15-20 min presentation from article
RESEARCH ARTICLE Open Access
Development of reverse-transcription loop- mediated isothermal amplification assay for rapid detection and differentiation of dengue virus serotypes 1–4 Sheng-feng Hu1,2, Miao Li1,2, Lan-lan Zhong1,2, Shi-miao Lu1,2, Ze-xia Liu1,2, Jie-ying Pu1,2, Jin-sheng Wen3*
and Xi Huang1,2,3*
Abstract
Background: Dengue virus (DENV), the most widely prevalent arbovirus, continues to be a threat to human health in the tropics and subtropics. Early and rapid detection of DENV infection during the acute phase of illness is crucial for proper clinical patient management and preventing the spread of infection. The aim of the current study was to develop a specific, sensitive, and robust reverse transcriptase loop-mediated isothermal amplification (RT-LAMP) assay for detection and differentiation of DENV1-4 serotypes.
Results: The method detection primers, which were designed to target the different DENV serotypes, were identified by inspection of multiple sequence alignments of the non-structural protein (NS) 2A of DENV1, NS4B of DENV2, NS4A of DENV3 and the 3′ untranslated region of the NS protein of DENV4. No cross-reactions of the four serotypes were observed during the tests. The detection limits of the DENV1-4-specific RT-LAMP assays were approximately 10-copy templates per reaction. The RT-LAMP assays were ten-fold more sensitive than RT-PCR or real-time PCR. The diagnostic rate was 100 % for clinical strains of DENV, and 98.9 % of the DENV-infected patients whose samples were tested were detected by RT-LAMP. Importantly, no false-positives were detected with the new equipment and methodology that was used to avoid aerosol contamination of the samples.
Conclusion: The RT-LAMP method used in our study is specific, sensitive, and suitable for further investigation as a useful alternative to the current methods used for clinical diagnosis of DENV1-4, especially in hospitals and laboratories that lack sophisticated diagnostic systems.
Keyword: Dengue virus, Dengue serotypes 1–4, Diagnostic accuracy, Reverse transcriptase loop-mediated isothermal amplification, Serotype detection
Background Dengue virus (DENV), a member of the Flaviviridae family, is the most prevalent arbovirus in more than 100 countries within tropical and subtropical regions of the world [1]. There are four distinct serotypes, described as DENV1, DENV2, DENV3, and DENV4 [2]. DENV
infection causes dengue fever, the more dangerous den- gue hemorrhagic fever and dengue shock syndrome, all of which are very contagious [3]. According to a World Health Organization report, there are 50 million DENV infections and 500,000 cases of dengue hemorrhagic fever annually, the latter requiring hospitalization [4]. In 2014, there was an outbreak of dengue fever in China and countries within Southeast Asia, with more than 50,000 DENV-infected people in southern China. DENV infections are not only a threat to human health, but also cause huge economic losses to society.
* Correspondence: wjs@wmu.edu.cn; huangxi6@mail.sysu.edu.cn 3Department of microbiology and immunology, Wenzhou, Medical University, Wenzhou, China 1Program of Immunology, Institute of Human Virology, Affiliated Guangzhou Women and Children’s Medical Center, Zhongshan School of Medicine, Sun Yat-sen University, 74 Zhongshan 2nd Road, Guangzhou 510080, China Full list of author information is available at the end of the article
© 2015 Hu et al. Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.
Hu et al. BMC Microbiology (2015) 15:265 DOI 10.1186/s12866-015-0595-1
The clinical characteristics of primary DENV do not involve bleeding or shock, and induce a life-long protect- ive immunity to the homologous serotype responsible for the infection [5]. Because of antibody-dependent enhance- ment [6], upon reinfection with a different DENV sero- type, antibodies against the virus are able to form a type of immune complex that activates the complement system resulting in immunopathologies [7], such as the pathogen- esis of dengue fever and dengue shock syndrome. Without an effective vaccine to prevent DENV infection, mul- tiple and sequential infections with DENV1-4 are to be expected for people living in regions where dengue is hyperendemic [6, 8].Therefore, rapid detection and dif- ferentiation of DENV serotypes are crucial for effective clinical diagnosis as well as for epidemiological investi- gation of this pathogen. Early and rapid detection of DENV infection during
the acute phase of illness are crucial for proper patient management and preventing the spread of infection. For microbiological diagnosis of DENV, several techniques have been developed; these include virus isolation, im- munoassays, and biochemical tests using nucleotide probes [9–11]. Virus isolation is the “gold standard” for DENV detection. However, it is laborious and time con- suming when used for routine clinical examination of patients. The presence of cross-reactive antigens shared by flaviviruses makes specific diagnosis of DENV by im- munoassay not possible in most cases. Furthermore, be- cause the antibodies produced in response to the virus do not occur at an early stage of the infection, the im- munoassay methods are not suitable for early diagnosis. Nucleic acid detection is deemed to be a timely and ef- fective method for diagnosis of DENV infection. Reverse transcriptase (RT)-PCR and real-time PCR methods have both been used widely for laboratory diagnosis be- cause of their high sensitivities and specificities [12, 13]. However, they require specialized equipment, which re- stricts the popularization of this approach [14–16]. Hence, there is great demand for a rapid, simple, con- venient, and appropriate method for use in resource- poor health clinics. Loop-mediated isothermal amplification (LAMP), de-
veloped by Notomi in 2000, can achieve fast amplifica- tion of nucleic acid using only a water bath or heating block [17]. This method is a promising tool to meet the increasing need for a fast and easily performable patho- gen detection assay [18]. LAMP can be used to deter- mine the sex of animals [19], and establish if a food has been genetically modified [20]. Reverse transcriptase LAMP (RT-LAMP), which is based on amplification of reverse-transcribed cDNA, has the same sensitivity of DNA amplification by the standard LAMP method [21]. This method has been adopted for detecting various vi- ruses [22–25], especially for detecting viruses that cause
similar symptoms in a host and share a high degree of nucleotide homology among them [15, 26, 27]. Disap- pointingly, because of its high sensitivity, RT-LAMP is easily affected by aerosol pollution thereby resulting in false-positive samples. The need to prevent aerosol gener- ation is of paramount importance when using RT-LAMP. Early reports of DENV1-4 detection by RT-LAMP in-
volved small numbers (<100) of clinical samples, use of the C-prM gene [28], serotype-specific regions of the 3′ untranslated region of the same gene [21, 29, 30], or the non-structural protein 1 (NS1) [31]. However, use of the same gene is not the best choice for all DENV1-4 geno- types because there may be high sequence identity among genotypes with the same serotype but low se- quence variability among the four serotypes; this situ- ation is relevant for the C-prM gene, its 3′-UTR [32], and NS1 [31]. The detection limits for DENV1-4 differ and the diagnostic accuracy was < 90 % because the DENV1-4 primers were limited to the same gene in earl- ier reports. Moreover, the aerosol pollution problem had not been solved in earlier reports. These deficiencies have hindered promotion of RT-LAMP for the detection of DENV. In this study, a DENV1-4-specific RT-LAMP assay
was developed and evaluated using serum from patients with DENV infections. The results showed that the RT- LAMP assay was specific, sensitive, and accurate. With new equipment and a method that avoids aerosol pollu- tion, RT-LAMP has the potential to become a useful and reliable method for clinical diagnostics of DENV, es- pecially in hospitals and laboratories that lack sophisti- cated diagnostic systems.
