4 hours and much more at

12 hours, IL-2 mRNA levels of REAC treated cells after RPM simulated microgravity exposure

(RPM+REAC) was highly increased compared to untreated cells (RPM+noREAC) (p< 0.001).

On the other hand, we observed that the difference between REAC post-treated and untreated

cells cultured in normal gravity condition (GC+REAC) (GC+noREAC) decrease during the

time course analyzed from 2 at 12h where the conditions REAC untreated (GC+noREAC) were

a few increases than GC+REAC (P<0.05). Considering these results, we can conclude that

REAC treatment can significantly modify both IL-2 and IL-2Rα gene expression and rescue the inhibitory effect induced by microgravity, in manner time dependent.

Effects of REAC treatment on IL2Rα protein expression in cells REAC pre- treated before exposition to RPM simulated microgravity

REAC pre-treated cells (REAC+RPM) at different time (2-4-12h) before exposition to RPM

simulated microgravity for 2-4-12h demonstrated an evident increase of the cell percentage

expressing IL2Rα protein compared to respective untreated cells (noREAC+RPM) (Fig 5A). The benefit of the REAC pre-treatment can be observed already between 2h-4h and

increases after 4h (2.24±0.25 vs. 0.9±0.2, p<0.001), in particular up to 12h (35. 57±1.5 vs. 24.88 ±1.2, p< 0.001), which is the "end point" of the experiment when Peripheral Blood Mononu- clear Cells (PBMCs) have a sudden increase in the expression of IL-2Rα. REAC pre-treatment effect increased after 4h, namely the moment of increased expression of cell membrane mark-

ers induced in response to the mitogenic stimulus of activation. It can be stated that REAC

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 11 / 16

pre-treatment for 2-4-12h has a better effect on cellular system subsequently exposed to an envi-

ronmental stress such as the simulated microgravity (REAC+RPM), compared to untreated one

(noREAC+RPM). Yet, REAC can also improve the performance of cells subsequently kept for

2-4-12h at 1g gravity conditions at the time of expression of the IL2Rα (REAC+GC), in compar- ison with respective ground control REAC untreated cells (noREAC+GC). In particular, we can

observe a significant increase of IL2Rα expression percentage already after 4h (4.32±0.26 vs. 1.3±0.2, p<0.001). Moreover, in the REAC untreated samples (no REAC+GC and noREAC+ RPM), that were our controls in the processing, cell expression of IL2Rα showed no differences between 2 and 4h, it starts to increase after 4 hours (1.3±0.2 vs. 0.9±0.2, p<0.01), grows up to 12h (31.87±1.24 vs. 24.88±1.23, p< 0.001) and it is greater at 1g conditions (noREAC+GC), if compared to RPM simulated microgravity (noREAC+RPM). These results are in agreement

with our previous data[17, 18, 24, 30]. Our results demonstrated that REAC pre-treatment has a

better effect on cellular systems subjected to environmental stress, such as simulated micrograv-

ity, though it can also improve the performance of not stressed systems.

Effects of REAC treatment on IL2Rα protein expression on cells exposed to RPM simulated microgravity model and post-treated with REAC

The REAC post-treatment occurs in the cellular system already activated for the clonal prolif-

eration on RPM simulated microgravity or at 1g gravity conditions after different times, 2-4- 12h (Fig 5C). As a whole, all samples showed no differences on IL2Rα protein expression between 2h and 4h, while IL-2Rα receptor expression started to increase from 4 hours up to 12 hours. In particular, it has been observed that cells exposed to RPM simulated microgravity

before REAC treatment (RPM+REAC) showed a greater expression of IL2Rα at 12h in com- parison with respective untreated cells after exposition to RPM (RPM+noREAC) (16,33±0,41 vs. 10.6±0.53, P < 0.0001). It can be stated that if the cells were subjected to a stress during their activation, as altered gravitational environment (RPM+REAC), the effect of REAC treat-

ment is positive in respect of the activation parameters, such as IL2Rα, which is one of the first molecules expressed during the Peripheral Blood Mononuclear Cells activation, when com-

pared to REAC untreated cells (RPM+noREAC). (Fig 5D) On the other hand, if the cellular

system does not undergo any stress following the activation stimulus (GC+REAC), REAC

treatment shows to be ineffective if compared to REAC untreated ground control (GC+ noR-

EAC) (21.28±0.37 vs. 25.63±0.5, p< 0.001).

