Presentation slides and speech written

mashan669
Airbornebacteria.pdf

RESEARCH ARTICLE

Polyamine transporter potABCD is required

for virulence of encapsulated but not

nonencapsulated Streptococcus pneumoniae

Haley R. Pipkins, Jessica L. Bradshaw, Lance E. Keller ¤ , Edwin Swiatlo, Larry

S. McDaniel*

Department of Microbiology and Immunology, University of Mississippi Medical Center, Jackson, Mississippi,

United States of America

¤ Current address: Department of Molecular Genetics, University of Groningen, Nijenborgh, Groningen, The Netherlands

* Lmcdaniel@umc.edu

Abstract

Streptococcus pneumoniae is commonly found in the human nasopharynx and is the causa-

tive agent of multiple diseases. Since invasive pneumococcal infections are associated with

encapsulated pneumococci, the capsular polysaccharide is the target of licensed pneumo-

coccal vaccines. However, there is an increasing distribution of non-vaccine serotypes,

as well as nonencapsulated S. pneumoniae (NESp). Both encapsulated and nonencapsu-

lated pneumococci possess the polyamine oligo-transport operon (potABCD). Previous

research has shown inactivation of the pot operon in encapsulated pneumococci alters pro-

tein expression and leads to a significant reduction in pneumococcal murine colonization,

but the role of the pot operon in NESp is unknown. Here, we demonstrate deletion of potD

from the NESp NCC1 strain MNZ67 does impact expression of the key proteins pneumoly-

sin and PspK, but it does not inhibit murine colonization. Additionally, we show the absence

of potD significantly increases biofilm production, both in vitro and in vivo. In a chinchilla

model of otitis media (OM), the absence of potD does not significantly affect MNZ67 viru-

lence, but it does significantly reduce the pathogenesis of the virulent encapsulated strain

TIGR4 (serotype 4). Deletion of potD also significantly reduced persistence of TIGR4 in the

lungs but increased persistence of PIP01 in the lungs. We conclude the pot operon is impor-

tant for the regulation of protein expression and biofilm formation in both encapsulated and

NCC1 nonencapsulated Streptococcus pneumoniae. However, in contrast to encapsulated

pneumococcal strains, polyamine acquisition via the pot operon is not required for MNZ67

murine colonization, persistence in the lungs, or full virulence in a model of OM. Therefore,

NESp virulence regulation needs to be further established to identify potential NESp thera-

peutic targets.

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 1 / 19

a1111111111

a1111111111

a1111111111

a1111111111

a1111111111

OPEN ACCESS

Citation: Pipkins HR, Bradshaw JL, Keller LE,

Swiatlo E, McDaniel LS (2017) Polyamine

transporter potABCD is required for virulence of

encapsulated but not nonencapsulated

Streptococcus pneumoniae. PLoS ONE 12(6):

e0179159. https://doi.org/10.1371/journal.

pone.0179159

Editor: Eliane N. Miyaji, Instituto Butantan, BRAZIL

Received: January 9, 2017

Accepted: May 24, 2017

Published: June 6, 2017

Copyright: © 2017 Pipkins et al. This is an open access article distributed under the terms of the

Creative Commons Attribution License, which

permits unrestricted use, distribution, and

reproduction in any medium, provided the original

author and source are credited.

Data Availability Statement: All relevant data are

within the paper and supporting information files.

Funding: This study was funded by institutional

research funds. There was no additional external

funding received for this study.

Competing interests: The authors have declared

that no competing interests exist.

Introduction

Streptococcus pneumoniae (the pneumococcus) is a gram positive coccus that colonizes the nasopharynx of humans [1]. Although colonization is typically asymptomatic, the organism

can gain access to normally sterile sites and cause illnesses such as pneumonia, otitis media

(OM), sinusitis, bacteremia, and meningitis [2]. In young children, the elderly, and immuno-

compromised patients, these pneumococcal infections can lead to serious complications or

even death [3]. Pneumococcal strains can be typed using either multilocus sequence typing

(MLST) or by serotyping of the polysaccharide capsule [4]. Strains that lack serological evi-

dence of capsule expression are divided into two nonencapsulated S. pneumoniae (NESp) groups [5]. Group I includes NESp that have a mutated, dysfunctional variant of the character-

istic capsule polysaccharide biosynthetic (cps) locus, while group II includes NESp whose cps genes are replaced by novel genes that code for distinct pneumococcal proteins [6,7].

Currently, there are two licensed pneumococcal vaccines used in the United States: Pre-

vnar13 and Pneumovax [8]. Because most invasive pneumococcal infections are associated

with encapsulated pneumococci, these vaccines target the capsular polysaccharide of 13 or 23

invasive disease-associated capsular serotypes, respectively [9]. However, non-invasive pneu-

mococcal disease rates remain high even with vaccine implementation. For example, middle

ear infections are the most frequent condition for which antibiotic treatment is prescribed to

children under the age of five in the U.S., and S. pneumoniae is the leading cause of acute bacte- rial OM [10–12]. This inefficiency is likely due to selective pressure against the pneumococcal

capsule resulting in capsular alterations in vaccine serotypes and increased colonization by

non-vaccine serotypes and NESp [13–15]. A recent study in Japan analyzed pneumococcal

isolates taken from the nasopharynges of children with OM, and of those isolates 6.4% were

NESp [16]. The distribution of NESp will likely continue to escalate as selective pressure is

placed on encapsulated strains. Since current vaccines do not protect against NESp strains, it is

important to identify new targets that will protect against both encapsulated and nonencapsu-

lated pneumococci.

All sequenced pneumococcal isolates, whether encapsulated or NESp, possess the poly-

amine oligo-transport operon (potABCD) [17]. A proposed description of each operon compo- nent is as follows: PotA is an ATP binding protein that couples polyamine translocation with

ATP hydrolysis, PotBC compose an α-helical transmembrane polypeptides with hydrophobic domains, and PotD is a membrane protein responsible for binding extracellular polyamines

[18]. Polyamines are cationic organic compounds that are found ubiquitously in nature and

are essential for normal cell growth of both eukaryotic and prokaryotic cells [19,20]. The role

of polyamine acquisition and biosynthesis in bacterial growth and virulence has recently been

investigated, and it has been determined that these pathways are integral to bacterial fitness

and pathogenesis [21–23]. Additionally, all four genes of the operon are essential for operon

function, as mutation or deletion of any one of the genes nullifies activity [24].

Analyses have shown the deletion of potD in encapsulated pneumococcal isolates signifi- cantly reduces their ability to colonize and cause disease [25]. The pot operon and the trans-

port of polyamines also appears to be necessary for regulation of certain encapsulated

pneumococcal virulence factors, such as pneumolysin and capsule [17,18]. Furthermore,

immunization with recombinant PotD both reduces pneumococcal nasopharyngeal coloniza-

tion and prevents systemic pneumococcal infection in a mouse model [26–28]. However, the

effects of a potD mutant in NESp have not yet been established. If potD deletion reduces NESp virulence as efficiently as it does in encapsulated pneumococci, then PotD could potentially be

a therapeutic target against both types of pneumococci. Since the pot operon has thus far been identified in all sequenced pneumococci, increased prevalence of non-vaccine strains could be

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 2 / 19

controlled by targeting PotD. The rationale for this study was therefore to determine the role

of the pot operon in the virulence and pathogenesis of NESp subgroup NCC1.

