Bio 325

June27
ANestedPCRAssaytoAvoidFalsePositive.pdf

RESEARCH ARTICLE

A Nested PCR Assay to Avoid False Positive

Detection of the Microsporidian

Enterocytozoon hepatopenaei (EHP) in

Environmental Samples in Shrimp Farms

Pattana Jaroenlak 1,2

, Piyachat Sanguanrut 2,3

, Bryony A. P. Williams 4 , Grant D. Stentiford

5 ,

Timothy W. Flegel 2,6

, Kallaya Sritunyalucksana 3,6

, Ornchuma Itsathitphaisarn 1,2*

1 Department of Biochemistry, Faculty of Science, Mahidol University, Bangkok, Thailand, 2 Center of

Excellence for Shrimp Molecular Biology and Biotechnology (Centex Shrimp), Faculty of Science, Mahidol

University, Bangkok, Thailand, 3 Shrimp Pathogen Interaction Laboratory (SPI), National Center for Genetic

Engineering and Biotechnology (BIOTEC), Bangkok, Thailand, 4 Biosciences, College of Life and

Environmental Sciences, University of Exeter, Exeter, United Kingdom, 5 European Community Reference

Laboratory for Crustacean Diseases, Center for Environment, Fisheries and Aquaculture Science (Cefas),

Weymouth, Dorset, United Kingdom, 6 National Center for Genetic Engineering and Biotechnology

(BIOTEC), National Science and Technology Development Agency (NSTDA), Pathum Thani, Thailand

* ornchuma.its@mahidol.ac.th

Abstract

Hepatopancreatic microsporidiosis (HPM) caused by Enterocytozoon hepatopenaei (EHP)

is an important disease of cultivated shrimp. Heavy infections may lead to retarded growth

and unprofitable harvests. Existing PCR detection methods target the EHP small subunit

ribosomal RNA (SSU rRNA) gene (SSU-PCR). However, we discovered that they can give

false positive test results due to cross reactivity of the SSU-PCR primers with DNA from

closely related microsporidia that infect other aquatic organisms. This is problematic for

investigating and monitoring EHP infection pathways. To overcome this problem, a sensitive

and specific nested PCR method was developed for detection of the spore wall protein

(SWP) gene of EHP (SWP-PCR). The new SWP-PCR method did not produce false positive

results from closely related microsporidia. The first PCR step of the SWP-PCR method was

100 times (10 4

plasmid copies per reaction vial) more sensitive than that of the existing

SSU-PCR method (10 6

copies) but sensitivity was equal for both in the nested step (10 cop-

ies). Since the hepatopancreas of cultivated shrimp is not currently known to be infected

with microsporidia other than EHP, the SSU-PCR methods are still valid for analyzing hepa-

topancreatic samples despite the lower sensitivity than the SWP-PCR method. However,

due to its greater specificity and sensitivity, we recommend that the SWP-PCR method be

used to screen for EHP in feces, feed and environmental samples for potential EHP

carriers.

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 1 / 15

a11111

OPEN ACCESS

Citation: Jaroenlak P, Sanguanrut P, Williams BAP,

Stentiford GD, Flegel TW, Sritunyalucksana K, et al.

(2016) A Nested PCR Assay to Avoid False Positive

Detection of the Microsporidian Enterocytozoon

hepatopenaei (EHP) in Environmental Samples in

Shrimp Farms. PLoS ONE 11(11): e0166320.

doi:10.1371/journal.pone.0166320

Editor: Erjun Ling, Institute of Plant Physiology and

Ecology Shanghai Institutes for Biological

Sciences, CHINA

Received: July 14, 2016

Accepted: October 26, 2016

Published: November 10, 2016

Copyright: © 2016 Jaroenlak et al. This is an open access article distributed under the terms of the

Creative Commons Attribution License, which

permits unrestricted use, distribution, and

reproduction in any medium, provided the original

author and source are credited.

Data Availability Statement: All relevant data are

within the paper and its Supporting Information

files.

Funding: OI acknowledges support from

Agricultural Research Development Agency under

project CRP5905020530 and Mahidol University.

KS received funding from National Research

Council Thailand, Division of Plan Administration

and Research Budget/2557-79. PJ is supported by

the Science Achievement Scholarship of Thailand

Introduction

Microsporidia are obligate, intracellular, spore-forming parasites [1]. The spores of microspor-

idia have a double-layered chitinaceous wall embedded with proteins that are believed to be

involved in host cell invasion and tissue recognition [2–4]. They infect a wide range of host

animal species from invertebrates to vertebrates, with infections ranging from sub-lethal to

lethal effects depending on pathogen load and host condition [5]. Microsporidian infections

by Nosema ceranae and N. apis in honeybees can lead to increased mortality and colony col- lapse [6], and infection by Enterocytozoon bieneusi in immunocompromized humans may cause severe diarrhea and death [7].

Aquatic animals, including freshwater fish, marine lobsters, crabs, copepods and shrimp

have been found to be infected with various genera of Microsporidia [8–14]. As one of the

world’s largest shrimp producers [15], Thailand’s shrimp production has been negatively

impacted by two microsporidia, namely Agmasoma penaei and Enterocytozoon hepatopenaei (EHP). A. penaei was first discovered in Thailand in 1992 and caused ‘cotton shrimp’ disease or ‘white back’ disease [16]. However, as A. penaei cannot be horizontally transmitted among shrimp, the negative impact of this microsporidian species was ameliorated by removing the

suspected fish alternate hosts from the shrimp cultivation system [17]. In contrast, EHP differs

markedly from A. penaei in that infections can be spread horizontally in shrimp ponds by can- nibalism [18] and cohabitation [19] making it a much more serious threat to shrimp farmers.