Results Primer design and specificity assessment of RT-LAMP for DENV1-4 The success of the RT-LAMP assay relies on the speci- ficities of the primer sets that are used. A set of primers based on the optimal regions revealed by multiple se- quence alignments (Fig. 1) was designed and used to evaluate the specificity of the DENV RT-LAMP assay; the primers are listed in Table 1. DENV1-4 was amplified successfully by the RT-LAMP
method and its amplicons were observed as ladder-like patterns on agarose gels. The sizes of the resultant digested products were in agreement with the sizes pre- dicted for DENV1-4 (Fig. 2). DNA sequencing of the digested products confirmed the specificity of the ampli- fication (data not shown). With the exception of the DENV1-4-positive RNA
samples, Japanese encephalitis virus, yellow fever virus, herpes simplex virus, and Epstein-Barr virus were all used as negative controls. Each of the samples used in this study were tested ten times and the results were
Hu et al. BMC Microbiology (2015) 15:265 Page 2 of 15
recorded. The DENV1-4 RT-LAMP primers showed high specificity by only amplifying their respective tar- gets (Figs. 3, 4, 5 and 6). No cross-reactions and false- positive or false-negative results were obtained. Simi- larly, the F3 and B3 primers used by RT-PCR shown high specificity (Fig. 7).
Sensitivity assessment of RT-LAMP for DENV1-4 The sensitivity of the RT-LAMP method for the detec- tion DENV1-4 was determined by testing 10-fold serially diluted viral genomic RNA templates with known num- bers of nucleic acid copies, and comparing the assay with those of RT-PCR and real-time PCR. As a
Fig. 1 The DENV genome and the regions of the RT-LAMP primers of DENV1-4, respectively. a, the region of the RT-LAMP primer for DENV1; b, the region of the RT-LAMP primer for DENV2; c, the region of the RT-LAMP primer for DENV3; d, the region of the RT-LAMP primer for DENV4
Table 1 The primer sequences of RT-LAMP for DENV1-4
Primers Sequence(5‘-3’)
DEN1-F3 TGTGTTCCTCCTTCTCATAATG
DENV1-B3 CAGACTCAATCCAATCGTAAGA
DENV1-FIP CATCCTGTCTGAAGCATTGGCTGGACAATTGACATGGAATGATC
DENV1-BIP CCTAGCTCTGATGGCCACTTTCTTCTCTAGATGTTAGTCTGCG
DENV1-LoopF CCAACCATGATGCATAACCTG
DENV1-LoopB ATGAGACCAATGTTCGCTGT
DENV2-F3 CACACTGGATAGCAGCTTC
DENV2-B3 CTATGTCCAGGATGTTGCTC
DENV2-FIP GGCCACCACTGTGAGGATGAGAACACCCCAAGATAACC
DENV2-BIP CAAACGAGATGGGTTTCCTGGATTGCTGGGTTGTAATGCTT
DENV2-LoopF GGCTATGACAACGTAGGTCAA
DENV2-LoopB ACGAAGAAAGATCTCGGATTGG
DENV3-F3 CCCGTCCAAGGACGTTAA
DENV3-B3 CTGCTGCGTTGTGTCATG
DENV3-FIP ACGACGGAGCTACAGGCAGAAGAAGTCAGGCCCAAA
DENV3-BIP GGGACGTAAAGCCTGGGAGCCTCTAACCACTAGTCTGCTA
DENV3-LoopF GTTTGCTCAAACCGTGGC
DENV3-LoopB AACCGTGGAAGCTGTACG
DENV4-F3 GCTCCTTTCGAGAGTGAAG
DENV4-B3 AGTACAGCTTCCTCCTGG
DENV4-FIP CGTTATTGGCGGAGCTACAGGGAGGCTATTGAAGTCAGGC
DENV4-BIP GGAGGCGTTAAATTCCCAGGGGTCTCCTCTAACCGCTAGT
DENV4-LoopF CAGCACGGTTTGCTCAAG
DENV4-LoopB CTGTACGCGTGGCATATTG
Hu et al. BMC Microbiology (2015) 15:265 Page 3 of 15
Fig. 2 Agarose gel electrophoresis and restriction analysis of DENV serotype-specific RT-LAMP assay products on a 2 % agarose gel. M, DL1000 DNA ladder (TAKARA, Japan); 1, DENV1 RT-LAMP amplification; 2, XbaI restriction enzyme digestion of DENV1 RT-LAMP product, 190,235,280 bp respectively; 3, DENV2 RT-LAMP amplification; 4, SpeI restriction enzyme digestion of DENV2 RT-LAMP product, 190,205,220 bp respectively; 5, DENV3 RT-LAMP assay amplification; 6, BglII restriction enzyme digestion of DENV3 RT-LAMP product, 145,185,210 bp respectively; 7, DENV4 RT-LAMP assay amplification; 8, AbaI restriction enzyme digestion of DENV4 RT-LAMP product, 180,210 bp respectively
Fig. 3 Specificity of RT-LAMP assay for the detection of DENV1. a Agarose gel electrophoresis analysis of the DENV1 RT-LAMP amplification product, showing the specificity of the primers. b The real-time monitoring over time for the DENV1 RT-LAMP reaction. c Visual inspection of the RT-LAMP specificity assay with SYBR Green I corresponding to the agarose gel electrophoresis analysis. 1, negative [43]; 2–3, DNA of HSV and EBV, respectively; 4–9, RNA of JEV, YFV and DENV1-4, respectively; M, DL1000 DNA Marker
Hu et al. BMC Microbiology (2015) 15:265 Page 4 of 15
consequence, positive results for the RT-LAMP assay were detected at 10-copy templates of DENV1-4 (Figs. 8, 9, 10 and 11c-e), while the detection limits for RT-PCR and real-time PCR were about 100 copies (Figs. 8, 9, 10 and 11a and b). Thus, the detection sensitivity of the RT-LAMP assay for amplification of DENV1-4 was 10-fold more sensitive than those of RT-PCR and real-time PCR.
