Biology
Plastics Derived Endocrine Disruptors (BPA, DEHP and DBP) Induce Epigenetic Transgenerational Inheritance of Obesity, Reproductive Disease and Sperm Epimutations Mohan Manikkam, Rebecca Tracey, Carlos Guerrero-Bosagna, Michael K. Skinner*
Center for Reproductive Biology, School of Biological Sciences, Washington State University, Pullman, Washington, United States of America
Abstract
Environmental compounds are known to promote epigenetic transgenerational inheritance of adult onset disease in subsequent generations (F1–F3) following ancestral exposure during fetal gonadal sex determination. The current study was designed to determine if a mixture of plastic derived endocrine disruptor compounds bisphenol-A (BPA), bis(2- ethylhexyl)phthalate (DEHP) and dibutyl phthalate (DBP) at two different doses promoted epigenetic transgenerational inheritance of adult onset disease and associated DNA methylation epimutations in sperm. Gestating F0 generation females were exposed to either the ‘‘plastics’’ or ‘‘lower dose plastics’’ mixture during embryonic days 8 to 14 of gonadal sex determination and the incidence of adult onset disease was evaluated in F1 and F3 generation rats. There were significant increases in the incidence of total disease/abnormalities in F1 and F3 generation male and female animals from plastics lineages. Pubertal abnormalities, testis disease, obesity, and ovarian disease (primary ovarian insufficiency and polycystic ovaries) were increased in the F3 generation animals. Kidney and prostate disease were only observed in the direct fetally exposed F1 generation plastic lineage animals. Analysis of the plastics lineage F3 generation sperm epigenome previously identified 197 differential DNA methylation regions (DMR) in gene promoters, termed epimutations. A number of these transgenerational DMR form a unique direct connection gene network and have previously been shown to correlate with the pathologies identified. Observations demonstrate that a mixture of plastic derived compounds, BPA and phthalates, can promote epigenetic transgenerational inheritance of adult onset disease. The sperm DMR provide potential epigenetic biomarkers for transgenerational disease and/or ancestral environmental exposures.
Citation: Manikkam M, Tracey R, Guerrero-Bosagna C, Skinner MK (2013) Plastics Derived Endocrine Disruptors (BPA, DEHP and DBP) Induce Epigenetic Transgenerational Inheritance of Obesity, Reproductive Disease and Sperm Epimutations. PLoS ONE 8(1): e55387. doi:10.1371/journal.pone.0055387
Editor: Toshi Shioda, Massachusetts General Hospital, United States of America
Received May 30, 2012; Accepted December 28, 2012; Published January 24, 2013
Copyright: � 2013 Manikkam et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
Funding: This research was supported by Department of Defense (DOD), and National Institues of Health (NIH) grants to MKS. The funders had no role in study design, data collection and analysis, decision to publish, or preparation of the manuscript.
Competing Interests: The authors have declared that no competing interests exist.
* E-mail: skinner@wsu.edu
Introduction
Epigenetic transgenerational inheritance involves the transmis-
sion of a phenotypic alteration to subsequent generations (F3)
through germline epimutations following ancestral environmental
exposure of a gestating F0 generation female [1,2]. Previous studies
[2,3,4] with the agricultural fungicide vinclozolin administered to
gestating rats and mice during the gonadal sex determination period
promotes a male germline epigenome reprogramming to induce
transgenerational adult-onset disease. This modification of germline
epigenetic programming occurs during the gonadal sex determina-
tion period when the germline DNA is demethylated and
remethylated in a sex specific manner [1,5]. This modified
epigenetic programming of the male germline subsequently leads
to all tissues propagated from this sperm to have differentially altered
epigenomes and transcriptomes that can influence development of
adult-onset disease. The altered epigenome in the germline is
transmitted through subsequent generations due to apparent
permanent imprinted-like DNA methylation properties [4]. These
germline mediated epimutations enable epigenetic transgenera-
tional inheritance of altered phenotypes.
Environmental chemicals such as vinclozolin and the pesticide
methoxychlor [2] are known to promote epigenetic transgenera-
tional inheritance of adult-onset diseases. The current study was
designed to investigate the actions of a mixture of plastic derived
endocrine disruptor compounds bisphenol-A (BPA), bis(2-ethyl-
hexyl)phthalate (DEHP) and dibutyl phthalate (DBP). This
mixture of plastic derived compounds was selected due to the
common exposures in human populations such as military
personnel [6]. Bisphenol-A is used to make polycarbonate plastic
and epoxy resins which are in turn used in a variety of plastic items
such as water bottles, sports equipment, medical and dental
devices, dental fillings and sealants, household electronics and
eyeglass lenses [7]. Bisphenol A is an endocrine disruptor with
widespread exposure and multiple effects including impaired
reproductive capacity, promotion of obesity and metabolic disease
[8,9,10,11,12]. DEHP is widely used as a plasticizer in manufac-
turing of articles made of polyvinyl compounds [13] and it is
considered a reproductive and developmental toxicant in humans
and animals [14]. DBP is a phthalate used primarily as plasticizer
to add flexibility to plastics. DBP is used as a component in latex
adhesives, cosmetics, in cellulose plastics, and as a solvent for dyes.
Exposure of pregnant females to high doses of DBP (greater than
500,000 mg/kg BW/day) causes reduced fetal survival, reduced birth weights among surviving offspring, skeletal malformations
PLOS ONE | www.plosone.org 1 January 2013 | Volume 8 | Issue 1 | e55387
and reproductive abnormalities in both male and female offspring
associated with reduced fertility [15]. These three endocrine
disruptors (BPA, DEHP and DBP) have been shown to be derived
from various plastic bottles [16] and are common exposures in
humans [6,17].
Previous studies with bisphenol-A or phthalates have primarily
focused on F0 or F1 generation studies [18]. Actions on the F0 and
F1 generations involve direct effect of the exposure on the
gestating female or fetus, so is a multigenerational exposure [1].
Exposure of an F0 generation gestating female also exposes the
germline in the F1 generation fetus that will develop into the F2
generation. The F3 generation is required to eliminate the
possibility of direct exposure effects [1]. The current study focused
on transgenerational effects and analyzed F3 generation in
comparison with the direct exposure F1 generation. There has
been only one study that documented transgenerational effects of
bisphenol-A for three generations involving testis abnormalities
[19]. The current study used doses of a ,1% fraction of the oral
LD50 dose for bisphenol-A or phthalates DEHP and DBP through
intraperitoneal injection. Previous studies have suggested these
doses do not produce overt toxicity (changes in litter size, sex ratio,
or mean weights) in the F1 generation [20]. The doses selected are
considered low for previous rodent exposures
[11,21,22,23,24,25,26,27,28,29,30], but are high in relation to
common human exposures. Therefore, the study was designed to
examine the potential pharmacological actions of the compounds
to influence epigenetic transgenerational inheritance and not
designed to do risk assessment analysis. The observations of the
current study can now be used to more effectively design risk
assessment studies.