EHP is the causative agent of hepatopancreatic microsporidiosis (HPM) and was first rec-

ognized as an unidentified microsporidian in the tubule epithelial cells of the hepatopancreas

in Penaeus monodon in Thailand in 2004 [20]. It was later characterized [12] and subsequently found in the more economically important P. vannamei [18]. Unpublished reports from farm- ers suggest that EHP is involved in the retarded growth of shrimp. This is consistent with a

recent report from China that showed a negative correlation between shrimp size and EHP

load above 10 3

copies/ng of total shrimp DNA [21].

For control of hepatopancreatic microsporidiosis in shrimp, a major initial focus was to

exclude EHP-infected broodstock and their post larvae from the cultivation system. This has

been accomplished in part by screening broodstock, post larvae, and living feed, such as brine

shrimp (Artemia), for post larvae, and molluscs or polychaetes for broodstock with nested PCR that targets the small subunit ribosomal RNA (SSU rRNA) gene of EHP (SSU-PCR) [18]

However, the level of threat from environmental sources of infection in rearing ponds is

still unknown. Issues of concern are the viability of residual spores that may be present in pre-

viously infected ponds and the existence of infected carrier species that may comprise an envi-

ronmental reservoir. Positive SSU-PCR test results for molluscs and polychaetes should be

followed up by in situ hybridization assays to determine whether they are active (infected) or passive (uninfected) carriers. In addition, after the development of the SSU-PCR method [18],

we discovered that recently published SSU rRNA sequences of closely related microsporidia in

marine organisms may potentially give false positive test results for EHP. As hosts of some of

these microsporidia, for example fish and Artemia, are raw materials of shrimp feed, such false positive test results from the SSU-PCR methods might lead to unnecessary destruction of feed

and broodstock from which feces are used for non-invasive PCR diagnosis.

All of the current molecular tools for EHP detection via nucleic acids are based on targeting

the SSU rRNA gene. They include conventional PCR, nested PCR, isothermal loop-mediated

amplification (LAMP) and in situ hybridization [18,22,23]. Thus, to explore the real possibility of obtaining false positive test results by using the SSU-PCR methods, we tested DNA

extracted from microsporidia that are closely related to EHP and available to us. We demon-

strated that, while the SSU-PCR method [18] produced false positive test results with DNA

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 2 / 15

(SAST). GDS acknowledges support of DG SANCO

of the European Commission, and the UK

Department of Environment, Food and Rural Affairs

under project FB002. The funders had no role in

study design, data collection and analysis, decision

to publish, or preparation of the manuscript.

Competing Interests: The authors have declared

that no competing interests exist.

from closely related microsporidia, a newly developed nested PCR method based on a spore

wall protein (SWP) gene (SWP-PCR) of EHP was more sensitive than the SSU-PCR in the first

PCR reaction and more discriminatory overall.

Materials and Methods

1. Multiple sequence alignment analysis

The SWP gene sequence for EHP used in this work was obtained by whole genome sequencing

of DNA extracted from EHP spores purified from infected hepatopancreatic tissue by Percoll

gradient centrifugation. It has been submitted to the GenBank database and assigned the

accession number KX258197. Accession numbers of the nucleotide sequences of the SSU

rRNA and SWP genes from EHP-related microsporidian taxa were retrieved from the Gen-

Bank database and are shown in Tables 1 and 2, respectively. Multiple sequence alignments

were carried out using Clustal Omega (http://www.ebi.ac.uk/Tools/msa/clustalo) [24].

2. Shrimp specimens

With permission from the farm owners to collect specimen from their properties for this

study, EHP-infected P. vannamei (5–7 grams) were collected from commercial shrimp ponds in Trat province, Thailand from August to September 2015. From each shrimp, hepatopan-

creas was removed, being careful to exclude bacterial contamination from the stomach and

intestine. One half of the hepatopancreas was subjected to DNA extraction while the other was

preserved with Davidson’s fixative and processed for routine paraffin embedding and histolog-

ical analysis as described by Bell & Lightner [25].

3. DNA extraction and purification

Hepatopancreatic tissue was homogenized in 500 μl lysis buffer (50 mM Tris pH 9, 0.1 M EDTA pH 8, 50 mM NaCl, 2% SDS) containing 5 μg/ml proteinase K before incubation at 55˚C for 30 min. Total DNA was purified using a standard phenol-chloroform method [26]

Table 1. Small subunit rRNA sequences used for multiple sequence alignment analysis.

Microsporidian species Acronym %Identity Host species Accession No.

Enterocytozoon hepatopenaei EHP - Penaeid spp. KP759285.1

Enterospora nucleophile Enu 93 Sparus aurata KF135645.1

Enterospora canceri Eca 90 Cancer pagurus HE584634

Nucleospora salmonis Nsa 89 Salmonidae AF185991.1

Enterocytozoon bieneusi Ebi 88 Homo sapiens AY257180.1

Nucleospora cyclopteri Ncy 86 Cyclopterus lumpus KC203457.1

Obruspora papernae Opa 86 Callionymus filamentosus HG005137.1

Paranucleospora theridion Pth 86 Salmo salar and Lepeophtheirus salmonis FJ594988.1

Enterocytospora artemiae Ear 82 Artemia spp. JX839889.1

Hepatospora eriocheir Her 80 Eriocheir sinensis HE584635.1

doi:10.1371/journal.pone.0166320.t001

Table 2. Spore wall protein sequences used for multiple sequence alignment analysis.

Microsporidian species Acronym % Identity Host species Accession No.

Enterocytozoon hepatopenaei EHP - Penaeid spp. KX258197

Enterocytozoon bieneusi Ebi 66 Homo sapiens NW003102063.1 (38817–39503)

Enterospora canceri Eca 64 Cancer pagurus Unpublished

Hepatospora eriocheir Her 60 Eriocheir sinensis Unpublished

doi:10.1371/journal.pone.0166320.t002

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 3 / 15

and treated with DNase-free RNase (New England Biolabs, USA). Concentration of DNA was

determined using a NanoDrop Spectrophotometer (Thermo Scientific, USA).