Amplification efficiency of RT-LAMP for DENV1-4 RT-LAMP products were detected by monitoring the in- crease in fluorescence by adding SYBR Green I to the RT-LAMP reaction mix. Quantitative analysis was ob- tained by measuring the time-to-positive (TTP) param- eter [33], a biomarker similar to the cycle threshold of real-time PCR [34]. The standard curves were generated by linear regression analysis of TTP for RT-LAMP and the Ct of real-time PCR for each amplification reaction versus the log10 RNA copy number (Fig. 12a). Addition- ally, the time taken for fluorescence signal detection for each RT-LAMP and real-time PCR amplification was calculated according to TTP or Ct, respectively, after which the standard curves were generated by linear re- gression analysis (Fig. 12b). The time required by RT- LAMP was about half of that required by real-time PCR
for every diluted concentration of DENV RNA, and the time required by the other serotypes was similar (date not shown). RT-LAMP was able to detect 10-copies of DENV RNA in 20 min, which should fit the requirement for rapid clinical diagnosis of DENV.
Evaluation of RT-LAMP for clinical diagnosis of DENV1-4 The applicability of the RT-LAMP assay for detection and differentiation of DENV serotypes was validated by evaluating clinical strains of the virus and patient serum with DENV infection. Twenty clinical strains of DENV1, 30 clinical strains of DENV2, 15 clinical strains of DENV3 and 15 clinical strains of DENV4, were exam- ined by the RT-LAMP assay, RT-PCR, and real-time PCR. As a result, the DENV1-4 detection rates had up to 100 % accuracy for RT-LAMP and real-time PCR, compared with 93 % by RT-PCR (Table 2). No cross- reactions between the serotypes were identified in this study. For the study on patient serum, 190 serum samples
from patients confirmed to be infected by DENV by clinical diagnosis were treated to extract the total RNA. Additionally, 20 serum samples from healthy volunteers received the same treatment (negative controls). Among the positive samples, 98.9 % (188/190) were RT-LAMP
Fig. 4 Specificity of RT-LAMP assay for the detection of DENV2. a Agarose gel electrophoresis analysis of the DENV2 RT-LAMP amplification product, showing the specificity of the primers. b The real-time monitoring over time for the DENV2 RT-LAMP reaction. c Visual inspection of the RT-LAMP specificity assay with SYBR Green I corresponding to the agarose gel electrophoresis analysis. 1, negative (water); 2–3, DNA of HSV and EBV, respectively; 4–9, RNA of JEV, YFV and DENV1-4, respectively; M, DL1000 DNA Marker
Hu et al. BMC Microbiology (2015) 15:265 Page 5 of 15
assay positive, a value higher than 84.2 % (160/190) with RT-PCR and 90.5 % (172/190) with real-time PCR (Table 2), thus indicating that the sensitivity of the RT- AMP assay is higher than that of RT-PCR (P < 0.0001) and that of real-time PCR (P = 0.0003). None of the 20 healthy blood donors were positive for dengue viruses, as determined by the three methods. No cross-reactions or false-positive reactions were noted.
Discussion DENV is the most widely prevalent arbovirus in tropical and subtropical regions of the world [5]. There is an ur- gent need for fast and accurate clinical diagnosis and serotype differentiation of DENV1-4 to prevent and treat this viral infection. Conventional methods of DENV de- tection, which include virus isolation, immunoassay, RT- PCR, and real-time PCR [10], have many drawbacks in that they are time consuming to perform, require special equipment, and have a high propensity for cross- reaction of the DENV1-4 serotypes. In contrast, RT- LAMP can be performed using a water bath or a heating block under isothermal conditions [17], and is more sen- sitive and faster to perform than the other methods de- scribed herein. Some studies have reported the use of RT-LAMP for analyzing DENV. However, the detection
limits for the DENV1-4 serotypes differed from each other and the diagnostic accuracy was < 90 % because the DENV1-4 primers were restricted to the same gene in the earlier reports [29–31, 35], although they could detect and differentiate DENV1-4 isotypes. In our study, we did not restrict the design of the primers to the same gene, but allowed different genes to be included in the search for optimal sequences with which to differentiate the different viral serotypes using multiple sequence alignments. This approach allowed us to establish an RT-LAMP method for detection of DENV 1–4 with higher sensitivity and greater diagnostic potential than RT-PCR and real-time PCR. The RT-LAMP reaction was sensitive enough to detect 10-copies of RNA tem- plate unlike RT-PCR and real-time PCR that each had detection limits of 100 copies. Scientific literature searches show that several studies have reported a higher sensitivity for real-time PCR than RT-PCR, but the detection limits of RT-PCR and real-time PCR can be discrepant in different detection systems, although both methods could detect 100 copies of DENV [36–39], which is consistent with our results. In our diagnostic testing of the viral clinical strains
and patients with DENV infections, the diagnostic rate RT-LAMP achieved was 100 % for the viral strains and
Fig. 5 Specificity of RT-LAMP assay for the detection of DENV3. a Agarose gel electrophoresis analysis of the DENV3 RT-LAMP amplification product, showing the specificity of the primers. b The real-time monitoring over time for the DENV3 RT-LAMP reaction. c Visual inspection of the RT-LAMP specificity assay with SYBR Green I corresponding to the agarose gel electrophoresis analysis. 1, negative [43]; 2–3, DNA of HSV and EBV, respectively; 4–9, RNA of JEV, YFV and DENV1-4, respectively; M, DL1000 DNA Marker
Hu et al. BMC Microbiology (2015) 15:265 Page 6 of 15
98.9 % for the patient samples, both values of which are better than that of RT-PCR (93 %, 84.2 %, respectively) and real-time PCR (100 %, 90.5 %, respectively). Encour- agingly, the time required for confirmation of the results by the RT-LAMP assay was less than 25 min, just half of the time required by real-time PCR.