Materials and methods

Bacterial strains and growth conditions

Descriptions of bacterial strains used for this work are listed in Table 1. All pneumococcal

strains were grown at 37˚C in 5% CO2 in Todd-Hewitt medium with 0.5% yeast extract (THY)

or on blood agar base supplemented with 5% sheep blood (BA). Mutant strains were grown in

the presence of the appropriate antibiotic selection as indicated in Table 1. For all experiments,

strains were grown to an OD600 of 0.3. Bacterial lysates were prepared by suspending 1.5 ml

pelleted bacteria in 150 μl lysis buffer (0.01% sodium dodecyl sulfate, 0.1% sodium deoxycho- late, and 0.015 M sodium citrate), incubating the suspension at 37˚C for 30 minutes, and

then diluting the mixture with 150 μl phosphate-buffered saline (PBS). Plasmid DNA was extracted from Escherichia coli using a plasmid miniprep kit following manufacturer’s proto- cols (Qiagen).

PCR amplification

Polymerase chain reaction (PCR) amplification was used to isolate a kanamycin resistance cas-

sette from pneumococcal strain DAR831ΔAR4 (donated by Dr. Ashley Robinson at The Uni- veristy of Mississippi Medical Center) (primers 5 and 6). PCR was also used to amplify a 750

bp segment upstream of potD (primers 1 and 2) and a 700 bp segment downstream from potD (primers 3 and 4) from the NESp isolate MNZ67. These three fragments were combined using

sequence overlap extension (SOE), and the full-length fragment was amplified using PCR

(primers 1 and 4) [29]. PCR was additionally used to amplify potD from MNZ67 (primers 7 and 8), which was cloned into the spectinomycin resistant plasmid pNE1 to generate pNE1::

potD. Products less than 1 kb were amplified using GoTaq DNA Polymerase (Promega) and products greater than 1 kb were amplified using Phusion High Fidelity DNA Polymerase

(Thermo-Scientific). Cycling parameters recommended by the manufacturers and an anneal-

ing temp of 55˚ were used for the amplification process, and size of amplified products was

verified by electrophoresis on an 0.8% agarose gel with EtBr staining. All primers used for

these studies are listed in Table 2.

Construction of mutant strain

An isogenic potD deletion mutant (PIP01) of MNZ67 was constructed by allelic replacement of the potD gene with a kanamycin resistance cassette flanked by the upstream and down- stream regions of potD (see PCR amplification for details). MNZ67 grown in competence media (THY containing .02% CaCl, .04% glucose, and .2% BSA) was activated with 200 ng of

Table 1. Description of strains used for the studies described in this manuscript.

Strain Strain Description

MNZ67 PspK +

Group II NESp (Subgroup NCC1); source of potD

PIP01 MNZ67 isogenic ΔpotD mutant (KanR) PIP02 PIP01 transformed with pNE1:: potD (Spec

R )

TIGR4 (T4) Virulent encapsulated pneumococcal isolate (serotype 4)

T4 ΔpotD TIGR4 isogenic ΔpotD mutant (ErmR) DAR831ΔAR4 Encapsulated pneumococcus; source of KanR cassette (Serotype 12F)

https://doi.org/10.1371/journal.pone.0179159.t001

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 3 / 19

each of competence stimulating peptide 1 and 2 (CSP 1 and CSP 2) for 12 min followed by

transformation with 500 ng of the kanamycin SOE construct for 3 hours. Selection for ΔpotD mutants was done by plating on BAP containing 500 μg/ml kanamycin. Complementation of potD in PIP01 was achieved by transforming PIP01 with pNE1::potD under previously described conditions, generating PIP02. Successful transformants were selected by plating on

BA containing 300 μg/ml spectinomycin.

Real time PCR

Bacterial cultures were grown to an OD600 of 0.3. Cells were pelleted by centrifugation and

enzymatically lysed with 200 μl TE buffer (10 mM Tris, 1 mM EDTA) containing 3 mg/ml lysozyme. Bacterial RNA was purified using a Qiagen RNeasy Mini kit, and collected RNA was

treated with RQ1 DNase (Promega) following manufacturer’s protocol. RNA concentrations

were determined using a Qubit 2.0 fluorometer. RT-qPCR was performed using 200 ng total

RNA, a Luna Universal One-Step RT-qPCR Kit (New England Biolabs), and gene specific

primers. Primers 9 and 10 were used for pspK and primers 11 and 12 were used for gyrA, which served as an internal control. A no template sample was used as a negative control. Sam-

ples were analyzed using an iCycler iQ Real-Time PCR Detection System (Biorad), and the

ΔΔCT method was used to calculate the fold-change in gene expression.

Protein standardization

A standard bicinchoninic acid (BCA) assay protocol [30] was used to quantify total protein

concentration of bacterial lysates. Protein concentrations were determined by reading samples

on an xMark microplate spectrophotometer (BioRad) at OD570. Lysates were standardized to

equivalent protein amounts by diluting with sterile PBS.

Hemolysis assay

Standardized bacterial lysates were serially diluted in 96-well round bottom plates containing

100 μl DTT buffer (10 ml PBS, 0.01g BSA, 0.015g DTT) in each well. Hemolysis was deter- mined by adding 50 μl of PBS containing 1% sheep red blood cells (RBCs) to each well, fol- lowed by incubation at 37˚C in 5% CO2 for 30 minutes. Triton X-114 served as the positive

control, and PBS was used as the negative control. The plate was centrifuged at 500 x g for 5

minutes. 100 μl of supernatant was removed from each well and transferred to a 96-well flat

Table 2. Names and sequences of primers used in these studies.

Reference Number Primer Name Primer Sequence (5’ to 3’)

1 potD upstream F TGG GAC TGG TCT TTC TGG TCC TCT

2 potD upstream R CAT TAT CCA TTA AAA ATC AAC GGG CTT GCT CCT CCT TCT CAC GA

3 potD downstream F TAC CTA TAA TTC ACC AAA AAT AAA AGA G ATA AAC GTA AGA AGA CGA ATC AG

4 potD downstream R AACTTGTCATTCTCTTGTTCTTATGCAATTGTA

5 Kan F CCG TTG ATT TTT AAT GGA TAA TG

6 Kan R TTT TAT TTT TGG TGA ATT ATA GGT A

7 potD F GCG GCA TGC GAG AGG AGA GAA A ATG AAA AAA ATC TAT TCA TTT TTA GCA GG

8 potD R GCG CTG CAG CTA CTT CCG ATA CAT TTT AAA CTG

9 PspK F RT CTGTGAAAGCAGAGATGGCA

10 PspK R RT CCTCAGCAACCTTGCTCTTT

11 GyrA F RT GCGAGCTCTTCCTGATGTTC

12 GyrA R RT GGGTCACACCCAATTCATTC

https://doi.org/10.1371/journal.pone.0179159.t002

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 4 / 19

bottom plate. The plate was read at OD450 on an xMark microplate spectrophotometer

(BioRad), and percent lysis was normalized to lysis by detergent set at 100%. Samples were

plated in triplicate and three independent experiments were performed.