4. SSU-PCR and SWP-PCR detection methods

The nested SSU rRNA PCR method (SSU-PCR) used in this study has been previously

described [18] and the primers for it are shown in Table 3. For the nested SWP PCR method

(SWP-PCR), primers were designed from the SWP sequence of EHP (GenBank Accession no.

KX258197) using Primer3 software [27]. Secondary structures of the primers were analyzed

using the Mfold web server [28]. The PCR reaction mixture for both steps (25 μl) contained 0.2 mM dNTP, 1.5 mM MgCl2, 0.2 μM of each primer, 0.5 unit of Taq DNA polymerase (New England Biolabs, USA). For the first step PCR, added templates consisted of either 100 ng of

total DNA extracted from EHP-infected, shrimp hepatopancreatic tissue or 5 ng of control

plasmid pGEM-SWP (see below). The PCR protocol for the first PCR reaction used primers

SWP_1F and SWP_1R (Table 3) and consisted of a 5-min initial denaturation at 95˚C followed

by 30 cycles of denaturation for 30 s at 95˚C, annealing for 30 s at 58˚C and extension for 45 s

at 68˚C with a final 5-min extension step at 68˚C. The expected PCR product was 514 bp. For

the second (nested) PCR step, the template consisted of 1 μl of the final reaction solution from the first PCR step. The PCR protocol for the second, nested PCR reaction used primers

SWP_2F and SWP_2R (Table 3), with an initial denaturation at 95˚C for 5 min followed by 20

cycles of 30 s denaturation at 95˚C, 30 s annealing at 64˚C and 20 s extension at 68˚C with a

final extension for 5-min at 68˚C. The expected PCR product was 148 bp. The amplicons were

analyzed by 1.5% agarose gel electrophoresis with ethidium bromide staining and using a

DNA ladder marker (2 log, 100 bp, or 1 kb DNA ladder from New England Biolabs, USA)

5. Construction of a plasmid control template for SWP-PCR

To construct a plasmid containing a fragment of the SWP gene, the primers SWP_1F and

SWP_1R (Table 3) were used as described above to generate a 514 bp amplicon that was cloned

into a pGEM1-T Easy Vector (Promega, USA). Plasmids from positive transformants were

Table 3. PCR primers used in this study.

Primer name Sequence (5’ to 3’) Amplicon size (bp) Reference

SWP-PCR

First step

SWP_1F TTGCAGAGTGTTGTTAAGGGTTT 514 This study

SWP_1R CACGATGTGTCTTTGCAATTTTC

Nested step

SWP_2F TTGGCGGCACAATTCTCAAACA 148 This study

SWP_2R GCTGTTTGTCTCCAACTGTATTTGA

SSU-PCR

First step

ENF779 CAGCAGGCGCGAAAATTGTCCA 779 [18]

ENR779 AAGAGATATTGTATTGCGCTTGCTG

Nested step

ENF176 CAACGCGGGAAAACTTACCA 176 [18]

ENR176 ACCTGTTATTGCCTTCTCCCTCC

Actin PCR

Actin_F CCTCGCTGGAGAAGTCCTAC 401 [29]

Actin_R TGGTCCAGACTCGTCGTACTC

doi:10.1371/journal.pone.0166320.t003

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 4 / 15

extracted using a Presto TM

Mini Plasmid kit (Geneaid, Taiwan) and sequenced using both SP6

and T7 universal primers (Macrogen, South Korea). Nucleotide sequences were analyzed by

BLASTn (http://www.ncbi.nlm.nih.gov/BLAST) and aligned against the SWP sequence (Gen-

Bank Accession no. KX258197) using MUSCLE multiple sequence alignment software (http://

www.ebi.ac.uk/Tools/msa/muscle). The plasmid was named pGEM-SWP. This plasmid and

one (pGEM-SSU) containing the target for the SSU-PCR method [18] were used as positive

control templates and for testing the comparative sensitivity of the SWP-PCR and SSU-PCR

detection methods.

6. Specificity of the SWP-PCR and SSU-PCR detection methods

To test the specificity of the SWP-PCR and SSU-PCR methods, PCR reactions were carried

out as described in section 4, with the exception that the total reaction volume contained 20 ng

of total DNA (gDNA) extracted from aquatic organisms infected with other microsporidian

species. These were closely-related Enterospora canceri (Eca) from the European edible crab (Cancer pagurus) and Hepatospora eriocheir (Her) from the Chinese mitten crab, which were chosen for the specificity test because of their availability in our laboratory. The more distantly

related microsporidia are Thelohania sp. (The) from white clawed crayfish and Spraguea lophii (Slo) from the monkfish Lophius piscatorius and Lophius budegassa. Positive control reactions included the plasmids (+ve; pGEM-SSU and pGEM-SWP plasmids for their respective prim-

ers) and total hepatopancreatic DNA from EHP-infected shrimp (I). Negative control reac-

tions included total hepatopancreatic DNA from naïve shrimp (U) and water (-ve). The PCR conditions were performed and analyzed as described above.

7. Comparative sensitivity of the SWP-PCR and SSU-PCR methods

To compare the sensitivity of the SSU-PCR and SWP-PCR methods, plasmids pGEM-SWP

and pGEM-SSU were used as serially diluted templates for their corresponding PCR reactions.

The highest dilution that still gave a visible band on the agarose gel was considered the lowest

detectable quantity of target DNA and the equivalent copy number was calculated using Avo-

gadro’s number against the molar quantity of plasmid DNA.