Because of its high sensitivity, RT-LAMP is more eas- ily affected by aerosol pollution, a disadvantage ignored in previous studies. To avoid contamination, the tubes used for RT-LAMP reactions should not be opened; however, it is not feasible to add the SYBR Green I to the tube directly before the start of the LAMP reaction
Fig. 6 Specificity of RT-LAMP assay for the detection of DENV4. a Agarose gel electrophoresis analysis of the DENV4 RT-LAMP amplification product, showing the specificity of the primers. b The real-time monitoring over time for the DENV4 RT-LAMP reaction. c Visual inspection of the RT-LAMP specificity assay with SYBR Green I corresponding to the agarose gel electrophoresis analysis. 1, negative (water); 2–3, DNA of HSV and EBV, respectively; 4–9, RNA of JEV, YFV and DENV1-4, respectively; M, DL1000 DNA Marker
Fig. 7 Specificity of RT-PCR assays for the detection of DENV1-4. Agarose gel electrophoresis analysis of the DENV1-4 RT-PCR amplification product, showing the specificity of the primers, DENV1-4-F3 and B3. (A-D) DENV1-4. 1, negative (water); 2–3, DNA of HSV and EBV, respectively; 4–9, RNA of JEV, YFV and DENV1-4, respectively; M, DL1000 DNA Marker
Hu et al. BMC Microbiology (2015) 15:265 Page 7 of 15
because a high concentration of SYBR Green I can in- hibit this reaction [40]. Therefore, in our study, to avoid aerosol pollution, the SYBR Green I was dispensed dir- ectly onto the inner cover of the reaction tube. After the reaction was completed, the SYBR Green I was mixed with the RT-LAMP reaction mix by centrifugation. Fur- thermore, a new fluorescence-real time-monitoring in- strument, ESE (DEAOU, Guangzhou, China) was used to eliminate aerosol pollution; this enabled the real-time monitoring of the RT-LAMP amplification to be realized using matched software. The risk of false-positives caused by aerosol contamination was minimized by using the improved methods and new equipment.
Conclusions The RT-LAMP method we established in this study is rapid, sensitive, and specific for the detection and dif- ferentiation of DENV1-4 serotypes. With new equip- ment and the application of our method to avoid aerosol contamination of the samples, the RT-LAMP method has potential for use in clinical laboratories where DENV assays are repeated many times. More- over, it is convenient to quantitatively detect DENV1- 4 by monitoring the fluorescence of the RT-LAMP reaction or by visually assessing the reaction using SYBR Green I for different requirements and test conditions.
Fig. 8 Comparison of the sensitivity of RT-PCR, real-time PCR and RT-LAMP for detection of DENV1. a Agarose gel electrophoresis analysis of detection limit of the RT-PCR assay for the detection of DENV1 RNA. b The real-time monitoring over time for detection limit of the real-time PCR assay for the detection of the DENV1 cDNAs. c Agarose gel electrophoresis analysis of the detection limit of the RT-LAMP assay for the detection of DENV1 RNA d Visual inspection of the RT-LAMP assay corresponding to agarose gel electrophoresis analysis. e The real-time monitoring of detection limit of the RT-LAMP assay. 1, negative [43]; 2–7, correspond to serial ten-fold dilutions of DENV1 RNA templates from 1 to 105copies; M, DL1000 DNA Marker
Hu et al. BMC Microbiology (2015) 15:265 Page 8 of 15
Methods Viruses In our studies stains of viruses used were as follows, four standard dengue virus serotypes (DENV1, Hawaii; DENV2, New Guinea; DENV3, H87; and DENV4, H241), four DENV serotypes with clinical isolates and confirm- ation, JEV, YFV, HSV, EBV. DENV were propagated in Aedes albopictus clone C6/36 cells in our laboratory; JEV and YFV were contributed by Zhu Jiang hospital in Guangzhou in China; HSV and EBV were kindly provided by Professor Yan Yuan in our school. In addition, the
DENV clinical stains were isolated and contributed by Zhu Jiang hospital and the CDC in Guangzhou, China.
Dengue Virus Isolation and titers Twenty to 200 μL of the initial serum sample of each pa- tient were diluted with cell culture medium and inocu- lated onto confluent monolayers of C6/36 cells in 24 well plates. Serum samples were incubated for 4 h before being replaced by fresh medium and C6/36 cells were incubated at 35 °C. The clinical DENV strains were isolated after about 7 days.
Fig. 9 Comparison of the sensitivity of RT-PCR, real-time PCR and RT-LAMP for detection of DENV2. a Agarose gel electrophoresis analysis of detection limit of the RT-PCR assay for the detection of DENV2 RNA. b The real-time monitoring over time for detection limit of the real-time PCR assay for the detection of the DENV2 cDNAs. c Agarose gel electrophoresis analysis of the detection limit of the RT-LAMP assay for the detection of DENV2 RNA d Visual inspection of the RT-LAMP assay corresponding to agarose gel electrophoresis analysis. e The real-time monitoring of detection limit of the RT-LAMP assay. 1, negative (water); 2–7, correspond to serial ten-fold dilutions of DENV2 RNA templates from 1 to 105copies; M, DL1000 DNA Marker
Hu et al. BMC Microbiology (2015) 15:265 Page 9 of 15
The supernatants were collected and clarified by centri- fugation (1000 g, 5 min). Viral concentrations were titered on C6/36 cells using the Reed-Muench method [41].