The current study examined the hypothesis that the exposure of a
gestating female during the fetal gonadal sex determination period
to the plastics mixture (BPA, DEHP and DBP) promotes epigenetic
transgenerational inheritance of adult onset disease. In the present
study diseases of the testis, prostate, kidney, ovary, tumor
development, and obesity were evaluated in 1-year old rats of F1
and F3 generations. Phenotypes observed in the F1 generation
animals are induced by a direct chemical exposure of the fetus and
somatic cells. However, effects observed in the F3 generation
animals are due to epigenetic transgenerational inheritance through
the germline and not due to any direct effect of the chemical
exposure [31]. Therefore, phenotypes or diseases observed in F1 and
F3 generation animals are not due to the same mechanism and are
often distinct. This study documents epigenetic transgenerational
inheritance of testis and ovary diseases, pubertal abnormalities, and
obesity in F3 generation offspring after the gestating ancestors
(great-grandmothers) were exposed to a mixture of plastic derived
compounds. This study further documents the ability of these
environmental exposures to induce epigenetic transgenerational
inheritance of sperm epimutations.
A recent study compared the actions of the plastic compound
mixture (BPA, DEHP, DBP) with a pesticide mixture, dioxin and a
hydrocarbon mixture on postnatal day 120 (P120) rats which
demonstrated all exposures induced F3 generation reproductive
abnormalities [20]. Observations demonstrated similar transge-
nerational disease phenotypes, but unique transgenerational sperm
epimutations [20]. The majority of adult onset disease develops
later in life (.6 mo age in rat) [32] and is not present at P120 in
rats. The current study extends these previous observations [20] to
examine the plastic compound mixture’s actions on F3 generation
animals. In addition, the transgenerational sperm epimutations
previously identified are more thoroughly investigated.
Results
Transgenerational Adult-Onset Disease Analysis The experimental design included exposure of outbred Harlan
Sprague Dawley gestating female rats to daily intraperitoneal
injections of DMSO vehicle (control) or a mixture of plastic
derived compounds (BPA, DEHP and DBP), designated as
‘‘plastics’’ and ‘‘lower dose plastics’’ (one half dose as plastics
group) during fetal days 8 to 14 of gestation. The F1 generation rat
offspring born to different exposed females were bred to obtain the
F2 generation. The F3 generation animals were obtained by
breeding non-littermate females and males of the F2 generation.
No sibling or cousin breeding was used to avoid any inbreeding
artifacts in generating the different lineages. Randomly selected
offspring from different litters of the F1 and F3 generations were
aged to one year and euthanized. Body and organ weights were
measured and examined for disease/abnormalities. The testis,
prostate, kidney and ovary were examined for histopathology as
outlined in Methods.
Potential overt toxicity from direct fetal exposure to plastics or
lower dose plastics in the F1 generation animals was determined
and comparisons were made to the F3 generation animals through
analysis of body weight and organ weights (Table S1A). Both
ovarian and uterine weights decreased in the F1 generation rats of
lower dose plastics lineage compared to control lineage. Only
uterine weights decreased in the F3 generation rats of plastics and
lower dose plastics lineage compared to control lineage. There
were no effects on body weight and weights of the testis, prostate,
seminal vesicle, epididymis and kidney of 1-year old male F1
generation rats. The seminal vesicle weights of the F3 generation
plastics and lower dose plastics lineage decreased compared to
control lineage. There was also a decline in epididymal weight in
lower dose plastics lineage (Table S1B). Hormone concentrations
were measured in the F3 generation control, plastics and lower
dose plastics lineages to assess any endocrine alteration in serum
sex steroid levels. Serum testosterone concentrations in the 1-year-
old F3 generation male rats from plastics or lower dose plastics
lineages did not differ from those of control lineage. Serum
estradiol concentrations in female rats during proestrus-estrus
phase or diestrus phase were also not altered in plastics and lower
dose plastics lineages compared to control lineage (Figure S2). No
statistical difference (p.0.05) was observed in litter size (average
12) or sex ratio (50:50) in the F1 or F3 generation control versus
plastics lineages. These combined observations suggest there is no
major endocrine or overt toxicity from the plastics or lower dose
plastics exposures at the doses administered.
One of the major disease/abnormality phenotypes observed in
the F1 and F3 generation males of plastics lineage was testicular
disease. There was a significant increase in the incidence of
transgenerational testis disease in the F3 generation males of lower
dose plastics lineage (Figure 1A). Testis histopathological abnor-
malities include the azoospermic and atretic seminiferous tubules,
the presence of vacuoles in basal regions of the seminiferous
tubules, the sloughed spermatogenic cells in the center of
seminiferous tubules and the lack of seminiferous tubule lumen
(Figures 1D, and 1E). Further analysis of testis abnormalities
determined the number of apoptotic spermatogenic cells within
the testis of male rats in plastics and lower dose plastic lineages.
Significantly higher spermatogenic cell apoptosis in males of the
F3 generation lower dose plastics lineage was observed (Figure S1).
Interestingly, reduced germ cell apoptosis was observed in males of
the F1 generation plastics and lower dose plastics lineages and of
the F3 generation plastics lineage. Therefore spermatogenic
defects that were previously observed in vinclozolin lineage F3
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 2 January 2013 | Volume 8 | Issue 1 | e55387
generation rats (2) were also present in the F3 generation rats from
the lower dose plastics lineage. The F1 generation males of lower
dose plastics lineage had increased incidence of prostate disease/
abnormalities. The prostate histopathological abnormalities in-
cluded hyperplastic or atretic ductular epithelium (Figure 1B).
Likewise, the F1 generation males of plastics and lower dose
plastics lineages showed an increased incidence of kidney disease.
The kidney histopathological abnormalities included Bowman’s
capsule abnormalities and proteinaceous fluid filled cysts
(Figure 2B). As previously reported [20] a significant increase in
pubertal abnormalities (comprising early or delayed onset of
puberty) was documented in the F1 generation male rats of the
lower dose plastics lineage compared to the control lineage
(Figure 3B). The incidences of pubertal abnormalities in the F1
generation males from plastics or lower dose plastics lineages were
43% and 51% respectively, with the majority of these having a
delayed pubertal onset. The incidence of pubertal abnormalities in
the F1 generation males of the control lineage was only 18% with
the majority of these animals having a delayed pubertal onset. No
changes were observed in the incidence of pubertal abnormalities
in the F3 generation males from plastics or lower dose plastics
lineages when compared to the control F3 generation lineage
males (Figure 3B). The F3 generation males from plastics lineage
did not show any significant change in transgenerational prostate
disease (Figure 1B) or kidney disease (Figure 2B). Tumor
development in the F1 and F3 generation males was also
investigated and no significant difference in tumor development
between the control and plastics lineages were observed
(Figure 3F). The predominant tumor observed were mammary
gland tumors, with some isolated tumors in the skin, spleen,
urinary bladder, cerebellum, lung and liver detected. Obesity was
assessed with an increase in body weight and dramatic increase in
abdominal adiposity, as shown in Figure 4D. No obesity was
detected in the male F1 generation control or plastic lineage
animals. Obese males were observed in the F3 generation and the
body weight of the non-obese (509632) and obese (555632) males
were statistically different (p,0.008). The abdominal adipose
tissue was present on most organs and dramatically increased in
the obese animals (Figure 4D) compared to the non-obese animals
(Figure 4C). The F3 generation males of lower dose plastics lineage
had a tendency to have an increased incidence of obesity
(p = 0.0697). Therefore, ancestral exposure to lower dose plastics
promoted transgenerational testis disease and obesity, but not
prostate or kidney disease, to their unexposed F3 generation male
descendants.
