article8.pdf

Enhancing Resistance to Sclerotinia minor in Peanut by Expressing a Barley Oxalate Oxidase Gene

1

D. Malcolm Livingstone 2 , Jaime L. Hampton, Patrick M. Phipps, and Elizabeth A. Grabau*

Department of Plant Pathology, Physiology and Weed Science, Virginia Polytechnic Institute and State University, Blacksburg, Virginia 24061 (D.M.L., J.L.H., E.A.G.); and Tidewater Agricultural Research and Extension Center, Suffolk, Virginia 23437 (P.M.P.)

Sclerotinia minor Jagger is the causal agent of Sclerotinia blight, a highly destructive disease of peanut (Arachis hypogaea). Based on evidence that oxalic acid is involved in the pathogenicity of many Sclerotinia species, our objectives were to recover transgenic peanut plants expressing an oxalic acid-degrading oxalate oxidase and to evaluate them for increased resistance to S. minor. Transformed plants were regenerated from embryogenic cultures of three Virginia peanut cultivars (Wilson, Perry, and NC-7). A colorimetric enzyme assay was used to screen for oxalate oxidase activity in leaf tissue. Candidate plants with a range of expression levels were chosen for further analysis. Integration of the transgene was confirmed by Southern-blot analysis, and gene expression was demonstrated in transformants by northern-blot analysis. A sensitive fluorescent enzyme assay was used to quantify expression levels for comparison to the colorimetric protocol. A detached leaflet assay tested whether transgene expression could limit lesion size resulting from direct application of oxalic acid. Lesion size was significantly reduced in transgenic plants compared to nontransformed controls (65%–89% reduction at high oxalic acid concentrations). A second bioassay examined lesion size after inoculation of leaflets with S. minor mycelia. Lesion size was reduced by 75% to 97% in transformed plants, providing evidence that oxalate oxidase can confer enhanced resistance to Sclerotinia blight in peanut.

Sclerotinia blight of peanut, caused by the necrotro- phic fungus Sclerotinia minor, is one of the most devastating diseases of peanut (Arachis hypogaea) in Virginia, northeastern North Carolina, Oklahoma, and Texas. The fungicide fluazinam provides some pro- tection (Smith et al., 1992), but its benefit to peanut producers is offset by the expense of the multiple applications necessary to achieve modest control. Yield losses due to Sclerotinia blight can be significant. For example, prior to the availability of fluazinam, losses to Sclerotinia blight averaged 10% in Virginia, with pod loss exceeding 50% in severely affected fields (Porter and Melouk, 1997).

Oxalic acid is considered a pathogenicity factor in Sclerotinia sclerotiorum and many other fungal patho- gens (Maxwell and Lumsden, 1970; Godoy et al., 1990). A wide variety of other fungi also secrete oxalic acid, including Poria placenta (Ritschkoff et al., 1995), Septoria musiva (Liang et al., 2001), Sclerotium rolfsii (Bateman and Beer, 1965), Endothia (Cryphonectria) para- sitica (Havir and Anagnostakis, 1985; Bennett and Hindal, 1989), Penicillium oxalicum (Ikotun, 1984),

Cristulariella pyramidalis (Kurian and Stelzig, 1979), Sclerotium cepivorum (Stone and Armentrout, 1985), Mycena citricolor (Rao and Tewari, 1987), and S. minor (Hollowell et al., 2001). Direct application of oxalic acid to stem or leaf tissue causes marked tissue injury and wilting, similar to plant responses to fungal in- fection by S. rolfsii (Bateman and Beer, 1965) and S. sclerotiorum (Noyes and Hancock, 1981). The most compelling evidence for the involvement of oxalic acid in disease initiation was the demonstration that mutant isolates of S. sclerotiorum, deficient in oxalic acid production, were not pathogenic on bean (Pha- seolus vulgaris), but revertants became pathogenic once they regained the ability to produce oxalic acid (Godoy et al., 1990). Screening for resistance to oxalic acid has also been studied as an indirect test of physiological resistance to white mold in common bean (Kolkman and Kelly, 2000).

Oxalic acid may aid in infection through a number of proposed routes, including acidification to facilitate cell wall-degrading enzyme activity, through pH- mediated tissue damage, or via sequestration of Ca21

ions (for review, see Dutton and Evans, 1996). The optimal pH for many cell wall-degrading enzymes lies in the acidic range (Lumsden, 1979). Degradative synergy between oxalic acid and polygalacturonase has been shown for Sclerotinia species and other fungal pathogens (Bateman and Beer, 1965; Kurian and Stelzig, 1979). Rollins (2003) demonstrated that both oxalic acid production and endopolygalacturo- nase activity are regulated by pH in S. sclerotiorum. The low pH resulting from oxalic acid production may weaken plants to improve access to fungal infection.

1 This work was supported by the Virginia Agricultural Council, the Virginia Peanut Growers Association, and the National Peanut Board.

2 Present address: School of Life Sciences, University of Queens- land, St. Lucia, Old. 4067, Australia.

* Corresponding author; e-mail egrabau@vt.edu; fax 540–231– 7126.

Article, publication date, and citation information can be found at www.plantphysiol.org/cgi/doi/10.1104/pp.104.057232.