Human patient serum samples and Ethics Statement The serum samples were collected from patients who were febrile and suspected of having DENV 1–5 days after the presence of two or more of the symptoms viz. headache, eye pain, nausea, vomiting, rash, myalgia, ab- dominal pain. And then all the serum samples were screened by conventional diagnostic methods, the isola- tion of DENV, RT-PCR and IgM-capture ELISA. If there were two or more positive results, the patient would be
confirmed with DENV infection. The number of DENV1- 4 was counted in the process of the diagnosis.190 serum samples from patients with confirmed DENV infection were obtained in this study and frozen in −80 °C. Serum of 20 healthy blood donors were obtained from the phys- ical examination center, the first affiliated hospital of Sun Yat-Sen University. All serum samples used in this study were collected by
Guangzhou CDC and appropriately anonymized. All individuals participating in the study gave written in- formed consent. Local ethical approval was obtained from Medical Ethics Committee of Guangzhou Center For Disease Control And Prevention (Guangzhou,
Fig. 10 Comparison of the sensitivity of RT-PCR, real-time PCR and RT-LAMP for detection of DENV3. a Agarose gel electrophoresis analysis of detection limit of the RT-PCR assay for the detection of DENV3 RNA. b The real-time monitoring over time for detection limit of the real-time PCR assay for the detection of the DENV3 cDNAs. c Agarose gel electrophoresis analysis of the detection limit of the RT-LAMP assay for the detection of DENV3 RNA d Visual inspection of the RT-LAMP assay corresponding to agarose gel electrophoresis analysis. e The real-time monitoring of detection limit of the RT-LAMP assay. 1, negative [43]; 2–7, correspond to serial ten-fold dilutions of DENV3 RNA templates from 1 to 105copies; M, DL1000 DNA Marker
Hu et al. BMC Microbiology (2015) 15:265 Page 10 of 15
China), and guidelines were followed for the use of clin- ical material and accession to diagnostic results.
RNA extraction Total RNAs were extracted from the supernatant of C6/36 cell infected DENV, and 200 μl patients’ sera using the QIAamp viral RNA mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions, respectively. The RNA was eluted from the QIA spin columns in a final volume of 50 μL of the elution buf- fer. Total RNAs were quantified using the Nano-Drop 2000c spectrophotometer (Thermo, Wilmington, DE). And then a little of every simple RNA was reversely
transcribed in 25 μL reaction volume using random hexamer oligonucleotides with the reverse transcription system (Promega, Madison, WI). The rest of RNAs and the cDNA were stored at −80 °C until testing.
Design of dengue virus serotype-specific RT-LAMP assay primers The serotype-specific oligonucleotide primers used for RT-LAMP assay amplification of dengue viruses were designed from different regions (Fig. 1). The nucleotide sequences of the prototype strains of each dengue virus serotype were retrieved from GenBank (DEN-1, accession no. EU848545.1; DEN-2, accession no. AF 038403.1;
Fig. 11 Comparison of the sensitivity of RT-PCR, real-time PCR and RT-LAMP for detection of DENV4. a Agarose gel electrophoresis analysis of detection limit of the RT-PCR assay for the detection of DENV4 RNA. b The real-time monitoring over time for detection limit of the real-time PCR assay for the detection of the DENV4 cDNAs. c Agarose gel electrophoresis analysis of the detection limit of the RT-LAMP assay for the detection of DENV4 RNA d Visual inspection of the RT-LAMP assay corresponding to agarose gel electrophoresis analysis. e The real-time monitoring of detection limit of the RT-LAMP assay. 1, negative (water); 2–7, correspond to serial ten-fold dilutions of DENV4 RNA templates from 1 to 105copies; M, DL1000 DNA Marker
Hu et al. BMC Microbiology (2015) 15:265 Page 11 of 15
DEN-3, accession no. M93130.1; and DEN-4, accession no AY947539.1), were aligned with the available sequences of other strains of each serotype to identify the potential re- gions which were the high sequence variabilities among DENV1-4 by using DNASIS software (Hitachi, Japan). And then the nucleotide sequences of the prototype strains of each DENV were aligned with the nucleotide se- quences of the various clinical strains of each DENV to identify the optimal regions, which were the high se- quence identities, in those potential regions. RT-LAMP assay primers were designed from the optimal region of each serotype using the software LAMP designer (Primer biosoft, America). A set of three pairs of primers
comprising a pair of outer (F3 and B3), a pair of inner (FIP and BIP), and a pair of loop primers (FLP and BLP) that recognize eight distinct regions on the target se- quence was designed. All the primers (Table 1) were se- lected based on the criteria described by Notomi et al. and then assessed for specificity before use in RT-LAMP as- says with a BLAST search in the GenBank.
RT-LAMP assays The RT-LAMP reaction was carried out in a total 25 μL reaction mixture containing 40 pM each of primers FIP and BIP, 5 pmol each of outer primers F3 and B3, 20 pM each of FLP and BLP, 1.4 mM deoxynucleoside
Fig. 12 Comparison of the amplification efficiency and time of real-time PCR and RT-LAMP. a Standard curves generated by linear regression analysis of TTP of LAMP and Ct of real-time PCR measured for each amplification versus the log10 number of DENV-1 RNA or cDNA copies for each standard dilution. b Standard curves generated by linear regression analysis of the time for each amplification versus the log10 number of DENV-1 RNA or cDNA copies each standard dilution. Data are shown as mean ± standard error of the mean (S.E.M) at least three independent experiments. Ct, cycle threshold; TTP, time-to-positive
Table 2 Comparative evaluation of DENV serotype-specific RT-LAMP assay with RT-PCR, and real-time PCR for detection of DENV stains and the patients’ serum samples
Type of case Virus serotype No. of samples Virus isolation
No. of samples positive by:
RT-LAMP RT-PCR Real-time PCR
Virus stains DEN-1 20 20 18 20
DEN-2 30 30 27 30
DEN-3 15 15 15 15
DEN-4 15 15 14 15
Total 80 80 74 80
Accuracy (%) 100 92.5 100
Patients’ serum samples DEN-1 50 50 41 44
DEN-2 60 59 52 54
DEN-3 40 40 35 38
DEN-4 40 39 33 36
Total 190 188 161 172
Accuracy (%) 98.95 84.74 90.53
Healthy 20 0 0 0
Total 20 0 0 0
False positive rate (%) 0 0 0
Hu et al. BMC Microbiology (2015) 15:265 Page 12 of 15
triphosphates, 0.8 M betaine, 0.1 % Tween 20, 10 mM (NH4)2SO4, 8 mM MgSO4, 10 mM KCl, 20 mM Tris– HCl, pH 8.8, 16 U of Bst DNA polymerase (New England Biolabs), 0.125 U of avian myeloblastosis virus reverse transcriptase (Invitrogen), and different copies of genomic RNA templates in sensitivity assays or about 100 ng of tar- get RNA in in the others experiments, which were incu- bated at 63 °C for 45 min.