There were a greater number of transgenerational diseases in
the F3 generation female rats from plastics and lower dose plastics
lineages. These included pubertal abnormalities (Figure 3A), and
ovarian disease. Ovarian disease involved both primordial follicle
loss (Figure 3C), as shown by a severe reduction in the number of
primordial follicles per ovary section [20], and polycystic ovarian
disease (Figure 3D), as characterized by an increase in the number
of cysts. The increase in the proportion of the F3 females of
plastics and lower dose plastics lineages with ovarian disease was
dramatic. In the control lineage F1 and F3 generation females only
one out of 9 had primordial follicle loss. In contrast, the majority
of the F1 generation plastics lineage (78%, 7/9), all of the lower
dose plastics lineage F1 generation females (100%, 9/9), all of the
F3 generation plastics lineage (100%, 9/9), and majority of the
lower dose plastics lineage F3 generation females (78%, 7/9)
examined had a significant loss of primordial follicles with a
reduced ovarian follicular reserve (Figure 3C). This condition is
associated with potential future development of primary ovarian
insufficiency. In the control lineage none of the females in either
the F1 or F3 generations examined developed polycystic ovaries.
In contrast, the majority of the F1 generation plastics lineage
(56%, 5/9), all of the lower dose plastics lineage F1 generation
females (100%, 9/9), and all of the plastics and lower dose plastics
lineage F3 generation females (100%, 9/9) examined had a
significant increase in number of cysts within the ovary (Figure 3D).
Polycystic ovarian disease is the most common ovarian disease in
women of reproductive age. Therefore, the observations demon-
strate epigenetic transgenerational inheritance of ovarian disease
following ancestral exposure to the plastic compounds.
The incidences of pubertal abnormalities in the F1 generation
females of plastics and lower dose plastics lineages were 67% and
30% respectively with the majority of these animals having
delayed pubertal onset (Figure 3A). The incidences of pubertal
abnormalities in the F3 generation females of plastics and lower
dose lineages were 29% and 23% respectively with the majority of
these animals having an early onset of puberty. The F1 and F3
generation females from plastics or lower dose plastics lineages did
not have an increased incidence of adult onset kidney disease
(Figure 2A) or tumor development (Figure 4A). The tumors
observed were primarily mammary gland tumors, with skin and
small intestine isolated tumors also indicated. The lower dose
plastics lineage F3 generation females did have a significant
increase in obesity (Figure 4C). The obesity phenotype involved an
increase in female body weight (332610 obese and 283648 non-
obese) and significant increase in abdominal fat deposition and
adiposity of most organs, Figure 4D. These combined observations
indicate ancestral exposure to plastics and low dose plastics
promotes transgenerational inheritance of pubertal abnormalities,
ovarian disease and obesity in the F3 generation female
descendants.
Other less frequent diseases were observed in the plastics and
low dose plastics lineages. These included constipation, swollen
intestinal lymph nodes, small seminal vesicles, sinus histiocytosis
and stomach abnormalities in the F1 generation animals of the
plastic lineage. Small seminal vesicles may be a developmental
defect. Histiocytosis and swelling of intestinal lymph nodes and
stomach abnormality are related to inflammatory processes. Low
frequency diseases in the F3 generation animals of plastic lineage
included blindness, cataract of the eye, focal fat necrosis,
histiocytosis, interstitial pneumonia, liver degeneration, sinusitis,
seizures and tremors. The F3 generation animals from the lower
dose plastics lineage also developed unique low frequency
diseases/abnormalities including liver disease (cirrhosis), swollen
epididymis and vulvar abscess. Focal fat necrosis is usually a sign of
inflammation due to contusions or constant sitting. Lack of activity
from constant sitting may predispose the rat to obesity as well.
Histiocytosis, pneumonia, sinusitis, swollen epididymis and vulvar
abscess indicate inflammatory abnormalities. Seizures and tremors
indicate neural dysfunction. Liver degeneration and cataract may
indicate premature aging. Blindness may be due to retinopathy or
abnormal blood vessel growth in the eye. These various diseases
were infrequent but more predominant in animals of the plastics
and low dose plastics lineages.
The incidence of disease/abnormality in individual rats in
control, plastics and low dose plastics lineages is presented in
Tables S2A (F1 generation females), Table S2B (F1 generation
males), Table S3A (F3 generation females) and Table S3B (F3
generation males). These tables list the occurrence of diseases for
each rat and clarify the number of animals for each specific
disease/abnormality assessment. The incidence of total disease/
abnormality increased significantly in the F3 generation females of
both plastics and lower dose plastics lineages (Figure 5A). The
incidence of total disease/abnormality increased in the F1
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 3 January 2013 | Volume 8 | Issue 1 | e55387
generation females of plastics lineage only (Figure 5A). The
incidence of multiple disease/abnormalities increased significantly
in the F1 and F3 generation females of plastics and lower dose
plastics lineages (Figure 5C). The incidence of total disease/
abnormality increased significantly in the F3 generation males of
plastics and lower dose plastic lineages (Figure 5B). The F1
generation males of plastics lineage, but not lower dose plastics
lineage, showed a significant increase in the incidence of total
disease/abnormalities (Figure 5B) and in the incidence of multiple
disease/abnormalities. Ancestral exposure to plastics and lower
dose plastics increased the overall incidence of transgenerational
adult onset diseases in both females and males.