Discussion

Immunosuppression and weakened T cell immune response during spaceflight are a major

barrier to safe, long-term human space habitation and travel[25]. All this can be counteracted

by a good maintenance and modulation of T cell polarity[31]. It is well known that in vivo acti-

vation of naive or resting T cells initiated by the binding of a foreign antigen, can be mimicked

in vitro by the use of several agents or by concanavalin A (Con A) alone, as activator of T cells,

in Peripheral Blood Mononuclear Cells[28]. Upon exposure to mitogen Con A in culture,

PBMCs can be selectively activated polyclonally to proliferate and to produce a number of

lymphokines. In particular, when exposed to Con A for at least 2 h, they will transcribe and

secrete interleukin-2 (IL-2). The regulation of the transcription of the IL-2 gene is based on

complex and still obscure mechanisms involving transcription factors such as NFAT, AP-1,

NF-kB and others, and it is object of extensive studies, extensively reviewed[32, 33]. The pro-

tein expression of immediate-early genes, within 30 min of activation, in turn activates IL-2

expression[34, 35]. The expression of IL-2 induces synthesis of IL-2Rα; both are essential for efficient immune response, T cell proliferation and progression from the G0 to G1 phase[36,

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 12 / 16

37]. The low gravity environment of spaceflight has proven to lead to impaired T cell activation

and profoundly down regulated transcription[30] of immediate early genes. These results

demonstrated and confirmed that reduced gravity can perturb molecular signals leading to

impaired immune function. DNA array analysis of T cells subjected to RPM microgravity

revealed an alteration of several signal modules, in particular NF-kB and MAPK-signaling [17,

33]. A number of potential, gravity-sensitive mechanisms are implicated in the impairment of

T cell activation and proliferation in spaceflight, but they are at least in part a result of

decreased IL-2 and IL-2Rα induction. We examined gene expression and synthesis of IL-2 as well as IL-2Rα subunits at early time points following activation and characterized the global gene expression of activated T cells in micro-gravity after 4h of activation[17]. This time-point

was determined to be the peak for IL-2 expression post activation. In fact, significant up regu-

lation of IL-2 and IL-2Rα was observed during T cell activation by 4h, while there was signifi- cant inhibition in micro-gravity[17, 18]. We also studied the time course of gene expression

after T cell activation and the pattern of how micro-gravity inhibits the first wave of immediate

early genes with downstream effects on a wider range of secondary response genes. Among

genes found to be down-regulated significantly in simulated micro-gravity, compared with 1g, which became detectable at 4h of activation, are included IL-2 IL-2Rα[30]. The goal of the

Fig 5. IL2Rα protein expression by Flow cytometric analysis. (A) IL2Rα gene expression at different time (2-4-12h) of cells pre-treated with REAC before exposition to RPM simulated microgravity (REAC+RPM) for 2-4-12h in comparison to no-REAC-treated cells before exposition to RPM simulated microgravity (noREAC+RPM);

(B) REAC pre-treated cells subsequently kept for 2-4-12h at 1g gravity conditions (REAC+GC), compared to 1g gravity conditions not REAC pre-treated (noREAC+ GC). (C) IL2Rα cell expression percentage at different time (2-4-12h) of REAC post-treatment after exposition to RPM simulated microgravity (RPM+REAC) for 2-4- 12h as compared to REAC untreated cells after exposition to RPM simulated microgravity (RPM+noREAC), (D) REAC post-treated cells after exposure to 1g gravity conditions (GC+REAC) compared to 1g gravity conditions without REAC post-treated (GC+noREAC). Data are expressed as mean ± S.D. (n = 3, �p<0.01; ��p<0.001; ���p<0.0001) of independent triplicate samples for each treatment.