Production of pneumolysin (Ply) and pneumococcal surface protein K

(PspK)

ELISA. Protein levels of both Ply and PspK were determined using a standard indirect

ELISA protocol. Blocking buffer used consisted of PBST and 1% BSA. Polyclonal rabbit anti-

Ply or rabbit anti-PspK serum was used as the primary antibody. Secondary antibody for all

assays was a polyclonal, biotinylated donkey anti-rabbit IgG combined with streptavidin-con-

jugated alkaline phosphatase. Protein was visualized by addition of P-nitrophenyl phosphate

and plates were read at OD405 on an xMark microplate spectrophotometer (BioRad). Protein

levels were normalized to wild type (WT) MNZ67 set at 100% expression. All samples were

analyzed in triplicate and three independent experiments were performed.

Flow cytometry. PspK was further examined using flow cytometry. Approximately 10 7

mid-log phase bacteria were pelleted by centrifugation, suspended in PBS containing rabbit

anti-PspK serum, and incubated for 30 minutes at 37˚C [31]. Pneumococcal cells were fluores-

cently labeled by incubation for 30 minutes at room temperature with biotinylated polyclonal

donkey anti-rabbit IgG combined with streptavidin-conjugated Alexa Flour 488. Bacteria were

washed three times in sterile PBS after each incubation step and surface expressed PspK was

analyzed using a Becton Dickinson flow cytometer with gate set to 25,000 bacteria.

Biofilm formation

Biofilm production was determined by seeding a 24-well plate with 10 5

CFU of bacteria in 1

ml of THY containing 8 units/ml catalase and 10% horse serum. The plate was incubated for

24 hours at 37˚C in 5% CO2. The media was removed and each well was stained with 350 μl 0.1% crystal violet for 30 minutes at room temperature. The excess crystal violet was carefully

removed and the remaining crystal violet was solubilized in 1 ml 100% ethanol for 10 minutes

with shaking. The plate was read at OD630 on an xMark microplate spectrophotometer

(BioRad). All samples were assayed in triplicate and experiments were performed three inde-

pendent times.

Epithelial cell adhesion and invasion

Human A549 (ATCC 1

CCL-185™ retrieved from Dr. Stephen Stray at University of Missis- sippi Medical Center) and Detroit 562 (ATCC

1 CCL-138™ retrieved from Dr. Justin Thornton

at Mississippi State University) epithelial cells were grown to 95% confluency in Eagle’s mini-

mal essential medium (EMEM) supplemented with 10% fetal calf serum (FCS) and containing

100 μg/ml penicillin, 100 μg/ml amphotericin B, and 50 μg/ml streptomycin. Epithelial cells were cultured in 24 well plates at 37˚C in 5% CO2. For adhesion and invasion assays, epithelial

cells were rinsed 3 times in sterile PBS and incubated with 1x10 7

bacteria suspended in 1 ml of

EMEM without antibiotics. The plates were incubated for 30 minutes for adherence or 2 hours

for invasion and then washed 3 times with sterile PBS. For adhesion, cells were trypsinized

with 100 μl 0.25% trypsin-EDTA, and the total volume was brought up to 1 ml by adding 900 μl PBS. For invasion, cells were incubated for an additional hour in 1 ml of EMEM con- taining 100 μg/ml penicillin, 100 μg/ml amphotericin B, and 50 μg/ml streptomycin. Cells were washed 3 times in PBS, detached using 100 μl 0.25% trypsin-EDTA, and then lysed in 100 μl 0.0125% Tritin X-100. All samples were plated on BA to enumerate bacteria. Three independent experiments were performed and all samples were done in triplicate.

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 5 / 19

Murine nasopharyngeal colonization

Six to eight week old C57BL/6 mice (n = 5) were briefly anesthetized with isoflurane and intra-

nasally inoculated with 1x10 7

CFU pneumococci suspended in 10 μl sterile PBS. Mice were euthanized 5 days post infection by cervical dislocation, and the nasopharyngeal passage was

washed with 200 μl sterile PBS. The skull was denuded, and the nasopharyngeal tissues and bullae were independently collected and homogenized in 200 μl sterile PBS. Samples were plated on BA to enumerate CFU. Animal studies performed were in accordance with protocols

approved by the Institutional Animal Care and Use Committee of the University of Mississippi

Medical Center. The physical condition of the mice was monitored daily by licensed veterinar-

ians, and all measures to minimize suffering during handling and euthanasia were taken.

Murine pneumonia

Adult C57BL/6 mice (n = 5) of were anesthetized by intraperitoneal injection of 500 μl of Aver- tin (2.5% amylene hydrate solution containing 6.25 mg tribromoethanol). Mice were intratra-

cheally inoculated with 1x10 7

CFU pneumococci and were euthanized by cervical dislocation

two days post infection. The lungs were collected and homogenized in 2 ml sterile PBS. Sam-

ples were plated on blood agar to enumerate CFU. Animal studies performed were in accor-

dance with protocols approved by the Institutional Animal Care and Use Committee of the

University of Mississippi Medical Center. The physical condition of the mice was monitored

daily by licensed veterinarians, and all measures to minimize suffering during handling and

euthanasia were taken.

Chinchilla otitis media

Young adult chinchillas (Chinchilla lanigera, 400–500 g body weight) were inoculated in each bulla via transbullar injection with 1x10

7 CFU pneumococci suspended in 100 μl PBS

containing 0.04% gelatin. Prior to infection, an otoscope was used to examine the animals’

tympanic membranes. Chinchillas were euthanized 4 days post infection in a CO2 chamber,

and tympanic pathology was scored through otoscopic examination as follows: 0 = none,

1 = inflammation, 2 = effusion, and 3 = tympanic rupture. The skin was removed from the

top of the head, and the middle ear was accessed by cutting a small hole in the top of the

bulla. Visible biofilm formation was scored as follows: 0 = none, 1 = surface formation,

2 = traverses bulla, and 3 = traverses bulla with thickening. Exudate was collected and each

bulla was washed with 1 ml sterile PBS. Whole bullae were removed and homogenized in 10

ml PBS. All samples were plated on BA to enumerate CFU. Animal studies performed were

in accordance with protocols approved by the Institutional Animal Care and Use Committee

of the University of Mississippi Medical Center. The chinchillas’ physical conditions were

monitored daily by licensed veterinarians, and all measures to minimize suffering during

handling and euthanasia were taken.

Statistical analysis

Data was compared using a Student’s t test with Prism 5 software (GraphPad Software, Inc., San Diego, CA).