Transgenerational Effects on the Sperm Epigenome Environmentally induced epigenetic transgenerational inheri-
tance of adult onset disease involves an altered germline
epigenome transmission between generations. The transgenera-
tional F3 generation control and plastics lineage sperm epigen-
omes were previously analyzed [20] and compared using a methyl
cytosine antibody chromatin immunoprecipitation (MeDIP) fol-
lowed by a genome-wide promoter tiling array chip (MeDIP-Chip)
Figure 1. Adult-onset testis disease and prostate disease in males from control, plastics and lower dose (LD) plastics (BPA, DEHP and DBP) lineages. Percentages of males with testis (panel A) or prostate disease (panel B) in F1 and F3 generations are presented. The actual number of diseased rats/total number of rats in each group are shown above the respective bar graphs (* P,0.05; *** P,0.001). Representative micrographs (Scale bar = 200 mm) showing histopathology images of adult-onset transgenerational testis and prostate disease in plastics (panels D, and G) and lower dose (LD) plastics lineages (panels E and H) compared to F3 control lineage (panels C and F). Testis sections from F3 generation animals in plastics and lower dose (LD) plastics lineages showed histopathology including azoospermic and atretic seminiferous tubules, presence of vacuoles in basal regions of seminiferous tubules, sloughed cells in center of seminiferous tubule and lack of seminiferous tubule lumen (arrows). Prostate sections showed epithelial atrophy and hyperplastic ductular epithelium (arrows). doi:10.1371/journal.pone.0055387.g001
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 4 January 2013 | Volume 8 | Issue 1 | e55387
assay [4]. The sperm DNA samples from rats of the F3 generation
control and plastics lineages were analyzed and previously
reported [20]. Three different experimental pools of F3 generation
control and plastics lineage MeDIP were generated and each pool
contained sperm DNA from three different animals each from a
different litter. A comparative hybridization with the MeDIP-Chip
assay was performed as described in the Methods to identify
differential DNA methylation regions between the control and
plastics lineage sperm pools. This analysis identified statistically
significant differential DNA methylation regions (DMR) in 197
different promoters [20] with an average 500 bp in size, Table S4.
The DMR previously identified [20] were more thoroughly
analyzed in the current study. The gene network described below
identified a highly interconnected DMR associated gene that was
selected for confirmation with an MeDIP-quantitative (Q) PCR
analysis. This DMR associated gene was Gdnf and had a 38.1 fold
increase (p,0.05) in the plastic lineage MeDIP compared to
control using the MeDIP-QPCR analysis. Therefore, the MeDIP-
QPCR analysis for this gene confirmed the previously reported
MeDIP-Chip analysis [20] for this DMR in postnatal 120 day old
males. Future studies are needed to assess the DMR in 1 year old
animals. The chromosomal locations of all the differentially
methylated regions (DMR) are presented in Figure 6. The sperm
DMR (termed epimutations) were present throughout the genome
Figure 2. Adult-onset kidney disease in males or females from control, plastics and lower dose (LD) plastics (BPA, DEHP and DBP) lineages. Percentages of females (panel A) and males (panel B) with kidney disease in F1 and F3 generations are presented. The actual number of diseased rats/total number of rats in each group are shown above the respective bar graphs (** P,0.01; *** P,0.001). Representative micrographs (Scale bar = 200 mm) showing histopathology images of adult-onset transgenerational kidney disease in F3 generation plastics (panels D and G) and lower dose (LD) plastics lineages (panels E and H) compared to F3 control lineage (panels C and F). Kidney sections showed Bowman’s capsule abnormality and proteinaceous fluid filled cysts (arrows). doi:10.1371/journal.pone.0055387.g002
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 5 January 2013 | Volume 8 | Issue 1 | e55387
Figure 3. Pubertal abnormalities, primordial follicle loss, polycystic ovary disease and tumor development from control, plastics, or lower dose (LD) plastics (BPA, DEHP and DBP) lineages. Percentages of females (panel A) and males (panel B) with pubertal abnormalities, or those females with primordial follicle loss (panel C) or polycystic ovary disease (panel D), and tumor development in females (panel E) and males (panel F) in F1 and F3 generations are presented. The actual number of diseased rats/total number of rats in each group are shown above the respective bar graphs (* P,0.05; ** P,0.01; *** P,0.001). doi:10.1371/journal.pone.0055387.g003
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 6 January 2013 | Volume 8 | Issue 1 | e55387
on all chromosomes examined. The functional gene categories of
the genes associated with the DMR are shown in Figure 7 and
Table S4. Therefore, the exposure to a plastic compound mixture
induced a transgenerational sperm epigenome alteration. Analysis
of the genes associated with the 197 DMR for potential correlated
cellular pathways and processes did not identify pathways with a
predominance of DMR associated genes, Table S5. A further
analysis was performed to identify a potential direct connection
(functional and/or binding connections) gene network associated
with the DMR, Figure 8. The network contained a number of
extracellular, membrane, cytoplasmic and nuclear localized genes
associated with the DMR identified. The glial derived neuro-
trophic factor (Gdnf) and neurotrophin 3 (Ntf3) cellular signaling
pathways and processes appear to be involved in the gene network
identified. Therefore, plastics derived compounds induced a
transgenerational alteration in the sperm epigenome and the
Figure 4. Obesity developed in control, plastics, or lower dose (LD) plastics (BPA, DEHP and DBP) lineages. Percentages of females (panel A) and males (panel B) with obesity in F1 and F3 generations are presented. The actual number of diseased rats/total number of rats in each group are shown above the respective bar graphs (* P,0.05). Abdominal fat deposition in F3 generation 1yr old rats from non-obese (C) and obese (D) animals. Pink colored fat deposition over most organs noted in panel B (arrows). doi:10.1371/journal.pone.0055387.g004
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 7 January 2013 | Volume 8 | Issue 1 | e55387
DMR epimutations potentially influence a gene network of specific
cellular pathways.
A final analysis of the genes associated with the DMR previously
identified [20] examined genes previously shown to be correlated
to the pathologies observed. A number (five) of the DMR
associated genes correlated to known obesity related genes as
shown in Figure 9. Other DMR associated genes (six) had indirect
connections through the five direct connection genes Tnfrsf12a,
Esrra, Fgf19, Wnt10b and Gdnf. No genes were found associated
with ovarian or testis diseases with direct connections. Interest-
ingly, the Gdnf was also observed in the gene network identified,
Figure 8. Therefore, previously identified genes that appear to be
involved in obesity correlated to a number of the genes associated
with the DMR epimutations.
Discussion
The current study was designed to investigate the actions of a
plastic compound mixture to promote epigenetic transgenerational
inheritance of adult onset disease. Gestating female rats, desig-
nated F0 generation, were exposed to a plastics or lower dose (one-
half dose) plastics mixture (BPA, DEHP and DBP) or DMSO
vehicle control daily during embryonic days 8–14 of development.
The F1 generation progeny were bred to produce the F2
generation, which were bred to obtain the F3 generation. Only
the F0 generation females and not the F1, F2 and F3 generation
individuals were treated. The F1 and F3 generation animals were
aged to one year and then euthanized. Tissues were collected,
fixed, sectioned and stained for histopathological examination.
Tissues examined included testis, prostate, kidney and ovary.
Previously, epididymal sperm were collected from P120 day old
males, DNA isolated, and transgenerational F3 generation sperm
epigenomes (DNA methylation) were examined with an MeDIP-
Chip analysis [20]. The current study more thoroughly investi-
gated these epimutations. The chromosomal locations, a gene
network and associated gene functions of the differential methyl-
ation regions (DMR) associated genes were identified.