8. Comparison of SSU-PCR and SWP-PCR with field samples

With permission from the farm owners to collect specimen from their properties for this study,

we used a total of 25 DNA extracts from hepatopancreatic tissue of EHP-infected shrimp that

had previously been obtained from commercial shrimp farms. These specimen had previously

given positive PCR test results with the SSU-PCR method [18] and exhibited histological evi-

dence of EHP infection. The DNA were subjected to a second round of testing using both the

SSU-PCR [18] and SWP-PCR methods to test the consistency of the two methods. For an inter-

nal control PCR reaction, primers for a P. vannamei actin gene [29] (Table 3) were used in a 25- μl reaction which contained 100 ng total shrimp DNA, 0.2 mM dNTP, 1.5 mM MgCl2, 0.2 μM of each primer, 0.5 unit of Taq DNA polymerase (New England Biolabs, USA). The condition for the actin PCR reaction was 5-min initial denaturation at 95˚C followed by 30 cycles of dena-

turation for 30 s at 95˚C, annealing for 30 s at 55˚C and extension for 45 s at 68˚C with a final

5-min extension step at 68˚C. The expected PCR amplicon of actin was 401 bp.

9. Preparation of a SWP in situ hybridization probe

The primers SWP_1F and SWP_1R and the plasmid pGEM-EHP were used to prepare a DIG-

labeled SWP probe for in situ hybridization assays following the protocol described by

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 5 / 15

Tangprasittipap et al. [18] Briefly, a DIG-PCR labeling kit (Roche, Germany) was used and the probe was purified using a PCR-amplicon purification kit (Geneaid, Taiwan), after which

labeling efficiency was determined by dot blot hybridization.

The hybridization protocol also followed Tangprasittipap et al. [18]. Briefly, tissue sections were treated with TNE buffer containing 5 μg/ml proteinase K and incubated at 37˚C for 10 min in a humidified chamber. The sections were then incubated with 0.4% formaldehyde for 5

min, 0.5 M EDTA for 1 hour, and pre-hybridization buffer (4x SSC buffer (3M NaCl, 0.3M

sodium citrate) and 50%(v/v) deionized formamide) for 10 min. Approximately 200 ng of the

DIG-labeled SSU probe or DIG-labeled SWP probe were mixed with hybridization buffer (4x

SSC buffer, 50% deionized formamide, 1x Denhardt’s solution (Sigma, USA), 0.25 mg/ml

salmon sperm DNA (Invitrogen, USA), 5% (w/v) dextran sulfate) and overlaid on rehydrated

tissue sections followed by incubation at 42˚C overnight in a humid chamber. Stringency

washes were carried out using SSC buffer and buffer I (1M Tris-HCl, 1.5M NaCl) at 37˚C

before 0.5% blocking solution (Roche, Germany) was added. For detection, the slides were

treated with 1:500 alkaline phosphatase-conjugated anti-DIG antibody. Buffer I was used twice

to wash away unbound materials. Development of signals was carried out using BCIP/NBT

solution (Roche, Germany). Finally, sections were counterstained in 0.5% Bismarck brown Y

(Sigma, USA) and washed with running tap water for 10 min before dehydration and mount-

ing for light microscopy.

Results

1. False positive SSU-PCR results for EHP

Unpublished reports from producers of shrimp feed indicated that the SSU rRNA primers

developed in Tangprasittipap et al., 2013 [18] produced false positive results when used to

screen raw materials such as fish meal. To investigate whether the EHP SSU rRNA primers

could potentially amplify homologous regions from other closely related microsporidia

(Table 1), the SSU rRNA genes of microsporidian pathogens of aquatic hosts, which may con-

taminate raw materials of shrimp feed, were compiled from the NCBI database. Multiple

sequence alignments were carried out and revealed that the homologous regions were highly

conserved (Fig 1A). The sequences at the annealing sites of the primers ENF779, ENR779,

ENF176 and ENR176 are 86.4%, 66.7%, 90% and 74% identical to that of other microsporidia.

This indicated that false positive results might be possible with some EHP-related microspori-

dia when using the SSU-PCR method.

Primer cross reactivity was tested using SSU-PCR with DNA extracts from aquatic animals

infected with microsporidia that are closely related to EHP, namely Enterospora canceri (Eca) and Hepatospora eriocheir (Her), or microsporidia that are more distantly related to EHP, namely Thelohania sp. (The) and Spraguea lophii (Slo) (Fig 1B). The negative controls gave negative results, as did total DNA templates containing more distantly related Thelohania sp. and S. lophii. However, the closely related E. canceri and H. eriocheir gave false positive results. The sizes of the PCR products from the two crab microsporidia are identical to those obtained

with total DNA extracts obtained from EHP-infected shrimp.

2. Lack of false positive results for EHP using SWP-PCR

Due to the false positive results obtained for EHP using the SSU-PCR method, we developed a

more discriminatory PCR method using the sequence of the newly discovered, putative spore

wall protein (SWP) gene of EHP (GenBank accession number KX258197). An alignment of

the designed primers with homologous regions of other SWP sequences (Fig 2A) demonstrates

that the degree of sequence similarity among the sequences is lower than that amplified from

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 6 / 15

Fig 1. Alignments of the SSU-PCR primer sequences and confirmation of cross reactions with closely related

microsporidia. (A) Alignments of the SSU primer sequences (Table 3) with homologous SSU regions of other microsporidia

(Table 1). Black highlights indicate matches with the primer sequences, while asterisks under the sequences indicate regions of

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 7 / 15

the SSU rRNA primers (Fig 1A), suggesting that the amplicons from the SWP region would be

better at distinguishing EHP from other closely related microsporidia in PCR assays.

Subsequent tests similar to those carried out using SSU-PCR (Fig 1B) were repeated using

the SWP-PCR method with the same DNA templates. Only the positive control plasmid DNA

and the DNA extracted from EHP-infected shrimp gave positive test results (Fig 2B).