https://doi.org/10.1371/journal.pone.0200128.g005

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 13 / 16

present experiments was to verify if REAC-RGN-S treatment could be an effective counter-

measure against the loss of T cell activity in space. Based on the results of this paper, the most

important conclusion we can draw is that if T cells suffered a stress, such as weightlessness,

during their activation, the effect of REAC-RGN-S treatment is positive in respect of the acti-

vation parameters. We can hypothesize that REAC acts as a T cell polarity optimizer[7], remo-

dulating the cell signal transduction pathways altered by reduced gravity, probably acting on

gravity-sensitive cellular targets, where the lipid-raft-associated membrane-proximal signalo-

some complex is located[33]. Acting on ion fluxes at molecular level, REAC is likely to affect

the release of intracellular stored calcium in the endoplasmic reticulum, involved in the activa-

tion of the protein kinase C (PKC). REAC effect on stored calcium is likely to be involved also

in the regulation of lymphocyte locomotory activity, which under microgravity culture condi-

tions is inhibited, as calcium signal was shown to be a directionality marker for the orientation

of neutrophils locomotion[38, 39]. The extensive research on immune cells in culture under

different gravity conditions and treated with REAC technology could contribute significantly

to the understanding of T cell growth responsiveness in space and may aid in the individuation

of a potential countermeasure to win the impact of weightlessness on the alteration of the

immune system experienced by humans during long duration missions.

Supporting information

S1 Data. Data collected in the study to assess the effect of REAC treatment on IL2Rα and IL2 gene expression in cells exposed to RPM low gravity model.

(XLSX)

Acknowledgments

We wish to thank Dr. Alessandra Cappelli of Rinaldi Fontani Institute & Foundation, for her

precious collaboration.

Author Contributions

Conceptualization: Salvatore Rinaldi, Maria Antonia Meloni, Vania Fontani.

Data curation: Maria Antonia Meloni, Grazia Galleri, Margherita Maioli, Gianfranco Pigliaru,

Giulia Cugia, Sara Santaniello, Alessandro Castagna.

Formal analysis: Salvatore Rinaldi.

Investigation: Salvatore Rinaldi, Maria Antonia Meloni, Grazia Galleri, Margherita Maioli,

Gianfranco Pigliaru, Giulia Cugia, Sara Santaniello, Alessandro Castagna, Vania Fontani.

Methodology: Salvatore Rinaldi, Maria Antonia Meloni, Grazia Galleri, Margherita Maioli,

Vania Fontani.

Project administration: Salvatore Rinaldi, Vania Fontani.

Visualization: Gianfranco Pigliaru, Giulia Cugia, Sara Santaniello, Alessandro Castagna.

Writing – original draft: Salvatore Rinaldi, Maria Antonia Meloni, Grazia Galleri, Margherita

Maioli, Vania Fontani.

Writing – review & editing: Salvatore Rinaldi, Vania Fontani.

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 14 / 16

References 1. Maioli M, Rinaldi S, Santaniello S, Castagna A, Pigliaru G, Gualini S, et al. Radiofrequency energy loop

primes cardiac, neuronal, and skeletal muscle differentiation in mouse embryonic stem cells: a new tool

for improving tissue regeneration. Cell Transplant. 2012; 21(6):1225–33. Epub 2011/10/07. https://doi.

org/10.3727/096368911X600966 PMID: 21975035.