The actions of plastic derived endocrine disruptor compounds
have been documented in previous studies primarily using direct
exposure studies. The documented actions of bisphenol A (BPA)
include altered pubertal onset [33,34], disruption of estrous cycles
[35,36], prostate disease [37,38,39], prostate neoplasia [37,40],
abnormal mammary gland development and presence of intra-
ductal hyperplasia and preneoplastic lesions in adults
Figure 5. Adult-onset disease/abnormalities in rats from control, plastics, or lower dose (LD) plastics (BPA, DEHP and DBP) lineages. Incidences of total female disease (panel A), total male disease (panel B), female multiple disease (panel C) and male multiple disease (panel D) in F1 and F3 generations are presented. The actual number of diseased rats/total number of rats in each group are shown above the respective bar graphs (* P,0.05; ** P,0.01; *** P,0.001). doi:10.1371/journal.pone.0055387.g005
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 8 January 2013 | Volume 8 | Issue 1 | e55387
[41,42,43,44], alterations in the uterus (cystic endometrial
hyperplasia) and ovary (cystic ovaries) abnormalities [41,45].
BPA induced brain and behavioral changes include abnormal
development of sexually dimorphic hypothalamic regions
[46,47,48,49], abnormal steroid receptor levels [50,51,52], aber-
rant behavior including hyperactivity [53,54], heightened aggres-
siveness [55], distorted sociosexual behavior [56], changed
cognitive and anxiolytic behaviors [57], and enhanced suscepti-
Figure 6. Gene network analysis for differential DNA methylation regions (DMR) associated genes in the F3 generation plastics lineage sperm. Chromosomal locations for transgenerational DMR detected with MeDIP-Chip are indicated with arrowheads. The chromosomal size and number are presented. There were 197 DMR in sperm DNA from F3 generation plastics lineage compared to control lineage. doi:10.1371/journal.pone.0055387.g006
Figure 7. The F3 generation plastics lineage sperm DMR associated gene functional categories. The number of DMR associated genes correlating to a specific gene functional category is presented including those with unknown function and expressed sequence tags (EST). doi:10.1371/journal.pone.0055387.g007
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 9 January 2013 | Volume 8 | Issue 1 | e55387
bility of addiction [54,58]. BPA alters body weight and body
composition [10,33,35,59,60,61] and abnormal glucose homeo-
stasis [62]. Therefore, early life BPA direct exposure promotes a
variety of adult onset disease states.
Phthalates DEHP and DBP are known reproductive and
developmental toxicants [14,15,63]. Toxicity of these phthalate
esters on male reproductive function include testicular seminifer-
ous tubule atrophy and germ cell degeneration [64,65,66,67], and
Figure 8. Gene network analysis for differential DNA methylation regions (DMR) associated genes in the F3 generation plastics lineage sperm. Direct connection (functional or binding) genes are shown according to their location in the cell. Genes not shown are not connected. Node shapes code: oval and circle – protein; diamond – ligand; circle/oval on tripod platform – transcription factor; ice cream cone – receptor. Arrows with plus sign show positive regulation/activation, arrows with minus sign – negative regulation/inhibition; gray arrows represent regulation, lilac – expression, purple – binding, green – promoter binding, and yellow – protein modification. doi:10.1371/journal.pone.0055387.g008
Figure 9. Genes with known links with obesity that correlate with F3 generation plastic lineage sperm DMR associated genes. The correlated DMR associated genes with associations with obesity are presented. The DMR associated genes with indirect connections to the direct connection genes are also presented. doi:10.1371/journal.pone.0055387.g009
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 10 January 2013 | Volume 8 | Issue 1 | e55387
male reproductive tract abnormalities consistent with androgen
dependent development and impaired testicular function
[68,69,70,71,72,73]. The phenotypic alterations included cryp-
torchidsm, hypospadias, agenesis of sex accessory organs, testicular
injury, reduced daily sperm production, delayed preputial
separation, permanent retention of nipples and decreased (femi-
nized) anogenital distance. Fetal exposure effects of DEHP and
DBP include reduction in testosterone secretion [74,75] and
increase in the diameter of seminiferous cords and induction of
gonocyte multinucleation in rat fetal testis [76]. The female
reproductive effects of phthalates include prolonged estrous cycles,
reduced serum estradiol levels and absence of ovulation in adult
rats [77]. Decrease in fertility [78,79], disruption of pregnancy
[27], abortions, fetal teratogenic abnormalities, skeletal and
visceral malformations, delay in the age of pubertal onset
[80,81] and altered number of ovarian follicles [81] are other
observed direct exposure effects of phthalates in females.
The current study was designed to examine the actions of
pharmacological doses of the plastic compound mixture on
epigenetic transgenerational inheritance of adult onset disease.
The in vivo doses used in previous studies that did not promote
overt toxicity (litter size, sex ratio or weight changes) were selected
[11,21,22,23,24,25,26,27,28,29,30]. The doses used were based on
a ,1% fraction of the oral LD50 dose for bisphenol-A (1%,
50 mg/kg/day), DEHP (0.025%, 750 mg/kg/day) and DBP
(0.8%, 66 mg/kg/day) [11,21,22,23,24,25,26,27,28,29,30]. A
lower dose of half this was also used, which should not be
considered ‘‘low dose’’ as previously described [12], but simply a
lower dose. The human exposure is estimated for BPA is 1 mg/kg/ day, for DEHP is 52 mg/kg/day, and for DBP is approximately 5 mg/kg/day. Although no overt toxicity was observed in the F1 generation animals, the mode of administration and dose used are
higher than anticipated environmental exposures so does not allow
risk assessment of these compounds from the current study.
However, the potential that these chemicals can have biphasic
dose curves with lower doses having greater effects needs to be
considered and impacts this dose discussion. The objective of the
study was to investigate if exposure to the plastics mixture could
potentially promote epigenetic transgenerational inheritance of a
disease phenotype and not to assess risk of the exposure to these
compounds. Future studies with more appropriate mode of
administration and dose curves will be required for risk
assessment. Observations from the current study will now allow
more effective risk assessment studies to be designed.
Transgenerational disease phenotypes are unique in the sense
that they are not caused by direct exposure to the environmental
chemical. As discussed above, effects of these compounds are
primarily assessed in direct exposure studies. When the exposure
occurs to a gestating female during the critical period of gonad sex
determination, not only the F0 generation female, but also the
developing fetus and the fetal germ cells are directly exposed.
Therefore, any pathology observed in F0, F1 (via fetal exposure)
and F2 (via fetal germ cell exposure) can be caused by the direct
exposure. Therefore, the F3 generation animals derived from the
exposed F0 generation female are the first generation to clearly
demonstrate epigenetic transgenerational inheritance of disease
phenotypes [31]. In the current study we examined the pathology
in F1 generation animals to observe any direct epigenetic effects
on somatic tissues and in the F3 generation animals to observe
germline mediated epigenetic transgenerational effects. Although
similarities in phenotype can occur, the distinct mechanisms
involved suggest differences in phenotype are anticipated.
