Golgi 1 page literature review
A R T I C L E S
A traffic-activated Golgi-based signalling circuit coordinates the secretory pathway Teodoro Pulvirenti1,3,4, Monica Giannotta1,4, Mariagrazia Capestrano1, Mirco Capitani1, Antonio Pisanu1, Roman S. Polishchuk1, Enrica San Pietro1, Galina V. Beznoussenko1, Alexander A. Mironov1, Gabriele Turacchio1, Victor W. Hsu2, Michele Sallese1,5,6 and Alberto Luini1,5,6
As with other complex cellular functions, intracellular membrane transport involves the coordinated engagement of a series of organelles and machineries; however, the molecular basis of this coordination is unknown. Here we describe a Golgi-based signalling system that is activated by traffic and is involved in monitoring and balancing trafficking rates into and out of the Golgi complex. We provide evidence that the traffic signal is due to protein chaperones that leave the endoplasmic reticulum and reach the Golgi complex where they bind to the KDEL receptor. This initiates a signalling reaction that includes the activation of a Golgi pool of Src kinases and a phosphorylation cascade that in turn activates intra-Golgi trafficking, thereby maintaining the dynamic equilibrium of the Golgi complex. The concepts emerging from this study should help to understand the control circuits that coordinate high-order cellular functions.
Complex subcellular systems coordinate the activities of their vari- ous internal components to execute their physiological functions effectively. This is also true for the intracellular trafficking pathways, where a series of anatomically separate compartments constantly exchange large fluxes of cargo molecules and membranes. For opti- mal activity of such a system, and to prevent structural and functional disruption, membrane fluxes across trafficking organelles must be precisely balanced. However, the molecular basis of this coordination has received little attention and is not well understood.
Here, we have sought to identify the molecular circuits that coor- dinate activities of different compartments in the secretory pathway. Although several types of autoregulatory mechanisms are possi- ble1, we chose to examine a specific model of regulation accord- ing to which these circuits involve signalling cascades analogous to those operating at the plasma membrane. This signalling would be triggered by transport-related events on the cytosolic surface of endomembranes and would act to regulate the function of traffick- ing organelles, thus coordinating their transport rates. The main argument in support of this hypothesis is that a large number of diverse transduction molecules, including G proteins, kinases and phospholipases, reside on trafficking organelles, and particularly on the Golgi complex where they would be ideally positioned to participate in local regulatory circuits. These observations and their
implications have been discussed previously2,3. Although appeal- ing, such an ‘inter-organelle’ cross-regulation model lacks direct experimental support, and the presence of transduction molecules on endomembranes can be explained in other ways. For example, these molecules may simply be relay devices in signalling networks that initiate at the plasma membrane and are involved in the control of trafficking4–7 or other functions (for example, cell growth and motility6,8–10). Also, these signalling proteins may only pass through the Golgi complex to the plasma membrane after their synthesis at the endoplasmic reticulum (ER)3,11.
To test the hypothesis of traffic-initiated inter-organelle signal- ling, we used specific traffic-synchronization protocols to control the intensity of traffic from the ER to the Golgi complex12, and then we examined whether the arrival of a traffic ‘pulse’ at the Golgi com- plex elicits a signalling response on the Golgi itself. We found that the Golgi complex can indeed sense incoming traffic from the ER and respond by activating specific signalling pathways that exert an activatory action on intra-Golgi trafficking. We outline the molec- ular composition and the mode of operation of this Golgi-based traffic-detection-and-response system. The principles that emerge from this study are likely to offer guidance for future analyses of the functional connectivity within and between complex cellular functional modules.
1Laboratory of Membrane Traffic, Department of Cell Biology and Oncology, Consorzio Mario Negri Sud, 66030 Santa Maria Imbaro (Chieti), Italy. 2Division of Rheumatology, Immunology and Allergy, Brigham and Women’s Hospital, and Department of Medicine, Harvard Medical School, Boston, MA 02115, USA. 3Current address: Cell Biology Program, Sloan-Kettering Institute for Cancer Research, Memorial Sloan-Kettering Cancer Center, New York, NY 90021, USA. 4These authors contributed equally to this work. 5These principal investigators contributed equally to this work 6Correspondence should be addressed to A. L. or M. S. (luini@negrisud.it; sallese@negrisud.it)
Received 28 March 2008; accepted 26 June 2008; published online 20 July 2008; DOI: 10.1038/ncb1751
9 1 2 nature cell biology volume 10 | number 8 | AuGuST 2008
© 2008 Macmillan Publishers Limited. All rights reserved.
A R T I C L E S
RESULTS Traffic induces Tyr phosphorylation on the Golgi complex To generate traffic pulses at the Golgi, we used two synchronizable secretory proteins12,13: procollagen-I (PC-I) and the temperature- sensitive mutant of the vesicular stomatitis virus G glycoprotein (VSVG). At 40 °C (and in the absence of ascorbate for PC-I14), these proteins cannot fold completely so their exit from the ER is blocked and they are cleared from the rest of the secretory pathway. When cells are cooled to 32 °C, PC-I and VSVG fold and leave the ER, resulting in a ‘pulse’ of secretory cargo that crosses the secretory pathway synchronously13.
To examine whether a traffic pulse can elicit a signalling response on the Golgi, we monitored the levels of phospho-Tyr (p-Tyr), as Tyr phosphorylation is involved in many signal transduction cascades and may provide a general readout for signalling. We first generated
a PC-I traffic pulse in human skin fibroblasts (HF cells) where PC-I is the most abundant cargo13,14. Immunofluorescence microscopy showed that during the 40 °C block, PC-I was diffusely distributed in the ER, whereas p-Tyr was mainly present in fine punctate structures scattered throughout the cytoplasm15 (Fig. 1a, b). A few minutes after removing the trafficking block (at 32 °C), PC-I reached the Golgi complex and its levels continued to increase for a further 30 min (Fig. 1a, d). At the same time, an increase in p-Tyr, paralleling that of PC-I, was observed in the Golgi area, but not in other parts of the cell (Fig. 1b, d). After 60 min, however, the p-Tyr signal seemed to spread to the cell periphery (data not shown). We also compared the traffic-induced p-Tyr response with that caused by growth factors. These agents induced the expected p-Tyr increase, but mainly at the plasma membrane (Supplementary Information, Fig. S1a) and never on the Golgi complex.
GM130 PC-I Merge PC-I
0 7 30
40°C
Time at 32 °C (min)
Time at 32 °C (min)
Time at 32 °C (min)
p-Tyr p-Tyr
0 7 30
40°C 32°C
0 30
40°C 32°C + SU6656
160
120
80
40
0
******
***
0 7 30 60
IF in
te n
si ty
( A
U )
a
b c d
32 °C
Time at 32 °C (min)
Figure 1 PC-I arrival at the Golgi is associated with Tyr phosphorylation in the Golgi area. (a) Time-course of PC-I in the Golgi area. Cells were incubated for 3 h at 40 °C (temperature block), shifted to 32 °C (block release) for the indicated times and then fixed and double-stained for GM130 (cis-Golgi marker, for Golgi definition; green) and PC-I (red). (b) Time course of Tyr phosphorylation in the Golgi area. Cells were treated as in a and double-stained for GM130 (data not shown) and p-Tyr (green). (c) Traffic-induced Tyr phosphorylation in the Golgi area under SFK inhibition. Cells underwent the traffic pulse in a, with SU6656 (10 µM) added 30 min before temperature block release, and were processed for p-Tyr immunofluorescence; inhibition of Tyr phosphorylation in the Golgi area was nearly complete. (d) Quantification of data illustrated in a, b.
Both the total p-Tyr-related immunofluorescence signal in the Golgi and non-Golgi areas and the immunofluorescence intensities (total signal over surface area) in the same areas were determined; immunofluorescence (IF) intensities are shown. Considering the total immunofluorescence signal across the whole cell, the increased immunofluorescence in trafficking cells (25–30%) is completely accounted for by the increased immunofluorescence in the Golgi area (350%). P-Tyr (blue circles) and PC-I (red squares) in the Golgi area, and p-Tyr in non-Golgi areas (green triangles; control). Data are means ±s.e.m. of four independent experiments, each assessing 10–20 cells. ***P < 0.001, compared with 40 °C control at zero time (ANOVA). Immunofluorescence intensities are expressed as arbitrary units (AU). Scale bars, 10 µm.
nature cell biology volume 10 | number 8 | AuGuST 2008 9 1 3
© 2008 Macmillan Publishers Limited. All rights reserved.
A R T I C L E S
p-Tyra p-Tyr
116 96
52
35
29
116 96
52
35
29
Control 40 °C 32 °C 40 °C 32 °C
SU6656 40 °C 32 °C
1
2
3
32 °C
p-SFKs
SFKs
Control 40 °C 32 °C 40 °C 32 °C
SU6656
40 °C 32 °C
p-Yes
p-Src/Fyn p-Lyn
b c
d p-SFKs p-SFKs SFKs
0 30 0 30 0 30
40°C 32°C 40°C 32°C + SU6656 40°C 32°C
e f
p-SFKs
0 30
40°C 32°C
GG
g 14
12
10
8
6
N u
m b
e r
o f
g o
ld p
a rt
ic le
s p
e r
c e ll
4
2
0
h 40 °C 32 °C
G ol
gi
P M
E nd
os om
e
E R
C yt
os ol
M r (K) M
r (K)
Time at 32 °C (min)
Time at 32 °C (min)
Time at 32 °C (min) Time at 32 °C (min)
Figure 2 Traffic stimulates Tyr phosphorylation on many proteins and activates SFKs in the Golgi area. (a) Traffic-pulse effects on cellular Tyr phosphorylation. HF cells were incubated for 3 h at 40 °C, shifted to 32 °C for 30 min and then homogenized; where indicated, SU6656 (10 µM) was added 30 min before temperature shift. The p-Tyr patterns were analysed by immunoblotting with an anti-p-Tyr antibody. (b) HeLa cells were processed as in a. The panel on the right shows key sectors of the p-Tyr pattern (at 32 °C) separated on a high-resolution gel, with three clusters of bands (cluster 1, 108K–130K; cluster 2, 70K–83K; cluster 3, 53K–62K) with increased Tyr phosphorylated under trafficking. (c) Traffic-pulse effects on SFK phosphorylation. HF cells underwent the traffic pulse in a and were analysed by immunoblotting for total SFKs (middle panel) and their phosphorylated (at Tyr 419) active forms p-SFKs (upper panel). Lower panel: control samples separated on high- resolution gel indicate that p-Yes and p-Src and/or p-Fyn (according to the
relative molecular mass) are the SFKs activated by trafficking in HF cells. (d, e) The traffic pulse activates SFKs in the Golgi area. HF cells were treated as in a and processed for p-SFKs immunofluorescence. (f) The traffic pulse does not modify intracellular SFK localization in the Golgi area. HF cells were treated as in a and processed for SFK immunofluorescence. Data are representative of at least three independent experiments, each assessing 10–20 cells (a–f). (g) Ultrastructural localization of traffic-induced p-SFKs on the Golgi complex. COS7 cells were treated as in a and processed for immuno-EM labelling of p-SFKs, using the gold-enhance technique. G, Golgi complex. (h) Quantification of traffic-induced p-SFKs illustrated in g. Data are means of two independent experiments, each of which involved 10–20 measurements, with a variability that never exceeded 10% of the means. For all immunofluorescence analyses, the Golgi area was defined by co- immunostaining with GM130. Scale bars, 10 µm (d–f) and 200 nm (g).
9 1 4 nature cell biology volume 10 | number 8 | AuGuST 2008
© 2008 Macmillan Publishers Limited. All rights reserved.
A R T I C L E S
Traffic induces a complex phosphorylation pattern that is mediated by Src family kinases To characterize the proteins that are Tyr-phosphorylated by the traffic pulse, we homogenised HF cells either during the traffic block or 30 min after traffic release, and probed them with an anti-p-Tyr antibody by western blotting. Several p-Tyr bands were consistently stronger in traf- ficking than in quiescent HF cells (Fig. 2a), and a similar p-Tyr pattern was seen in other cell types. This pattern included 12 main traffic-stim- ulated bands that formed three clusters with relative molecular masses of 108,000–130,000, 70,000–83,000 and 53,000–62,000 (M
r(K); Fig. 2b, insets; Supplementary Information, Fig. S2f). These effects differed from those induced by growth factors (Supplementary Information, Fig. S1b), further underscoring the distinct nature of these stimuli.
The molecular masses in the 53K–62K cluster are typical of Src fam- ily kinases (SFKs). At least nine members of this family16 are present in different combinations in all animal cells (Supplementary Information,
Fig. S2a). They are involved in many signal transduction pathways and cellular functions, and are located in several cellular compartments. In particular, SFKs localize on the Golgi complex in many cell lines17–21, including, HF, HeLa and COS7 cells, which we have tested (Supplementary Information, Fig. S2b, c). We thus examined directly whether traffic could induce the phosphorylation of SFKs in HF cells. To this end, we used an antibody that selectively recognizes p-Tyr 419 in human Src (or the equivalent p-Tyr in other SFKs22). Indeed, traffic pulses markedly increased the levels of p-Tyr 419 in SFKs (p-SFKs; Fig. 2c, upper panel), and this increase was inhibited by the selective SFK inhibitor SU665623,24. As phosphorylation on Tyr 419 is always associated with catalytic activa- tion of SFKs16, these data indicate that traffic activates SFKs. On the basis of molecular mass, more than one SFK was Tyr-phosphorylated by the traffic pulse (Yes and Src and/or Fyn, but not Lyn; Fig. 2c).