2. Maioli M, Rinaldi S, Santaniello S, Castagna A, Pigliaru G, Gualini S, et al. Radio electric conveyed

fields directly reprogram human dermal skin fibroblasts toward cardiac, neuronal, and skeletal muscle-

like lineages. Cell Transplant. 2013; 22(7):1227–35. Epub 2012/10/13. https://doi.org/10.3727/

096368912X657297 PMID: 23057961.

3. Maioli M, Rinaldi S, Santaniello S, Castagna A, Pigliaru G, Delitala A, et al. Radioelectric asymmetric

conveyed fields and human adipose-derived stem cells obtained with a nonenzymatic method and

device: a novel approach to multipotency. Cell Transplant. 2014; 23(12):1489–500. Epub 2013/09/21.

https://doi.org/10.3727/096368913X672037 PMID: 24044359.

4. Rinaldi S, Maioli M, Santaniello S, Castagna A, Pigliaru G, Gualini S, et al. Regenerative treatment

using a radioelectric asymmetric conveyor as a novel tool in antiaging medicine: an in vitro beta-galacto-

sidase study. Clin Interv Aging. 2012; 7:191–4. Epub 2012/07/19. https://doi.org/10.2147/CIA.S33312

PMID: 22807628; PubMed Central PMCID: PMC3396051.

5. Maioli M, Rinaldi S, Santaniello S, Castagna A, Pigliaru G, Delitala A, et al. Anti-senescence efficacy of

radio-electric asymmetric conveyer technology. Age (Dordr). 2013. Epub 2013/05/09. https://doi.org/

10.1007/s11357-013-9537-8 PMID: 23653328.

6. Rinaldi S, Maioli M, Pigliaru G, Castagna A, Santaniello S, Basoli V, et al. Stem cell senescence. Effects

of REAC technology on telomerase-independent and telomerase-dependent pathways. Sci Rep. 2014;

4:6373. Epub 2014/09/17. https://doi.org/10.1038/srep06373 PMID: 25224681.

7. Maioli M, Rinaldi S, Pigliaru G, Santaniello S, Basoli V, Castagna A, et al. REAC technology and hya-

luron synthase 2, an interesting network to slow down stem cell senescence. Sci Rep. 2016; 6:28682.

Epub 2016/06/25. https://doi.org/10.1038/srep28682 PMID: 27339908.

8. Shinde V, Brungs S, Henry M, Wegener L, Nemade H, Rotshteyn T, et al. Simulated Microgravity Modu-

lates Differentiation Processes of Embryonic Stem Cells. Cellular Physiology and Biochemistry. 2016;

38(4):1483–99. https://doi.org/10.1159/000443090 PMID: 27035921

9. Cogoli A, Tschopp A. Lymphocyte reactivity during spaceflight. Immunol Today. 1985; 6(1):1–4. Epub

1985/01/01. https://doi.org/10.1016/0167-5699(85)90151-3 PMID: 11539785.

10. Cogoli-Greuter M. Influence of microgravity on mitogen binding, motility and cytoskeleton patterns of T

lymphocytes and jurkat cells-experiments on sounding rockets1998. 27–39 p.

11. Cogoli-Greuter M, Cogoli A, Spano A, Sciola L, Pippia P. Influence of Microgravity on Mitogen Binding

and Cytoskeleton in Jurkat Cells—Experiment on Maxus 21997.

12. Cogoli-Greuter M, Lovis P, Vadrucci S. Signal transduction in T cells: an overview. J Gravit Physiol.

2004; 11(2):P53–6. Epub 2005/10/20. PMID: 16231454.

13. Tauber S, Hauschild S, Paulsen K, Gutewort A, Raig C, Hurlimann E, et al. Signal transduction in pri-

mary human T lymphocytes in altered gravity during parabolic flight and clinostat experiments. Cell Phy-

siol Biochem. 2015; 35(3):1034–51. Epub 2015/02/11. https://doi.org/10.1159/000373930 PMID:

25661802.