Results

Ply activity and production

We examined the effects of potD deletion on the synthesis and function of the pneumococcal pore-forming toxin Ply. Hemolysis assays were performed to examine the differences in

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 6 / 19

hemolytic potential between MNZ67 and PIP01. A significant reduction in RBC lysis was

observed by PIP01, whereas WT MNZ67 lysed the RBCs as levels equivalent to the detergent

control set at 100% (Fig 1A). To confirm the reduction in hemolytic potential was due to lower

production of Ply, an ELISA was performed to establish Ply concentration. PIP01 bacterial

lysates had significantly lower levels of Ply than WT MNZ67 (Fig 1B). Together, these results

indicate Ply synthesis is reduced in the absence of a functional pot operon and correlate with

data obtained from similar experiments using T4.

PspK analysis

PspK has thus far only been found in a subset of group II NESp designated NCC1, in which

pspK replaces capsule synthesis genes [5,32]. PspK is known to increase epithelial cell adhesion and has been implicated in increased nasopharyngeal colonization, as well as enhanced acute

OM [31,33]. We examined the effects of potD deletion on PspK production in the NESp MNZ67 using an ELISA to determine relative PspK concentrations. In comparison to MNZ67,

PIP01 had significantly higher concentrations of PspK (Fig 2A). To confirm these results, we

also utilized RT-qPCR to analyze pspK expression. In correlation with our ELISA results, we observed a significant fold change in pspK in PIP01 (Fig 2B). Since PspK is a surface protein, we wanted to determine if the increased PspK observed in PIP01 was actually present on the

surface of viable pneumococci. The amount of surface-associated PspK was assessed by flow

cytometry. Interestingly, there was not a significant difference in fluorescence intensity, signi-

fying there was no difference in surface expressed PspK (Fig 2C). Taken together, these results

indicate the absence of potD impacts the production of PspK.

Fig 1. Ply activity and expression. Effects of potD deletion on hemolytic activity were assessed via hemolysis assay, in which

pneumococcal lysates were incubated with sheep RBCs and lysis was monitored. Lysis by Triton X-114 was set at 100%. Effects on Ply

synthesis were determined using a standard indirect ELISA, in which WT values were set at 100%. Deletion of potD from MNZ67

significantly reduced hemolytic potential (A). A significant reduction in Ply production was also observed upon deletion of potD (B). All

samples were analyzed in triplicate and experiments were performed at least 3 times. Error bars denote standard error of the mean.

https://doi.org/10.1371/journal.pone.0179159.g001

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 7 / 19

Fig 2. PspK analysis. PspK was quantified in pneumococcal lysates by an indirect ELISA, and pspK expression was determined via

RT-qPCR. Surface-expressed PspK was assessed by flow cytometry. Significantly more PspK was produced in potD mutant PIP01

when compared to wild type MNZ67 (A). Additionally, significantly higher pspK expression was seen in PIP01 (B). Although increased

PspK was observed, no difference was seen in surface associated PspK (C). The ELISA was performed at least three times, and each

sample was analyzed in triplicate. RT-qPCR was performed three independent times and data was analyzed using the ΔΔCT method. Flow cytometry was performed twice. Error bars denote standard error of the mean.

https://doi.org/10.1371/journal.pone.0179159.g002

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 8 / 19

Complementation of potD expression

To validate results, potD was restored in PIP01, and production of Ply and PspK was analyzed via ELISA. Expression of potD was complemented into PIP01 via transformation with pNE1:: potD to generate the strain PIP02. Whereas deletion of potD resulted in increased PspK expres- sion and decreased Ply expression (Figs 1 and 2), restoration of potD resulted in decreased PspK expression (Fig 3A) and increased Ply expression (Fig 3B). Furthermore, Ply levels were

significantly greater than WT, while PspK levels were significantly lower than WT (Fig 3).

Epithelial cell adhesion and invasion

Adhesion and invasion of epithelial cells is a key component of pneumococcal pathogenesis.

Since an increase in the adhesive protein PspK was observed in PIP01, we analyzed whether or

not adhesion to human epithelial cells was also increased. Adhesion and invasion assays were

performed using two different human-derived epithelial cell lines: the pulmonary cell line

A549 and the pharyngeal cell line Detroit 562. For adhesion to Detroit 562 cells, there was no

discernable difference between MNZ67 and PIP01 (Fig 4A). In contrast, there was a significant

increase in adhesion to A549 cells by PIP01 (Fig 4B). Epithelial cell invasion was not signifi-

cantly altered when using Detroit 562 cells (Fig 4C) or A549 cells (Fig 4D).

Biofilm production

It has been shown polyamine acquisition and biosynthesis play an integral role in biofilm for-

mation of certain bacterial species [34,35]. We therefore sought to establish if polyamine

transport via the pot operon was necessary for biofilm production in pneumococci and to

determine if there were variances between encapsulated pneumococci and NCC1 NESp. Bio-

film assays were utilized to assess biofilm formation, and results showed significantly more

biofilm was formed by PIP01 in comparison to WT MNZ67 (Fig 5A). In contrast, biofilm

assays using encapsulated strain T4 and a T4ΔpotD showed biofilm formation was significantly lower in TIGR4ΔpotD (Fig 5B). Thus, polyamine acquisition appears to differentially affect encapsulated pneumococci and NESp progression to biofilm.

Fig 3. Restoration of protein synthesis in PIP01 after complementation of potD. PIP01 was transformed

with pNE1::potD to produce PIP02. An indirect ELISA was used to determine effects on PspK and

pneumolysin production. PspK was reduced to levels significantly less than wild type after potD

complementation (A), while pneumolysin was increased to levels significantly higher than wild type after

complementation (B). All samples were analyzed in triplicate and experiments were performed at least 3

times. Error bars denote standard error of the mean.

https://doi.org/10.1371/journal.pone.0179159.g003

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 9 / 19

Murine colonization and ascension

Deletion of the pot operon in encapsulated pneumococcal strain T4 severely attenuates its ability to colonize the nasopharynx of a mouse [17]. However, NESp ΔpotD mutant PIP01 expresses higher levels of the adhesive protein PspK and shows increased biofilm formation

Fig 4. Epithelial cell adhesion and invasion. Changes in epithelial cell adhesion and invasion were assessed using adhesion/invasion

assays with either Detroit 562 (pharyngeal) or A549 (lung) human epithelial cells. Epithelial cells were incubated with 10 7

pneumococci

and adhered or internalized pneumococci were enumerated on BA. Adhesion to Detroit 562 was not significantly affected by the absence

of potD in MNZ67 (A), but adhesion to A549 cells was significantly increased in the absence of potD (B). A significant difference was not

observed between MNZ67 and PIP01 when examining Detroit 562 or A549 cell invasion (C and D). All samples were analyzed in

triplicate and experiments were performed at least 3 times. Error bars denote standard error of the mean.

https://doi.org/10.1371/journal.pone.0179159.g004

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 10 / 19

(Figs 2, 3, 4, and 5A), factors that aid in colonization. We therefore investigated if the absence

of potD significantly affects MNZ67 nasopharyngeal colonization and ascension into the mid- dle ear in a mouse model. Interestingly, CFU recovered from the nasopharynxes and middle

ears of mice infected with PIP01 did not significantly differ from those infected with MNZ67

(Fig 6).