Given the role of SFKs in many phosphorylation cascades, we used SU6656 to determine whether the whole p-Tyr pattern induced by
a
K D
E L
-R p
-S F
K s
S T
B K
D E
L
0 60
19.5 °C 37 °C
120
b
c HRP p-SFKs
ss H
R P
K D
E L
ss H
R P
KDEL-R p-SFKs
L o
w H
ig h
d
180
150
120
90
IF in
te n
si ty
( A
U )
60
30
0
STBKDEL
p-SFKs
300
250
200
150
IF in
te n
si ty
( A
U )
100
50
0
STB p-SFKs
0 60 120 (min)
(min)0 60 120
37 °C
37 °C
e 140 120
100
80
p -S
F K
s IF
in te
n si
ty ( A
U )
60
40
0
20
ss H
R P
K D
E L
ss H
R P
H ig
h
Lo w
Time at 37 °C (min)
******
***
**
Figure 3 Activation of the KDEL-R leads to activation of SFKs in the Golgi area. (a) On reaching the Golgi area, STBKDEL activates the KDEL-R and SFKs. Src-transfected Vero cells were incubated with Alexa488-conjugated STBKDEL and stained for p-SFKs and the KDEL-R. Synchronized retrograde movement of STBKDEL was achieved by its binding (4 °C) and accumulation in the endosomal compartment (19.5 °C) followed by its release (37 °C) for 0, 60 and 120 min. (b) Quantification of data illustrated in a, showing accumulation in the Golgi area of p-SFKs with STBKDEL (upper panel) and wild-type STB (lower panel). Data are means ± s.e.m. of three independent experiments, each assessing 10–20 cells. **P < 0.01, ***P < 0.001, versus 19.5 °C control at zero time (ANOVA analysis). The quantification of p-SFKs at 120 min used the Golgi marker GM130 staining as reference
area (data not shown). (c) ssHRPKDEL expressed in the secretory pathway activates SFKs in the Golgi area. COS7 cells were co-transfected for 16 h with Src and ssHRPKDEL or ssHRP, fixed and stained for HRP and p-SFKs. (d) KDEL-R overexpression activates SFKs in the Golgi area. COS7 cells were transfected for 16 h with KDEL-R–GFP, fixed and stained for p-SFKs, with low and high KDEL-R–GFP (KDEL-R)-expressing cells chosen. The high-expressing cells showed threefold more KDEL-R–GFP than the low expressing cells. (e) Quantification of data illustrated in c and d. Data are means from two independent experiments, each assessing 10–20 measurements with a variability that never exceeded 10% of the means. All immunofluorescence (IF) intensities are expressed as arbitrary units (AU). Scale bars, 10 µm.
nature cell biology volume 10 | number 8 | AuGuST 2008 9 1 5
© 2008 Macmillan Publishers Limited. All rights reserved.
A R T I C L E S
trafficking depends on the activation of SFKs. SU6656 inhibited most of the traffic-induced p-Tyr bands (Fig. 2a), indicating that SFKs con- trol this phosphorylation cascade. SU6656 also inhibited the traffic- induced increase in the p-Tyr immunofluorescence signal on the Golgi complex (Fig. 1c).
We then examined whether the increase in p-SFKs during traf- ficking was restricted to the Golgi complex (Fig. 2d), as seen for the p-Tyr signal (Fig. 1b). As established by immunofluorescence and immunoelectron microscopy (immuno-EM), this stimulated p-SFK signal localized exclusively to the Golgi, in particular, to the cis- and trans-Golgi poles and at the cisterna rims, but not on the stack core (Fig. 2g, h; Supplementary Information, Text S1). These increases were markedly inhibited by SU6656 (Fig. 2e). We also used a phos- phorylation-insensitive anti-SFK antibody, which interacts with Src, Yes, Fyn and Fgr, to examine the effects of traffic on the location of the total cellular SFK pool. A strong signal was again detectable in the Golgi area; however, its levels were unaffected by traffic (Fig. 2f ), indicating that traffic phosphorylates a pool of SFKs that is already located on the Golgi complex.
These experiments were carried out in HF cells because they are specialized PC-I secretors. However, most cell types secrete one or more forms of procollagen25,26 and may therefore show activation of the
Golgi-SFKs if subjected to a traffic synchronization protocol. Indeed, other cell lines (NRK, NIH 3T3, COS7 and Vero cells) subjected to the same protocol behaved similarly to HF cells, confirming that traffic- induced SFK activation on the Golgi complex occurs in several cell lines (Supplementary Information, Figs S2f, g, S3 and Text S2).
We also carried out a series of control experiments to ensure that the Golgi p-SFK response is not induced or influenced by the 40–32 °C tem- perature shift. The results confirmed the specific traffic-dependence of this SFKs activation (Supplementary Information, Fig. S4 and Text S2).
SFK activation on the Golgi complex is mediated by the KDEL receptor The data described above suggest the existence of a Golgi-based traffic- detection system that is activated by the arrival of ER-derived carriers at the cis-Golgi, and causes SFK activation on the Golgi complex itself. We hypothesized that this mechanism should rely on molecules that are invariant across cell types, rather than on cell-specific cargo pro- teins. These molecules include the KDEL receptor (KDEL-R; a seven- transmembrane-domain-containing protein27) and the ER chaperones28. Chaperones leave the ER and reach the Golgi complex during trafficking, and there they bind to the KDEL-R through their C-terminal KDEL motif28,29. Once bound, the KDEL-R moves retrogradely, thus recycling
a Non-related IgGs Anti-KDEL-R Ab
0 20
40 °C 32 °C
0 20
40 °C 32 °C
p –S
F K
s V
S V
G –G
F P
b
c
K D
E L -R
HRP p-SFKs
K D
E L -R
D 1 9 3 N
K D
E L -R
D 1 9 3 N
K D
E L -R
d VSVG p-SFKs
0 20
40 °C 32 °C
20
p -S
F K
s IF
in te
n si
ty ( A
U ) 140
120
100
80
60
40
0
*** ***
20
***
A C D
Time at 32 °C (min)
Time at 32 °C (min)
Figure 4 Inhibition of the KDEL-R impairs traffic-induced SFKs activation in the Golgi area. (a) Microinjection of an antibody against the C terminus of the KDEL-R blocks SFK activation in the Golgi area. COS7 cells were co-transfected with Src and VSVG–GFP, and microinjected (during the 40 °C temperature block) with unrelated IgGs or an anti-KDEL-R antibody (Ab; clone 10C3). After a 60-min recovery, the block was released (32 °C) for 20 min and cells stained for p-SFKs. (b) Quantification of p-SFKs in the Golgi area as illustrated in a (column A), c (column C) and d (column D). Data are means ± s.e.m.of four independent experiments, each assessing 10–20 cells. Open columns, respective controls; filled columns, anti-KDEL-R antibody microinjection (A) and KDEL-RD193N transfection (C, D). ***P < 0.001, compared with respective controls (Student’s
t-test). Active SFK immunofluorescence (IF) intensities expressed as arbitrary units (AU). (c) The KDEL-RD193N mutant blocks SFKs activation in the Golgi area induced by ssHRPKDEL. COS7 cells were co-transfected with Src and ssHRPKDEL, and with KDEL-RD193N–GFP (KDEL-RD193N) or KDEL- R–GFP (KDEL-R), then fixed and stained for HRP and p-SFKs. (d) The KDEL-RD193N mutant blocked SFK activation in the Golgi area that was induced by a VSVG traffic pulse. COS7 cells were co-transfected with Src and KDEL-RD193N–GFP (KDEL-RD193N) or KDEL-R–GFP (KDEL-R), and infected with VSV. The cells were subjected to the VSVG traffic pulse and examined for VSVG and p-SFKs by immunofluorescence microscopy. Perinuclear KDEL-R localization was used to define the Golgi area. Scale bars, 10 µm.
9 1 6 nature cell biology volume 10 | number 8 | AuGuST 2008
© 2008 Macmillan Publishers Limited. All rights reserved.
A R T I C L E S
the bound chaperones to the ER28–32. This cycle is similar to traffick- ing of signalling receptors at the plasma membrane. On the basis of its transmembrane structure and its participation in long-term mitogenic responses to prolonged ER stress, the KDEL-R has been hypothesised to have a signalling function33–35.
To test the idea that the KDEL-R and chaperones participate in traffic- induced Golgi-SFK activation, we addressed two main questions. One was whether direct binding of the KDEL-R by specific ligands could stimulate SFKs on the Golgi complex. To determine this, we first used the non-toxic B-fragment of Shiga toxin (STB) engineered to contain a C terminus KDEL sequence (STBKDEL)36 as a ligand. Both STB and STBKDEL enter cells via the endocytic pathway. They are then transported retro- gradely through the Golgi complex where STBKDEL, but not STB, binds the KDEL-R and then moves to the ER36–38. The arrival of STBKDEL at the Golgi complex induced SFK activation in the Golgi area (Fig. 3a, b), whereas STB moved retrogradely to the Golgi complex (albeit slightly more slowly than STBKDEL), but had no effect on Golgi-SFKs (Fig. 3b). We next used another KDEL-R ligand: a soluble, secreted variant of horse- radish peroxidase (ssHRP) bearing the KDEL motif at its C terminus (ssHRPKDEL)39, with ssHRP alone as control. In COS7 cells transfected with ssHRPKDEL, SFKs in the Golgi area were activated, whereas in cells transfected with ssHRP, SFK activation was much lower (Fig. 3c, e). Overexpression of the KDEL-R is known to induce receptor self-acti- vation and recycling to the ER40. Indeed, at high levels of expression, the
KDEL-R partially redistributed to the ER, and this effect was associated with activation of SFKs in the Golgi area (Fig. 3d, e). Collectively, these data show that direct activation of the KDEL-R induces the activation of SFKs on the Golgi complex.
The second question was whether inhibition of the KDEL-R can abol- ish traffic-induced activation of Golgi SFKs. We used several approaches to inhibit this receptor. One was to microinject COS7 cells with an antibody against the cytosolic C-tail of the KDEL-R31. This prevented activation of SFKs in the Golgi area by a traffic pulse, whereas control antibodies had no effect (Fig. 4a, b). Second, we blocked the KDEL-R by transfecting cells with a mutant receptor (KDEL-RD193N) that can- not redistribute to the ER when bound to KDEL-bearing ligands41. The rationale here is that this defective protein may behave as a dominant- negative KDEL-R by dimerizing30 with the less abundant endogenous KDEL-R, and sequestering it in inactive complexes. As expected, SFK activation in the Golgi area occurred in control COS7 cells transfected with ssHRPKDEL, but was abolished in KDEL-RD193N-expressing cells (Fig. 4b, c), indicating that KDEL-RD193N behaves as a dominant-negative mutant, at least with respect to SFK activation by ssHRPKDEL. We thus examined whether KDEL-RD193N can also prevent traffic-induced activa- tion of Golgi-SFKs. Fig. 4b, d shows that this was indeed the case. Third, KDEL-R downregulation by siRNAs markedly reduced the activation of SFKs in the Golgi area in response to a traffic pulse (Supplementary Information, Fig. S5a–c). Thus, the KDEL-R is required for a traffic wave to induce the Golgi-SFK response.
A further series of experiments (described in Supplementary Information, Text S3) indicated that certain chaperones can be visu- alized in carriers leaving the ER, and that their arrival at the Golgi can activate KDEL-R recycling and SFK phosphorylation at the Golgi complex (Fig. S5d–f ).
Finally, we sought to determine how KDEL-R activates SFKs, by draw- ing on the structural analogy between the KDEL-R and seven-transmem- brane-domain receptors. As some of these receptors have been shown to bind and activate SFKs42, we used a two-hybrid assay system to investigate whether the KDEL-R and Src interact directly. The KDEL-R C-terminal domain (amino acids Ala 183–Ala 212 of the human sequence) interacted with Src in this assay (Fig. 5), suggesting that the KDEL-R may activate SFKs directly. However, this does not exclude the possibility that this interaction may be a part of a more complex mechanism.
In summary, traffic activates the SFKs on the Golgi complex but not at the cell periphery. This SFK activation is inhibited by various treat- ments that abolish KDEL-R function and is mimicked by expression of both natural and artificial (STBKDEL and ssHRPKDEL) ligands of the KDEL-R. Furthermore, KDEL-R can bind directly to Src. Together, these observations indicate that traffic activates the SFKs on the Golgi complex through the KDEL-R.
SFK activation on the Golgi complex is required for intra-Golgi transit during a traffic pulse We next wanted to determine whether SFKs are involved in the regula- tion of trafficking. Given the variable SFK repertoire in different cell lines (Supplementary Information, Fig. S2a), we first used chemical inhibitors that act on most of the SFKs (SU6656, Src kinase inhibitor I, PP1, PP2). These molecules belong to three different structural classes and are there- fore very unlikely to have overlapping off-target effects. At concentrations that block SFKs22, they did not inhibit ER-to-Golgi transport (Fig. 6a),
D D
O Q
D O
KDEL-R-C +
pGADT7
Src +
pGBKT7
Src +
KDEL-R-C
pGADT7-T +
pGBKT7-53
Figure 5 A direct interaction between Src and the KDEL-R, as revealed by the yeast two-hybrid assay. To investigate the molecular mechanisms through which the KDEL-R activates SFKs, we carried out a yeast two- hybrid assay between the KDEL-R C-terminal domain (KDEL-R-C, amino acids Ala 183–Ala 212 of the human sequence) and full-length Src. Assays were performed by mating the two yeast strains transformed with the KDEL-R and Src. The diploid yeasts expressing both proteins were selected on auxotrophic media lacking leucine and tryptophan (double drop-out, DDO panels). Furthermore, the diploid yeast grown on DDO were replica-plated on highly selective media lacking leucine, tryptophan, histidine and adenine (quadruple drop-out, QDO panels). In this system, only diploid yeasts bearing the two interacting proteins can grow on QDO media, indicating that Src can interact with the KDEL- R-C. When co-transformed with the empty vectors (Src + pGBKT7 and KDEL-R-C + pGADT7, respectively), Src and KDEL-R-C cells did not grow, confirming specificity of the result. The pGBKT7–53 + pGADT7-T panels show the positive control for the two interacting proteins.
nature cell biology volume 10 | number 8 | AuGuST 2008 9 1 7
© 2008 Macmillan Publishers Limited. All rights reserved.
A R T I C L E S
or the recycling of the KDEL-R from the Golgi complex to the ER24 (Supplementary Information, Fig. S6a). Instead, all four agents inhibited intra-Golgi trafficking (Fig. 6a, b). VSVG accumulated within the Golgi stack and did not reach the TGN (Supplementary Information, Fig. S6b), whereas an inactive structural analogue of PP1 (PP3) and an inhibitor of an unrelated kinase (for JNK, SP600125) had no effects (Fig. 6b). This inhibitor profile provides evidence for a role of SFKs in intra-Golgi traf- ficking43. Inhibitory effects of SU6656 were seen in all other cell types examined, including COS7, NRK, HeLa, HepG2, Vero and NIH 3T3 cells, and mouse embryo (8.5 day) fibroblasts (data not shown).
A further approach to study the role of SFKs in trafficking was to use siRNAs directed against the SFKs. We first used siRNAs against Src in COS7 cells where this kinase is present on the Golgi complex (Fig. 6c)
and is the main traffic-activated SFK (see Supplementary Information, Fig. S2h). Treatment with Src siRNAs (either pooled or used separately) reduced the Src levels and inhibited intra-Golgi trafficking (Fig. 6d, f ). A dominant-negative Src mutant inhibited trafficking in COS7 cells to an extent dependent on its expression levels (Fig. 6e, g), whereas a dom- inant-negative mutant of Lyn, which is not activated by traffic in these, cells had no effect (Fig. 6g; Supplementary Information, Fig. S2h).