1354 Plant Physiology, April 2005, Vol. 137, pp. 1354–1362, www.plantphysiol.org � 2005 American Society of Plant Biologists https://plantphysiol.orgDownloaded on February 20, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

Oxalic acid is also a strong chelator of divalent cations, and sequestration of calcium may weaken cell walls (Bateman and Beer, 1965). Oxalic acid can directly suppress the oxidative burst associated with the de- tection of pathogens by the plant (Cessna et al., 2000). Recently, oxalic acid has been reported to disturb guard cell function during infection by S. sclerotiorum by in- ducing stomatal opening and inhibiting abscisic acid- induced stomatal closure (Guimarães and Stotz, 2004). Oxalate oxidase belongs to the germin family of

proteins and catalyzes the degradation of oxalic acid to produce carbon dioxide and hydrogen peroxide (H2O2; Chiriboga, 1966; Lane et al., 1993). Oxalate oxidase is expressed during germination, where it associates with cell wall components such as glucuronogalactoarabi- noxylans (Lane, 2000). Plant oxalate oxidase activity increases the pH at the site of infection following contact with oxalate-secreting pathogens (Rollins, 2003). Oxalate oxidase has received considerable atten- tion for its possible utility in plant defense. It has been proposed that through the production of H2O2, oxalate oxidase or oxalate oxidase-like proteins may cause cross-linking of plant cell wall proteins in papillae at the site of infection (Wei et al., 1998) or play a role in the plant hypersensitive response (Lane, 1994; Zhou et al., 1998), previously shown to be orchestrated by H2O2 from the oxidative burst (Levine et al., 1994). Wheat (Triticum aestivum) oxalate oxidase activity increased following biotic (e.g. fungal pathogens) and abiotic (e.g. salt or heavy-metal ions) stress (Hurkman et al., 1994; Dessalegne et al., 1997; Berna and Bernier, 1999). Barley (Hordeum vulgare) oxalate oxidase is also induced in leaves following challenge with the fungus Erysiphe graminis (Dumas et al., 1995; Zhang et al., 1995). Reports of oxalate oxidase activity in response

to pathogen attack have been restricted to cereals (Pundir, 1991; Lane et al., 1993); however, trans- genic technology has been used to successfully trans- fer oxalate oxidase genes from cereals to other plants. Transgenic oilseed rape (Brassica napus) expressing a barley oxalate oxidase can break down exogenously applied oxalic acid (Thompson et al., 1995). Soybean (Glycine max), tobacco (Nicotiana tabacum), and sun- flower (Helianthus annuus) transformed with a wheat oxalate oxidase gene demonstrated increased resis- tance to S. sclerotiorum (Zaghmout et al., 1997; Donaldson et al., 2001; Hu et al., 2003). Poplar (Populus spp.) expressing the same gene was resistant to S. musiva (Liang et al., 2001). Although not examined in the soybean or poplar studies, it was demonstrated in transformed sunflower that oxalate oxidase expres- sion resulted in the induction of plant defense proteins (Hu et al., 2003). There are also reports of increased resistance to insect predation in corn (Zea mays) expressing a wheat oxalate oxidase (Ramputh et al., 2002). Expression of another oxalate-degrading en- zyme, oxalate decarboxylase, isolated from Collybia velutipes, also resulted in resistance of transgenic tomato (Lycopersicon esculentum) and tobacco to S. sclerotiorum (Kesarwani et al., 2000).

Further evidence for the utility of H2O2-generating enzymes in protective plant responses was provided by an examination of Glc oxidase expression in trans- genic rice (Kachroo et al., 2003). Expression of Glc oxidase and release of H2O2 led to enhanced resistance to the bacterial pathogen Xanthomonas oryzae and the fungus Magnaporthe grisea. Multiple strategies for engineering oilseed crops for resistance to S. sclerotio- rum, including introduction of H2O2-producing en- zymes, have recently been reviewed (Lu, 2003). Together, these reports suggest that introduction of an oxalate oxidase to degrade oxalic acid and generate H2O2 can be used in peanut to enhance resistance to oxalic acid- producing fungi, including S. minor.

RESULTS

Assay of Transformants for Oxalate Oxidase Activity

Following establishment of embryogenic tissue cul- ture lines for several Virginia peanut cultivars, em- bryos were transformed by particle bombardment with a plasmid vector containing the barley oxalate oxidase coding sequence. Selection and regeneration resulted in greater than 200 viable plants from three different cultivars. A simple colorimetric assay was used to screen hygromycin-resistant transformants for oxalate oxidase activity, and 40% to 60% of regen- erated T0 plants showed elevated activity levels, depending on cultivar (data not shown). Eight trans- formed plants were chosen for a closer examination of enzyme activity (Fig. 1). Oxalate oxidase activity levels were higher in seven of the transformants than in all three nontransformed controls (Wilson, Perry, and NC-7). One additional regenerated plant, W1, was included as a nonexpressing control transformant.

Figure 1 shows a comparison of results from two different protocols for detection of oxalate oxidase activity. Both the colorimetric assay and the commer- cially available fluorescent kit relied on the detection of H2O2 produced by the activity of oxalate oxidase on the substrate, oxalic acid. The difference between the two protocols was the greater sensitivity and lower background of the fluorescent assay, which required 5-fold less reaction volume for a comparable response. Both methods are easy to perform in a microtiter format, which allowed for high throughput analysis of transformed material. The assay results were highly repeatable with comparable levels of expression in different leaves of the same plant. One line, W3, gave variable oxalate oxidase activity results at different sampling dates, with some leaflets showing moderate activity and some with only background levels, in- dicating possible chimerism (data not shown).

Southern and Northern Analysis

Genomic DNA samples from transformed and con- trol peanut plants were analyzed by Southern-blot hybridization to demonstrate the integration of the

Oxalate Oxidase-Mediated Disease Resistance in Peanut

Plant Physiol. Vol. 137, 2005 1355 https://plantphysiol.orgDownloaded on February 20, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

oxalate oxidase transgene into the peanut genome. The number of insertion sites varied among transformants, as illustrated in Figure 2. The variable intensity of bands also suggested the possible insertion of multiple copies of the coding sequence in several lines, as is frequently observed for microprojectile bombardment. Hybridization patterns differed for the three Perry transformants, P9, P30, and P39, indicating that they were all independent transformation events. Hybrid- ization patterns for two of the Wilson transformants (W3 and W100) were similar, raising the possibility that they may have originated from the same bom- bardment event. However, the difference in oxalate oxidase expression and other parameters tested below suggested that W3 and W100 originated from different events and that the patterns appeared similar due to the inability to resolve small size differences for large

fragments on the gel. A similar consideration applies to transformant N6 obtained from bombardment of NC-7 cultures. The similarity of its hybridization pattern to P39 called into question whether it could have been inadvertently mislabeled during transfer to the greenhouse. We have retained the N6 designator while recognizing this caveat and will confirm its origin if progeny from this plant are used for any future studies.