Detection of RT-LAMP products For naked-eye detection, 1.0 μL of 10−1 diluted SYBR Green I (Takara Bio Inc., Otsu, Japan) was dropped on the inner cover of the reaction tube to avoid the aerosol pollution, and then mixed the SYBR Green I and the reaction mixture to observe the color. For the electrophoretic analysis, 2 μL of reaction mixture was loaded on 2 % agarose gel. The gel was stained with ethidium bromide and assessed photographically under UV light. To confirm a structure of the RT- LAMP product, the amplification products was digested with restriction enzyme and was analyzed by the electrophoresis. For quantitative detection, real- time monitoring of RT-LAMP was performed using ESE (DEAOU, Guangzhou, China), a kind of new fluorescence-real time-monitoring instrument, with 8 wells and the positive and negative of the amplifica- tion shown on the instrument screen. SYBR Green I was used as a source of fluorescence. The original so- lution of SYBR Green I was diluted into 25× and then added 1.0 μl in the 25 μl RT-LAMP reaction mixture. All amplifications and detections were car- ried out in ESE. Accumulation of RT-LAMP products was detected by monitoring the increase in fluores- cence of dsDNA-binding SYBR Green at every 1 min for 35 min under isothermal condition at 63 °C. The datas of real time RT-LAMP were analyzed by using the ESE software (DEAOU, Guangzhou, China).
Specificity of RT-LAMP assays The RT-LAMP production was digested with XbaI for DENV-1, Bgl II for the DENV-2, SpeI for DENV-3, ApaI for DENV4. The amplification products and the corresponding digests were analyzed by electrophoresis on a 2 % agarose gel, stained with ethidium bromide. The authenticity of the amplified products was also verified by nucleotide sequencing of digested products. Cross-reactivity was evaluated within the four dengue virus serotypes, two other Flaviviruses, JEV and YFV as well as two DNA virus, HSV and EBV, having a far away genetic relationship with dengue virus.
Viral genomic RNA quantification In vitro-transcribed RNA was used as the copy number control to quantify RNA templates of DENV1-4 as
previously described [42]. Briefly, templates were de- veloped by amplifying DENV1-4 using F3 and B3 prime pairs in the DENV1-4 RT-LAMP assay and cloned into a TOPO TA vector. Target RNA was transcribed with T7 RNA polymerase using Ampli- Scribe T7 Flash Transcription Kit. The resulting RNA was quantified by spectrophotometry and expressed as copy per mL (copy/mL). And then, the quantified RNA templates were diluted down to 105 copies/mL to be used in followed assays.
Sensitivity of the RT-LAMP assays The sensitivity of RT-LAMP assays was carried out through ten-fold serially diluted viral genomic RNA tem- plates with the known nucleic acid copies.
RT-PCR assays Each of viral samples was amplified in a 25 μL reaction containing 5 μL 5 × reaction buffer, 1 μL 25 mM MgSO4, 0.5 μL 10 mM dNTP Mix, 0.25 μL each of 50 μM primer F3 and B3 mixture, 0.5 μL 5U/μL AMA, 0.5 μL 5 U/μL Tfl DNA polymerase, 1 μL different cop- ies of genomic RNA templates, and RNase- free ddH2O. Amplification by RT-PCR was performed using a Profes- sional Thermocycler (Biometra-Göttingen, Germany). The thermal profile consisted of a 45 min reverse tran- scription step at 48 °C followed by 2 min of Taq poly- merase activation at 94 °C, and then 35 cycles of PCR (94 °C for 30 s, annealing temperature 55 °C for 60 s, and 68 °C for 2 min).
Real-time PCR assays Viral RNA was reversely transcribed into cDNA as de- scribed above. Real-time PCR was performed in a 25 μL reaction containing 1 μL cDNA templates, 10 μL 2× SYBR® Premix Ex Taq™(TaKaRa), 2 μL 10 μM F3, 2 μL 10 μM B3, and nuclease-free ddH2O. The CFX96 Real- Time PCR System (Bio-Rad, CA) was programmed to denature the samples for 5 min at 95 °C, followed by 40 cycles of 95 °C for 15 s, 59 °C for 30 s, and 72 °C for 30 s.
Statistical analysis All statistical analysis was performed using IBM SPSS Statistics, version 21 (IBM Corporation, New York, United States). Chi-square test (McNemar’s exact test, two-tailed) was performed to evaluate and compare the sensitivity of all molecular and serological methods used. In the present study, the p-value <0.001 was used to suggest significant results. The diagnostic per- formance of RT-LAMP assay as compared to RT-PCR and Real-time PCR was calculated using web based Medcalc easy-to-use statistical software (https:// www.medcalc.org/calc/diagnostic_test.php).
Hu et al. BMC Microbiology (2015) 15:265 Page 13 of 15
Abbreviations Ct: cycle threshold; DENV: dengue virus; DHF: dengue hemorrhagic fever; DSS: dengue shock syndrome; EBV: Epstein-Barr virus; HSV: herpes simplex virus; JEV: Japanese encephalitis virus; NS DF: dengue fever; RT-LAMP: reverse transcription-loop-mediated isothermal amplification; TTP: time-to-positive; YFV: yellow fever virus.
Competing interests The authors have none competing interests to declare.
Authors’ contributions Sheng-feng Hu designed the study, did laboratory testing, analyzed the test results. Miao Li, Lan-lan Zhong, Shi-miao Lu, Ze-xia Liu, Jie-ying Pu participated in the laboratory testing. Jin-sheng Wen, Xi Huang as the corresponding author conducted the experiment. All authors read and approved the final manuscript.