We also examined SYF cells, a fibroblast cell line that is genetically depleted of Src, Fyn and Yes44 but shows normal secretory trafficking of VSVG24. We found that other SFK isoforms are present45 in these cells, and that intra-Golgi trafficking is inhibited by the same SFK inhibitors that are active in other cells. This indicates that traffic in SYF cells also depends on SFKs (Supplementary Information, Fig. S7).
a VSVG
S U
6 6
5 6
C o
n tr
o l
GM130 GM130 TGN46 0 15
40 °C 32 °C 45 60
120
100
80
V S
V G
I F
in te
n si
ty o
n P
M ( A
U )
60
40
0
*** 20
b
*** *** ***
Src Src/Giantin
c
C o
n tr
o l
C o
n tr
o l
S rc
s iR
N A
D N
S rc
0 60 0 60
40 °C 32 °C40 °C 32 °C
d e
120 100
80
V S
V G
I F
in te
n si
ty o
n P
M ( A
U )
60 40
0
***
20
f
140 160 180
120 100
80
V S
V G
I F
in te
n si
ty o
n P
M ( A
U )
60
40
0
**
20
140 g
C on
tr ol
S U
66 56
S K
I- 1
P P
1 P
P 2
P P
3 S
P 60
01 25
S rc
s iR
N A
C on
tr ol
D N
L yn
D N
S rc
C on
tr ol
Time at 32 °C (min)
Time at 32 °C (min) Time at 32 °C (min)
VSVGVSVG
Figure 6 Activation of SFKs is required for synchronized intra-Golgi trafficking. (a) SFK inhibition blocks transport of VSVG. COS7 cells were infected with VSV and kept at 40 °C for 3 h, with vehicle or SU6656 (5 µM) added for the final 30 min. The block was released (32 °C) for the indicated times. Panels 0, 15, 45 min: immunostaining for VSVG (red) and GM130 or TGN46 (green). Panels 60 min: VSVG arrival at the plasma membrane, as revealed by an antibody against the extracellular domain of VSVG. (b) VSVG transport is inhibited in SFK-inhibitor-treated cells. Quantification of VSVG transport in COS7 cells treated as in a, with vehicle (Control) or 5 µM SU6656, 10 µM PP1, PP2, Src kinase inhibitor 1 (SKI-1) and PP3, or 30 µM SP00125 added for the final 30 min (SU6656, SKI-1 and SP00125) or 3 h (PP1, PP2 and PP3) of the 40 °C block. Data are means ± s.e.m. of four independent experiments, each assessing 20–30 cells. (c) Endogenous Src localizes to the Golgi
complex in COS7 cells, as assessed by immunostaining with anti-Src (red) and anti-giantin (green) antibodies. The insets show magnification of the Golgi area. (d, e) Src-directed siRNAs and a dominant-negative (DN) Src inhibit VSVG transport. COS7 cells were transfected with SrcK295R (DN Src), or siRNAs for Src, and then VSV infected and processed as in a, with VSVG arrival at the plasma membrane (red) as in a, and immunostaining for total VSVG (green). (f, g) Quantification of the effects of Src-directed siRNAs and of SrcK295R (DN Src) transfection on VSVG transport in COS7 cells illustrated in d and e respectively. Data are means ± s.e.m. of four independent experiments, each assessing 20–30 cells. VSVG immunofluorescence (IF) intensities on the plasma membrane (PM) are calculated as ratios of VSVG on the PM to total VSVG; all IF intensities are expressed as arbitrary units (AU). **P < 0.01, ***P < 0.001, versus respective controls (Student’s t-test; b, f, g). Scale bars, 10 µm (a, c, d, e).
9 1 8 nature cell biology volume 10 | number 8 | AuGuST 2008
© 2008 Macmillan Publishers Limited. All rights reserved.
A R T I C L E S
As the KDEL-R is required for traffic-induced SFK activation, inhi- bition of the KDEL-R should prevent intra-Golgi trafficking, and this should be reversed by active Src. Indeed, trafficking was inhibited in COS7 cells transfected with the KDEL-RD193N, (Supplementary Information, Fig. S8a, b) and was partially restored when KDEL-RD193N was co-trans- fected with a constitutively active Src mutant (SrcY527F; Supplementary Information, Fig. S8c, d). This indicates that the KDEL-R is required for trafficking mainly through its ability to activate Golgi SFKs.
A final question was whether the regulation of Golgi trafficking by SFKs operates only during pulsed traffic or also in unperturbed cells. A series of experiments (see Supplementary Information, Text S4 for details) indicated that SFKs control intra-Golgi trafficking also during physiologi- cal steady-state transport (Fig. 7). Thus, activation of SFKs is required for both pulsed and normal intra-Golgi trafficking in mammalian cells.
DISCUSSION This study comprises three parts that convey interrelated messages: first, traffic activates SFKs and a phosphorylation cascade on the Golgi complex; second, these effects are mediated by the KDEL-R acting as a signalling receptor; third active SFKs are required for traffic to proceed through the Golgi complex. Further studies are required to elucidate the detailed molecular links between these three elements of the pathway. It is clear, however, that these elements define a regulatory mechanism by which the secretory pathway can coordinate its activities through a signalling circuit that operates across different compartments. As noted above, it has long been known that signal transduction molecules reside on secretory membranes, and that they have potent effects on membrane transport3. This suggests the existence of a rich regulatory layer superim- posed on the core trafficking machinery6,46–48. How the information flow
a p-Tyr
37 °C 40 °C 32 °C
PC-I
0 60 120
120 100
80
p -T
yr I F
in te
n si
ty ( A
U )
60 40
0 20
140
120 100
80
p -S
F K
s IF
in te
n si
ty ( A
U )
60 40
0 20
140 160
b c
d e
f VSVG 100
80
R a ti o
o f
G o
lg i t
o P
M I F
60
40
0
20
0 20 30 40 50
g
0 60 120 10
60
50
40
P C
-I I F
in te
n si
ty in
t h
e G
o lg
i ( A
U )
30
20
0
10
0 30 60 90 120
Time at 32 °C (min)Time at 32 °C (min) + SU6656
Time at 32 °C (min) + SU6656
Time at 32 °C (min)
37 °
C 40
° C
32 °
C
32 °
C
40 °
C
37 °
C
Figure 7 Activation of SFKs is required for steady-state intra-Golgi trafficking. (a) Modulation of Tyr phosphorylation in the Golgi area. HF cells were fixed at steady-state (37 °C) or 3 h after ER exit block (40 °C) or 30 min after transport block release (32 °C), and double-stained for GM130 (cis-Golgi marker, for Golgi definition; data not shown) and p-Tyr (green). (b) Quantification of data illustrated in a. (c) Golgi SFKs are activated during steady-state transport in HeLa cells. Quantitative analysis of p-SFKs in the Golgi area in HeLa cells treated as in a. (d) Inhibition of PC-I steady-state transport. HF cells were incubated at 32 °C (non-perturbed transport) before addition of vehicle or 10 µM SU6656 for the indicated times, then fixed and double-stained for GM130 (data not shown) and
PC-I (red). (e) Quantification of data illustrated in d. Red squares, control Golgi-PC-I accumulation; blue squares, SU6656-treated cells. (f) Inhibition of VSVG–GFP steady-state transport. COS7 cells were transfected with VSVG–GFP and incubated overnight at 32 °C, before addition of vehicle or 5 µM SU6656 for the indicated times, and then examined for VSVG by immunofluorescence microscopy. (g), Quantification of data illustrated in f showing VSVG–GFP accumulation in the Golgi expressed as the Golgi- to-PM IF ratio. Data are means of two independent experiments, each of which involved 10–20 measurements with a variability that never exceeded 10% of the mean (b, c, e, g). All immunofluorescence (IF) intensities are expressed as arbitrary units (AU). Scale bars, 10 µm (a, d, f).
nature cell biology volume 10 | number 8 | AuGuST 2008 9 1 9
© 2008 Macmillan Publishers Limited. All rights reserved.
A R T I C L E S
is organized within this signalling network, however, and its physiologi- cal significance in trafficking has so far remained unclear. Our model of secretory traffic coordination by a signalling circuit (Fig. 8) suggests that signalling originates from a Golgi-based signal-receptor system that senses incoming traffic from the ER. The primary traffic-related signal is most probably provided by ER chaperones that reach the Golgi complex49 and bind to the KDEL-R through their KDEL motif28. This leads to activation of Src and other SFKs on the Golgi complex, trigger- ing a phosphorylation cascade on the Golgi. In turn, this activates the intra-Golgi transport machinery and may also enhance Golgi-to-ER recycling24,50, balancing the membrane input that initiates the process with increased membrane output.
SFKs are crucial for intra-Golgi trafficking in all of the cell lines we have investigated to date (seven cell types), including SYF cells, which, although depleted for Src, Yes and Fyn, still rely on SFKs for the regulation of Golgi trafficking. Instead, in evolutionarily distant cell types such as yeast, fungi and plants, SFKs may not have roles in trafficking, as these organisms do not possess tyrosine kinases, which appeared first in meta- zoa51. It is possible that these species have evolved regulatory circuits that are different from those operating in mammals. In our view, the common feature in all eukaryotes may be the presence of endomembrane-based signalling pathways that can coordinate different compartments of the secretory pathway. In the mammalian Golgi, SFKs have a dominant func- tion, which would be performed by other kinases in non-mammalian spe- cies (see Supplementary Information, Text S5 for further discussion).
This chaperone–KDEL-R-activated–SFK-phosphorylation cascade is similar to many transduction systems at the cell surface; however, all of its
components, from the initial signal to the final effectors, are intracellular. This sequence of events defines the concept of ‘inter-organelle signalling’, which raises further questions. An obvious question is whether there are other inter-organelle signalling circuits. The unfolded protein response (UPR)52 may be included in this definition as it involves the activation of two kinases on the cytosolic surface of the ER, one that phosphorylates EF2 and the other that acts as an endonuclease and binds TRAF2, a scaffold molecule that is also involved in TNF-receptor-mediated signal- ling53. We are not aware of other inter-organelle signalling cascades simi- lar to that defined above. However, given the abundance of signalling molecules on endomembranes, it seems likely that other such pathways will be discovered in the future.
In conclusion, the KDEL-R- and SFK-based pathway provides a sim- ple feed-forward signalling circuit that controls the gating of the Golgi complex and contributes to preserving the dynamic equilibrium of this organelle during trafficking. An additional possibility that is of broader significance is that traffic-induced SFK phosphorylation cascade may also influence other cellular machineries (Fig. 8). Indeed, although most of the traffic-induced p-Tyr signal is located on the Golgi complex, it is possible that minor, but functionally important, phosphorylation events also occur in other cellular compartments. Moreover, the Golgi complex hosts many molecules that may be involved in diverse functions, including cell motility and growth, and the cell cycle8,54,55. It is thus conceivable that Golgi SFKs contribute also to the coordination between membrane trafficking and other cellular events during global cell responses, when various functional modules must operate in an integrated fashion.
METHODS Cells. HF cells (M. De Luca, Venice, Italy) were cultured as described previously13 and all other cells lines were cultured as recommended by ATCC.
Antibodies. 4G10 (Upstate) and PY99 (Santa Cruz Biotech) anti-p-Tyr; anti-p-SFKs (p-Tyr 418; BioSource and Cell Signalling Technology); GD11 (Upstate) and SC-18 (Santa Cruz Biotechnology) anti-Src; anti-Yes (Upstate); anti-Fyn (Abcam); anti-Lyn (Santa Cruz Biotechnology); anti-KDEL-R and anti-PDI (Stressgene); anti-GM130 (Transduction Laboratories and G. Di Tullio, Consorzio Mario Negri Sud, Italy); anti-Myc (Santa Cruz Biotechnology); P5D4 anti-VSVG (Sigma); anti-VSVG luminal domain (J. Gruenberg, University of Geneva, Switzerland), LF-68 anti-PC-I (L.W. Fisher, NIH, Bethesda, USA); M3F7 anti-PC-IV (developed by H. Furthmayr, obtained from DSHB, University of Iowa, USA); anti-HRP (Rockland); anti- Sec31 (G. Di Tullio); anti-TGN46 (V. Ponnambalan, University of Dundee, UK); fluorophore-conjugated antibodies (Molecular Probes); HRP-conjugated antibodies (Calbiochem). Expression vectors: ts045-VSVG–GFP, ts045VS- VG–KDEL-R chimaera, KDEL-R–GFP and KDEL-R-D193N–GFP cDNAs (J. Lippincott-Schwartz); KDEL-RM and KDEL-R-D193NM by subcloning the KDEL-R coding sequence into a Myc-containing modified pCMV5 vector; wild-type Src, and dominant-positive (SrcY527F) mutant cDNAs of chicken origin (S. Gutkind, NIH, Bethesda, USA); Src dominant-negative (SrcK295R) of mouse origin (J. Brugge, Harvard Medical School, Boston, USA); kinase- dead Lyn (K275A) mutant cDNA of human origin (Yamaguchi, Chiba, Japan56; ssHRP and ssHRPKDEL cDNAs (D. F. Cutler, MRC, London, UK).
Reagents. All reagents were of analytical grade or higher (Sigma, unless oth- erwise specified). Cell culture medium was from Invitrogen, complete pro- tease inhibitors from Roche, EGF from Upstate, SU6656, SKI-1, PP3 and SP600125 from Calbiochem, PP1, PP2 and ONO-RS-082 from BioMol, Fugene from Roche and oligofectamine transfection reagents from Invitrogen. SiRNA duplexes, from Dharmacon, were as follows: KDEL-R type 1 (no. 1, GUUCAAAGCUACUUACGAU; no. 2, GGUGUUCACUGCCCGAUAU; no. 3, CCAACUACAUCUCACUCUA; no. 4, CUACAUAGCCUGCUCCUUC), type 2 (no. 1, ACACAUCUAUGAAGGUUAUUU; no. 2,
PM
KDEL-R
Chaperones Cargo
ER cis-Golgi
Other functions
SFKs
Figure 8 Model of traffic self-regulation by the chaperone-KDEL-R-SFK signal- response system. Chaperones containing KDEL sequences (red triangles) leave the ER with cargo (black ballsticks). On arrival at the cis-Golgi, they bind the KDEL-R (green Pacmen), triggering activation of SFKs on the Golgi complex (localization indicated by the shadowed area). This activation may occur by direct interactions between the KDEL-R and Golgi SFKs or by a more complex mechanism. In turn, these p-SFKs induce a phosphorylation cascade (violet arrows) that is required for the trafficking machinery to function for the subsequent intra-Golgi transport. The KDEL-R-dependent SFK activation on the Golgi complex may also regulate other functions in the cell (indicated by fuchsia arrows). As it has been reported previously that SFKs can modulate Golgi-to-ER retrograde transport, the SFK Golgi pool may also be responsible for this modulation24 (indicated by pale violet arrow). The green arrows indicate the directions of membrane trafficking.