Oxalate oxidase RNA expression was examined by northern-blot analysis to confirm the enzyme activity results. RNA from young leaflets was hybridized with the oxalate oxidase probe (Fig. 3). The seven oxalate oxidase-positive transformants showed the presence of a single 700-nucleotide RNA band that was absent from nontransformed controls. RNA expression levels were variable among lines. Line W3 showed very low levels of oxalate oxidase RNA, while P30 had the highest level of expression, consistent with enzyme activity results.

Resistance to Oxalic Acid

To determine whether transgenic peanut plants ex- pressing oxalate oxidase showed increased resistance to

Figure 1. Comparison of two oxalate oxidase activity assays using transgenic and control peanut plants. Transgenic plants were regen- erated from embryogenic peanut cultures bombarded with an oxalate oxidase gene under the control of the cauliflower mosaic virus 35S promoter and selected in the presence of hygromycin. Transformants were identified by screening for transgene expression using a leaf disc assay for oxalate oxidase activity. Quantitative measure of enzyme activity was determined for eight transformants and three untrans- formed controls using two different detection methods. A, The color- imetric detection protocol used 100 mL of the enzyme reaction, and results were measured spectrophotometrically at A550. B, The Amplex Red detection kit used 20 mL of the enzyme reaction, and results were measured with a fluorescence plate reader with an excitation filter of 530 nm and emission filter of 590 nm. (The same reaction was assayed by both methods for each of the eight leaf discs per plant.) Un- transformed controls were Perry, Wilson, and NC-7. P9, P30, and P39 were regenerated from bombardment of Perry embryogenic cultures. W1, W3, W73, and W100 were regenerated from bombardment of Wilson embryogenic cultures. N6 is derived from NC-7 embryos, although some caution in making this assignment was described in ‘‘Materials and Methods.’’ ‘‘Blank’’ indicates a reaction performed without plant material (buffer alone). Means and SE are presented for eight replicates for each plant.

Figure 2. Southern-blot analysis of peanut genomic DNA with the oxalate oxidase probe. BstXI-digested DNA was probed with a 32P- labeled fragment amplified by PCR from the barley oxalate oxidase cDNA. Size markers were HindIII-digested lambda DNA (sizes to the left of the blot are in base pairs). The first three lanes show hybridization of the probe to the PCR product used as the probe (470 bp), to undigested pOxOx plasmid, and to BstXI-digested pOxOx plasmid. Untransformed controls are cultivars Perry, Wilson, and NC-7. P9, P30, and P39 were Perry transformants. W3, W73, and W100 were Wilson transformants, and N6 is believed to be a NC-7 transformant.

Livingstone et al.

1356 Plant Physiol. Vol. 137, 2005 https://plantphysiol.orgDownloaded on February 20, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

the damaging effects of oxalic acid, varying concentra- tions of oxalic acid were applied to the surface of detached leaflets. Resistance was measured as a reduc- tion in lesion size on transgenic plant leaflets compared to lesion size on nontransformed controls. Transformed peanut plants showed decreased damage from exoge- nously applied oxalic acid over a wide range of oxalic acid concentrations, as illustrated in Figures 4 and 5. The assays showed that expression of oxalate oxidase in

transgenic peanut was able to neutralize the effects of oxalic acid at pathophysiological concentrations (Fig. 4A) and at concentrations up to 20-fold higher than normally found in infected tissue (Fig. 4, B–D). At high (200 mM) oxalic acid concentrations, lesions were re- duced by 65% to 89% compared to the corresponding nontransformed controls (Fig. 5A). Figure 5B shows the appearance of leaflets from several transformants following application of oxalic acid, illustrating the reduced lesion size. Liang et al. (2001) found that lesion area resulting from exposure to 200 mM oxalic acid on leaf discs from oxalate oxidase-expressing poplar trans- formants was reduced by 18% compared to nontrans- formed controls. The apparent difference in oxalic acid resistance in our transgenic peanut lines compared to the transgenic poplar may have resulted from differ- ences in parameters such as plant species, expression levels, and/or assay conditions.

Resistance to S. minor

To test for enhanced resistance to S. minor, thin agar plugs from the actively growing edge of a fungal culture were used to inoculate isolated leaflets from

Figure 3. Northern-blot analysis of peanut leaflet RNA with the oxalate oxidase probe. A, Total RNA from transformants and nontransformed controls was probed with the same 470-bp probe as described for the Southern blot in Figure 2. Expression in transgenic peanuts is observed by the presence of a 700-nucleotide mRNA band. B, Ethidium bromide (EtBr) staining was performed to demonstrate sample loading.

Figure 4. Resistance of transgenic plants to application of oxalic acid. Different concentrations of oxalic acid were applied to detached leaflets from transformants and nontransformed controls. Oxalic acid in A was applied at 0, 2, 4, 6, 8, and 10 mM. Oxalic acid in B to D was applied at 0, 20, 50, 100, and 200 mM. A, Nontransformed Perry and three transformants (P9, P30, and P39) at low oxalic acid concentrations. B, Same samples as in A except for high range of oxalic acid concen- trations. C, Nontransformed Wilson and three transformants (W3, W73, and W100). D, Nontransformed NC-7 and transformed N6. Means and SE are shown for four replicates.