3. Comparative sensitivity of the SWP-PCR and SSU-PCR methods

Using serially diluted plasmid DNA as templates, SSU-PCR gave the 779-bp amplicon in the

first PCR step at 10 6

copies of the pGEM-SSU plasmid per reaction mix, while SWP-PCR gave

the amplicon of 514 bp at 10 4

copies (Fig 3A). In the nested PCR step, both methods had iden-

tical sensitivity at 10 copies per reaction vial (Fig 3B), similar to what had previously been

reported for the SSU-PCR method [23].

At high copy numbers of the target sequence in which the first step PCR amplicon was

seen, both detection methods resulted in an additional faint band just above their respective

nested PCR amplicons. These additional bands were amplified by residual primers from the

first PCR step and primers from the second nested step. Specifically, in the SSU-PCR method,

the 226 bp amplicon right above the nested 176 bp amplicon were produced from the forward

nested primer ENF176 and the reverse first step primer ENR779, while in the SWP-PCR

method the 180 bp amplicon just above the nested 148 bp amplicon arose from an interaction

between the forward nested primer SWP_2F and the reverse first step primer SWP_1R.

4. Comparison of SSU-PCR and SWP-PCR with field samples

Using a total of 25 DNA extracts from hepatopancreas of EHP-infected, farmed shrimp that

previously tested positive for EHP using the SSU-PCR method, a second round of tests carried

out using both the SSU-PCR and SWP-PCR methods gave positive test results for EHP for all

25 samples with both methods (Fig 4). However, consistent with the greater sensitivity of the

first PCR step of the SWP-PCR method (Fig 3), detection of EHP after the first step of PCR

was found in 88% of the samples, while only 12% of the samples gave positive results in the

first step with the SSU-PCR method.

5. SSU and SWP in situ hybridization results are similar

In situ hybridization (ISH) is an important tool to determine the location of pathogen nucleic acid in tissue sections of PCR positive animals in order to know whether they are active

(infected) or passive (uninfected) carriers. Blocks of shrimp hepatopancreatic tissue (previ-

ously confirmed for EHP infection by SSU-PCR, histology and ISH using the SSU rRNA

probe) were used to cut adjacent tissue sections for comparison of in situ hybridization reac- tions using DIG-labeled probes for the SSU rRNA and SWP genes. One tissue section was

stained with hematoxylin and eosin (H&E) (Fig 5A) and another served as the negative no-

probe control (Fig 5B). The latter showed no positive ISH reaction (black precipitate). How-

ever, both the SSU rRNA probe and the SWP probe gave positive ISH reactions for EHP in the

same areas of the infected hepatopancreas and at similar intensity (Fig 5C and 5D, respec-

tively). The results showed that either probe could be used for ISH to confirm the location of

100% identity for all of the aligned sequences. (B) Agarose gel of SSU-PCR amplicons from EHP and other microsporidia. In

addition to the pGEM-SSU plasmid (+ve) and water (-ve), total DNA obtained from EHP-infected shrimp (I) and naïve shrimp (U) were used as controls. PCR amplicons and false positive test results are marked with arrowheads and asterisks, respectively.

The band at 226 bp show amplicons of residual primers ENR779 from the first PCR step and primers ENF176 from the second

nested PCR step.

doi:10.1371/journal.pone.0166320.g001

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 8 / 15

EHP infected cells in PCR-positive specimens of cultivated P. monodon and P. vannamei and other EHP-infected carriers. However, neither of the probes could be used solely to diagnose

EHP infections since specificity of the in situ hybridization reaction can be relatively low. For example, hepatopancreatic parvovirus (HPV) in P. chinensis from Korea and P. monodon from Thailand share approximately 80% nucleic acid identity but an ISH probe based on the HPV

Fig 2. Alignments of the SWP-PCR primer sequences and lack of cross reactions with closely related microsporidia. (A)

Alignments of the SWP primer sequences (Table 3) with homologous regions of spore wall protein genes of other microsporidia available

in databases (Table 2). Black highlights indicate matches with the primer sequences, and asterisks indicate regions of 100% identity for

all of the aligned sequences. (B) Agarose gel of SWP-PCR amplicons from EHP and other microsporidia. In addition to the pGEM-SWP

plasmid (+ve) and water (-ve), total DNA obtained from EHP-infected shrimp (I) and naïve shrimp (U) were used as controls. PCR amplicons are marked with arrowheads. The 180 bp band is PCR products from residual primers SWP1_R from the first PCR step and

primers SWP_2F from the second nested PCR step.

doi:10.1371/journal.pone.0166320.g002

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 9 / 15

sequence from P. chinensis could sometimes give positive ISH reactions using shrimp infected with HPV from Thailand [30].

Discussion

In this study, we developed a new, specific, nested PCR method for detection of EHP based on

one of the spore wall protein (SWP) genes. Spore walls of microsporidia provide environmen-

tal protection and are also involved in host-pathogen interactions [3,31] via species-specific

SWP. The SWP-PCR method was superior to the SSU-PCR method in terms of both specific-

ity and sensitivity. Compared to the existing SSU-PCR methods, the new SWP-PCR method

did not cross react with DNA from the closely related microsporidia and is more sensitive in

the first PCR step.