9 2 0 nature cell biology volume 10 | number 8 | AuGuST 2008
© 2008 Macmillan Publishers Limited. All rights reserved.
A R T I C L E S
CAUGAUACCUUCCGAGUGGUU; no. 3, GAUCUGGCGCUUCUACUUUUU; no. 4, CAAAAGUACUCAAGGGAAAUU), type 3 (no. 1, GACCAUAACUACUCACUAC; no. 2, GGUACCAGACUGAGAAUUU; no. 3, AGUCGUGUCUGGAGUAGUA; no. 4, CAGUGUACAUGAUAUAUGG), Src: (no. 5, GAGAACCUGGUGUGCAAAGUU; no. 6, CGTCCAAGCCGCAGACUCAUU; no. 7, CCUCAGGCAUGGCGUACGUUU; no. 12, CCAAGGGCCUCAAC) and siCONTROL non-targeting siRNA no. 2 (no. 1, AUGAACGUGAAUUGCUCAA, no. 2, UAAGGCUAUGAAGAGAUAC; no. 3, AUGUAUUGGCCUGUAUUAG; no. 4, UGGUUUACAUGUCGACUAA); fluorophore-conjugated STB and STBKDEL from B. Goud, Curie Institute, Paris, France; ECL Plus western blotting detection system from Amersham; FITC-dextran from Molecular Probes.
Cell handling and transport synchronization protocols. HF cells were always used between passages 3 and 8 (older cells gradually dedifferentiate). Cells were transfected with Fugene, according to the manufacturer’s instructions. VSV infec- tion: cells were infected with VSV as described previously13. Transport-pulse pro- tocols: PC-I and VSVG transport pulses were performed in Dulbecco’s modified Eagle’s medium (DMEM) containing 1% fetal calf serum and 20 mM HEPES, as described previously13,57. Cycloheximide (100 µg ml–1) was added at the tem- perature shift or 30 min before fixing the cells, as appropriate. Pre-treatment with 5 µM (or 10 µM, where indicated) SU6656, 10 µM SKI-1, 30 µM SP600125 and 10 µM ONO-RS-082 was from 30 min before the temperature shift. Pre- treatment with 10 µM PP1, PP2 and PP3 was from 3 h before the temperature shift. Retrograde transport of Shiga toxin in Vero cells: incubated with STB and STBKDEL was performed as described previously38. Microinjection: COS7 and HeLa cells were microinjected as described previously58, with the purified anti-KDEL-R antibody at 2 mg ml–1 and Sar1-GTP at 1.5 mg ml–1, respectively. Treatments with siRNAs were carried out as previously described57. Briefly, cells were transfected for 3 days with 100 nM of the siGENOME SMARTpool reagents containing four pooled siRNA duplexes against Src (see text). Src siRNAs were also used separately. The KDEL-R type 2 siRNA produced the strongest effect on KDEL-R levels, whereas type 3 was ineffective. Thus, type 2 siRNA (presumably against the most abundant isoform) was used in all functional experiments. Of note, the KDEL-R is conserved at the nucleotide level across species. The siRNAs used do not match non-KDEL-R sequences in any known species, reducing potential off-target effects. Non-targeting siRNA no. 2 was used as a control.
Microscopy. Immunofluorescence microscopy (LSM 510 laser scanning confo- cal microscope; Zeiss) and gold-enhancement immuno-EM, cryo-immuno-EM (Tecnai-12 electron microscope; FEI-Philips) were as described previously12,59. The Golgi SFK immunofluorescence staining in Supplementary Information, Figs S2b, 6c were obtained from streptolysin-O-permeabilized cells, as described previously60. Quantification of immunofluorescence in the Golgi area was defined by using Golgi-marker images (with GM130, giantin or TGN46). The Golgi profile was delineated manually (Fig. 1a). The non-Golgi area was the cytosolic region of the cell excluding the Golgi complex and the nucleus. To overcome possible prob- lems from different transfection levels in Src-transfected cells, we normalized these values with respect to the p-SFKs on the plasma membrane. Images were acquired with pinhole size and amplification gain optimized for intensity values between 1 and 254 (linear range). The total immunofluorescence within each area of interest was acquired, and the immunofluorescence intensity was calculated by integra- tion of the immunofluorescence signal within the region of interest divided by the area. VSVG on the plasma membrane was selectively stained using an anti-VSVG luminal domain antibody in non-permeabilized cells. Total VSVG was stained using the P5D4 anti-VSVG antibody after the cells had been permeabilized59. All experiments were carried out at twice, and immunofluorescence was quantified in at least 10 cells (from three wells) per point per experiment using the LSM510-3.2 software (Zeiss)59. Sampling of cells was performed randomly. All samples were processed equally and evaluated in a blind fashion. The results are shown graphi- cally on an arbitrary scale (AU). For immuno-EM, quantification of gold particles associated with individual Golgi stacks was carried out with the ‘touch count’ tool (Analysis software, Soft Imaging Software Corporation). For each experimental condition, at least 20 Golgi stacks were analysed.
Protein analysis. Cells were plated 48 h before use. Following the transport protocol, as described above, the cells were washed three times with ice- cold PBS and collected immediately at 4 °C in lysis buffer (1% Triton X-100,
20 mM Tris-HCl, pH 8.0, 150 mM NaCl, 5 mM Na3VO4, 1 mM PMSF, 30 mM β-glycerophosphate, 10 mM NaF) and complete protease inhibitors (5×; Roche). Cell lysates were centrifuged at 18,000g for 5 min at 4 °C to eliminate nuclei. The postnuclear supernatant was immediately processed for SDS–PAGE and western blotting. Of note, removing the nuclei is crucial in the detection of tyrosine phosphorylation. Quantification of immunoreactive bands was as described previously4.
Two-hybrid assay. The yeast two-hybrid assay was carried out using the Matchmaker two-hybrid system 3 (BD Biosciences, Clontech), according to the manufacturer’s instructions. Briefly, the human KDEL-R2 C-terminal domain (KDEL-R-C; amino acids Ala 183–Ala 212) was subcloned into the NaeI and BamHI restriction site of the Gal4 DNA binding domain vector pGBKT7. Full-length mouse Src cDNA was subcloned by PCR (primer; for- ward, 5´-CGG AAT TCA TGG GCA GCA ACA AGA GCA A-3´; reverse, 5´-ACG GAT CCC TAG GTT CTC CCC GGG CTG-3´) into the EcoRI and BamHI sites of GAL4 activation domain vector pGADT7. The subcloned DNA fragments were verified by DNA sequencing. The yeast AH109 and Y187 strains were transformed with KDEL-R-C and Src respectively, then mated and plated onto a nutritionally selective media that was deficient in adenine, histidine, leucine and tryptophan (QDO). The assays were considered positive when diploid yeasts grew on QDO medium and activated the MEL1 reporter gene in the dedicated assay. As a control, KDEL-R-C and Src were assayed with the respective empty vectors.
Note: Supplementary Information is available on the Nature Cell Biology website.
ACknoWLEdGEMEnTS We thank M. A. De Matteis and A. Colanzi for critical reading of the manuscript, C. P. Berrie for editorial assistance and E. Fontana for artwork preparation. We thank C. Ruggiero for experimental help and P. Randazzo, M. Frame, P. Cohen, K. Kadler and T. Smithgall for helpful discussions, and several other colleagues for sharing reagents (see Methods). We thank Telethon (Italy), AIRC (Italy) and MIUR (Italy) for financial support. T.P., M.G., Ma.C. and Mi.C. are or were FIRC Fellows. T.P. was a recipient of a Fellowship from Fondazioni Bancarie Abruzzesi and Fondazione Negri Sud ONLUS.
AuTHoR ConTRiBuTionS T.P., M.S. and A.L. conceived and designed the study; T.P., M.G., Ma.C., Mi.C., A.P., R.P., E.S.P., G.V.B., A.A.M., G.T. and V.W.H. performed the experiments; M.S. and A.L. prepared the manuscript.
CoMPETinG finAnCiAL inTERESTS The authors declare no competing financial interests.
Published online at http://www.nature.com/naturecellbiology/ Reprints and permissions information is available online at http://npg.nature.com/ reprintsandpermissions/
1. Heinrich, R. & Rapoport, T. A. Generation of nonidentical compartments in vesicular transport systems. J. Cell Biol. 168, 271–280 (2005).
2. Donaldson, J. G. & Lippincott-Schwartz, J. Sorting and signaling at the Golgi complex. Cell 101, 693–696 (2000).
3. Sallese, M., Pulvirenti, T., & Luini, A. The physiology of membrane transport and endomembrane-based signalling. EMBO J. 25, 2663–2673 (2006).
4. De Matteis, M. A., Santini, G., Kahn, R. A., Di Tullio, G., & Luini, A. Receptor and protein kinase C-mediated regulation of ARF binding to the Golgi complex. Nature 364, 818–821 (1993).
5. Luton, F., Verges, M., Vaerman, J. P., Sudol, M., & Mostov, K. E. The SRC family protein tyrosine kinase p62yes controls polymeric IgA transcytosis in vivo. Mol. Cell 4, 627–632 (1999).
6. Sorkin, A. & Von Zastrow, M. Signal transduction and endocytosis: close encounters of many kinds. Nature Rev. Mol. Cell Biol. 3, 600–614 (2002).
7. Di Fiore, P. P. & De Camilli, P. Endocytosis and signaling. an inseparable partnership. Cell 106, 1–4 (2001).
8. Bivona, T. G. et al. Phospholipase Cγ activates Ras on the Golgi apparatus by means of RasGRP1. Nature 424, 694–698 (2003).
9. Sorkin, A. TRKing signals through the Golgi. Sci. STKE. 2005, e1 (2005). 10. Rocks, O. et al. An acylation cycle regulates localization and activity of palmitoylated
Ras isoforms. Science 307, 1746–1752 (2005). 11. Michaelson, D., Ahearn, I., Bergo, M., Young, S., & Philips, M. Membrane trafficking
of heterotrimeric G proteins via the endoplasmic reticulum and Golgi. Mol. Biol. Cell 13, 3294–3302 (2002).
12. Trucco, A. et al. Secretory traffic triggers the formation of tubular continuities across Golgi sub-compartments. Nature Cell Biol. 6, 1071–1081 (2004).
nature cell biology volume 10 | number 8 | AuGuST 2008 9 2 1
© 2008 Macmillan Publishers Limited. All rights reserved.
A R T I C L E S
13. Mironov, A. A. et al. Small cargo proteins and large aggregates can traverse the Golgi by a common mechanism without leaving the lumen of cisternae. J. Cell Biol. 155, 1225–1238 (2001).
14. Bonfanti, L. et al. Procollagen traverses the Golgi stack without leaving the lumen of cisternae: evidence for cisternal maturation. Cell 95, 993–1003 (1998).
15. Bjorge, J. D., Jakymiw, A., & Fujita, D. J. Selected glimpses into the activation and function of Src kinase. Oncogene 19, 5620–5635 (2000).
16. Thomas, S. M. & Brugge, J. S. Cellular functions regulated by Src family kinases. Annu. Rev. Cell Dev. Biol. 13, 513–609 (1997).
17. Bard, F. et al. Molecular complexes that contain both c-Cbl and c-Src associate with Golgi membranes. Eur. J. Cell Biol. 81, 26–35 (2002).
18. Bijlmakers, M. J., Isobe-Nakamura, M., Ruddock, L. J., & Marsh, M. Intrinsic signals in the unique domain target p56(lck) to the plasma membrane independently of CD4. J. Cell Biol. 137, 1029–1040 (1997).
19. Carreno, S., Gouze, M. E., Schaak, S., Emorine, L. J., & Maridonneau-Parini, I. Lack of palmitoylation redirects p59Hck from the plasma membrane to p61Hck-positive lysosomes. J. Biol. Chem. 275, 36223–36229 (2000).
20. Li, M. et al. The SH3 domain of Lck modulates T-cell receptor-dependent activation of extracellular signal-regulated kinase through activation of Raf-1. Mol. Cell Biol. 28, 630–641 (2008).
21. Hiyoshi, M. et al. Interaction between Hck and HIV-1 Nef negatively regulates cell surface expression of M-CSF receptor. Blood 111, 243–250 (2008).
22. Meyn, M. A., III, Schreiner, S. J., Dumitrescu, T. P., Nau, G. J., & Smithgall, T. E. SRC family kinase activity is required for murine embryonic stem cell growth and differentia- tion. Mol. Pharmacol. 68, 1320–1330 (2005).
23. Blake, R. A. et al. SU6656, a selective src family kinase inhibitor, used to probe growth factor signaling. Mol. Cell Biol. 20, 9018–9027 (2000).
24. Bard, F., Mazelin, L., Pechoux-Longin, C., Malhotra, V., & Jurdic, P. Src regulates Golgi structure and KDEL receptor-dependent retrograde transport to the endoplasmic Reticulum. J. Biol. Chem. 278, 46601–46606 (2003).
25. Canty, E. G. & Kadler, K. E. Procollagen trafficking, processing and fibrillogenesis. J. Cell Sci. 118, 1341–1353 (2005).
26. Green, H. & Goldberg, B. Synthesis of collagen by mammalian cell lines of fibroblastic and nonfibroblastic origin. Proc. Natl Acad. Sci. USA 53, 1360–1365 (1965).
27. Scheel, A. A. & Pelham, H. R. Identification of amino acids in the binding pocket of the human KDEL receptor. J. Biol. Chem. 273, 2467–2472 (1998).
28. Munro, S. & Pelham, H. R. A C-terminal signal prevents secretion of luminal ER pro- teins. Cell 48, 899–907 (1987).
29. Pelham, H. R. Recycling of proteins between the endoplasmic reticulum and Golgi complex. Curr. Opin. Cell Biol. 3, 585–591 (1991).
30. Aoe, T. et al. The KDEL receptor, ERD2, regulates intracellular traffic by recruiting a GTPase-activating protein for ARF1. EMBO J 16, 7305–16 (1997).
31. Majoul, I. et al. KDEL receptor (Erd2p)-mediated retrograde transport of the cholera toxin A subunit from the Golgi involves COPI, p23, and the COOH terminus of Erd2p. J. Cell Biol. 143, 601–12 (1998).
32. Semenza, J. C., Hardwick, K. G., Dean, N., & Pelham, H. R. ERD2, a yeast gene required for the receptor-mediated retrieval of luminal ER proteins from the secretory pathway. Cell 61, 1349–1357 (1990).