Oxalate Oxidase-Mediated Disease Resistance in Peanut

Plant Physiol. Vol. 137, 2005 1357 https://plantphysiol.orgDownloaded on February 20, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

both transformed and nontransformed peanut plants. All the transgenic lines showed increased resistance to S. minor as measured by a reduction in lesion area (Fig. 6A). The type of lesion also varied between transgenic and control lines. Controls showed a large, continu- ous, tan-colored lesion, whereas the transgenic lines typically exhibited numerous smaller lesions resem- bling a hypersensitive response (Fig. 6B). The average reduction compared to the respective nontransformed control cultivars ranged from 75% for P39 to 97% for W100. The resistance results in peanut correlated well with previously published reports in other plants. Lesion size resulting from inoculation with the oxalate-secreting pathogen S. musiva was reduced by 63% in poplar expressing a wheat oxalate oxidase gene (Liang et al., 2001). Using oxalate decarboxylase to degrade oxalic acid, Kesarwani et al. (2000) showed

decreased lesion size of approximately 89% in trans- genic tomato inoculated with S. sclerotiorum.

Fertility of Transgenic Lines

Primary transgenic plants often show reduced fer- tility and lower yields than nontransformed plants. This can be due to epigenetic effects related to long tissue culture regimens or to the direct effect of the transgene itself, either because of position effects or the toxic nature of some transgene products. For example, Kachroo et al. (2003) showed that ectopic, wound-inducible expression of a Glc oxidase gene in transgenic rice resulted in lesion mimicry. Our T0 peanut transformants did not grow as well as non- regenerated control plants and exhibited variable fertility. T1 progeny plants showed improved growth, and no lesion mimicry has been observed. Line P30 had the highest average enzyme activity, but, although it flowered and produced several pods, all seeds were aborted at an early stage. Lines P9, P39, W73, and N6 produced seed yields similar to the nonexpressing

Figure 5. Resistance to oxalic acid in control and transformed peanut. A, Bar graph showing lesion size (in mm2) for transformed lines and nontransformed controls following application of 200 mM oxalic acid to peanut lines. B, Photograph of selected peanut lines showing lesion size and appearance on detached leaflets after application of increasing amounts of oxalic acid. Means and SE are shown for four replicates.

Figure 6. Resistance to S. minor in oxalate oxidase-expressing peanut lines compared to controls. A, Lesion size (in mm2) on detached leaflets in response to inoculation with S. minor. B, Comparison of selected peanut lines in response to inoculation with S. minor showing lesion size and appearance on detached leaflets. Means and SE are shown for 16 replicates.

Livingstone et al.

1358 Plant Physiol. Vol. 137, 2005 https://plantphysiol.orgDownloaded on February 20, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

transformant from line W1 (21–54 seeds). Line W100 produced only five viable seeds. Line W3 showed the lowest levels of transgene expression and most variable enzyme activity but also failed to produce any viable seed. From a comparison of RNA expres- sion levels and seed recovery, we concluded that the lack of seed production in several transformants could not be attributed to the expression of oxalate oxidase alone.

DISCUSSION

These studies demonstrated that the expression of a barley oxalate oxidase in transgenic peanut increased resistance to exogenously applied oxalic acid over a wide range of concentrations (up to 20 times patho- physiological levels). Transgenic peanut plants also exhibited enhanced resistance to S. minor as measured by reduced lesion size in detached leaflet assays. Peanut leaf inoculations were previously shown to serve as a reliable indicator of host resistance to S. minor (Hollowell and Shew, 2003). In addition to meeting the goal of enhancing re-

sistance to S. minor, the project results also demon- strated the potential utility of oxalic acid as a screen for fungal disease resistance. Previous studies used wilt- ing during immersion of cut bean seedlings in 20 mM oxalic acid as a screen for white mold resistance (Kolkman and Kelly, 2000). Our studies quantified the response to oxalic acid over a much wider range of concentrations. In addition, the leaflet assay is much more rapid and simple to perform. Due to the absence of obvious deleterious effects of

the oxalate oxidase transgene in most peanut trans- formants, we have used it as a sensitive marker for following transformation and regeneration, and as a reporter gene to evaluate expression in transformants. It is inexpensive and easy to assay, allowing screening of many progeny plants for transgene segregation patterns during generation of sufficient peanut seeds for field studies. The utility of oxalate oxidase as a reporter gene and its advantages over luciferase, b-glucuronidase, and green fluorescent protein have been recently described for other dicots (soybean) and monocots (maize) alike (Simmonds et al., 2004). As encouraging as these results are in support of

oxalate oxidase as a useful resistance gene, a limitation to the experiments is that the leaflet assays were per- formed under highly controlled conditions, including constant temperature, humidity, and use of a single fungal isolate. This will not be the case in field con- ditions. S. minor is an obligate necrotrophic fungus and requires dead or decaying tissue for successful establishment of infection. Variable growth and envi- ronmental conditions will come into play in a field production situation. Oxalic acid is considered a path- ogenicity factor for Sclerotinia spp. (Godoy et al., 1990) but may be only one of a number of factors that con- tribute to successful infection by fungal pathogens.

The oxalate oxidase gene may also play a role in cell wall defense unrelated to its enzyme activity. For example, Schweizer et al. (1999) showed that the expression of a mutant wheat oxalate oxidase se- quence lacking enzyme activity conferred increased resistance to penetration by S. sclerotiorum (20%–67% of control levels). Other studies have suggested that additional factors, such as hydrolytic enzymes, are likely to be important in establishing infection and progression of disease caused by S. minor. Based on the observation that coexpression of glucanase and chiti- nase genes in transgenic tobacco enhanced protection against fungal attack (Zhu et al., 1994), these genes have also been introduced into peanut (Chenault et al., 2002). Expression of multiple resistance genes may offer a better approach for providing greater and long- lasting fungal resistance.

Although there are probably multiple factors in- volved in the establishment of fungal infection, this study demonstrates the importance of oxalic acid as a pathogenicity factor in infection of peanut by S. minor, and that counteracting the effects of oxalic acid through oxalate oxidase expression can enhance re- sistance to injury and establishment of fungal infec- tion. Further studies are in progress to assess disease resistance and peanut yields for a number of oxalate oxidase-expressing peanut transformants under field conditions.