Fig 3. Higher sensitivity of first step SWP-PCR compared to first step SSU-PCR. (A) and (C) show

agarose gels of amplicons from the first step PCR reactions, while (B) and (D) show agarose gels of

amplicons from the nested step PCR reactions carried out using serial dilutions of the plasmid templates

pGEM-SWP and pGEM-SSU, respectively.

doi:10.1371/journal.pone.0166320.g003

Fig 4. Comparison of the SWP-PCR and SSU-PCR methods with field samples. (A) and (C) are amplicons from the first PCR reactions, while (B) and

(D) are amplicons from the nested PCR step. PCR reactions for the housekeeping gene actin were used as the internal control.

doi:10.1371/journal.pone.0166320.g004

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 10 / 15

The low specificity of diagnostic methods based on the SSU rRNA sequence is not limited

to EHP. For single-step PCR detection of the malaria parasite Plasmodium knolesi, SSU rRNA primers could cross react with P. vivax and other Plasmodium species [32]. Similarly, single- step PCR detection methods for the protozoan parasite Leishmania siamensis based on the SSU rRNA gene and a heat shock protein 70 (Hsp70) gene gave false positive results when

used with the protozoan parasites Trypanosoma brucei and T. evansi [33]. Prior to the development of the SWP-PCR method, the SSU-PCR method was used widely

to screen for EHP in shrimp, shrimp pond sediments and living, freshly killed or frozen mate-

rials used to feed shrimp [34]. Since the SSU-PCR and SWP-PCR methods both gave the same

results for all tested specimens of shrimp hepatopancreatic tissue, it suggests that only one

microsporidian species is the cause of current HPM outbreaks in cultivated P. monodon and P. vannamei in Thailand and elsewhere in Asia. Thus, the SSU-PCR method used here [18] and a more recent one that is also based on the EHP SSU rRNA sequence [22] are still appropriate

for use with cultivated shrimp specimens. However, for environmental samples, such as sedi-

ments and suspected carriers previously reported to be SSU-PCR positive for EHP infection, it

is necessary to re-confirm their status by use of the SWP-PCR method or by sequencing.

The multiple sequence alignments and the PCR test results from the available specimens

revealed that false positive test results may occur with the SSU rRNA based methods and that

samples of shrimp or shrimp feed might give false positive test results, potentially leading to

Fig 5. DIG-labeled SWP and SSU probes give comparable in situ hybridization results in EHP-infected shrimp.

Adjacent hepatopancreatic tissue sections from an EHP-infected shrimp specimen were stained with H&E and tested

with the two probes. (A) Section stained with H&E (B) Negative control for in situ hybridization (no probe applied) (C) In

situ hybridization with DIG-labeled SSU rRNA probe (D) In situ hybridization with DIG-labeled SWP probe. Black

precipitates indicate positive hybridization reactions with EHP.

doi:10.1371/journal.pone.0166320.g005

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 11 / 15

their unnecessary discard or destruction. In addition, non-destructive screening of broodstock

shrimp for EHP in a hatchery is usually carried out using feces and this raises the possibility

that PCR positive results might arise from presence of residual microsporidian DNA that orig-

inated from the feed source and not from the shrimp themselves. For such reasons, we recom-

mend that non-destructive screening of broodstock feces be carried out using the SWP-PCR

method and that any suspected positive broodstock results be confirmed by absence of positive

results in their feed.

With respect to sensitivity in testing EHP, the quantitative real-time PCR method [21] may

be the most sensitive. However, for those without equipment to carry out the process, an iso-

thermal loop mediated (LAMP) method with a sensitivity of 2 EHP copies/reaction vial of

total DNA from EHP-infected shrimp has been reported [23]. In this study, we found that the

SSU-PCR and SWP-PCR methods could detect DNA plasmids containing respective target

sequences at 10 copies per reaction vial, although the SWP-PCR method had better sensitivity

than the SSU-PCR method for the first PCR step.

The greater sensitivity of the SWP primers in the first PCR step might be due to the lower

efficiency of the primers and condition for the first step of SSU-PCR. There is a 7˚C difference

in the melting temperatures of the primers ENF779 and ENR779. The GC content of the SWP

primers is also lowered compared to that of the SSU rRNA primers (S1 and S2 Tables). Primers

with higher GC contents tend to form more thermodynamically stable secondary structures

that can hinder template annealing and therefore, compromise primer efficiency [35–37].

Based on secondary structure analysis of the primers (S1 and S2 Tables), the SSU rRNA prim-

ers form secondary structures with more negative, i.e. more thermodynamically favorable,

Gibb’s free energy values (ΔG), while the secondary structures formed by the SWP primers have less favorable ΔG values. The enhanced sensitivity is useful for the identification of the potential carriers of EHP in environmental samples. Moreover, the 58˚C annealing tempera-

ture in the first SSU-PCR step is higher than the 57˚C melting temperature of the primer

ENR779. Hence, we recommend the new primer sets reported in this study be used as screen-

ing primers to study the life cycle of EHP.

In conclusion, we developed a new nested PCR detection method for EHP infection that

has superior specificity and sensitivity compared to previous methods. This new method can

be used for diagnosis of EHP in shrimp and environmental samples. It will be a useful tool for

studying EHP transmission routes with the objective of devising more effective HPM manage-

ment and control measures.

Supporting Information

S1 Table. GC content and stability of secondary structures of the SWP primers.

(DOCX)

S2 Table. GC content and stability of secondary structures of the SSU rRNA primers.

(DOCX)

Acknowledgments

The author would like to thank the owners of shrimp farms who provided the shrimp speci-

men. OI acknowledges support from Agricultural Research Development Agency under proj-

ect CRP5905020530 and Mahidol University. KS received funding from National Research

Council Thailand, Division of Plan Administration and Research Budget/2557-79. PJ is sup-

ported by the Science Achievement Scholarship of Thailand (SAST). GDS acknowledges sup-

port of DG SANCO of the European Commission and, the UK Department of Environment,

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 12 / 15

Food and Rural Affairs under project FB002. The funders had no role in study design, data col-

lection and analysis, decision to publish, or preparation of the manuscript.

Author Contributions

Conceptualization: OI KS TF.

Funding acquisition: OI KS GDS.

Investigation: PJ PS BAPW.

Methodology: OI TF.

Project administration: OI KS.

Resources: BAPW GDS.

Supervision: OI KS TF.

Visualization: PJ TF OI.

Writing – original draft: PJ OI.

Writing – review & editing: OI PJ TF BAPW KS.