33. Lewis, M. J. & Pelham, H. R. A human homologue of the yeast HDEL receptor. Nature 348, 162–163 (1990).
34. Cabrera, M. et al. The retrieval function of the KDEL receptor requires PKA phosphoryla- tion of its C terminus. Mol. Biol. Cell 14, 4114–4125 (2003).
35. Yamamoto, K. et al. The KDEL receptor modulates the endoplasmic reticulum stress response through mitogen-activated protein kinase signaling cascades. J. Biol. Chem. 278, 34525–34532 (2003).
36. Johannes, L., Tenza, D., Antony, C., & Goud, B. Retrograde transport of KDEL-bearing B-fragment of Shiga toxin. J. Biol. Chem. 272, 19554–19561 (1997).
37. Keusch, G. T. et al. Globotriaosylceramide, Gb3, is an alternative functional receptor for Shiga-like toxin 2e. Infect. Immun. 63, 1138–1141 (1995).
38. Valderrama, F. et al. Actin microfilaments facilitate the retrograde transport from the Golgi complex to the endoplasmic reticulum in mammalian cells. Traffic 2, 717–726 (2001).
39. Connolly, C. N., Futter, C. E., Gibson, A., Hopkins, C. R., & Cutler, D. F. Transport into and out of the Golgi complex studied by transfecting cells with cDNAs encoding horseradish peroxidase. J. Cell Biol. 127, 641–652 (1994).
40. Hsu, V. W., Shah, N., & Klausner, R. D. A brefeldin A-like phenotype is induced by the overexpression of a human ERD-2-like protein, ELP-1. Cell 69, 625–635 (1992).
41. Townsley, F. M., Wilson, D. W., & Pelham, H. R. Mutational analysis of the human KDEL receptor: distinct structural requirements for Golgi retention, ligand binding and retrograde transport. EMBO J. 12, 2821–2829 (1993).
42. McGarrigle, D. & Huang, X. Y. GPCRs signaling directly through Src-family kinases. Sci. STKE. 2007, e35 (2007).
43. Bain, J., McLauchlan, H., Elliott, M., & Cohen, P. The specificities of protein kinase inhibitors: an update. Biochem. J. 371, 199–204 (2003).
44. Klinghoffer, R. A., Sachsenmaier, C., Cooper, J. A., & Soriano, P. Src family kinases are required for integrin but not PDGFR signal transduction. EMBO J. 18, 2459–2471 (1999).
45. Arcaro, A. et al. Critical role for lipid raft-associated Src kinases in activation of PI3K–Akt signalling. Cell Signal. 19, 1081–1092 (2007).
46. Austin, C. D. & Shields, D. Formation of nascent secretory vesicles from the trans-Golgi network of endocrine cells is inhibited by tyrosine kinase and phosphatase inhibitors. J. Cell Biol. 135, 1471–1483 (1996).
47. Webb, R. J., Judah, J. D., Lo, L. C., & Thomas, G. M. Constitutive secretion of serum albumin requires reversible protein tyrosine phosphorylation events in trans-Golgi. Am. J. Physiol Cell Physiol 289, C748–C756 (2005).
48. Pelkmans, L. et al. Genome-wide analysis of human kinases in clathrin- and caveolae/ raft-mediated endocytosis. Nature 436, 78–86 (2005).
49. Griffiths, G. et al. Localization of the Lys, Asp, Glu, Leu tetrapeptide receptor to the Golgi complex and the intermediate compartment in mammalian cells. J. Cell Biol. 127, 1557–1574 (1994).
50. Majoul, I., Straub, M., Hell, S. W., Duden, R., & Soling, H. D. KDEL-cargo regulates interactions between proteins involved in COPI vesicle traffic: measurements in living cells using FRET. Dev. Cell 1, 139–53 (2001).
51. Cetkovic, H., Grebenjuk, V. A., Muller, W. E., & Gamulin, V. Src proteins/src genes: from sponges to mammals. Gene 342, 251–261 (2004).
52. Patil, C. & Walter, P. Intracellular signaling from the endoplasmic reticulum to the nucleus: the unfolded protein response in yeast and mammals. Curr. Opin. Cell Biol. 13, 349–355 (2001).
53. Xia, Z. P. & Chen, Z. J. TRAF2: a double-edged sword? Sci. STKE. 2005, e7 (2005).
54. Altan-Bonnet, N., Phair, R. D., Polishchuk, R. S., Weigert, R., & Lippincott-Schwartz, J. A role for Arf1 in mitotic Golgi disassembly, chromosome segregation, and cytokinesis. Proc. Natl Acad. Sci. USA 100, 13314–13319 (2003).
55. Preisinger, C. et al. YSK1 is activated by the Golgi matrix protein GM130 and plays a role in cell migration through its substrate 14–3-3ζ. J. Cell Biol. 164, 1009–1020 (2004).
56. Matsuda, D. et al. Involvement of Golgi-associated Lyn tyrosine kinase in the transloca- tion of annexin II to the endoplasmic reticulum under oxidative stress. Exp. Cell Res. 312, 1205–1217 (2006).
57. Bonazzi, M. et al. CtBP3/BARS drives membrane fission in dynamin-independent transport pathways. Nature Cell Biol. 7, 570–580 (2005).
58. Mironov, A. A. et al. ER-to-Golgi carriers arise through direct en bloc protrusion and multistage maturation of specialized ER exit domains. Dev. Cell 5, 583–594 (2003).
59. Polishchuk, R., Di Pentima, A., & Lippincott-Schwartz, J. Delivery of raft-associated, GPI-anchored proteins to the apical surface of polarized MDCK cells by a transcytotic pathway. Nat. Cell Biol. 6, 297–307 (2004).
60. Mironov, A. et al. Role of NAD+ and ADP-ribosylation in the maintenance of the Golgi structure. J. Cell Biol. 139, 1109–1118 (1997).
9 2 2 nature cell biology volume 10 | number 8 | AuGuST 2008
© 2008 Macmillan Publishers Limited. All rights reserved.
s u p p l e m e n ta r y i n f o r m at i o n
www.nature.com/naturecellbiology 1
Figure S1 Tyrosine phosphorylation induced by growth factors differs from that arising from the arrival of traffic at the Golgi complex. The Tyr- phosphorylation response to growth factors was examined at both the morphological and biochemical levels. (a) Platelet-derived growth factor (PDGF) stimulates tyrosine phosphorylation at the PM, and particularly in ruffle-like structures, rather than in the Golgi area. Cells were serum-starved overnight and then treated with 10 ng ml-1 PDGF at 37 °C for 5 min. F-actin was stained with Alexa488-phalloidin, and the cells were immunostained for the cis-Golgi marker GM130 (red) and p-Tyr (green), as indicated. Arrows,
membrane ruffles. Images are representative of two independent experiments where at least 100 cells were analyzed. Scale bars, 10 µm. (b) Epidermal growth factor (EGF) and PDGF induce cellular tyrosine phosphorylation patterns different from those caused by the arrival of traffic. Cells were serum-starved for 48 h, treated with 10 ng ml-1 EGF or PDGF, as indicated, at 37 °C for 5 min, and then homogenized. The p-Tyr patterns were revealed by SDS-PAGE and immunoblotting, and they are different from those generated by the arrival of a traffic pulse at the Golgi complex (compare with Fig. 2a, b). Data are representative of three independent experiments.
P D
G F
C o
n tr
o l
p-TyrGM130Phalloidin
a b
Control EGF PDGF
p-Tyr
203
116
96
52
35
28
© 2008 Macmillan Publishers Limited. All rights reserved.
s u p p l e m e n ta r y i n f o r m at i o n
2 www.nature.com/naturecellbiology
Figure S2 Although the SFKs repertoire is different across cell lines, traffic pulses induce similar phosphorylation patterns in all cells. Different cell lines have their own particular and complex SFK repertoire. (a) Western blotting of the SFKs Yes, Src, Fyn and Lyn (two isoforms) in COS7, HF, HeLa and NIH 3T3 cell lysates. (b) Endogenous SFKs localize on the Golgi complex in HF, HeLa fibroblast-like (HeLa FL) and COS7 cells. The cells were grown under standard conditions, and processed as detailed in Methods. Staining was with an anti-SFK (red) and anti-giantin (green) antibodies. The right panels show the co-localization between SFK and giantin staining. Scale bars, 10 µm. (c) Quantification of data illustrated in b, showing the IF signal of the SFKs as means (±SE) (as assessed in 10 to 20 cells) in the Golgi area as a percentage of total cellular IF. *** p< 0.001 versus the other cell lines. p-SFK and p-Tyr responses to traffic arrival at the Golgi complex. (d) HeLa cells secrete procollagen-IV (PC-IV) in a synchronisable fashion. For their synchronisation, HeLa cells were incubated for 3 h at 40 °C, shifted at 32 °C for 30 min in the presence of 50 µg ml-1 ascorbic acid, fixed and double-stained for GM130 (blue) and PC-IV (green). This experiment was carried out in triplicate. Scale bars, 10 µm. (e) The Golgi SFKs are activated by a PC-IV transport pulse in
HeLa cells. The cells were treated as above and double-stained for GM130 (blue) and p-SFKs (red). A strong increase in Golgi-located p-SFKs is seen at 30 min, with respect to that at time 0. This experiment was carried out in triplicate. Scale bars, 10 µm. (f) The p-Tyr patterns are similar in different cell lines exposed to a traffic pulse. HF, NRK, HeLa and COS7 cells were treated as in a and then homogenized. The p-Tyr patterns of their lysates were analysed by immunoblotting with an anti-p-Tyr antibody. All four cell lines show common traffic-arrival-dependent p-Tyr patterns. confirming the generality of the p-Tyr signalling response at the Golgi. (g) Western blotting of p-SFKs in cells treated as in f. Traffic pulses induce SFK activation in all cell lines tested. The traffic-dependent SFK activation pattern varies across cell lines. (h) Western blotting of p-SFKs in COS7 cells treated as in f. In high resolution gels of lysate from traffic-pulsed COS7 cells, a clear increase is seen in a 60-kDa band that probably represents p-Src and p-Fyn and the slight increase seen in the 62-kDa band should represent p-Yes. No lower bands were visible, indicating that Lyn activation is not controlled by traffic arrival in COS7 cells. Data shown in f, g and h are representative of at least two independent experiments.
Lyn
Yes
Src
Fyn
He La
CO S7
NIH 3T
3
CO S7
HF
62
60
59
56
53
a
S F
K s o
n t
h e G
o lg
i
(% o
f to
ta l IF
)
H F
H eL
a FL
0
2
4
6
8
C O
S 7
c
SFKs
H F
H e L
a F
L C
O S
7
b SFKs/Giantin
40 °C 32 °C (min at 32 °C)
0 30
p -S
F K
s p
-S F
K s /G
M 1 3 0
40 °C 32 °C (min at 32 °C)
0 30
P C
-I V
P C
-I V
/G M
1 3 0
p-Tyr
HF NRK HeLa
0 30 0 30 0 30
116
96
52
35
28
40 °C 32 °C (min at 32 °C)
p-SFKs
40 °C 32 °C
COS7
COS7
0 30
HF NRK
HeLa COS7
h
40 °C 32 °C 40 °C 32 °C
p-Yes
p-Src/Fyn p-Lyn
d
e
f g
***
© 2008 Macmillan Publishers Limited. All rights reserved.
s u p p l e m e n ta r y i n f o r m at i o n
www.nature.com/naturecellbiology 3
Figure S3 Transfected Src localizes to the Golgi complex and is activated by traffic in COS7 cells. Transfected Src localizes to the Golgi complex and is activated by both PC-IV and VSVG traffic pulses. (a) COS7 cells secrete PC-IV in a synchronisable fashion. Cells were incubated for 3 h at 40 °C, shifted to 32 °C for 20 min in the presence of 50 µg ml-1 ascorbic acid, fixed and double-stained for GM130 (blue) and PC-IV (green). The ER staining is negligible probably because the anti-PC-IV antibody recognizes only the folded state of PC-IV. Images are representative of two independent experiments. Scale bars, 10 µm. (b, c) PC-IV and VSVG traffic pulses induce Golgi-SFK activation. COS7 cells were transfected with Src alone (b, traffic pulse here provided by endogenous PC-IV, see panel a) or with both Src and VSVG-GFP, c. During the traffic block (left panels), low levels of p-SFKs were seen in the Golgi area. Twenty min after the block release to 32 °C, PC-IV (panels a, b) and VSVG (panel c) have moved to the Golgi area and there are high levels of p-SFKs in the Golgi area (b, c right panels). We also used a (phosphorylation- insensitive) anti-SFK antibody (SC-18) to examine the effects of traffic on ‘total’ cellular SFKs (c, SFKs). The SFKs were clearly detectable in the Golgi area; however, their Golgi levels were unaffected by arrival of traffic. Data in b
and c are representative of at least three independent experiments. Scale bars, 10 µm. (d) Quantification of p-SFK IF in the Golgi area from data illustrated in b and c as means (±SE) from at least five independent experiments, each assessing 10 to 20 cells. IF intensities are expressed as arbitrary units (AU). *p< 0.05, **p<0.001, versus relative controls at time 0 (ANOVA analysis). (e) To study the kinetics of traffic-dependent SFK activation and inactivation, we performed a time course of Golgi cargo loading and emptying with VSVG. A detailed analysis of p-SFKs was carried out across several cellular compartments. The graph shows the quantification of the IF of VSVG (blue diamonds), Golgi p-SFKs (pink squares) and p-SFKs in the cytoplasm (red triangles) in cells following the 40-32 °C traffic pulse protocol that was then followed by an ER transport block (40 °C) for the indicated times. p-SFKs increased in the Golgi area at 32 °C; then, when the block of VSVG traffic was reinstalled (40 °C), the VSVG and p-SFK levels in the Golgi area both gradually returned to basal levels over 60 min. IF intensities (means ±SE) are expressed as arbitrary units (AU; see Methods). **p<0.01,***p<0.001 versus relative controls at time 0 (ANOVA analysis). Data are representative of at least three independent experiments, each assessing 30 to 40 cells.