The primary transgenerational disease/abnormality phenotypes
observed include testis disease, ovary disease, obesity and pubertal
abnormalities. The testicular disease incidence was significantly
higher in the F3 generation in the lower dose plastics lineage males
at one year of age. The spermatogenic cell apoptosis was also
significantly increased in these males which further supports the
development of testis disease. In recent years there is a trend of a
gradual decline in sperm concentration in most human popula-
tions [82] and human male infertility is approaching 10% [83].
The etiology of testicular disease and rise in infertility are
suspected to be at least in part due to exposure to environmental
chemicals, including endocrine disruptor toxicants [84]. The
potential role of epigenetic transgenerational inheritance of male
infertility needs to be considered [1]. The testicular disease
observed in the F3 generation lower dose plastics lineage males
provides support for a role of environmental epigenetics and
ancestral exposures in male infertility.
Ovarian disease in the form of primordial follicle loss and
polycystic ovarian disease was significantly increased in F3
generation plastics and lower dose plastics lineage females at one
year of age. Currently the world’s population of women are facing
increased ovarian diseases of primary ovarian insufficiency
characterized by primordial follicle loss, and polycystic ovarian
disease characterized by the presence of anovulatory cystic
structures [85,86]. Polycystic ovarian disease is now one of the
most common reproductive diseases in the human female
population [87]. Similar to the testicular disease/abnormality,
the ovary disease phenotypes in the current study may also be the
outcome of epigenetic transgenerational inheritance following
ancestral environmental exposures. It is important to note that the
ovarian disease observed had an increased frequency both in the
directly exposed offspring (F1) and transgenerationally (F3). All
females examined in the F3 generation plastics and lower dose
plastics lineages had polycystic ovarian disease. In a previous
study, observations demonstrated a significant transgenerational
alteration in both the transcriptome and the epigenome of the
ovarian granulosa cells from rats of the F3 generation vinclozolin
lineage [88]. Epigenetic mechanisms have been suggested to
underlie the development of polycystic ovary syndrome pheno-
types in women [89] and prenatally androgenized rhesus monkeys
[90]. In addition to considering the effects of direct exposure, the
current study suggests epigenetic mechanisms allow the transmis-
sion of the disease to future generation offspring following
ancestral exposure to abnormal environmental toxicants. There-
fore, ancestral exposure to plastics may contribute to the
development of these ovarian diseases. Observations suggest an
additional paradigm be considered for the etiology of primary
ovarian insufficiency and polycystic ovarian disease in women.
Pubertal abnormalities were significantly increased in the
females of the F3 generation plastics and lower dose plastics
lineages. Puberty is a milestone in developmental physiology and
the axis of hypothalamus-pituitary-gonad shows progressive
changes during fetal development and matures in adolescence
[91]. In rats there are clear external genital changes that indicate
pubertal onset (vaginal opening and balano-preputial separation)
[92]. Puberty checks were performed from postnatal day 30 in
females and day 35 in males in this study. In an earlier report [20]
it was shown that the F3 generation plastics and lower dose plastics
lineage females had a significant alteration of the pubertal onset
(number of days to pubertal onset) compared to control females.
The current study assessed the pubertal abnormalities incidence
using a puberty cutoff of mean of controls 6 2 standard deviations.
Observations demonstrate F1 generation females and males of
plastics and lower dose plastics lineages had increased incidence of
delayed pubertal onset. The F3 generation females of plastics and
lower dose plastics lineages had increased proportion of early onset
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 11 January 2013 | Volume 8 | Issue 1 | e55387
of puberty, while males of plastics and lower dose plastics lineages
had an increased incidence of delayed onset of puberty. The F1
generation phenotypes are due to direct somatic tissue actions,
while the F3 generation is due to germ line mediated transgenera-
tion mechanisms. Pubertal abnormalities, have increased over the
past several decades in human populations [91]. The early versus
delayed onset of puberty has influences on different adult onset
clinical conditions. Early onset of puberty leads to accelerated
bone mineralization and short adult height in girls and predisposes
them to breast cancers. Delayed onset of puberty leads to
decreased bone mineralization, psychological stress and metabolic
disease [93]. Previous studies have suggested early onset of puberty
in girls is suspected to be caused by environmental exposure to an
endocrine disruptor [94]. Early onset of puberty in girls disrupts
health by affecting brain development, endocrine organ systems
and growth, leading to later increase in susceptibility to disease.
Observations of the current study suggest abnormal pubertal onset
(an early developmental milestone) is associated with epigenetic
transgenerational adult onset ovary disease, primordial follicle loss
and polycystic ovaries in the F3 generation females of both plastics
and lower dose plastics lineages.
Obesity was significantly increased in the F3 generation females
and there was a tendency to be increased in the F3 generation
males of the lower dose plastics lineage. Interestingly, the obesity
was not observed in the direct exposure F1 generation, but only in
the F3 generation suggesting a transgenerational mechanism is
involved. Bisphenol-A and phthalates are suspected obesogens
[95] and direct exposures have been shown to promote obesity
[96]. Obesity is associated with other diseases and clinical
conditions including cardiovascular disease, type 2 diabetes, and
a diminished average life expectancy [97]. Obesity is a component
of a complex disease condition termed metabolic disease syndrome
[98]. Obese women have a higher prevalence of amenorrhea and
infertility. A major associated disease with obesity is polycystic
ovarian disease. The majority of the females with obesity have
polycystic ovarian disease [99,100]. Interestingly, the current study
demonstrated the F3 generation plastic lineage females developed
both obesity and polycystic ovarian disease. Therefore, the ability
of a BPA and phthalates mixture to promote the transgenerational
inheritance of obesity and polycystic ovarian disease supports an
association of these diseases. Maternal obesity can have a negative
effect on children’s health [101]. Experimental studies in rats
indicate that obese dams are responsible for the appearance of
obesity in the subsequent generation [102]. Waterland et al.,
(2008) [103] suggested that epigenetic mechanisms are involved in
this generational transmission of maternal obesity. The current
study extends this concept that epigenetic transgenerational
inheritance in the absence of any direct exposure may promote
obesity. Therefore, ancestral exposure to environmental plastic
compounds such as BPA and phthalates may influence adult-onset
obesity. Future studies will need to evaluate the adult status of
obesity associated conditions such as adiposity, bone mineraliza-
tion, adult height and metabolic disease in the F3 generation
plastics and lower dose plastics lineages. Observations suggest the
different disease phenotypes observed (testis disease, ovary disease,
pubertal abnormality and obesity) may be linked in a complex
disease syndrome that involves an epigenetic transgenerational
inheritance etiology.