Chinchilla otitis media

We examined the effects of potD deletion on pneumococcal pathogenesis during OM using a chinchilla model. Although there was no significant difference in CFU recovered from the

bullae of chinchillas infected with PIP01 in comparison to those infected with MNZ67, a

strong trend towards increased CFU was observed (Fig 7A). Additionally, PIP01 infected

chinchillas had higher otic and biofilm scores in comparison to WT MNZ67 (Table 3). In

contrast, the absence of a functional pot operon significantly reduced OM caused by T4.

This included a reduction in pathology and biofilm formation (Table 3), as well as signifi-

cantly fewer CFU recovered from the bullae of chinchillas infected with T4 ΔpotD (Fig 7B). These results further illustrate the pot operon has contrasting effects on encapsulated pneu-

mococci and NESp.

Murine pneumonia

Ware et al. demonstrated disruption of the pot operon significantly attenuates virulence of encapsulated strains during a pulmonary infection [25]. We investigated the ability of PIP01 to

persist within the lungs of a mouse to determine if the pot operon is required for NESp pulmo- nary infections. After a two day infection period, significantly more pneumococci were

Fig 5. Differential effects on biofilm production. Effects of potD deletion on biofilm production were determined using a biofilm assay,

in which biofilm formation was assessed 24 hours after seeding 1x10 5

pneumococci in a 24 well plate. Data is presented as OD630. NESp

PIP01 formed significantly more biofilm than WT MNZ67 (A), while T4ΔpotD produced significantly less biofilm than WT T4 (B). Samples were analyzed in triplicate and experiments were performed at least three times. Error bars denote standard error of the mean.

https://doi.org/10.1371/journal.pone.0179159.g005

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 11 / 19

Fig 6. Murine nasopharyngeal colonization and ascension to the middle ear. Murine colonization and ascension were determined

five days post infection after an intranasal challenge with 10 7

pneumococci. Changes in colonization (A) and ascension (B) in the

absence of potD were not significantly different. Five mice were infected with each strain, and two independent experiments were

performed. Error bars denote standard error of the mean.

https://doi.org/10.1371/journal.pone.0179159.g006

Fig 7. Chinchilla acute OM. Experimental OM was assessed using a chinchilla model. Animals were infected via transbullar injection

and were euthanized 4 days post infection. Pneumococci recovered from chinchilla bullae did not significantly differ between WT MNZ67

and PIP01 (A). Significantly less CFU were recovered from chinchillas infected with T4ΔpotD in comparison to wild type T4 (B). For each strain, 3 chinchillas were infected in both ears, yielding 6 individual infections. Experiments were performed twice and error bars denote

standard error of the mean.

https://doi.org/10.1371/journal.pone.0179159.g007

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 12 / 19

recovered from the lungs of mice infected with PIP01 in comparison to those infected with

MNZ67 (Fig 8). Furthermore, all five mice infected with PIP01 had bacteria in the lungs after 2

days, whereas no bacteria were recovered from the lungs of two of the mice infected with

MNZ67.

Discussion

The pot operon has been identified in all sequenced pneumococcal isolates [17]. Inactivation of the pot operon attenuates virulence of encapsulated pneumococcal strains [15,25,36], thus making the pot operon an intriguing target for pneumococcal treatment and prevention. How- ever, the challenge of finding a target that truly conveys protection against all pneumococci,

and not just encapsulated strains, remains an obstacle. Because research targeting the pot operon of encapsulated strains proved promising as a disease preventative, we aimed to evalu-

ate the involvement of the pot operon in NESp virulence. Attenuation of NESp virulence after potABCD inactivation would confirm the pot operon is important for both types of pneumo- cocci and would further validate its potential as an all-inclusive pneumococcal therapeutic.

Since potABCD is highly conserved amongst pneumococcal isolates [17], we hypothesized it would have conserved effects on pneumococcal virulence as well. However, here we show inac-

tivating the pot operon in the NESp isolate MNZ67 produces results dissimilar to those obtained using a Δpot encapsulated strain. The only data that correlated with previous encap- sulated studies was effects on the pore-forming toxin Ply (Fig 1). Ply is an important virulence

factor of S. pneumoniae and has been shown to greatly impact the ability of the organism to cause infection [37,38]. Proteomic analysis of the virulent pneumococcal isolate T4 showed the

T4-derived mutant lacking a functional pot operon had reduced expression of Ply [17]. We

observed reduced lysis of RBCs when potD was deleted from MNZ67. Our quantitative ELISA results confirmed the loss of hemolytic potential observed in our hemolysis assay was from a

decrease in Ply production. Therefore, it appears polyamine acquisition does serve a similar

function in relation to regulation of this specific protein.

In MNZ67, the cps genes are replaced by pspK [32]. Examining PspK expression not only further elucidated the effects of potD deletion on pneumococcal protein expression, but it also allowed us to investigate the effects on a protein unique to NESp. Previous studies noted a

decrease in capsule synthesis proteins when potABCD was deleted from T4 [17]. In contrast, we noted increased expression of PspK in MNZ67 ΔpotD mutant, PIP01 (Fig 2). Interestingly, although cps and pspK genes occupy the same locus within the different strains, polyamine transport appears to positively regulate capsule production but negatively regulate pspK expression. Taken together with our Ply data and previous research involving encapsulated

strains, we conclude polyamine acquisition via the pot operon is important for protein regula-

tion in both encapsulated and nonencapsulated pneumococci. However, this appears to have

strain and gene dependent variances.

Table 3. OM tympanic pathology scores and biofilm scores 4 days post infection.

Strain *Otic Score ± SEM #Biofilm Score ± SEM MNZ67 1.5 ± 0.33 1.0 ± 0.66 PIP01 2 1.75 ± 0.28

T4 2.2 ± 0.21 2.5 ± 0.24 T4 ΔpotD 1.0 ± 0.33 0.71± 0.75

* 0 = none, 1 = inflammation, 2 = effusion, and 3 = tympanic rupture #

0 = none, 1 = surface formation, 2 = traverses bulla, and 3 = traverses bulla with thickening

https://doi.org/10.1371/journal.pone.0179159.t003

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 13 / 19

To confirm potD deletion was responsible for changes in protein expression, we comple- mented potD in PIP01 and determined if protein levels were returned to those of wild type. When potD was restored in PIP01, not only was Ply increased and PspK decreased, but these changes were significantly higher or lower than WT (Fig 3). Because potD was complemented into PIP01 via transformation with the plasmid pNE1, these significant changes are likely due

to increased copy number of potD. This data further indicates the involvement of polyamine acquisition in NESp protein expression regulation, as increased presence of PotD significantly

alters protein levels.