120
min at 32 °C min at 40 °C
IF i n
te n
s it
y (
A U
)
0
20
40
60
80
100
6010 20 40200 0
** ***
***
***
***
b
p -S
F K
s G
M 1 3 0
40 °C 32 °C (min at 32 °C)
0 20
c
V S
V G
S F
K s
p -S
F K
s
40 °C 32 °C (min at 32 °C)
0 20
d
0 -VSVG +VSVG
p -S
F K
s I F
i n
te n
s it
y
o n
t h
e G
o lg
i (A
U )
25
75
125
175 32°C
40°C
PC-IV
***
*
a
P C
-I V
40 °C 32 °C (min at 32 °C)
0 20
P C
-I V
/G M
1 3 0
e
© 2008 Macmillan Publishers Limited. All rights reserved.
s u p p l e m e n ta r y i n f o r m at i o n
4 www.nature.com/naturecellbiology
Figure S4 Traffic-induced tyrosine phosphorylation is not influenced by temperature shifts. As the traffic pulses involve temperature changes, we examined whether temperature per se influences the Golgi p-SFK response. (a) HeLa cells were incubated for 3 h at 40 °C, and during the last hour of this they were microinjected with 1.5 mg ml-1 Sar1-GTP plus 1.2 mg ml-1 FITC-labelled dextran (marker), as Sar1-GTP microinjection blocks ER-to-Golgi transport. The cells were then shifted to 32 °C for 30 min and double-stained for GM130 (blue) and p-SFKs (red). Sar1-GTP prevented activation of SFKs in the Golgi area, indicating that Golgi-SFK activation depends only on transport. Scale bars, 10 µm. (b) Quantification of data illustrated in a, as means (±SE) from four independent experiments, each assessing 10 to 20 cells. *p<0.05, versus 32 °C control without Sar1- GTP (Student’s t-test). IF intensities are
expressed in arbitrary units (AU). (c) Golgi p-SFK response in cargo depleted of HF cells. The cells were initially treated for 2 h with either vehicle (control) or CHX (protocol 1), to allow emptying of cargo from the secretory system; they were then incubated for 3 h at 40 °C still in the presence of CHX, shifted to 32 °C for 30 min, and then homogenized. The possible toxic effects of CHX were evaluated with CHX protocol 2: the cells were first incubated for 3 h at 40 °C (to accumulate PC-I in the ER), and then treated with CHX for 5 h at 40 °C; finally, they were shifted to 32 °C (block release) for 30 min and homogenized. The p-Tyr patterns were analysed by immunoblotting with an anti-p-Tyr antibody. Data are representative of at least two independent experiments. For a summary of the other independent approaches that are relevant to the effects of temperature, see Supplementary Information, Text S2.
a
b
C o
n tr
o l
S a r1
G T
P
p-SFKs p-SFKs/GM130Dextran
p -S
F K
s I
F o
n t
h e
G o
lg i
(A U
)
Control
40°C 0
20
40
60
80
100
120
32°C 40°C 32°C
Sar1GTP
*
40 °C 32 °C
Control
40 °C 32 °C
CHX
Protocol 1
40 °C 32 °C
CHX
Protocol 2
p-Tyr
116
96
52
35
c
© 2008 Macmillan Publishers Limited. All rights reserved.
s u p p l e m e n ta r y i n f o r m at i o n
www.nature.com/naturecellbiology 5
Figure S5 KDEL-R and chaperones in traffic-induced activation of Golgi SFKs. Silencing of the KDEL-R with siRNAs impairs traffic-induced SFK activation in the Golgi area in COS7 cells. (a-c) Cells were transfected for 72 h with siRNAs for the KDEL-R. During the final 24 h, they were transfected with VSVG-GFP and Src, then subjected to a VSVG traffic pulse, and stained for p-SFKs. (a) Knock-down of the KDEL-R by the siRNAs blocked SFK activation in the Golgi area. Scale bars, 10 µm. (b) Cells treated as in a, but not transfected with Src and VSVG-GFP, were analysed by Western blotting for Src and the KDEL-R. Data shown are representative of two independent experiments. (c) Quantification of data illustrated in a, (p-SFK IF intensity; means ±SE). IF intensities are expressed as arbitrary units (AU). ***p<0.001, versus control (Student’s t-test). Data are representative of two independent experiments, each assessing 10 to 20 cells. Of note, the morphology of the Golgi complex was not affected during this KDEL-R siRNAs treatment (as assessed by giantin IF; data not shown). Non-targeting siRNAs had no effects on KDEL-R levels when compared to untreated cells (data not shown). Chaperones exit the ER during a traffic pulse and induces
the redistribution of the KDEL-R. (d) COS7 cells were infected with VSV and incubated for 3 h at 40 °C, shifted to 32 °C for 3 min (not shown) and 8 min, and processed for IF. During the block, the chaperone PDI was located in the ER, as was VSVG, while the ER exit site marker Sec31 was seen in numerous scattered puncta. Eight min after the block release, VSVG had moved from the ER to the Golgi area and its carriers were clearly visible (arrows in VSVG, 8-min panel). PDI was present in the same carriers (arrows, PDI 8-min panel); these did not contain Sec31 (arrows, Sec31 8-min panel). Thus 8 min after block release, these VSVG carriers are already uncoated and likely to be detached from the ER. Scale bars, 10 µm. (e) The KDEL-R redistributes to the periphery during a traffic pulse. In cells treated as in a, 20 min after the block release VSVG was concentrated in the Golgi area and the KDEL-R has partially redistributed back to the ER. Scale bars, 10 µm. (f) Quantification of data illustrated in e, showing the KDEL-R (means ±SE) outside the Golgi area (non-Golgi IF) as a percentage of total cellular IF. ***p<0.001 versus control 0 min (Student’s t-test). Data are representative of three independent experiments, each assessing 10 to 20 cells.
b
KDEL-R
C o n tr o l
K D
E L -R
si R
N A s
Src
a
K D
E L
-R s
iR N
A s
C o
n tr
o l
VSVG-GFP p-SFKs KDEL-R
40 °C 32 °C (min at 32 °C)
0 20
c
***
Control KDEL-R
siRNAs
0
20
40
60
80
100
120
140
p -S
F K
s I F
i n
te n
s it
y (A
U )
V S
V G
S e c 3 1
P D
I
d
40 °C 32 °C (min at 32 °C)
0 8
e V
S V
G K
D E
L -R
40 °C 32 °C (min at 32 °C)
0 20
f
0
K D
E L
-R re
d is
tr ib
u ti
o n
(% n
o n
-G o
lg i/ t
o ta
l IF
)
0
5
10 15 20
25
30 35
40
45
min at 32 °C
***
20
© 2008 Macmillan Publishers Limited. All rights reserved.
s u p p l e m e n ta r y i n f o r m at i o n
6 www.nature.com/naturecellbiology
Figure S6 SFKs are not required for retrograde, Golgi-to-ER, trafficking of the KDEL-R, whereas they are needed for intra-Golgi transport of VSVG. (a) KDEL-R recycling does not require basal SFK activity in COS7 cells. The retrograde, Golgi-to-ER, pathway was monitored using a chimeric construct that expressed a KDEL-R and VSVG fusion protein. As with wild-type KDEL-R, this protein cycles between the ER and the Golgi complex at 32 °C, resulting in a prominent Golgi complex localization (panels 0). On changing temperature to 40 °C (panels 60), the VSVG component of the chimera unfolds and becomes trapped in the ER, resulting in a rapid shift in the distribution of the chimera from the Golgi complex to the ER (control)15. When the same treatment was repeated in the presence of the SFK inhibitor SU6656 (5 µM), the chimera still shifted from the Golgi to the ER after 60 min at 40 °C, indicating no impairment of Golgi-to-ER trafficking under SFK inhibition (SU6656 panel). As a positive control, we used the PLA2 inhibitor ONO-RS- 082 (10 µM), which has been shown to block Golgi-to-ER trafficking16. Data are representative of at least two independent experiments. Scale bars, 10 µm. (b) EM analysis shows that SFK inhibitors block intra-Golgi transport of
VSVG. COS7 and NRK cells were infected with VSV and kept at 40 °C for 3 h, with addition of vehicle (Control) or 5 µM SU6656 for the last 30 min. The temperature block was released (32 °C) for 60 min, and the samples were processed for cryo-immunogold labelling with anti-VSVG (filled arrowheads) in combination with either GM130, COPI (empty arrowheads) or mannosidase II (MannII), as indicated. Data are representative of at least three independent experiments. Scale bars, 200 nm. Morphometric analysis carried out on NRK cells 1 h after the 40 °C block release of VSVG transport revealed that the mean number of Golgi cisternae per stack was 5.5, with a mean length of 552 nm in control cells; in SU6656-treated cells, these increased to 7.0 and 1059 nm, respectively. Together, these data indicate that SU6656 inhibits cargo transit from the medial-trans cisternae to the TGN. We also surveyed the distribution of Golgi machinery proteins in SU6656-treated cells, here used as markers. We noticed that the locations of GM130 and COPI were altered. The functional significance of these alterations is unclear but they certainly indicate a disorganization of the trafficking machinery and may provide potentially useful indications for future molecular studies.
C o
n tr
o l
O N
O
VSVG-KDEL-R
32 °C 40 °C (min at 40 °C)
0 60
S U
6 6 5 6
VSVG 15 nm
GM130 10 nm
VSVG 15 nm
COP I 10 nm
Control
VSVG 15 nm
COP I 10 nm
VSVG 15 nm
GM130 10 nm
SU6656
VSVG 15 nm
COP I 10 nm
VSVG 10 nm
GM130 15 nm
VSVG 10 nm
MannII 15 nm
COS7 NRK
a
b
© 2008 Macmillan Publishers Limited. All rights reserved.
s u p p l e m e n ta r y i n f o r m at i o n
www.nature.com/naturecellbiology 7
Figure S7 Regulation of intra-Golgi trafficking in SYF cells. (a) SFK-inhibitors impairs transport of VSVG in SYF cells. The cells were infected with VSV and kept at 40 °C for 3 h, with vehicle (control) or SKI-1, (10 µM), for the final 45 min. The block was then released (32 °C) for 90 min, and the total (green) and PM (red) VSVG was revealed with an antibody against the extracellular domain of VSVG. (b) Quantification of VSVG transport in SYF cells treated as in a with SKI-1, and with PP1, PP3, SU6656 (10 µM) and PP2 (20 µM). VSVG transport was inhibited by all of the SFK blockers tested, but not by the inactive analogue of PP3. The further SFK inhibitors were added either for the final 45 min of the 40 °C block (SU6656) or for the full 3 h 40 °C block (PP1, PP2, PP3). These data thus strongly indicate that SYF cells express at least one member of the SFKs, the activity of which is required for membrane transport. Data are means (±SE) from three independent experiments, each assessing 10 to 20 cells. The VSVG IF intensities on the PM are expressed as arbitrary units (AU). ***p<0.001, versus control (ANOVA analysis). (c) Presence of various members of SFKs in SYF cells. PCR for all of the SFKs suggested the presence of Fgr, Hck (not shown) and Lck (not shown) in SYF
cells, with the presence of Fgr and Hck confirmed by further analysis, as described below: the total SYF RNA was reverse transcribed with a random hexamer. Amplification of 250 ng of cDNA was carried out for 35 cycles. Ten µl of the PCR products was analyzed by electrophoresis on 2% agarose gels. Controls are represented by amplification of Fyn (knocked out in SYF cells), and two parallel samples (Fyn and Fgr) containing everything but the reverse transcriptase (-RT). M, molecular weight standards. Sequence analysis of the purified PCR bands confirmed the identity of the amplicons as murine Fgr and Hck (not shown). (d) Finally, we confirmed the presence of Hck and Fgr in SYF cells by Western blotting. Lane 1, wild-type SYF cells; lane 2, transfected SYF cells. (e) Endogenous Hck localizes to the Golgi complex in SYF cells. SYF cells were grown under standard conditions, fixed and stained with anti-Hck and anti-GM130 antibodies. Endogenous Hck staining mainly co-localized with GM130, although it is also present in the ER, at the PM, and on some unidentified cytoplasmic structures. Altogether, these data and other published results17 show that SYF cells contain at least three members of the SFKs, and that a SFK is involved in supporting intra-Golgi trafficking.
© 2008 Macmillan Publishers Limited. All rights reserved.
s u p p l e m e n ta r y i n f o r m at i o n
8 www.nature.com/naturecellbiology
Figure S8 DN KDEL-R blocks intra-Golgi trafficking in COS7 cells, a block reversed by active Src. (a) COS7 cells were transfected with KDEL-R-GFP (KDEL-R) or DN KDEL-R-D193N-GFP (KDEL-R-D193N), and infected with VSV. They were then subjected to the 40-32 °C VSVG traffic pulse and examined by IF microscopy. The KDEL-R and KDEL-R-D193N (green) and VSVG (red) are shown at the end of the temperature block (0) and after 15 and 60 min at 32 °C (block release). The effects of the KDEL-R- D193N mutant are very similar to those of the SFK inhibitor SU6656 (see Fig. 6a, b): ER-to-Golgi trafficking was not affected (15 min), whereas the arrival of VSVG at the PM was inhibited (60 min). Scale bars, 10 µm. (b) Quantification of data illustrated in a, as means (±SE) from two independent experiments, each assessing 10 to 20 cells, showing the arrival of VSVG at the PM 60 min from temperature block release. IF intensities are expressed as arbitrary units (AU; see Methods). **p<0.01, versus KDEL-R (Student’s t-test). (c) The transport block imposed by the DN KDEL-R is overcome by overexpression of constitutively active
Src. COS7 cells were transfected with VSVG-GFP, Myc-tagged KDEL-R (KDEL-RM) or KDEL-R-D193N-Myc (KDEL-R-D193NM), and wild-type Src (control; Src) and constitutively active Src (Src c.a.). The cells were subjected to the 40-32 °C VSVG traffic pulse and examined under IF microscopy. KDEL-RM, KDEL-R-D193NM (red) and VSVG (green) are shown 60 min after release of the temperature block. The block of VSVG transport to the PM seen in KDEL-R-D193N-transfected cells was rescued by overexpression of constitutively active Src, where VSVG arrival at the PM was restored; this was not the case for wild-type Src transfection. Scale bars, 10 µm. (d) Quantification of data illustrated in c, with VSVG-GFP on the PM determined by integrating the VSVG IF excluding the Golgi and the nuclear areas. (b, d) Data are representative of at least two independent experiments, each assessing 30 to 40 cells. The VSVG IF intensities (means ±SE) are expressed as arbitrary units (AU; see Experimental Procedure). **p<0.01, KDEL-R-D193N plus constitutively active Src versus plus wild- type Src; ***p<0.01, versus respective controls (ANOVA analysis).
K D
E L
-R K
D E
L -R
D 1 9 3 N
a VSVG
b
c
40 °C 32 °C (min at 32 °C)
0 6015
0
20
40
60
80
100
120
140
160
K D E L-
R
K D E L-
R D
19 3N
V S
V G
I F
i n
te n
s it
y o
n P
M (
A U
)
***
d
VSVG-GFP
K D
E L
-R M
K D
E L
-R M D
1 9 3 N
0
20
40
60
80
100
120
140
KD EL
-R M
Sr
c
KD EL
-R D
19 3N
M Sr
c
KD EL
-R M
Sr
c c.
a.