MATERIALS AND METHODS

Tissue Culture and Regeneration

Embryos from mature seeds of Virginia-type peanut (Arachis hypogaea)

cultivars (NC-7, Wilson, and Perry) were surface sterilized by soaking the

seeds in 70% ethanol for 5 min, twice in 1% dichloroisocyanuric acid for 5 min,

and finally rinsing the seeds with sterile distilled water. Following steriliza-

tion, the embryo was excised and the radicle end removed. Excised embryos

were washed in 1% dichloroisocyanuric acid for 30 s and rinsed with three

volumes of sterile distilled water. All reagents for tissue culture and sub-

sequent assays were obtained from Sigma (St. Louis) unless otherwise

specified.

Embryogenic callus was induced by culturing the mature embryos on MP3

medium, which contained Murashige and Skoog (MS; Murashige and Skoog,

1962) salts and vitamins (Caisson Laboratories, Sugar City, ID), 3% (w/v) Suc,

1 g L21 Gln, 0.8% (w/v) agar, and 3 mg L21 picloram. Embryogenic callus was

maintained on MP3 medium at 28�C, in the dark, with a subculture period of 3 to 4 weeks.

Maintenance, bombardment, and regeneration of peanut embryogenic

cultures were conducted as described previously (Livingstone and Birch,

1999). For regeneration, differentiated embryos with a clearly distinguishable

‘‘apex’’ and ‘‘root’’ bipolarity were transferred to MS medium, which con-

tained MS salts and vitamins, 2% (w/v) Suc, and 0.1% activated charcoal, and

allowed to grow for 1 month. The embryos were transferred to a thin layer of

MS medium and allowed to dessicate for approximately 1 month before final

transfer to fresh MS medium. Any embryos that failed to turn green or show

signs of growth and differentiation were discarded. Both regeneration steps

were performed at 28�C in the light (80 mmol m22 s21) with a 16-h photoperiod.

Vector Construction

RNA was purified from germinating barley seedlings (RNeasy kit; Qiagen,

Valencia, CA) for amplification of the oxalate oxidase coding region by

reverse transcription-PCR. Oligonucleotide primers were designed from the

Oxalate Oxidase-Mediated Disease Resistance in Peanut

Plant Physiol. Vol. 137, 2005 1359 https://plantphysiol.orgDownloaded on February 20, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

published sequence for barley oxalate oxidase (accession no. Y14203; Zhou

et al., 1998). Upstream (5#GCAAGGTACCATGGGTTACTCTAAAAACC- TAG) and downstream (5#GCAAGTCGACTGGGGCTCATGGAAGTTAAG) primers included KpnI and SalI sites, respectively, for cloning into the

transformation vector. First-strand synthesis was carried out using Super-

script reverse transcriptase according to manufacturer’s specifications (Invi-

trogen, Carlsbad, CA), and amplification was performed using Taq PCR

master mix (Qiagen). PCR conditions were denaturation for 30 s at 94�C, annealing for 1 min at 44�C and 50�C for the first and second cycles, respectively, followed by 56�C for the remaining 38 cycles, and extension for 1 min at 72�C. After cloning the 710-bp PCR product into the SmaI site of an intermediate vector pTZ19R and verification of the sequence for oxalate

oxidase, cDNA was excised as a KpnI-SalI fragment and used to replace the

coding sequence for a fungal phyA gene in a previously described plasmid

vector (Li et al., 1997) under control of the dual-enhanced cauliflower mosaic

virus 35S promoter. The final oxalate oxidase construct (pOxOx) included

a selectable marker for hygromycin resistance.

Plant Transformation and Growth of Regenerated Plants

Embryogenic callus was bombarded with the pOxOx plasmid DNA that

had been coated onto 1-mm-diameter tungsten microparticles. Particles were

accelerated using a PDS-1000/He Particle Delivery System and an 1,100-psi

rupture disc according to manufacturer’s recommendations (Bio-Rad, Her-

cules, CA). Callus was incubated on MP3 medium supplemented with 0.4 M

D-mannitol for bombardment. After 2 h of recovery, callus was transferred to

MS medium for 2 to 3 d and then plated onto MP3 medium supplemented

with filter-sterilized hygromycin B at a concentration of 40 mg L21 for

selection. After 3 to 6 months, transformed somatic embryos were regenerated

on antibiotic-free medium as described previously (Livingstone and Birch,

1999). Once plants were transferred from Magenta boxes to the greenhouse,

growth conditions included daylight plus supplemental light (sodium halide

and high-intensity discharge lighting) for 12 h a day. Plants were treated with

Osmocote fertilizer (Scotts, Marysville, OH) and Nitro-Fix (TCI, Pekin, IL)

according to manufacturers’ recommendations.

DNA and RNA Extraction

DNA was extracted by a modification of the hexadecyltrimethylammo-

nium bromide method described by Murray and Thompson (1980). Unex-

panded peanut leaflets (1–1.5 g) were ground in a mortar and pestle with

liquid nitrogen and transferred to 10 mL of extraction buffer containing 2%

hexadecyltrimethylammonium bromide, 2% polyvinylpyrrolidone (PVP 40;

Sigma), 50 mM MES, and 1.4 M NaCl, pH 5.5, which was preheated to 65�C. A volume of 100 mL of 0.2 M b-mercaptoethanol was added to each tube

immediately before adding the frozen tissue. The mixture was incubated at

65�C for 10 min with several gentle inversions to ensure mixing, and debris was pelleted at 12,000 rpm in a prewarmed (.15�C) Sorvall SA-600 rotor (Kendro, Asheville, NC) for 10 min. The supernatant was poured through two

layers of Miracloth (Calbiochem, La Jolla, CA) into a clean tube containing 10

mL of 10 mg mL21 RNase A and incubated for 30 min at 37�C. Following RNase digestion, the sample was transferred to a clean tube, and an equal

volume of chloroform was added. The tube was gently agitated for 5 min

before centrifugation at 12,000 rpm for 10 min. The supernatant was retained

and the DNA precipitated with 0.1 volumes of 7.5 M ammonium acetate and 2

volumes of ice-cold ethanol. After 30 min at 220�C, the DNA was spooled into a fresh tube and allowed to stand at room temperature to evaporate the

remaining alcohol. The sample was resuspended in 3 mL of TE (10 mM Tris,

pH 8, 1 mM EDTA). RNA was extracted from 100 to 150 mg of fresh, tightly

folded peanut leaflets using an RNeasy kit (Qiagen).