14. Hauschild S, Tauber S, Lauber B, Thiel CS, Layer LE, Ullrich O. T cell regulation in microgravity–The

current knowledge from in vitro experiments conducted in space, parabolic flights and ground-based

facilities. Acta Astronautica. 2014; 104(1):365–77. https://doi.org/10.1016/j.actaastro.2014.05.019.

15. Meloni MA, Galleri G, Pippia P, Cogoli-Greuter M. Cytoskeleton changes and impaired motility of mono-

cytes at modelled low gravity. Protoplasma. 2006; 229(2):243. https://doi.org/10.1007/s00709-006-

0210-2 PMID: 17180508

16. Hatton JP, Gaubert F, Cazenave JP, Schmitt D. Microgravity modifies protein kinase C isoform translo-

cation in the human monocytic cell line U937 and human peripheral blood T-cells. J Cell Biochem.

2002; 87(1):39–50. Epub 2002/09/05. https://doi.org/10.1002/jcb.10273 PMID: 12210720.

17. Boonyaratanakornkit JB, Cogoli A, Li CF, Schopper T, Pippia P, Galleri G, et al. Key gravity-sensitive

signaling pathways drive T cell activation. Faseb J. 2005; 19(14):2020–2. Epub 2005/10/08. https://doi.

org/10.1096/fj.05-3778fje PMID: 16210397.

18. Hughes-Fulford M, Sugano E, Schopper T, Li C-F, Boonyaratanakornkit JB, Cogoli A. Early immune

response and regulation of IL-2 receptor subunits. Cell Signal. 2005; 17(9):1111–24. https://doi.org/10.

1016/j.cellsig.2004.12.016 PMID: 15993752

19. Pietsch J, Bauer J, Egli M, Infanger M, Wise P, Ulbrich C, et al. The effects of weightlessness on the

human organism and mammalian cells. Curr Mol Med. 2011; 11(5):350–64. Epub 2011/05/17. PMID:

21568935.

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 15 / 16

20. Cogoli A. The effect of hypogravity and hypergravity on cells of the immune system. J Leukoc Biol.

1993; 54(3):259–68. Epub 1993/09/01. PMID: 8371056.

21. Hammond TG, Lewis FC, Goodwin TJ, Linnehan RM, Wolf DA, Hire KP, et al. Gene expression in

space. Nat Med. 1999; 5(4):359. Epub 1999/04/15. https://doi.org/10.1038/7331 PMID: 10202906.

22. Schwarzenberg M, Pippia P, Meloni MA, Cossu G, Cogoli-Greuter M, Cogoli A. Signal transduction in T

lymphocytes—a comparison of the data from space, the free fall machine and the random positioning

machine. Adv Space Res. 1999; 24(6):793–800. Epub 2001/09/07. PMID: 11542624.

23. Luo H, Wang C, Feng M, Zhao Y. Microgravity inhibits resting T cell immunity in an exposure time-

dependent manner. Int J Med Sci. 2014; 11(1):87–96. Epub 2014/01/08. https://doi.org/10.7150/ijms.

7651 PMID: 24396290; PubMed Central PMCID: PMCPMC3880995.

24. Walther I, Pippia P, Meloni MA, Turrini F, Mannu F, Cogoli A. Simulated microgravity inhibits the genetic

expression of interleukin-2 and its receptor in mitogen-activated T lymphocytes. FEBS Lett. 1998; 436

(1):115–8. Epub 1998/10/15. PMID: 9771904.

25. Crucian B, Stowe RP, Mehta S, Quiriarte H, Pierson D, Sams C. Alterations in adaptive immunity persist

during long-duration spaceflight. Npj Microgravity. 2015; 1:15013. https://doi.org/10.1038/npjmgrav.

2015.13 PMID: 28725716

26. Hoson T, Kamisaka S, Masuda Y, Yamashita M. Changes in plant growth processes under microgravity

conditions simulated by a three-dimensional clinostat. The botanical magazine = Shokubutsu-gaku-zas-

shi. 1992; 105(1):53–70. https://doi.org/10.1007/bf02489403

27. Boyum A. Isolation of lymphocytes, granulocytes and macrophages. Scand J Immunol. 1976;Suppl

5:9–15. Epub 1976/06/01. PMID: 1052391.