The molecular mechanism involved in epigenetic transgenera-
tional inheritance of adult-onset disease phenotypes involves
reprogramming of the germline (sperm) epigenome during sex
determination [1,5]. The modified sperm epigenome (DNA
methylation) appears to become permanently reprogrammed in
an imprinted-like manner and is protected from DNA de-
methylation and reprogramming after fertilization. This allows
transgenerational transmission of the modified sperm epigenome
and subsequent modification of somatic cell and tissue epigenomes
and transcriptomes [104]. All tissues and cells will have a
transgenerational transcriptome [105] and those tissues sensitive
to this modified transcriptome will develop disease. Therefore, the
current study further examined the altered sperm epigenome and
epimutations induced by the plastic compound mixture previously
identified [20].
A transgenerational alteration in sperm DNA methylation has
been shown to be induced by vinclozolin [2,4]. A transgenera-
tional change in the fetal testis transcriptome has also shown to be
induced by vinclozolin [106]. More recently, all tissues examined
in the F3 generation vinclozolin lineage had a tissue specific
transgenerational transcriptome [105]. A previous study used F3
generation rat sperm from plastics and control lineages were used
for genome wide promoter DNA methylation analysis using an
MeDIP-Chip protocol [20]. Differential DNA methylated regions
(DMR) defined as epimutations and epigenetic biomarkers were
identified for the plastics lineage F3 generation sperm in
comparison with control lineage F3 generation sperm [20]. The
current study more thoroughly examined these DMR that are
presented in Table S4. A DMR was selected and used in a
MeDIP-QPCR analysis to confirm the MeDIP-Chip analysis
previously reported [20]. The Gdnf gene associated DMR selected
had a change that confirmed the MeDIP-Chip analysis when the
sperm from 120 day old males was investigated. Future analysis
will require analysis of age affects and more genome-wide analysis.
The DMR chromosomal locations were identified and the gene
functional categories for the 197 genes associated with the DMR.
A gene network analysis identified a direct connection network
between the genes associated with the DMR (Figure 8). These
interconnected genes have previously been shown to have direct
functional and/or binding associations. Several cellular signaling
pathways and processes were identified within the gene network
that will be of interest for future investigations. Therefore, the
epigenetic analysis confirmed the development of epimutations in
the sperm and a role in epigenetic transgenerational inheritance of
the disease phenotypes observed.
The altered sperm epigenome will generate altered epigenomes
in all the cells generated from the sperm which will be distinct
between cell types [104,105]. The cascade of epigenetic and
genetic (transcriptome) changes involved in generating an adult
cell type will likely have negligible correlations with the specific
original sperm epigenome and associated genes. However, the
sperm DMR associated gene regulation may influence develop-
mental events promoting the adult onset disease. The correlation
of the DMR associated genes with genes previously shown to be
linked to one of the major transgenerational disease phenotypes
observed was accomplished. The DMR list had 5 genes previously
shown to be associated with the onset of obesity (Figure 9). These
included Tnfrsf12a [107], Esrra [108], Fgf19 [109], Wnt10b [110],
and Gdnf [111]. Therefore, a number of the epimutation associated
genes identified in the F3 generation plastic lineage sperm were
found to be linked to the adult onset of obesity. Two DMR
associated genes found in both the gene network analysis and
obesity associated gene list were Gdnf and Esrra. Future studies on
the various cell types associated with the disease/abnormality
phenotypes will be required to determine potential correlations
with the sperm DMR identified.
Epigenetic transgenerational inheritance of disease has been
shown to be promoted by several environmental compounds
[20,112]. Vinclozolin exposure resulted in F3 generation testis
disease, prostate disease, kidney disease, immune system abnor-
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 12 January 2013 | Volume 8 | Issue 1 | e55387
malities, tumors, uterine hemorrhage during pregnancy and
polycystic ovary disease [2,3,20,32,113]. Alterations in methyla-
tion patterns of sperm of F3 generation rats and mice have been
reported following exposure of F0 generation females to
vinclozolin [2,3,4,114]. Exposure of F0 generation gestating rats
to bisphenol-A caused decreased fertility in F3 generation males
[19]. Transgenerational decline in fertility in F3 generation mice
was also documented following exposure to dioxin of gestating F0
generation females [20,112,115]. Other environmental factors
such as nutrition [103] also can promote epigenetic transgenera-
tional inheritance of disease phenotypes. Demonstration of
epigenetic transgenerational inheritance in worms [116], flies
[117], plants [118] and mammals [119,120,121] suggest this
phenomena will likely be critical in biology and disease etiology
[1]. Combined observations demonstrate exposure of gestating
females during the critical development period of gonadal sex
determination to a plastics endocrine disruptor mixture consisting
of bisphenol-A, DEHP and DBP promotes epigenetic transgenera-
tional inheritance of adult-onset disease including testis disease,
ovarian disease, pubertal abnormalities and obesity. All these
disease phenotypes have an impact on fertility and reproduction.
The overall increase in total disease and multiple diseases in F3
generation plastics and lower dose plastics lineages is considerable.
Associated with the occurrence of these transgenerational diseases
are the epigenetic changes in rat sperm DNA. These epimutations
may be useful as early stage biomarkers of compound exposure
and adult onset disease. Although not designed for risk assessment,
these findings have implications for the human population that is
exposed to these compounds and is experiencing significant
decline in fertility and incidence of adult onset disease.
Materials and Methods
Animal Studies All experimental protocols for the procedures with rats were
approved by the Washington State University Animal Care and
Use Committee (IACUC) (approval # 02568-026). Washington State University Department of Environmental Health and Safety
approved the protocols for the use of environmental chemicals.
Female and male rats of an outbred strain Sprague Dawley SD
(Harlan) of about 70 and 100 days of age were maintained in
ventilated isolator cages containing Aspen Sani-chips. Rats were
fed ad libitum with a standard rat diet and ad libitum tap water for
drinking. During the injection, vaginal smear collection, weaning
and puberty checking procedures rats were held in an animal
transfer station. To obtain time-pregnant females the female rats
in proestrus were pair-mated with male rats. The sperm-positive
(day 0) rats were considered pregnant and monitored for diestrus
and body weight. On embryonic day 8 (E8) through E14 of
gestation [113], the gestating females were administered daily
intraperitoneal injections of the plastic compound mixture (BPA
50 mg/kg BW/day, DEHP 750 mg/kg BW/day and DBP
66 mg/kg/BW/day) or dimethyl sulfoxide (DMSO) (vehicle) with
an equal volume of sesame oil (Sigma) to prevent irritation at the
injection site. The gestating females rats treated with vehicle or
plastic compound mixture were designated as the F0 generation.
When selected litters from the plastics lineage F1 generation litter
size and sex ratio were reduced, another treatment lineage with
exactly half of the original dose for each compound was generated
and it was designated ‘‘lower dose plastics.’’ These treatment
lineages are designated ‘‘control’’, ‘‘plastics’’ (bisphenol-A, DEHP
and DBP mixture) or ‘‘lower dose plastics’’ lineages throughout the
manuscript. The number of animals used for each generation and
exposure lineage are outlined in Tables S2 and S3. For female F1
generation total were control (20 animals), plastics (17 animals),
lower dose plastics (35 animals), and for male F1 generation the
total were control (22 animals), plastics (14 animals), lower dose
plastics (46 animals), and for female F3 generation totals were
control (69 animals), plastics (43 animals), lower dose plastics (52
animals), and for male F3 generation totals were control (56
animals), plastics (40 animals), and lower dose plastics (58 animals).