Acknowledgments This work was supported by National Natural Science Foundation of China (31470877, 81261160323, 31070143), National Science and Technology Key Projects for Major Infectious Diseases (2013ZX10003001), Guangdong Province University and colleges Pearl River Scholar Funded Scheme (No.2009), the Nature Science Foundation of Zhejiang (LY13H160035) and Guangdong Innovative Team Program (2009010058). We are grateful to Zhu Jiang hospital (Guangzhou, China) for generously providing clinical samples, JEV and YFV. We also thank Prof. Yuan Yan of Sun Yat-sen University for providing HSV and EBV.
Author details 1Program of Immunology, Institute of Human Virology, Affiliated Guangzhou Women and Children’s Medical Center, Zhongshan School of Medicine, Sun Yat-sen University, 74 Zhongshan 2nd Road, Guangzhou 510080, China. 2Key Laboratory of Tropical Diseases Control (Sun Yat-sen University), Ministry of Education, Guangzhou 510080, China. 3Department of microbiology and immunology, Wenzhou, Medical University, Wenzhou, China.
Received: 13 February 2015 Accepted: 30 October 2015
References 1. Sekaran SD, Artsob H. Molecular diagnostics for the detection of human
flavivirus infections. Exp Opin Med Diag. 2007;1(4):521–30. 2. Ligon BL. Dengue fever and dengue hemorrhagic fever: a review of the
history, transmission, treatment, and prevention. Semin Pediatr Infect Dis. 2005;16(1):60–5.
3. Guzman MG, Halstead SB, Artsob H, Buchy P, Farrar J, Gubler DJ, et al. Dengue: a continuing global threat. Nat Rev Microbiol. 2010;8(12 Suppl):S7–S16.
4. Halstead SB. Dengue. Lancet. 2007;370(9599):1644–52. 5. Racloz V, Ramsey R, Tong S, Hu W. Surveillance of dengue fever virus: a
review of epidemiological models and early warning systems. PLoS Negl Trop Dis. 2012;6(5):e1648.
6. Dowd KA, Pierson TC. Antibody-mediated neutralization of flaviviruses: a reductionist view. Virology. 2011;411(2):306–15.
7. Sun P, Kochel TJ. The Battle between Infection and Host Immune Responses of Dengue Virus and Its Implication in Dengue Disease Pathogenesis. Scien World J. 2013;2013:843469.
8. Vasilakis N, Weaver SC. The history and evolution of human dengue emergence. Adv Virus Res. 2008;72:1–76.
9. Philip Samuel P, Tyagi BK. Diagnostic methods for detection & isolation of dengue viruses from vector mosquitoes. Indian J Med Res. 2006;123(5):615–28.
10. Teles FS. Biosensors and rapid diagnostic tests on the frontier between analytical and clinical chemistry for biomolecular diagnosis of dengue disease: a review. Anal Chim Acta. 2011;687(1):28–42.
11. Blacksell SD. Commercial dengue rapid diagnostic tests for point-of-care application: recent evaluations and future needs? J Biomed Biotechnol. 2012;2012:151967.
12. Leone G, van Schijndel H, van Gemen B, Kramer FR, Schoen CD. Molecular beacon probes combined with amplification by NASBA enable homogeneous, real-time detection of RNA. Nucleic Acids Res. 1998;26(9):2150–5.
13. Kuno G. Universal diagnostic RT-PCR protocol for arboviruses. J Virol Methods. 1998;72(1):27–41.
14. Guzman MG, Kouri G. Dengue diagnosis, advances and challenges. Int J Infect Dis. 2004;8(2):69–80.
15. Shu PY, Huang JH. Current advances in dengue diagnosis. Clin Diagn Lab Immunol. 2004;11(4):642–50.
16. Guzman MG, Kouri G. Advances in dengue diagnosis. Clin Diagn Lab Immunol. 1996;3(6):621–7.
17. Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, et al. Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 2000;28(12):E63.
18. Parida MM. Rapid and real-time detection technologies for emerging viruses of biomedical importance. J Biosci. 2008;33(4):617–28.
19. Hirayama H, Kageyama S, Moriyasu S, Sawai K, Onoe S, Takahashi Y, et al. Rapid sexing of bovine preimplantation embryos using loop-mediated isothermal amplification. Theriogenology. 2004;62(5):887–96.
20. Fukuta S, Mizukami Y, Ishida A, Ueda J, Hasegawa M, Hayashi I, et al. Real-time loop-mediated isothermal amplification for the CaMV-35S promoter as a screening method for genetically modified organisms. Euro Food Res Technol. 2004;218(5):496–500.
21. Li S, Fang M, Zhou B, Ni H, Shen Q, Zhang H, et al. Simultaneous detection and differentiation of dengue virus serotypes 1–4, Japanese encephalitis virus, and West Nile virus by a combined reverse-transcription loop-mediated isothermal amplification assay. Virol J. 2011;8:360.
22. Hong TC, Mai QL, Cuong DV, Parida M, Minekawa H, Notomi T, et al. Development and evaluation of a novel loop-mediated isothermal amplification method for rapid detection of severe acute respiratory syndrome coronavirus. J Clin Microbiol. 2004;42(5):1956–61.
23. Fukuta S, Ohishi K, Yoshida K, Mizukami Y, Ishida A, Kanbe M. Development of immunocapture reverse transcription loop-mediated isothermal amplification for the detection of tomato spotted wilt virus from chrysanthemum. J Virol Methods. 2004;121(1):49–55.
24. Fukuta S, Kato S, Yoshida K, Mizukami Y, Ishida A, Ueda J, et al. Detection of tomato yellow leaf curl virus by loop-mediated isothermal amplification reaction. J Virol Methods. 2003;112(1–2):35–40.
25. Liu J, Nian QG, Li J, Hu Y, Li XF, Zhang Y, et al. Development of reverse- transcription loop-mediated isothermal amplification assay for rapid detection of novel avian influenza A (H7N9) virus. BMC Microbiol. 2014;14(1):271.