Southern and Northern Hybridization

To confirm integration of the transgene in peanut transformants, genomic

DNA was digested with BstXI. BstXI cuts the pOxOx plasmid once in the

oxalate oxidase coding sequence, adjacent to the region amplified as the

hybridization probe. DNA fragments were separated by agarose gel electro-

phoresis and transferred to positively charged nylon membranes (Nytran

supercharge; Schleicher and Schuell BioScience, Keene, NH). The membrane

was hybridized with a 32P-labeled oxalate oxidase probe. The probe sequence

was a 470-bp fragment amplified by PCR using puReTaqReady-To-Go PCR

beads (Amersham Biosciences, Piscataway, NJ) with forward primer

5#CCCTCTACAGGACTTCTGCG3# and reverse primer 5#CTGGCTGTTGA- AGGAACACAA3#. The PCR product was purified using a QIAquick PCR purification kit (Qiagen) and labeled using a Prime-It RmT Random Primer

labeling kit (Stratagene, La Jolla, CA) and radiolabeled 32P-dCTP (Perkin

Elmer, Boston). Hybridization and subsequent washes were performed at

65�C using conditions described by Sambrook et al. (1989) and analyzed on a Storm 850 phosphorimager (Molecular Dynamics, Piscataway, NJ).

RNA was separated by formaldehyde agarose gel electrophoresis and

transferred to positively charged nylon membranes as described previously

(Sambrook et al., 1989). Membranes were probed with the same oxalate

oxidase sequence as described above for Southern blots.

Oxalate Oxidase Assays

To determine oxalate oxidase activity in transgenic peanut plants, leaf discs

(5 mm diameter) were placed in 1.5-mL microfuge tubes and assayed using

a modification of the procedure by Sugiura et al. (1979). Next, 200 mL of assay

buffer (18 mg oxalic acid in 100 mL of 2.5 mM succinic acid, pH 4) were added

to tubes and reactions incubated for 15 min at 37�C. After incubation, developing solution (135 mL) was added to the tubes and the reactions

allowed to continue at room temperature for 30 min. Developing solution

consisted of 6 mg of aminoantipyrene dissolved in 30 mL of N,N-dimethylani-

line, which was added to 100 mL of 0.1 M sodium phosphate buffer, pH 7.0,

containing 57 mL of a 140 mg mL21 solution of horseradish peroxidase. The

absorbance was measured at a wavelength of 550 nm. For assay in a microtiter

plate format, volumes were reduced to one-half the microfuge assay reaction

size.

An alternative assay for release of H2O2 as a measure of oxalate oxidase

activity was performed with an Amplex Red kit (Molecular Probes, Eugene,

OR). Amplex Red in the presence of H2O2 and horseradish peroxidase forms

the fluorescent compound resorufin. For the fluorescent assay, leaf discs were

incubated in microtiter wells with the same assay buffer as described above.

After incubation of leaf discs with oxalic acid substrate, a 20-mL aliquot of each

sample was transferred with a multichannel pipettor to a fresh plate and

brought to a volume of 50 mL with kit reaction buffer. To start the detection

reaction, 50 mL of the Amplex Red/horseradish peroxidase reagent was

added and incubated for 30 min in the dark. Fluorescence was detected in

a plate reader (Bio-Tek Instruments, Winooski, VT), using a 530-nm excitation

filter and 590-nm emission filter. A standard curve allowed calculation of the

total H2O2 released. The products of the Amplex Red reaction can also be

measured spectrophotometrically at 550 nm due to the high extinction

coefficient.

Oxalic Acid Bioassays

Leaflet assays were conducted to assess the ability of oxalate oxidase

expression to prevent damage in response to application of oxalic acid to plant

tissue. Detached peanut leaflets were arranged on an inverted weigh boat in

15-cm petri dishes containing dampened paper towels. Eight leaflets were

used for each plant line, one for each concentration of oxalic acid. Each leaflet

was wounded in four locations on the abaxial surface with an 18-gauge

needle, and 15 mL of oxalic acid was applied to each wound. For oxalic acid

concentrations in the 0 to 200 mM range, the leaflets were incubated for 6 h at

room temperature. For concentrations in the 0 to 10 mM range, leaflets were

incubated for 48 h at room temperature. To quantify lesion size, leaflets were

washed and viewed with a Zeiss Stemi SV 11 dissecting microscope (Carl

Zeiss, Jena, Germany). Images were recorded with an attached Scion video

camera and imaging software (Scion, Frederick, MD). The lesion area was

traced with the computer mouse on the image displayed on the computer

monitor. The delimited area was calculated in square pixels by the software

package and converted to mm2.

Fungal Bioassays

Fungal assays were performed using detached leaflets inoculated with an

agar plug of S. minor mycelia. S. minor cultures were grown on thin potato

dextrose agar plates and 5-mm plugs taken from the actively growing edge.

Leaflets were wounded with an 18-gauge needle, and plugs were placed on

the adaxial surface, near the midvein. Eight leaflets were inoculated for each

plant line tested using a minimal quantity of agar in each plug. The plates

were incubated for 48 h at 19�C, and lesion area was measured as in the oxalic acid assays above.