KD EL
-R D
19 3N
M
Sr c
c. a.
**
***
V S
V G
I F
i n
te n
s it
y o
n P
M (
A U
)
Src Src c.a.
6060
© 2008 Macmillan Publishers Limited. All rights reserved.
1
Supplementary Information
Supplementary Information, Text S1. Subcellular distribution of p-SFKs in traffic-pulsed
cells under immunoelectron microscopy.
The detailed Golgi distribution of p-SFKs induced by traffic was analysed by
immunoelectron microscopy (immuno-EM). In quiescent cells (at 40 °C), p-SFKs were distributed
throughout the cytosol and in various organelles, including the Golgi complex (Fig. 2g, h). During
trafficking, p-SFKs increased markedly on the Golgi complex, but not elsewhere (Fig. 2h), in
agreement with the immunofluorescence (IF) data. In the Golgi, the p-SFKs were mostly on the cis-
and trans-most cisternae and (to a lesser extent) on the cis- and trans-Golgi networks (CGN and
TGN). These structures accounted for 65% of the total labelling (approximately equally distributed
between the two poles). The rims of the cisternae and vesicles accounted for the remaining 35%,
while the core of the stacks were nearly devoid of labelling.
Supplementary Information, Text S2. Golgi-SFK activation on the Golgi is not restricted to
HF cells and is exclusively dependent on trafficking.
Virtually all cells secrete one or more forms of procollagen1, 2, and might therefore show
activation of Golgi-SFKs under traffic synchronization protocols. We thus examined the Golgi p-
SFK response to traffic (by IF) in other cell lines, including NRK fibroblasts (which secrete PC-I),
HeLa and COS7 cells (which secrete PC-IV, albeit in variable amounts) (see Supplementary
Information, Fig. S2d and S3a)3, 4. In HeLa cells, the basal Golgi p-SFK signal was faint at 40 °C,
but increased during the PC-IV pulse in 60%-70% of cells (Supplementary Information, Fig. S2e).
In NRK and COS7 cells, however, the p-SFK signal was too low to be readily assessed on the Golgi
in most cells, even during trafficking (not shown), possibly because the amount of SFKs present on
the Golgi complex in these cells is lower than in other cell lines (see Supplementary Information,
Fig. S2c for details). We thus looked at Tyr phosphorylation patterns in cell lysates of NRK and
COS7 cells, potentially a more sensitive assay than IF in single cells. Indeed, traffic-induced p-Tyr
bands were detectable in lysates from COS7, NRK and HeLa cells (Supplementary Information,
Fig. S2f) and their patterns were similar to those in HF cells. There was also a similar, albeit not
identical, increase in p-SFKs (Supplementary Information, Fig. S2g). For instance, Yes and Src
(and, or Fyn), but not Lyn, were activated in COS7 and HF cells (Supplementary Information, Fig.
S2h and Fig. 2c, respectively), while Yes, Fyn and possibly Lyn were activated in HeLa cells (not
shown). Moreover, adding to the variability, Src was abundant in COS7 cells and scarce in HeLa
© 2008 Macmillan Publishers Limited. All rights reserved.
2
cells, with Fyn showing the opposite (see Supplementary Information, Fig. S2a). Thus the repertoire
and activation by traffic of the SFKs varies across cell types.
We also sought to overcome the limitations of the single-cell IF-based assay in COS7 cells
by transfecting these cells with Src and the synchronizable cargo VSVG, as this should increase the
size and reproducibility of the traffic pulse. Indeed, when these COS7 cells were subjected to a
traffic pulse, the arrival of VSVG at the Golgi complex was accompanied by a large increase in the
Golgi p-SFK signal (Supplementary Information, Fig. S3c-e). Similar results were obtained in
VSV-infected cells. When COS7 cells were transfected with Src but not VSVG (i.e. where the main
cargo was PC-IV; Supplementary Information, Fig. S3a, b, d), the p-SFK increase was visible but
smaller, presumably reflecting the smaller cargo input. The same protocols were used in other cell
lines (i.e. NRK, NIH 3T3 and Vero cells); these behaved like COS7 cells, confirming that this
activation of SFKs on the Golgi complex by traffic in several cell lines (not shown).
We also carried out control experiments to ensure that the Golgi p-SFK response is not
induced or influenced by the 40-32 °C temperature shift itself. First, we microinjected HeLa cells
with a recombinant GTP-locked mutant of the small GTPase Sar1 (Sar1-GTP), a construct that
blocks cargo exit from the ER5, and then subjected these cells to the 40-32 °C shift. This treatment
completely prevented the p-SFK response on the Golgi complex (Supplementary Information, Fig.
S4a, b). Secondly, we depleted the cells of cargo with cycloheximide (CHX), thus preventing them
from generating a cargo pulse, and subjected them to the same temperature shift. Again, no p-SFK
and p-Tyr responses were detected. Note that CHX does not by itself affect secretory function nor
the ability of cells to produce the p-Tyr response, as shown by specifically designed control
experiments (Supplementary Information, Fig. S4c).
We also summarize here other independent approaches that are relevant to the effects of
temperature and are described in the main body of the text.
First, Golgi SFKs are activated in Vero cells upon synchronized retrograde transport of a
modified Shiga toxin B (STB) fragment engineered to bear a KDEL tetrapeptide on its C-terminus
(STB-KDEL). This toxin enters the cells by endocytosis. and the cells also undergo an upward 19-
37 °C temperature shift instead of the classical downward 40-32 °C. Moreover, and more
importantly, Golgi-SFK activation is seen about 1 h after the temperature shift, concomitant with
the arrival of STB-KDEL at the Golgi, which also rules out possible acute effects of this
temperature shift (Fig. 3a, b).
Second, Golgi SFKs are activated in COS7 cells upon overexpression of an artificial KDEL-
R ligand (HRP-KDEL) or the receptor itself, without any temperature shift (see Fig. 3c-e).
© 2008 Macmillan Publishers Limited. All rights reserved.
3
Third, there are the series of experiments that follow microinjection of an anti-KDEL-R
antibody and transfection of a DN KDEL-R (see Fig. 4), and the transfection of KDEL-R-directed
siRNAs (see Supplementary Information, Fig. S5)
This collective evidence leaves little doubt that the Golgi p-SFK response is due to
activation of the KDEL-R and not to temperature-change effects.
Collectively, the above data show that traffic pulses from the ER to the Golgi complex induce
the phosphorylation and activation of SFKs on the Golgi itself, and SFK-dependent phosphorylation
of other proteins.
Supplementary Information, Text S3. Traffic pulses carry enough chaperones to activate the
KDEL-R and the Golgi p-SFK response.
To determine whether a traffic pulse carries enough chaperones to activate the KDEL-R—p-
SFK-response, we first showed the presence of the chaperone disulphide isomerase (PDI) in traffic
carriers leaving the ER during a 40-32 °C VSVG traffic pulse, in agreement with previous
observations (Supplementary Information, Fig. S5d)6-8. Then, we examined the effects of a VSVG
traffic pulse on the KDEL-R: this induced recycling of some 30% of the KDEL-R from the Golgi
complex to the ER (Supplementary Information, Fig. S5e, f). Since the recycling of the KDEL-R is
due to its binding to KDEL ligands (the chaperones are the only known natural KDEL ligands), this
indicates that chaperones bind a sizeable portion of the Golgi KDEL-R during a traffic pulse.
Finally, we sought to determine the roles of chaperones in activation of Golgi SFKs by
overexpressing the abundant chaperone BiP. When expressed at medium levels (2-3-fold over
basal), BiP induced a partial redistribution of the KDEL-R and of cis-Golgi markers from the Golgi
complex to the ER (so BiP was binding to the Golgi KDEL-R), and at the same time the Golgi p-
SFK signal increased (2.5 ±0.3 fold; n = 5). Very high BiP expression levels caused instead the
complete dispersal of the cis-Golgi and loss of the Golgi p-SFK signal (not shown). Thus,
overexpressed BiP can escape the ER retention mechanisms, and like other KDEL ligands (see Fig.
3), it can induce recycling of the KDEL-R and also induce the Golgi p-SFK response (albeit less
effectively than a traffic pulse). More work is needed to establish whether all of the chaperones can
activate the Golgi SFKs and whether other components can mimic the chaperones or modulate their
effects.
© 2008 Macmillan Publishers Limited. All rights reserved.
4
Supplementary Information, Text S4. SFK activation on the Golgi complex is required for
steady-state trafficking.
The traffic synchronization conditions used to reveal this Golgi signalling pathway involved
the accumulation of cargo in the ER at 40 °C, followed by rapid release of large amounts of cargo
to the Golgi complex. This could result in ER stress and in Golgi overload. It has been shown
previously that under similar conditions (VSVG accumulation in the ER at 40 °C), the ER stress
response is not activated9. Nevertheless, a possible concern would be that the Golgi-SFK response
to the arrival of traffic could come into play only under these synchronization conditions, and not
during physiological steady-state trafficking. We addressed this experimentally, by asking two
questions: first, can steady-state trafficking elicit a p-SFK signal on the Golgi complex, and second,
are the activities of SFKs needed to sustain steady-state trafficking through the Golgi complex?
For the first, we used HF and HeLa cells, where endogenous p-SFKs are detectable by IF.
Under conditions of non-perturbed trafficking at 37 °C (Fig. 7a-c), p-Tyr and p-SFK signals were
visible in the Golgi area. When trafficking was arrested by the 40 °C block, the Golgi p-Tyr and p-
SFK labelling dropped to background levels (Fig. 7a-c); when this block was lifted, the Golgi p-Tyr
and p-SFK signals rebounded to higher values (Fig. 7a-c). This indicates that activation of SFKs on
the Golgi complex is also associated with steady-state trafficking.
To examine the second question, i.e. whether activation of SFKs is needed for steady-state
trafficking, we analysed the effects of the SFK blocker SU6656 on PC-I transport in non-perturbed
HF cells. Here, the PC-I present in the Golgi complex in transit towards the PM is detectable by IF
(Fig. 7d, time 0). Thus, if SU6656 blocks intra-Golgi but not ER-to-Golgi trafficking (as with traffic
pulses), SU6656 should result in accumulation of PC-I in the Golgi area. Indeed, in HF cells treated
with SU6656, PC-I increased in the Golgi area, gradually reaching high levels (Fig. 7d, e), although
after a few hours the cargo-filled Golgi complex appeared to partially recover its export of cargo.
Similar experiments were performed in COS7 cells expressing low levels of VSVG-GFP, where the
VSVG in the Golgi complex during steady-state transport was barely visible (Fig. 7f, time 0). Also
in these cells, SU6656 induced a gradual accumulation of VSVG in the Golgi area (Fig. 7f, g),
confirming that exit of cargo from the Golgi complex was inhibited. The converse was to treat HF
cells with CHX to block synthesis of PC-I, and then to monitor the exit rate of the PC-I present in
the secretory system at the time of the block. In SU6656-treated cells, PC-I exited the Golgi
complex much more slowly than in control cells, again consistent with inhibition of intra-Golgi
trafficking (not shown). Similar results were obtained in other procollagen-secreting cells (NRK
cells), and in cells where trafficking was monitored using VSVG (COS7) (not shown).
© 2008 Macmillan Publishers Limited. All rights reserved.
5
We also investigated whether steady-state secretion of a soluble cargo, albumin, is affected by
SFK inhibition10. Albumin secretion in HepG2 cells was markedly reduced by 5 µM SU6656
applied for 30 min (not shown; shorter exposures to SU6656 were less effective10, 11). We thus
conclude that the Golgi-SFK signalling circuit also operates during steady-state trafficking.
Supplementary Information, Text S5. SYF cells evolved salvage mechanisms to replace the
ablation of Src, Yes and Fyn as a trafficking regulator.
Complex cellular functions, such as proliferation and motility, are controlled by robust
regulatory networks within which one pathway is often dominant over the others, but not unique12,
13. Moreover, inhibition of the dominant pathway can lead to a functional switch towards the
subordinate ones. This appears to be the case for SYF embryonic fibroblasts, where the ubiquitous
Src, Fyn and Yes SFKs have been genetically ablated and trafficking appears to be supported by
other members of the SFKs, which are normally absent in fibroblasts (see Supplementary
Information Fig. S7). The expression of these kinases in these cells is probably supported by
adaptive mechanisms designed to compensate for the lack of Src, Yes and Fyn, and that thus sustain
trafficking (as well as other essential SFK-dependent functions)14.
© 2008 Macmillan Publishers Limited. All rights reserved.
6
References 1. Canty, E. G. & Kadler, K. E. Procollagen trafficking, processing and fibrillogenesis. J. Cell Sci.
118, 1341-1353 (2005). 2. Green, H. & Goldberg, B. Synthesis of collagen by mammalian cell lines of fibroblastic and
nonfibroblastic origin. Proc. Natl. Acad. Sci. U. S. A 53, 1360-1365 (1965). 3. Furth, J. J., Wroth, T. H., & Ackerman, S. Genes for collagen types I, IV, and V are transcribed
in HeLa cells but a postinitiation block prevents the accumulation of type I mRNA. Exp. Cell Res. 192, 118-121 (1991).
4. Lee, C. I. et al. Leptin and connective tissue growth factor in advanced glycation end-product- induced effects in NRK-49F cells. J. Cell Biochem. 93, 940-950 (2004).
5. Mironov, A. A. et al. ER-to-Golgi carriers arise through direct en bloc protrusion and multistage maturation of specialized ER exit domains. Dev. Cell 5, 583-594 (2003).
6. Ko, M. K. & Kay, E. P. PDI-mediated ER retention and proteasomal degradation of procollagen I in corneal endothelial cells. Exp. Cell Res. 295, 25-35 (2004).
7. Gough, L. L. & Beck, K. A. The spectrin family member Syne-1 functions in retrograde transport from Golgi to ER. Biochim. Biophys. Acta 1693, 29-36 (2004).
8. Mezghrani, A. et al. Protein-disulfide isomerase (PDI) in FRTL5 cells. pH-dependent thyroglobulin/PDI interactions determine a novel PDI function in the post-endoplasmic reticulum of thyrocytes. J. Biol. Chem. 275, 1920-1929 (2000).
9. Nadanaka, S., Yoshida, H., Kano, F., Murata, M., & Mori, K. Activation of mammalian unfolded protein response is compatible with the quality control system operating in the endoplasmic reticulum. Mol. Biol. Cell 15, 2537-2548 (2004).