References 1. Texier C, Vidau C, Vigues B, El Alaoui H, Delbac F. Microsporidia: A model for minimal parasite-host

interactions. Curr Opin Microbiol. 2010; 13: 443–449. doi: 10.1016/j.mib.2010.05.005 PMID: 20542726

2. Hayman JR, Southern TR, Nash TE. Role of sulfated glycans in adherence of the microsporidian Ence-

phalitozoon intestinalis to host cells in vitro. Infect Immun. 2005; 73: 841–848. doi: 10.1128/IAI.73.2.

841–848.2005 PMID: 15664924

3. Southern TR, Jolly CE, Lester ME, Hayman JR. EnP1, a microsporidian spore wall protein that enables

spores to adhere to and infect host cells in vitro. Eukaryot Cell. 2007; 6: 1354–1362. doi: 10.1128/EC.

00113-07 PMID: 17557882

4. Wang Y, Dang X, Ma Q, Liu F, Pan G, Li T, et al. Characterization of a novel spore wall protein

NbSWP16 with proline-rich tandem repeats from Nosema bombycis (microsporidia). Parasitology.

2014; 1–9. doi: 10.1017/S0031182014001565 PMID: 25363531

5. Didier ES, Stovall ME, Green LC, Brindley PJ, Sestak K, Didier PJ. Epidemiology of microsporidiosis:

Sources and modes of transmission. Vet Parasitol. 2004; 126: 145–166. doi: 10.1016/j.vetpar.2004.09.

006 PMID: 15567583

6. Fries I. Nosema ceranae in European honey bees (Apis mellifera). J Invertebr Pathol. Elsevier Inc.;

2010; 103: S73–S79. doi: 10.1016/j.jip.2009.06.017 PMID: 19909977

7. Szumowski SC, Troemel ER. Microsporidia-host interactions. Curr Opin Microbiol. Elsevier Ltd; 2015;

26: 10–16. doi: 10.1016/j.mib.2015.03.006 PMID: 25847674

8. Palenzuela O, Redondo MJ, Cali A, Takvorian PM, Alonso-Naveiro M, Alvarez-Pellitero P, et al. A new

intranuclear microsporidium, Enterospora nucleophila n. sp., causing an emaciative syndrome in a

piscine host (Sparus aurata), prompts the redescription of the family Enterocytozoonidae. Int J Parasi-

tol. Australian Society for Parasitology Inc.; 2014; 44: 189–203. doi: 10.1016/j.ijpara.2013.10.005

PMID: 24326177

9. Freeman MA, Bell AS, Sommerville C. A hyperparasitic microsporidian infecting the salmon louse,

Lepeophtheirus salmonis: An rDNA-based molecular phylogenetic study. J Fish Dis. 2003; 26: 667–

676. doi: 10.1046/j.1365-2761.2003.00498.x PMID: 14710759

10. Stentiford GD, Bateman KS, Small HJ, Moss J, Shields JD, Reece KS, et al. Myospora metanephrops

(n. g., n. sp.) from marine lobsters and a proposal for erection of a new order and family (Crustaceacida;

Myosporidae) in the Class Marinosporidia (Phylum Microsporidia). Int J Parasitol. 2010; 40: 1433–

1446. doi: 10.1016/j.ijpara.2010.04.017 PMID: 20558169

11. Kiryu Y, Behringer DC, Landsberg JH, Petty BD. Microsporidiosis in the Caribbean spiny lobster Panu-

lirus argus from southeast Florida, USA. Dis Aquat Organ. 2009; 84: 237–242. doi: 10.3354/dao02046

PMID: 19565701

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 13 / 15

12. Tourtip S, Wongtripop S, Stentiford GD, Bateman KS, Sriurairatana S, Chavadej J, et al. Enterocyto-

zoon hepatopenaei sp. nov. (Microsporida: Enterocytozoonidae), a parasite of the black tiger shrimp

Penaeus monodon (Decapoda: Penaeidae): Fine structure and phylogenetic relationships. J Invertebr

Pathol. Elsevier Inc.; 2009; 102: 21–29. doi: 10.1016/j.jip.2009.06.004 PMID: 19527727

13. Stentiford GD, Feist SW, Stone DM, Bateman KS, Dunn AM. Microsporidia: Diverse, dynamic, and

emergent pathogens in aquatic systems. Trends Parasitol. Elsevier Ltd; 2013; 29: 567–578. doi: 10.

1016/j.pt.2013.08.005 PMID: 24091244

14. Stentiford GD, Becnel JJ, Weiss LM, Keeling PJ, Didier ES, Williams BAP, et al. Microsporidia—Emer-

gent Pathogens in the Global Food Chain. Trends Parasitol. Elsevier Ltd; 2016; xx: 1–13. doi: 10.1016/j.

pt.2015.12.004 PMID: 26796229

15. GLOBEFISH Highlights. FAO/GLOBEFISH Highlights. 4. 2014: 62. Available: http://www.fao.org/in-

action/globefish/publications/details-publication/en/c/350750/

16. Flegel TW, Boonyaratpalin S, Fegan DF, Guerin M, Sriurairatana S. High mortality of black tiger prawns

from cotton shrimp disease in Thailand. Dis Asian Aquac I. 1992; 181–197.

17. Pasharawipas T, Flegel TW. A specific DNA probe to identify the intermediate host of a common micro-

sporidian parasite of Penaeus merguiensis and P. monodon. Asian Fish Sci. 1994; 7: 157–167.

18. Tangprasittipap A, Srisala J, Chouwdee S, Somboon M, Chuchird N, Limsuwan C, et al. The microspor-

idian Enterocytozoon hepatopenaei is not the cause of white feces syndrome in whiteleg shrimp

Penaeus (Litopenaeus) vannamei. BMC Vet Res. BMC Veterinary Research; 2013; 9: 139. doi: 10.