Livingstone et al.

1360 Plant Physiol. Vol. 137, 2005 https://plantphysiol.orgDownloaded on February 20, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

ACKNOWLEDGMENT

We thank Dr. Carla Hegeman for assistance in cloning the oxalate oxidase

cDNA.

Received November 30, 2004; returned for revision January 24, 2005; accepted

January 30, 2005.

LITERATURE CITED

Bateman DF, Beer SV (1965) Simultaneous production and synergistic

action of oxalic acid and polygalacturonase during pathogenesis by

Sclerotium rolfsii. Phytopathology 55: 204–211

Bennett AR, Hindal DF (1989) Mycelial growth and oxalate production by

five strains of Cryphonectria parasitica in selected liquid culture media.

Mycologia 81: 554–560

Berna A, Bernier F (1999) Regulation by biotic and abiotic stress of a wheat

germin gene encoding oxalate oxidase, a H2O2-producing enzyme. Plant

Mol Biol 39: 539–549

Cessna SG, Sears VE, Dickman MB, Low PS (2000) Oxalic acid, a patho-

genicity factor for Sclerotinia sclerotiorum, suppresses the oxidative burst

of the host plant. Plant Cell 12: 2191–2199

Chenault KD, Burns JA, Melouk HA, Payton ME (2002) Hydrolase

activity in transgenic peanut. Peanut Sci 29: 89–95

Chiriboga J (1966) Purification and properties of oxalic acid oxidase. Arch

Biochem Biophys 116: 516–523

Dessalegne L, Wetten AC, Caligari PDS (1997) Production of transgenic

tomatoes expressing oxalate oxidase. Acta Hortic 447: 457–458

Donaldson PA, Anderson T, Lane BG, Davidson AL, Simmonds DH

(2001) Soybean plants expressing an active oligomeric oxalate oxidase

from the wheat gf-2.8 (germin) gene are resistant to the oxalate-secreting

pathogen Sclerotinia sclerotiorum. Physiol Mol Plant Pathol 59: 297–307

Dumas B, Freyssinet G, Pallett KE (1995) Tissue-specific expression of

germin-like oxalate oxidase during development and fungal infection of

barley seedlings. Plant Physiol 107: 1091–1096

Dutton MV, Evans CS (1996) Oxalate production by fungi: its role in

pathogenicity and ecology in the soil environment. Can J Microbiol 42:

881–895

Godoy G, Steadman JR, Dickman MB, Dam R (1990) Use of mutants to

demonstrate the role of oxalic acid in pathogenicity of Sclerotinia

sclerotiorum on Phaseolus vulgaris. Physiol Mol Plant Pathol 37: 179–191

Guimarães RL, Stotz HU (2004) Oxalate production by Sclerotinia sclero-

tiorum deregulates guard cells during infection. Plant Physiol 136:

3703–3711

Havir EA, Anagnostakis SL (1985) Oxaloacetate acetylhydrolase activity in

virulent and hypovirulent strains of Endothia (Cryphonectria) parasitica.

Physiol Plant Pathol 26: 1–9

Hollowell JE, Shew BB (2003) Evaluating isolate aggressiveness and host

resistance from peanut leaflet inoculations with Sclerotinia minor. Plant

Dis 87: 402–406

Hollowell JE, Smith MR, Shew BB (2001) Oxalic acid production by nine

isolates of Sclerotinia minor. Proc Am Peanut Res Ed Soc 33: 24

Hu X, Bidney DL, Yalpani N, Duvick JP, Crasta O, Folkerts O, Lu G (2003)

Overexpression of a gene encoding hydrogen peroxide-generating

oxalate oxidase evokes defense responses in sunflower. Plant Physiol

133: 170–181

Hurkman WJ, Lane BG, Tanaka CK (1994) Nucleotide sequence of

a transcript encoding a germin-like protein that is present in salt-

stressed barley (Hordeum vulgare L.) roots. Plant Physiol 104: 803–804

Ikotun T (1984) Production of oxalic acid by Penicillium oxalicum in culture

and in infected yam tissue and interaction with macerating enzyme.

Mycopathologia 88: 9–14

Kachroo A, He Z, Patkar R, Zhu Q, Zhong J, Li D, Ronald P, Lamb C,

Chattoo BB (2003) Induction of H2O2 in transgenic rice leads to cell

death and enhanced resistance to both bacterial and fungal pathogens.

Transgenic Res 12: 577–586

Kesarwani M, Azam M, Natarajan K, Mehta A, Datta A (2000) An oxalate

decarboxylase from Collybia velutipes: molecular cloning and its over-

expression to confer resistance to fungal infection in transgenic tobacco

and tomato. J Biol Chem 275: 7230–7238

Kolkman JM, Kelly JD (2000) An indirect test using oxalate to determine

physiological resistance to white mold in common bean. Crop Sci 40:

281–285

Kurian P, Stelzig DA (1979) The synergistic role of oxalic acid and

endopolygalacturonase in bean leaves infected by Cristulariella pyrami-

dalis. Phytopathology 69: 1301–1304

Lane BG, Dunwell JM, Ray JA, Schmitt MR, Cuming AC (1993) Germin,

a protein marker of early plant development, is an oxalate oxidase. J Biol

Chem 268: 12239–12242

Lane BG (1994) Oxalate, germin, and the extracellular matrix of higher

plants. FASEB J 5: 294–301

Lane BG (2000) Oxalate oxidases and differentiating surface structure in

wheat: germins. Biochem J 349: 309–321

Levine A, Tenhaken R, Dixon R, Lamb C (1994) H2O2 from the oxidative

burst orchestrates the plant hypersensitive disease resistance response.