10. Webb, R. J., Judah, J. D., Lo, L. C., & Thomas, G. M. Constitutive secretion of serum albumin requires reversible protein tyrosine phosphorylation events in trans-Golgi. Am. J. Physiol Cell Physiol 289, C748-C756 (2005).
11. Blake, R. A. et al. SU6656, a selective src family kinase inhibitor, used to probe growth factor signaling. Mol. Cell Biol. 20, 9018-9027 (2000).
12. Hutcheson, I. R. et al. Heregulin beta1 drives gefitinib-resistant growth and invasion in tamoxifen-resistant MCF-7 breast cancer cells. Breast Cancer Res. 9, R50 (2007).
13. Huang, P. H. et al. Quantitative analysis of EGFRvIII cellular signaling networks reveals a combinatorial therapeutic strategy for glioblastoma. Proc. Natl. Acad. Sci. U. S. A 104, 12867- 12872 (2007).
14. Thomas, S. M. & Brugge, J. S. Cellular functions regulated by Src family kinases. Annu Rev Cell Dev Biol 13, 513-609 (1997).
15. Cole, N. B., Ellenberg, J., Song, J., DiEuliis, D., & Lippincott-Schwartz, J. Retrograde transport of Golgi-localized proteins to the ER. J. Cell Biol. 140, 1-15 (1998).
16. de Figueiredo, P. et al. Phospholipase A2 antagonists inhibit constitutive retrograde membrane traffic to the endoplasmic reticulum. Traffic. 1, 504-511 (2000).
17. Arcaro, A. et al. Critical role for lipid raft-associated Src kinases in activation of PI3K-Akt signalling. Cell Signal. 19, 1081-1092 (2007).
© 2008 Macmillan Publishers Limited. All rights reserved.
- A traffic-activated Golgi-based signalling circuit coordinates the secretory pathway
- RESULTS
- DISCUSSION
- METHODS
- Acknowledgements
- Author contributions
- References
- Figure 1 PC-I arrival at the Golgi is associated with Tyr phosphorylation in the Golgi area. (a) Time-course of PC-I in the Golgi area. Cells were incubated for 3 h at 40 °C (temperature block), shifted to 32 °C (block release) for the indicated times and then fixed and double-stained for GM130 (cis-Golgi marker, for Golgi definition; green) and PC-I (red). (b) Time course of Tyr phosphorylation in the Golgi area. Cells were treated as in a and double-stained for GM130 (data not shown) and p-Tyr (green). (c) Traffic-induced Tyr phosphorylation in the Golgi area under SFK inhibition. Cells underwent the traffic pulse in a, with SU6656 (10 µM) added 30 min before temperature block release, and were processed for p-Tyr immunofluorescence; inhibition of Tyr phosphorylation in the Golgi area was nearly complete. (d) Quantification of data illustrated in a, b. Both the total p-Tyr-related immunofluorescence signal in the Golgi and non-Golgi areas and the immunofluorescence intensities (total signal over surface area) in the same areas were determined; immunofluorescence (IF) intensities are shown. Considering the total immunofluorescence signal across the whole cell, the increased immunofluorescence in trafficking cells (25–30%) is completely accounted for by the increased immunofluorescence in the Golgi area (350%). P-Tyr (blue circles) and PC-I (red squares) in the Golgi area, and p-Tyr in non-Golgi areas (green triangles; control). Data are means ±s.e.m. of four independent experiments, each assessing 10–20 cells. ***P < 0.001, compared with 40 °C control at zero time (ANOVA). Immunofluorescence intensities are expressed as arbitrary units (AU). Scale bars, 10 µm.
- Figure 2 Traffic stimulates Tyr phosphorylation on many proteins and activates SFKs in the Golgi area. (a) Traffic-pulse effects on cellular Tyr phosphorylation. HF cells were incubated for 3 h at 40 °C, shifted to 32 °C for 30 min and then homogenized; where indicated, SU6656 (10 µM) was added 30 min before temperature shift. The p-Tyr patterns were analysed by immunoblotting with an anti-p-Tyr antibody. (b) HeLa cells were processed as in a. The panel on the right shows key sectors of the p-Tyr pattern (at 32 °C) separated on a high-resolution gel, with three clusters of bands (cluster 1, 108K–130K; cluster 2, 70K–83K; cluster 3, 53K–62K) with increased Tyr phosphorylated under trafficking. (c) Traffic-pulse effects on SFK phosphorylation. HF cells underwent the traffic pulse in a and were analysed by immunoblotting for total SFKs (middle panel) and their phosphorylated (at Tyr 419) active forms p-SFKs (upper panel). Lower panel: control samples separated on high-resolution gel indicate that p-Yes and p-Src and/or p-Fyn (according to the relative molecular mass) are the SFKs activated by trafficking in HF cells. (d, e) The traffic pulse activates SFKs in the Golgi area. HF cells were treated as in a and processed for p-SFKs immunofluorescence. (f) The traffic pulse does not modify intracellular SFK localization in the Golgi area. HF cells were treated as in a and processed for SFK immunofluorescence. Data are representative of at least three independent experiments, each assessing 10–20 cells (a–f). (g) Ultrastructural localization of traffic-induced p-SFKs on the Golgi complex. COS7 cells were treated as in a and processed for immuno-EM labelling of p-SFKs, using the gold-enhance technique. G, Golgi complex. (h) Quantification of traffic-induced p-SFKs illustrated in g. Data are means of two independent experiments, each of which involved 10–20 measurements, with a variability that never exceeded 10% of the means. For all immunofluorescence analyses, the Golgi area was defined by co-immunostaining with GM130. Scale bars, 10 µm (d–f) and 200 nm (g).
- Figure 3 Activation of the KDEL-R leads to activation of SFKs in the Golgi area. (a) On reaching the Golgi area, STBKDEL activates the KDEL-R and SFKs. Src-transfected Vero cells were incubated with Alexa488-conjugated STBKDEL and stained for p-SFKs and the KDEL-R. Synchronized retrograde movement of STBKDEL was achieved by its binding (4 °C) and accumulation in the endosomal compartment (19.5 °C) followed by its release (37 °C) for 0, 60 and 120 min. (b) Quantification of data illustrated in a, showing accumulation in the Golgi area of p-SFKs with STBKDEL (upper panel) and wild-type STB (lower panel). Data are means ± s.e.m. of three independent experiments, each assessing 10–20 cells. **P < 0.01, ***P < 0.001, versus 19.5 °C control at zero time (ANOVA analysis). The quantification of p-SFKs at 120 min used the Golgi marker GM130 staining as reference area (data not shown). (c) ssHRPKDEL expressed in the secretory pathway activates SFKs in the Golgi area. COS7 cells were co-transfected for 16 h with Src and ssHRPKDEL or ssHRP, fixed and stained for HRP and p-SFKs. (d) KDEL-R overexpression activates SFKs in the Golgi area. COS7 cells were transfected for 16 h with KDEL-R–GFP, fixed and stained for p-SFKs, with low and high KDEL-R–GFP (KDEL-R)-expressing cells chosen. The high-expressing cells showed threefold more KDEL-R–GFP than the low expressing cells. (e) Quantification of data illustrated in c and d. Data are means from two independent experiments, each assessing 10–20 measurements with a variability that never exceeded 10% of the means. All immunofluorescence (IF) intensities are expressed as arbitrary units (AU). Scale bars, 10 µm.
- Figure 4 Inhibition of the KDEL-R impairs traffic-induced SFKs activation in the Golgi area. (a) Microinjection of an antibody against the C terminus of the KDEL-R blocks SFK activation in the Golgi area. COS7 cells were co-transfected with Src and VSVG–GFP, and microinjected (during the 40 °C temperature block) with unrelated IgGs or an anti-KDEL-R antibody (Ab; clone 10C3). After a 60-min recovery, the block was released (32 °C) for 20 min and cells stained for p-SFKs. (b) Quantification of p-SFKs in the Golgi area as illustrated in a (column A), c (column C) and d (column D). Data are means ± s.e.m.of four independent experiments, each assessing 10–20 cells. Open columns, respective controls; filled columns, anti-KDEL-R antibody microinjection (A) and KDEL-RD193N transfection (C, D). ***P < 0.001, compared with respective controls (Student’s t-test). Active SFK immunofluorescence (IF) intensities expressed as arbitrary units (AU). (c) The KDEL-RD193N mutant blocks SFKs activation in the Golgi area induced by ssHRPKDEL. COS7 cells were co-transfected with Src and ssHRPKDEL, and with KDEL-RD193N–GFP (KDEL-RD193N) or KDEL-R–GFP (KDEL-R), then fixed and stained for HRP and p-SFKs. (d) The KDEL-RD193N mutant blocked SFK activation in the Golgi area that was induced by a VSVG traffic pulse. COS7 cells were co-transfected with Src and KDEL-RD193N–GFP (KDEL-RD193N) or KDEL-R–GFP (KDEL-R), and infected with VSV. The cells were subjected to the VSVG traffic pulse and examined for VSVG and p-SFKs by immunofluorescence microscopy. Perinuclear KDEL-R localization was used to define the Golgi area. Scale bars, 10 µm.
- Figure 5 A direct interaction between Src and the KDEL-R, as revealed by the yeast two-hybrid assay. To investigate the molecular mechanisms through which the KDEL-R activates SFKs, we carried out a yeast two-hybrid assay between the KDEL-R C-terminal domain (KDEL-R-C, amino acids Ala 183–Ala 212 of the human sequence) and full-length Src. Assays were performed by mating the two yeast strains transformed with the KDEL-R and Src. The diploid yeasts expressing both proteins were selected on auxotrophic media lacking leucine and tryptophan (double drop-out, DDO panels). Furthermore, the diploid yeast grown on DDO were replica-plated on highly selective media lacking leucine, tryptophan, histidine and adenine (quadruple drop-out, QDO panels). In this system, only diploid yeasts bearing the two interacting proteins can grow on QDO media, indicating that Src can interact with the KDEL-R-C. When co-transformed with the empty vectors (Src + pGBKT7 and KDEL-R-C + pGADT7, respectively), Src and KDEL-R-C cells did not grow, confirming specificity of the result. The pGBKT7–53 + pGADT7-T panels show the positive control for the two interacting proteins.
- Figure 6 Activation of SFKs is required for synchronized intra-Golgi trafficking. (a) SFK inhibition blocks transport of VSVG. COS7 cells were infected with VSV and kept at 40 °C for 3 h, with vehicle or SU6656 (5 µM) added for the final 30 min. The block was released (32 °C) for the indicated times. Panels 0, 15, 45 min: immunostaining for VSVG (red) and GM130 or TGN46 (green). Panels 60 min: VSVG arrival at the plasma membrane, as revealed by an antibody against the extracellular domain of VSVG. (b) VSVG transport is inhibited in SFK-inhibitor-treated cells. Quantification of VSVG transport in COS7 cells treated as in a, with vehicle (Control) or 5 µM SU6656, 10 µM PP1, PP2, Src kinase inhibitor 1 (SKI-1) and PP3, or 30 µM SP00125 added for the final 30 min (SU6656, SKI-1 and SP00125) or 3 h (PP1, PP2 and PP3) of the 40 °C block. Data are means ± s.e.m. of four independent experiments, each assessing 20–30 cells. (c) Endogenous Src localizes to the Golgi complex in COS7 cells, as assessed by immunostaining with anti-Src (red) and anti-giantin (green) antibodies. The insets show magnification of the Golgi area. (d, e) Src-directed siRNAs and a dominant-negative (DN) Src inhibit VSVG transport. COS7 cells were transfected with SrcK295R (DN Src), or siRNAs for Src, and then VSV infected and processed as in a, with VSVG arrival at the plasma membrane (red) as in a, and immunostaining for total VSVG (green). (f, g) Quantification of the effects of Src-directed siRNAs and of SrcK295R (DN Src) transfection on VSVG transport in COS7 cells illustrated in d and e respectively. Data are means ± s.e.m. of four independent experiments, each assessing 20–30 cells. VSVG immunofluorescence (IF) intensities on the plasma membrane (PM) are calculated as ratios of VSVG on the PM to total VSVG; all IF intensities are expressed as arbitrary units (AU). **P < 0.01, ***P < 0.001, versus respective controls (Student’s t-test; b, f, g). Scale bars, 10 µm (a, c, d, e).
- Figure 7 Activation of SFKs is required for steady-state intra-Golgi trafficking. (a) Modulation of Tyr phosphorylation in the Golgi area. HF cells were fixed at steady-state (37 °C) or 3 h after ER exit block (40 °C) or 30 min after transport block release (32 °C), and double-stained for GM130 (cis-Golgi marker, for Golgi definition; data not shown) and p-Tyr (green). (b) Quantification of data illustrated in a. (c) Golgi SFKs are activated during steady-state transport in HeLa cells. Quantitative analysis of p-SFKs in the Golgi area in HeLa cells treated as in a. (d) Inhibition of PC-I steady-state transport. HF cells were incubated at 32 °C (non-perturbed transport) before addition of vehicle or 10 µM SU6656 for the indicated times, then fixed and double-stained for GM130 (data not shown) and PC-I (red). (e) Quantification of data illustrated in d. Red squares, control Golgi-PC-I accumulation; blue squares, SU6656-treated cells. (f) Inhibition of VSVG–GFP steady-state transport. COS7 cells were transfected with VSVG–GFP and incubated overnight at 32 °C, before addition of vehicle or 5 µM SU6656 for the indicated times, and then examined for VSVG by immunofluorescence microscopy. (g), Quantification of data illustrated in f showing VSVG–GFP accumulation in the Golgi expressed as the Golgi-to-PM IF ratio. Data are means of two independent experiments, each of which involved 10–20 measurements with a variability that never exceeded 10% of the mean (b, c, e, g). All immunofluorescence (IF) intensities are expressed as arbitrary units (AU). Scale bars, 10 µm (a, d, f).
- Figure 8 Model of traffic self-regulation by the chaperone-KDEL-R-SFK signal-response system. Chaperones containing KDEL sequences (red triangles) leave the ER with cargo (black ballsticks). On arrival at the cis-Golgi, they bind the KDEL-R (green Pacmen), triggering activation of SFKs on the Golgi complex (localization indicated by the shadowed area). This activation may occur by direct interactions between the KDEL-R and Golgi SFKs or by a more complex mechanism. In turn, these p-SFKs induce a phosphorylation cascade (violet arrows) that is required for the trafficking machinery to function for the subsequent intra-Golgi transport. The KDEL-R-dependent SFK activation on the Golgi complex may also regulate other functions in the cell (indicated by fuchsia arrows). As it has been reported previously that SFKs can modulate Golgi-to-ER retrograde transport, the SFK Golgi pool may also be responsible for this modulation24 (indicated by pale violet arrow). The green arrows indicate the directions of membrane trafficking.