Fig 8. Persistence in murine lungs. The lungs of intratracheally infected mice were collected 2 days post infection, and the ability of

MNZ67 and PIP01 to persist in the lungs was determined by enumerating CFU. Significantly more pneumococci were recovered from

mice infected with PIP01. Five mice were infected with each strain. Error bars denote standard error of the mean.

https://doi.org/10.1371/journal.pone.0179159.g008

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 14 / 19

We established PspK was increased in PIP01 by analyzing cell lysates via ELISA. Because

PspK is a surface protein, we also wanted to determine if the increased PspK observed in

PIP01 was actually expressed on the surface, or if the PspK detected by the ELISA was intra-

cellular protein released into the environment after cell lysis. Flow cytometric analysis

showed no discernable difference in surface bound PspK (Fig 2C). We therefore hypothesize

these variances in expression and surface bound analyses are due to two possible explana-

tions. The first explanation being higher levels of PspK were produced in PIP01, but it was

kept within the cell and released during cell lysis; this could be because the cells already have

the maximum amount of PspK on their surfaces. The second explanation is that PIP01 is

actually expressing more PspK than MNZ67 on the cell surface. Due to steric hindrance,

however, the antibody cannot access, and therefore cannot bind, the excess proteins, thus

skewing flow cytometry results. To discern which was accurate, we looked for functionality

of the increased protein.

PspK is an adhesive surface protein known to aid in adhesion to human epithelia. This

adhesiveness propagates nasopharyngeal colonization and increases persistence during infec-

tion [31,33]. Our studies showed PIP01 to have increased PspK expression but no difference in

surface bound PspK, which led us to investigate if PIP01 exhibited any changes in epithelial

cell adhesion and invasion. We showed PIP01 had increased adhesion to human A549 pulmo-

nary epithelial cells in vitro (Fig 4B). This data, combined with our data showing PIP01 to

have increased persistence in the lungs of a mouse, led us to conclude the increased PspK

being produced in PIP01 is functional and surface bound. If PspK were truncated or kept

within the cell, it would not aid in adherence. However, increased PspK expression did not

alter adhesion to Detroit 562 pharyngeal cells or nasopharyngeal colonization. Based on these

results, we hypothesize lung epithelia may have an additional PspK ligand not present on pha-

ryngeal cells. PspK has thus far been implicated in colonization and OM, but this data suggests

PspK may also be important for adherence and pathogenesis within the lungs.

Biofilm production is a central characteristic of numerous bacterial species. For pneumo-

cocci, it is thought biofilm formation aids in colonization [39]. Biofilms also serve as a point of

interaction between strains, facilitating genetic exchange of virulence factors and antibiotic

resistances [40]. Previous studies have shown that polyamines are essential for biofilm forma-

tion by the plague-causing organism Yersinia pestis [34]. Additionally, biofilm formation by Vibrio cholerae was shown to increase when excess polyamines were added to growth media [35]. We examined changes in biofilm formation in both T4 and MNZ67 in the absence of a

functional pot operon. However, these results were contrasting, with T4ΔpotD having decreased biofilm formation and PIP01 having increased biofilm formation in comparison to

WT. Polyamine acquisition is generally thought to aid in progression to biofilm, which seems

to be the case for encapsulated pneumococci. Yet, in MNZ67 the inactivation of the polyamine

transporter appears to enhance biofilm development.

Although we did not see an increase in pharyngeal cell adhesion in vitro (Fig 4A), we still

wanted to examine in vivo nasopharyngeal colonization. Pneumococci must first colonize the

nasopharynx before it can disseminate to other parts of the body and cause disease. It has been

shown potABCD deletion significantly reduces the ability of encapsulated pneumococci to col- onize the nasopharynx of a mouse [17], further supporting the claim that the pot operon is a

good target for pneumococcal disease prevention. However, our results showed deletion of

potD from MNZ67 did not reduce murine colonization or ascension from the nasopharynx to the middle ear. In fact, CFU recovered from mice infected with PIP01 were slightly higher

than CFU recovered from mice infected with WT MNZ67 (Fig 6). Unlike encapsulated pneu-

mococci, polyamine acquisition via the pot operon is not vital to successful colonization and

disease development by NESp subgroup NCC1. This can be explained by the difference in

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 15 / 19

biofilm formation, with reduced biofilm formation in encapsulated strain leading to reduced

colonization and more biofilm in MNZ67 leading to slightly more colonization.

Middle ear infections are the most frequent reason for pediatric visits in the United States,

and S. pneumoniae is a leading cause of OM [11]. Although the involvement of polyamine acquisition in other pneumococcal diseases has been explored, the role of polyamines in pneu-

mococcal OM has not been determined. We therefore examined effects of potD deletion on T4 and MNZ67 associated OM in a chinchilla model. In MNZ67, potD deletion produced slight increases in recovered CFU, otic pathology, and biofilm formation. In contrast, deletion of

potD in T4 significantly attenuated pathology, biofilm formation, and bacterial persistence in the middle ear. This data further supports our idea that polyamine acquisition by the pot

operon is essential for pathogenesis of encapsulated pneumococci, but it is dispensable for

pathogenesis of NCC1 NESp.

Together, the increased biofilm development, increased epithelial adhesion, increased col-

onization, and increased OM pathology reinforce that the absence of a functional pot operon in MNZ67 actually increases virulence. We propose two explanations for these results: 1)

polyamine acquisition and metabolism negatively regulate virulence in the NESp, or 2) inac-

tivation of the pot operon results in upregulation of polyamine biosynthetic pathways, thus

overcompensating for the loss of polyamine acquisition and resulting in increased poly-

amine-associated virulence. In any case, we conclude polyamines are an integral component

of pneumococcal virulence. Their role however, is altered between encapsulated and natu-

rally occurring nonencapsulated strains. These finding exemplify the diversity amongst

pneumococci and further elucidate the challenge of finding all-inclusive pneumococcal tar-

gets. Although our studies do not illustrate the pot operon to be a suitable target for reducing

NESp virulence, our data does shed light on NCC1 protein regulation. Furthermore, our

studies show NESp have unique mechanisms of virulence regulation that differ from encap-

sulated pneumococci. Together, our results illuminate the need to further investigate NESp

virulence factors, virulence regulation, and metabolic processes.

Supporting information

S1 Fig. 1–3 Data. Datasets underlying Figs 1, 2, and 3. Protein levels were measured by indi-

rect ELISA and pneumolysin function was determined by hemolysis assay. Triplicates were

averaged, and percent production was calculated by dividing mutant values by WT/control

values and multiplying by 100. Gene expression was determined by RT-qPCR. Change is

expression was determined by the ΔΔCT method with gyrA serving as an internal control. (PDF)

S2 Fig. 4 Data. Dataset underlying Fig 4. Human epithelial cells were incubated with pneu-

mococci to allow adherence or invasion. CFU was determined by plating on BA. Data is

reported as log CFU.

(PDF)

S3 Fig. 5 Data. Dataset underlying Fig 5. Biofilm formation was determined by crystal violet

staining, alcohol solubilization, and OD630 analysis. OD readings and triplicate averages are

reported here.