Cell 79: 583–593

Li J, Hegeman CE, Hanlon RW, Lacy GH, Denbow DM, Grabau EA (1997)

Secretion of active recombinant phytase from soybean cell-suspension

cultures. Plant Physiol 114: 1103–1111

Liang H, Maynard CA, Allen RD, Powell WA (2001) Increased Septoria

musiva resistance in transgenic hybrid poplar leaves expressing a wheat

oxalate oxidase gene. Plant Mol Biol 45: 619–629

Livingstone DM, Birch RG (1999) Efficient transformation and regenera-

tion of diverse cultivars of peanut (Arachis hypogaea L.) by particle

bombardment into embryogenic callus produced from mature seeds.

Mol Breed 5: 43–51

Lu G (2003) Engineering Sclerotinia sclerotiorum resistance in oilseed crops.

Afr J Biotechnol 2: 509–516

Lumsden RD (1979) Histology and physiology of pathogenesis in plant

diseases caused by Sclerotinia species. Phytopathology 69: 890–896

Maxwell DP, Lumsden RD (1970) Oxalic acid production by Sclero-

tinia sclerotiorum in infected bean and in culture. Phytopathology 60:

1395–1398

Murashige T, Skoog F (1962) A revised medium for rapid growth and

bioassays with tobacco tissue cultures. Physiol Plant 15: 473–497

Murray MG, Thompson WF (1980) Rapid isolation of high molecular

weight DNA. Nucleic Acids Res 8: 4321–4325

Noyes RD, Hancock JG (1981) Role of oxalic acid in the Sclerotinia wilt of

sunflower. Physiol Plant Pathol 18: 123–132

Porter DM, Melouk HA (1997) Sclerotinia blight. In N Kokkalis-Burelle,

DM Porter, R Rodriguez-Kabana, DH Smith, P Subrahmanyam, eds,

Compendium of Peanut Diseases. APS Press, St. Paul, pp 34–36

Pundir CS (1991) Purification and properties of oxalate oxidase from

Sorghum leaves. Phytochemistry 30: 1065–1067

Ramputh AI, Arnason JT, Cass L, Simmonds JA (2002) Reduced herbivory

of the European corn borer (Ostrinia nubilalis) on corn transformed with

germin, a wheat oxalate oxidase gene. Plant Sci 162: 431–440

Rao DV, Tewari JP (1987) Production of oxalic acid by Mycena citri-

color, causal agent of American leaf spot of coffee. Phytopathology 77:

780–785

Ritschkoff A-C, Rättö M, Buchert J, Viikari L (1995) Effect of carbon

source on the production of oxalic acid and hydrogen peroxide by

brown-rot fungus Poria placenta. J Biotechnol 40: 179–186

Rollins JA (2003) The Sclerotinia sclerotiorum Pac 1 gene is required for

sclerotial development and virulence. Mol Plant-Microbe Interact 16:

785–795

Sambrook J, Fritsch EF, Maniatis T (1989) Molecular Cloning: A Labora-

tory Manual, Ed 2. Cold Spring Harbor Laboratory Press, Cold Spring

Harbor, NY

Schweizer P, Christoffel A, Dudler R (1999) Transient expression of

members of the germin-like gene family in epidermal cells of wheat

confers disease resistance. Plant J 20: 541–552

Simmonds J, Cass L, Routly E, Hubbard K, Donaldson P, Bancroft B,

Davidson A, Hubbard S, Simmonds D (2004) Oxalate oxidase: a novel

reporter gene for monocot and dicot transformations. Mol Breed 13:

79–91

Smith FD, Phipps PM, Stipes RJ (1992) Fluazinam: a new fungicide for

control of sclerotinia blight and other soil borne diseases of peanut.

Peanut Sci 19: 115–120

Stone HE, Armentrout VN (1985) Production of oxalic acid by Sclerotium

cepivorum during infection of onion. Mycologia 77: 526–530

Sugiura M, Yamamura H, Harano K, Sasaki M, Morikawa M, Tsuboi M

(1979) Purification and properties of oxalate oxidase from barley seed-

lings. Chem Pharm Bull (Tokyo) 27: 2003–2007

Oxalate Oxidase-Mediated Disease Resistance in Peanut

Plant Physiol. Vol. 137, 2005 1361 https://plantphysiol.orgDownloaded on February 20, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.

Thompson C, Dunwell JM, Johnstone CE, Lay V, Schmitt M, Watson H,

Nisbet G (1995) Degradation of oxalic acid by transgenic oilseed rape

plants expressing oxalate oxidase. Euphytica 85: 169–172

Wei YD, Zhang Z, Anderson CH, Schmelzer E, Gregerson PL, Collinge

DB, Smedegaard-Peterson V, Thordal-Christensen H (1998) An

epidermis/papilla-specific oxalate oxidase-like protein in the defense

response of barley attacked by the powdery mildew fungus. Plant Mol

Biol 36: 101–112

Zaghmout OF, Dang PD, Allen RD (1997) Expression of oxalate oxidase in

transgenic plants provides resistance to oxalic acid and oxalate-

producing fungi (abstract no. 1152). Plant Physiol (Suppl) 114: 227

Zhang Z, Collinge DB, Thordal-Christensen H (1995) Germin-like oxalate

oxidase, a H2O2-producing enzyme, accumulates in barley attacked by

the powdery mildew fungus. Plant J 8: 139–145

Zhou F, Zhang Z, Gregersen PL, Mikkelsen JD, de Neergaard E, Collinge

DB, Thordal-Christensen H (1998) Molecular characterization of the

oxalate oxidase involved in the response of barley to the powdery

mildew fungus. Plant Physiol 117: 33–41

Zhu Q, Maher EA, Masoud S, Dixon RA, Lamb CJ (1994) Enhanced

protection against fungal attack by constitutive co-expression of chiti-

nase and glucanase genes in transgenic tobacco. Nat Biotechnol 12:

807–812

Livingstone et al.

1362 Plant Physiol. Vol. 137, 2005 https://plantphysiol.orgDownloaded on February 20, 2021. - Published by

Copyright (c) 2020 American Society of Plant Biologists. All rights reserved.