28. Dwyer JM, Johnson C. The use of concanavalin A to study the immunoregulation of human T cells. Clin-

ical and Experimental Immunology. 1981; 46(2):237–49. PubMed PMID: PMC1536405. PMID:

6461456

29. Maioli M, Santaniello S, Montella A, Bandiera P, Cantoni S, Cavallini C, et al. Hyaluronan esters drive

Smad gene expression and signaling enhancing cardiogenesis in mouse embryonic and human mesen-

chymal stem cells. PLoS One. 2010; 5(11):e15151. Epub 2010/12/15. https://doi.org/10.1371/journal.

pone.0015151 PMID: 21152044; PubMed Central PMCID: PMC2994904.

30. Chang TT, Walther I, Li C-F, Boonyaratanakornkit J, Galleri G, Meloni MA, et al. The Rel/NF-κB path- way and transcription of immediate early genes in T cell activation are inhibited by microgravity. J Leu-

koc Biol. 2012; 92(6):1133–45. https://doi.org/10.1189/jlb.0312157 PMID: 22750545

31. Krummel MF, Macara I. Maintenance and modulation of T cell polarity. Nat Immunol. 2006; 7(11):1143–

9. https://doi.org/10.1038/ni1404 PMID: 17053799

32. Weil R, Israel A. Deciphering the pathway from the TCR to NF-kappaB. Cell Death Differ. 2006; 13

(5):826–33. Epub 2006/01/28. https://doi.org/10.1038/sj.cdd.4401856 PMID: 16439988.

33. Ullrich O, Huber K, Lang K. Signal transduction in cells of the immune system in microgravity. Cell Com-

mun Signal. 2008; 6:9. Epub 2008/10/30. https://doi.org/10.1186/1478-811X-6-9 PMID: 18957108;

PubMed Central PMCID: PMC2583999.

34. Crabtree GR. Contingent genetic regulatory events in T lymphocyte activation. Science. 1989; 243

(4889):355–61. Epub 1989/01/20. PMID: 2783497.

35. Foletta VC, Segal DH, Cohen DR. Transcriptional regulation in the immune system: all roads lead to

AP-1. J Leukoc Biol. 1998; 63(2):139–52. PMID: 9468273

36. Nelson BH, Willerford DM. Biology of the interleukin-2 receptor. Adv Immunol. 1998; 70:1–81. Epub

1998/10/02. PMID: 9755337.

37. Modiano JF, Mayor J, Ball C, Chitko-McKown CG, Sakata N, Domenico-Hahn J, et al. Quantitative and

qualitative signals determine T-cell cycle entry and progression. Cell Immunol. 1999; 197(1):19–29.

Epub 1999/11/11. https://doi.org/10.1006/cimm.1999.1563 PMID: 10555992.

38. Lang K, Hatt H, Niggemann B, Zaenker KS, Entschladen F. A novel function for chemokines: downregu-

lation of neutrophil migration. Scand J Immunol. 2003; 57(4):350–61. PMID: 12662298.

39. Entschladen F, Niggemann B, Zanker KS, Friedl P. Differential requirement of protein tyrosine kinases

and protein kinase C in the regulation of T cell locomotion in three-dimensional collagen matrices. J

Immunol. 1997; 159(7):3203–10. PMID: 9317118.

REAC and loss of T cell responsiveness in microgravity

PLOS ONE | https://doi.org/10.1371/journal.pone.0200128 July 6, 2018 16 / 16

Copyright of PLoS ONE is the property of Public Library of Science and its content may not be copied or emailed to multiple sites or posted to a listserv without the copyright holder's express written permission. However, users may print, download, or email articles for individual use.