1186/1746-6148-9-139 PMID: 23856195

19. Tang KFJ, Han JE, Aranguren LF, White-Noble B, Schmidt MM, Piamsomboon P, et al. Dense popula-

tions of the microsporidian Enterocytozoon hepatopenaei (EHP) in feces of Penaeus vannamei exhibit-

ing white feces syndrome and pathways of their transmission to healthy shrimp. J Invertebr Pathol.

2016; doi: 10.1016/j.jip.2016.08.004 PMID: 27530403

20. Chayaburakul K, Nash G, Pratanpipat P, Sriurairatana S, Withyachumnarnkul B. Multiple pathogens

found in growth-retarded black tiger shrimp Penaeus monodon cultivated in Thailand. Dis Aquat Org.

2004; 60: 89–96. doi: 10.3354/dao060089 PMID: 15460852

21. Liu Z, Zhang QL, Wan XY, Huang J. Development of real-time PCR assay for detection of microspori-

dian Enterocytozoon hepatopenaei and detection in shrimp samples under different growth rates. Fish

Sci(in Press Chinese, English Abstr. 2015;

22. Tang KFJ, Pantoja CR, Redman RM, Han JE, Tran LH, Lightner D V. Development of in situ hybridiza-

tion and PCR assays for the detection of Enterocytozoon hepatopenaei (EHP), a microsporidian para-

site infecting penaeid shrimp. J Invertebr Pathol. Elsevier Inc.; 2015; 130: 37–41. doi: 10.1016/j.jip.

2015.06.009 PMID: 26146228

23. Suebsing R, Prombun P, Srisala J, Kiatpathomchai W. Loop-mediated isothermal amplification com-

bined with colorimetric nanogold for detection of the microsporidian Enterocytozoon hepatopenaei in

penaeid shrimp. J Appl Microbiol. 2013; 114: 1254–1263. doi: 10.1111/jam.12160 PMID: 23387348

24. Sievers F, Wilm A, Dineen D, Gibson TJ, Karplus K, Li W, et al. Fast, scalable generation of high-quality

protein multiple sequence alignments using Clustal Omega. Mol Syst Biol. 2011; 7: 539. doi: 10.1038/

msb.2011.75 PMID: 21988835

25. Bell T. A. DVL. A handbook of normal penaeid shrimp histology. World Aquaculture Society,Baton

Rouge, LA. Lawrence, Kansas, USA: Allen Press; 1988. p. 114.

26. Sambrook J, Russell DW. Molecular cloning: a laboratory manual. Cold Spring Harbour. 2001.

27. Koressaar T, Remm M. Enhancements and modifications of primer design program Primer3. Bioinfor-

matics. 2007; 23: 1289–1291. doi: 10.1093/bioinformatics/btm091 PMID: 17379693

28. Zuker M. Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Res.

2003; 31: 3406–3415. doi: 10.1093/nar/gkg595 PMID: 12824337

29. Somchai P, Jitrakorn S, Thitamadee S, Meetam M, Saksmerprome V. Use of microalgae Chlamydomo-

nas reinhardtii for production of double-stranded RNA against shrimp virus. Aquac Reports. 2016; 3:

178–183. doi: 10.1016/j.aqrep.2016.03.003

30. Phromjai J, Sukhumsirichart W, Pantoja C, Lightner D V., TW Flegel. Different reactions obtained using

the same DNA detection reagents for Thai and Korean hepatopancreatic parvovirus of penaeid shrimp.

Dis Aquat Organ. 2001; 46: 153–158. doi: 10.3354/dao046153 PMID: 11678231

31. Li Y, Wu Z, Pan G, He W, Zhang R, Hu J, et al. Identification of a novel spore wall protein (SWP26) from

microsporidia Nosema bombycis. Int J Parasitol. 2009; 39: 391–398. doi: 10.1016/j.ijpara.2008.08.011

PMID: 18854188

32. Lucchi NW, Poorak M, Oberstaller J, DeBarry J, Srinivasamoorthy G, Goldman I, et al. A new single-

step PCR assay for the detection of the zoonotic malaria parasite Plasmodium knowlesi. PLoS One.

2012; 7: 1–7. doi: 10.1371/journal.pone.0031848 PMID: 22363751

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 14 / 15

33. Hitakarun A, Tan-ariya P, Siripattanapipong S, Mungthin M, Piyaraj P, Naaglor T, et al. Comparison of

PCR methods for detection of Leishmania siamensis infection. Parasit Vectors. 2014; 7: 458. doi: 10.

1186/s13071-014-0458-x PMID: 25274259

34. Thitamadee S, Prachumwat A, Srisala J, Jaroenlak P, Salachan PV, Sritunyalucksana K, et al. Review

of current disease threats for cultivated penaeid shrimp in Asia. Aquaculture. 2016; 452: 69–87. doi: 10.

1016/j.aquaculture.2015.10.028

35. Skinneratb M, Varadaraj K, Skinner DM. Denaturants or cosolvents improve the specificity of PCR

amplification of a G + C-rich DNA using genetically engineered DNA polymerases. Gene. 1994; 140: 1–

5. doi: 10.1016/0378-1119(94)90723-4 PMID: 8125324

36. Kumar A, Kaur J. Primer based approach for PCR amplification of high GC content gene: Mycobacte-

rium gene as a model. Mol Biol Int. 2014; 2014: 937308. doi: 10.1155/2014/937308 PMID: 24782926

37. Bachmann B, Luke W, Hunsmann G. Improvement of PCR amplified DNA sequencing with the aid of

detergents. Nucleic Acids Res. ENGLAND; 1990; 18: 1309. PMID: 2320432

A Nested PCR Assay to Avoid False Positive Detection of EHP in Environmental Samples

PLOS ONE | DOI:10.1371/journal.pone.0166320 November 10, 2016 15 / 15