26. Zhao X, Li Y, Wang L, You L, Xu Z, Li L, et al. Development and application of a loop-mediated isothermal amplification method on rapid detection Escherichia coli O157 strains from food samples. Mol Biol Rep. 2010;37(5):2183–8.
27. Parida M, Posadas G, Inoue S, Hasebe F, Morita K. Real-time reverse transcription loop-mediated isothermal amplification for rapid detection of West Nile virus. J Clin Microbiol. 2004;42(1):257–63.
28. Lu X, Li X, Mo Z, Jin F, Wang B, Zhao H, et al. Rapid identification of Chikungunya and Dengue virus by a real-time reverse transcription-loop- mediated isothermal amplification method. Am J Trop Med Hyg. 2012;87(5):947–53.
29. Teoh BT, Sam SS, Tan KK, Johari J, Danlami MB, Hooi PS, et al. Detection of dengue viruses using reverse transcription-loop-mediated isothermal amplification. BMC Infect Dis. 2013;13:387.
30. Parida M, Horioke K, Ishida H, Dash PK, Saxena P, Jana AM, et al. Rapid detection and differentiation of dengue virus serotypes by a real-time reverse transcription-loop-mediated isothermal amplification assay. J Clin Microbiol. 2005;43(6):2895–903.
31. Neeraja M, Lakshmi V, Lavanya V, Priyanka EN, Parida MM, Dash PK, et al. Rapid detection and differentiation of dengue virus serotypes by NS1 specific reverse transcription loop-mediated isothermal amplification (RT- LAMP) assay in patients presenting to a tertiary care hospital in Hyderabad, India. J Virol Methods. 2015;211:22–31.
32. Buerano CC, Natividad FF, Contreras RC, Ibrahim IN, Mangada MN, Hasebe F, et al. Antigen sandwich ELISA predicts RT-PCR detection of dengue virus genome in infected culture fluids of Aedes albopictus C6/36 cells. Southeast Asian J Trop Med Public Health. 2008;39(5):817–21.
33. Cai T, Lou G, Yang J, Xu D, Meng Z. Development and evaluation of real-time loop-mediated isothermal amplification for hepatitis B virus DNA quantification: a new tool for HBV management. J Clin Virol. 2008;41(4):270–6.
34. Dircio Montes Sergio A, Gonzalez Figueroa E, Maria Saadia VG, Elizabeth SH, Beatriz RS, Altuzar Aguilar Victor M, et al. Leptospirosis prevalence in patients with initial diagnosis of dengue. J Trop Med. 2012;2012:519701.
35. Perera N, Aonuma H, Yoshimura A, Teramoto T, Iseki H, Nelson B, et al. Rapid identification of virus-carrying mosquitoes using reverse transcription-loop-mediated isothermal amplification. J Virol Methods. 2009;156(1–2):32–6.
Hu et al. BMC Microbiology (2015) 15:265 Page 14 of 15
36. Chun TW, Davey RT Jr, Ostrowski M, Shawn Justement J, Engel D, Mullins JI, et al. Relationship between pre-existing viral reservoirs and the re-emergence of plasma viremia after discontinuation of highly active anti-retroviral therapy. Nat Med. 2000;6:7.
37. Santiago GA, Vergne E, Quiles Y, Cosme J, Vazquez J, Medina JF, et al. Analytical and clinical performance of the CDC real time RT-PCR assay for detection and typing of dengue virus. PLoS Negl Trop Dis. 2013;7(7):e2311.
38. De Paula SO, de Melo LC, Torres MP, Pereira MR, da Fonseca BA L. One-Step RT-PCR protocols improve the rate of dengue diagnosis compared to Two-Step RT-PCR approaches. J Clin Virol. 2004;30(4):297–301.
39. Zhao LM, Li G, Gao Y, Zhu YR, Liu J, Zhu XP. Reverse transcription loop-mediated isothermal amplification assay for detecting tomato chlorosis virus. J Virol Methods. 2015;213:93–7.
40. Goto M, Honda E, Ogura A, Nomoto A, Hanaki K. Colorimetric detection of loop-mediated isothermal amplification reaction by using hydroxy naphthol blue. Biotechniques. 2009;46(3):167–72.
41. Reed LJ, Muench H. A simple method of estimating fifty per cent endpoints. Am J Epidemiol. 1938;27(3):493–7.
42. Chao DY, Davis BS, Chang GJ. Development of multiplex real-time reverse transcriptase PCR assays for detecting eight medically important flaviviruses in mosquitoes. J Clin Microbiol. 2007;45(2):584–9.
43. Waters RA, Fowler VL, Armson B, Nelson N, Gloster J, Paton DJ, et al. Preliminary validation of direct detection of foot-and-mouth disease virus within clinical samples using reverse transcription loop-mediated isothermal amplification coupled with a simple lateral flow device for detection. PLoS One. 2014;9(8):e105630.
Submit your next manuscript to BioMed Central and take full advantage of:
• Convenient online submission
• Thorough peer review
• No space constraints or color figure charges
• Immediate publication on acceptance
• Inclusion in PubMed, CAS, Scopus and Google Scholar
• Research which is freely available for redistribution
Submit your manuscript at www.biomedcentral.com/submit
Hu et al. BMC Microbiology (2015) 15:265 Page 15 of 15
- Abstract
- Background
- Results
- Conclusion
- Background
- Results
- Primer design and specificity assessment of RT-LAMP for DENV1-4
- Sensitivity assessment of RT-LAMP for DENV1-4
- Amplification efficiency of RT-LAMP for DENV1-4
- Evaluation of RT-LAMP for clinical diagnosis of DENV1-4
- Discussion
- Conclusions
- Methods
- Viruses
- Dengue Virus Isolation and titers
- Human patient serum samples and Ethics Statement
- RNA extraction
- Design of dengue virus serotype-specific RT-LAMP assay primers
- RT-LAMP assays
- Detection of RT-LAMP products
- Specificity of RT-LAMP assays
- Viral genomic RNA quantification
- Sensitivity of the RT-LAMP assays
- RT-PCR assays
- Real-time PCR assays
- Statistical analysis
- Abbreviations
- Competing interests
- Authors’ contributions
- Acknowledgments
- Author details
- References