(PDF)

S4 Fig. 6 Data. Dataset underlying Fig 6. Mice were intranasally infected with pneumococci

and CFU were determined 5 days post infection. CFU counts for nasal samples and bullae

were determined separately. Data is reported as log CFU.

(PDF)

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 16 / 19

S5 Fig. 7 Data. Dataset underlying Fig 7. Chinchillas were infected in each bullae with pneu-

mococci and CFU were determined 4 days post infection. Counts for the wash, exudate, and

whole bullae were combined and data is reported as log CFU.

(PDF)

S6 Fig. 8 Data. Dataset underlying Fig 8. Mice were intratracheally infected with pneumo-

cocci and CFU were determined 2 days post infection. Data is reported as log CFU.

(PDF)

Acknowledgments

We would like to acknowledge Cheshil Dixit and Jessica Friley for their assistance collecting

and processing colonization and OM samples.

Author Contributions

Conceptualization: LSM ES LEK.

Data curation: HRP LSM.

Formal analysis: HRP JLB LSM ES LEK.

Funding acquisition: LSM.

Investigation: HRP JLB LEK.

Methodology: HRP JLB LEK LSM.

Project administration: LSM.

Resources: ES LEK LSM.

Supervision: LSM.

Validation: HRP JLB LEK LSM.

Visualization: HRP JLB LSM.

Writing – original draft: HRP.

Writing – review & editing: HRP JLB LEK ES LSM.

References 1. Kadioglu A, Weiser JN, Paton JC, Andrew PW. The role of Streptococcus pneumoniae virulence factors

in host respiratory colonization and disease. Nat Rev Microbiol. 2008; 6: 288–301. https://doi.org/10.

1038/nrmicro1871 PMID: 18340341

2. Musher DM. Infections Caused by Streptococcus pneumoniae: Clinical Spectrum, Pathogenesis,

Immunity, and Treatment. Clin Infect Dis. 1992; 14: 801–809. https://doi.org/10.1093/clinids/14.4.801

PMID: 1576274

3. Forrester HL, Jahnigen DW, Marc Laforce F. Inefficacy of pneumococcal vaccine in a high-risk popula-

tion. Am J Med. 1987; 83: 425–430. https://doi.org/10.1016/0002-9343(87)90751-0 PMID: 3661581

4. Enright MC, Spratt BG. A multilocus sequence typing scheme for Streptococcus pneumoniae: identifi-

cation of clones associated with serious invasive disease. Microbiology. 1998; 144 (Pt 1: 3049–60.

https://doi.org/10.1099/00221287-144-11-3049 PMID: 9846740

5. Park IH, Kim K-H, Andrade AL, Briles DE, McDaniel LS, Nahm MH. Nontypeable Pneumococci Can Be

Divided into Multiple cps Types, Including One Type Expressing the Novel Gene pspK. MBio. 2012; 3:

e00035–12–e00035–12. https://doi.org/10.1128/mBio.00035-12 PMID: 22532557

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 17 / 19

6. Hathaway LJ, Meier PS, Battig P, Aebi S, Muhlemann K. A Homologue of aliB Is Found in the Capsule

Region of Nonencapsulated Streptococcus pneumoniae. J Bacteriol. 2004; 186: 3721–3729. https://

doi.org/10.1128/JB.186.12.3721-3729.2004 PMID: 15175285

7. Geno KA, Gilbert GL, Song JY, Skovsted IC, Klugman KP, Jones C, et al. Pneumococcal Capsules and

Their Types: Past, Present, and Future. Clin Microbiol Rev. 2015; 28: 871–899. https://doi.org/10.1128/

CMR.00024-15 PMID: 26085553

8. Castiglia P. Recommendations for Pneumococcal Immunization Outside Routine Childhood Immuniza-

tion Programs in Western Europe. Adv Ther. 2014; 31: 1011–1044. https://doi.org/10.1007/s12325-

014-0157-1 PMID: 25300593

9. Bonten MJM, Huijts SM, Bolkenbaas M, Webber C, Patterson S, Gault S, et al. Polysaccharide Conju-

gate Vaccine against Pneumococcal Pneumonia in Adults. N Engl J Med. 2015; 372: 1114–1125.

https://doi.org/10.1056/NEJMoa1408544 PMID: 25785969

10. FADEN H, DUFFY L, BOEVE M. Otitis media: back to basics. Pediatr Infect Dis J. 1998; 17: 1105–

1113. https://doi.org/10.1097/00006454-199812000-00002 PMID: 9877357

11. Faden H, Duffy L, Wasielewski R, Wolf J, Krystofik D, Tung Y. Relationship between nasopharyngeal col-

onization and the development of otitis media in children. Tonawanda/Williamsville Pediatrics. J Infect

Dis. 1997; 175: 1440–5. Available: http://www.ncbi.nlm.nih.gov/pubmed/9180184 PMID: 9180184

12. Gonzales R, Malone DC, Maselli JH, Sande MA. Excessive Antibiotic Use for Acute Respiratory Infec-

tions in the United States. Clin Infect Dis. 2001; 33: 757–762. https://doi.org/10.1086/322627 PMID:

11512079

13. Hicks LA, Harrison LH, Flannery B, Hadler JL, Schaffner W, Craig AS, et al. Incidence of Pneumococcal

Disease Due to Non—Pneumococcal Conjugate Vaccine (PCV7) Serotypes in the United States during

the Era of Widespread PCV7 Vaccination, 1998–2004. J Infect Dis. 2007; 196: 1346–1354. https://doi.

org/10.1086/521626 PMID: 17922399

14. Tavares DA, Simões AS, Bootsma HJ, Hermans PW, de Lencastre H, Sá-Leão R. Non-typeable pneu- mococci circulating in Portugal are of cps type NCC2 and have genomic features typical of encapsu-

lated isolates. BMC Genomics. 2014; 15: 863. https://doi.org/10.1186/1471-2164-15-863 PMID:

25283442

15. Croucher NJ, Harris SR, Fraser C, Quail MA, Burton J, van der Linden M, et al. Rapid Pneumococcal

Evolution in Response to Clinical Interventions. Science (80-). 2011; 331: 430–434. https://doi.org/10.

1126/science.1198545 PMID: 21273480

16. Hotomi M, Nakajima K, Hiraoka M, Nahm MH, Yamanaka N. Molecular epidemiology of nonencapsu-

lated Streptococcus pneumoniae among Japanese children with acute otitis media. J Infect Chemother.

2016; 22: 72–77. https://doi.org/10.1016/j.jiac.2015.10.006 PMID: 26705748

17. Shah P, Nanduri B, Swiatlo E, Ma Y, Pendarvis K. Polyamine biosynthesis and transport mechanisms

are crucial for fitness and pathogenesis of Streptococcus pneumoniae. Microbiology. 2011; 157: 504–

515. https://doi.org/10.1099/mic.0.042564-0 PMID: 20966092

18. Shah P, Swiatlo E. A multifaceted role for polyamines in bacterial pathogens. Mol Microbiol. 2008; 68:

4–16. https://doi.org/10.1111/j.1365-2958.2008.06126.x PMID: 18405343

19. Pegg AE, McCann P. Polyamine metabolism and function. Am J Physiol—Cell Physiol. 1982; 243:

212–221. Available: http://ajpcell.physiology.org/content/243/5/C212

20. Cohen S. A Guide to Polyamines. New York: Oxford University Press; 1997.

21. Chattopadhyay MK, Tabor CW, Tabor H. Polyamines protect Escherichia coli cells from the toxic effect

of oxygen. Proc Natl Acad Sci. 2003; 100: 2261–2265. https://doi.org/10.1073/pnas.2627990100

PMID: 12591940

22. Jung IL, Kim IG. Polyamines and Glutamate Decarboxylase-based Acid Resistance in Escherichia coli.

J Biol Chem. 2003; 278: 22846–22852. https://doi.org/10.1074/jbc.M212055200 PMID: 12670930

23. Ware D, Watt J, Swiatlo E. Utilization of putrescine by Streptococcus pneumoniae during growth in cho-

line-limited medium. J Microbiol. 2005; 43: 398–405. Available: http://www.ncbi.nlm.nih.gov/pubmed/

16273030 PMID: 16273030

24. Furuchi T, Kashiwagi K, Kobayashi H, Igarashi K. Characteristics of the gene for a spermidine and

putrescine transport system that maps at 15 min on the Escherichia coli chromosome. J Biol Chem.

1991; 266: 20928–33. Available: http://www.jbc.org/content/266/31/20928.long PMID: 1939142

25. Ware D, Jiang Y, Lin W, Swiatlo E. Involvement of potD in Streptococcus pneumoniae Polyamine

Transport and Pathogenesis. Infect Immun. 2006; 74: 352–361. https://doi.org/10.1128/IAI.74.1.352-

361.2006 PMID: 16368990

26. Shah P, Briles DE, King J, Hale Y, Swiatlo E. Mucosal Immunization with Polyamine Transport Protein

D (PotD) Protects Mice Against Nasopharyngeal Colonization with Streptococcus pneumoniae. Exp

Biol Med. 2009; 234: 403–409. https://doi.org/10.3181/0809-RM-269 PMID: 19176871

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 18 / 19

27. Shah P, Swiatlo E. Immunization with Polyamine Transport Protein PotD Protects Mice against Sys-

temic Infection with Streptococcus pneumoniae. Infect Immun. 2006; 74: 5888–5892. https://doi.org/10.

1128/IAI.00553-06 PMID: 16988268

28. Conversoa TR, Goularta C, Rodrigueza D, Darrieuxc M, Leite LCC. Systemic immunization with rPotD

reduces Streptococcus pneumoniae nasopharyngeal colonization in mice. Vaccine. 2017; 35: 149–155.

Available: http://www.sciencedirect.com/science/article/pii/S0264410X1631074X https://doi.org/10.

1016/j.vaccine.2016.11.027 PMID: 27884476

29. Horton RM, Hunt HD, Ho SN, Pullen JK, Pease LR. Engineering hybrid genes without the use of restric-

tion enzymes: gene splicing by overlap extension. Gene. 1989; 77: 61–68. Available: http://www.

sciencedirect.com/science/article/pii/0378111989903594 PMID: 2744488

30. Smith PK, Krohn RI, Hermanson GT, Mallia AK, Gartner FH, Provenzano MD, et al. Measurement of

protein using bicinchoninic acid. Anal Biochem. 1985; 150: 76–85. https://doi.org/10.1016/0003-2697

(85)90442-7 PMID: 3843705

31. Keller LE, Jones C V., Thornton JA, Sanders ME, Swiatlo E, Nahm MH, et al. PspK of Streptococcus

pneumoniae Increases Adherence to Epithelial Cells and Enhances Nasopharyngeal Colonization.

Infect Immun. 2013; 81: 173–181. https://doi.org/10.1128/IAI.00755-12 PMID: 23115034

32. Keller LE, Robinson DA, McDaniel LS. Nonencapsulated Streptococcus pneumoniae: Emergence and

Pathogenesis. MBio. 2016; 7: e01792–15. https://doi.org/10.1128/mBio.01792-15 PMID: 27006456

33. Keller LE, Friley J, Dixit C, Nahm MH, McDaniel LS. Nonencapsulated Streptococcus pneumoniae

Cause Acute Otitis Media in the Chinchilla That Is Enhanced by Pneumococcal Surface Protein K.

Open Forum Infect Dis. 2014; 1: ofu037–ofu037. https://doi.org/10.1093/ofid/ofu037 PMID: 25734113

34. Patel CN, Wortham BW, Lines JL, Fetherston JD, Perry RD, Oliveira MA. Polyamines Are Essential for

the Formation of Plague Biofilm. J Bacteriol. 2006; 188: 2355–2363. https://doi.org/10.1128/JB.188.7.

2355-2363.2006 PMID: 16547021

35. Karatan E, Duncan TR, Watnick PI. NspS, a Predicted Polyamine Sensor, Mediates Activation of Vibrio

cholerae Biofilm Formation by Norspermidine. J Bacteriol. 2005; 187: 7434–7443. https://doi.org/10.

1128/JB.187.21.7434-7443.2005 PMID: 16237027

36. Rai AN, Thornton JA, Stokes J, Sunesara I, Swiatlo E, Nanduri B. Polyamine transporter in Streptococ-

cus pneumoniae is essential for evading early innate immune responses in pneumococcal pneumonia.

Sci Rep. 2016; 6: 26964. https://doi.org/10.1038/srep26964 PMID: 27247105

37. Hirst RA, Gosai B, Rutman A, Guerin CJ, Nicotera P, Andrew PW, et al. Streptococcus pneumoniae

Deficient in Pneumolysin or Autolysin Has Reduced Virulence in Meningitis. J Infect Dis. 2008; 197:

744–751. https://doi.org/10.1086/527322 PMID: 18260758

38. Berry AM, Alexander JE, Mitchell TJ, Andrew PW, Hansman D, Paton JC. Effect of defined point muta-

tions in the pneumolysin gene on the virulence of Streptococcus pneumoniae. Infect Immun. 1995; 63:

1969–1974. Available: http://www.ncbi.nlm.nih.gov/pmc/articles/PMC173251/ PMID: 7729909

39. Allegrucci M, Sauer K. Characterization of Colony Morphology Variants Isolated from Streptococcus

pneumoniae Biofilms. J Bacteriol. 2007; 189: 2030–2038. https://doi.org/10.1128/JB.01369-06 PMID:

17189375

40. Marks LR, Reddinger RM, Hakansson AP. High Levels of Genetic Recombination during Nasopharyn-

geal Carriage and Biofilm Formation in Streptococcus pneumoniae. MBio. 2012; 3: e00200–12–

e00200–12. https://doi.org/10.1128/mBio.00200-12 PMID: 23015736

Polyamine transport and virulence of Streptococcus pneumoniae

PLOS ONE | https://doi.org/10.1371/journal.pone.0179159 June 6, 2017 19 / 19