The animals per litter (litter representation) mean 6 SEM for each
specific disease/abnormality assessment between the control and
plastic or lower dose plastic lineages was not found to be
statistically different (p.0.05), so no litter bias was identified.
Breeding The offspring of the F0 generation rats were the F1 generation.
Non-littermate females and males aged 70–90 days from F1
generation control or plastics or low dose plastics lineages were
bred to obtain F2 generation offspring. The F2 generation rats were
bred to obtain F3 generation offspring. No sibling or cousin breeding
was used to avoid any inbreeding artifacts. Suckling rats were
weaned from their mothers at 21 days of age. It is important to note
that only the F0 generation gestating female was exposed directly to
the control vehicle or plastics or low dose plastics treatment, and the
F1–F3 generations were not subjected to any treatment.
Tissue Harvest and Histology Processing One-year old rats were euthanized by CO2 inhalation for tissue
harvest. Body and organ weights were measured at dissection time.
Testis, epididymis, prostate, seminal vesicle, ovaries, uterus and
kidney were collected and fixed in Bouin’s solution (Sigma) and
70% ethanol, then processed for paraffin embedding by standard
procedures for histopathology examination. Five-micrometer
tissue sections were made and were either unstained and used
for TUNEL analysis or stained with H & E stain and examined for
histopathology. Blood samples were collected at the time of
dissection, allowed to clot, centrifuged and serum samples stored at
220uC for steroid hormone assays.
Testicular Apoptotic Cell Analysis Testis sections were examined by a terminal deoxynucleotidyl
transferase-mediated dUTP nick end labeling (TUNEL) assay (In
situ cell death detection kit, Fluorescein, Roche Diagnostics,
Mannheim, Germany) as per the manufacturer’s protocols. Sections
were deparaffinized and rehydrated. They were deproteinized by
Proteinase K (20 mg/ml; Invitrogen, Carlsbad, CA) and then
washed with PBS and then 25 ml of the enzyme-label solution mix was applied on the testis sections and incubated at 37uC for 90 min. After PBS washes slides were mounted and kept at 4uC until examination in a fluorescent microscope in dark field. Both testis
sections of each slide were microscopically examined to identify and
to count apoptotic germ cells by their bright fluorescence.
Histopathology Examination and Disease/Abnormality Classification
Three different observers examined each unmarked tissue slide
and identical criteria were applied to identify diseased tissue. A
cut-off was established to declare a tissue ‘diseased’ based on the
mean number of histopathological abnormalities plus two
standard deviations from the mean number of abnormalities in
control tissues by each of the three individual observers. This
number was used to classify rats into those with and without
disease in testis, prostate or kidney in each lineage. A rat tissue
section was declared ‘diseased’ only when at least two of the three
observers marked the same tissue section as such. Necropsy and
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 13 January 2013 | Volume 8 | Issue 1 | e55387
histopathology examinations on rats that died prior to 1 year of
age and also pathology analysis of tissues sent with unknown or
suspected diseases were performed by the WSU Washington
Disease Diagnostic Laboratory and these results were also
included in the study. The proportion of rats with obesity or
tumor development was obtained by counting those that had these
conditions out of all the animals evaluated.
A marked central portion of each prostate, kidney and testis
section was microscopically examined under 200x magnification.
An additional peripheral portion of each testis section was also
examined. Testis histopathology criteria included the presence of a
vacuole, azoospermic atretic seminiferous tubule and ‘other’
abnormalities including sloughed spermatogenic cells in center of
the tubule and a lack of a tubule lumen. Prostate histopathology
criteria included the presence of vacuoles, atrophic epithelial layer
of ducts and hyperplasia of prostatic duct epithelium. Kidney
histopathology criteria included reduced size of glomerulus,
thickened Bowman’s capsule and the presence of proteinaceous
fluid-filled cysts.
Ovary sections were stained with hematoxylin and eosin and
three stained sections (150 mm apart) through the central portion of the ovary with several of the largest cross sections evaluated.
Ovary sections were assessed for two diseases, primordial follicle
loss and polycystic ovary disease. Primordial follicle loss was
determined by microscopically counting the number of primordial
follicles per ovary section. Primordial follicle loss was considered
present in the ovary when the primordial follicle number was less
than the control mean minus two standard deviations. Polycystic
ovaries were determined by microscopically counting the number
of small cystic structures. The mean number of primordial follicles
and small cysts was calculated from three sections. Polycystic ovary
disease was considered present when the number of cysts per
section was more than the control mean plus two standard
deviations. Follicles had to be non-atretic and showing an oocyte
nucleus in order to be counted. Primordial follicles had an oocyte
surrounded by a single layer of either squamous or both squamous
and cuboidal granulosa cells [122,123]. Cysts were defined as
fluid-filled structures of a specified size that were not filled with red
blood cells, had no oocyte and negligible granulosa cells. A single
layer of cells may line cysts. Small cysts were 50 to 250 mm in diameter measured from the inner cellular boundary across the
longest axis. Percentages of females with primordial follicle loss or
polycystic ovarian disease were computed.
Onset of puberty was assessed in females by daily examination
for vaginal opening from 30 days of age and in males by balano-
preputial separation from 35 days of age. For identifying a rat with
a pubertal abnormality (either an early or delayed onset of
puberty) a mean from all the rats from the control lineage
evaluated for pubertal onset was computed and its standard
deviation calculated. A range of normal pubertal onset was chosen
based on mean 6 2 standard deviations. Any rat with a pubertal
onset below this range was considered to have had an early
pubertal onset and any rat with a pubertal onset above this range
was considered to have had a delayed pubertal onset and the
proportion of rats with pubertal abnormality was computed from
the total number of rats evaluated for puberty onset.
Obesity was assessed with an analysis of body weight and gross
evaluation of abdominal adiposity. The increased fat deposition in
an obese animal required presence on most organs (Figure 4D)
compared to an absence in non-obese animals. The designation of
obesity required the increased body weight and increased abdom-
inal adiposity to be designated obese. Subsequently the correlation
to the presence of polycystic ovarian disease was made.
A table of the incidence of individual diseases/abnormalities in
rats from each group was created and the proportions of individual
disease, Tables S2 and S3, total disease and multiple disease
incidences were computed from this table. For the individual
disease/abnormality, only those rats that showed a plus (presence
of disease) or minus (absence of disease) in the table are included in
the computation. Those without a (+) or (2) were not analyzed for that disease. For the total diseases, a column with total disease is
presented and the number of plus signs (indicating the presence of
disease) were added up for each of the rats and the proportion was
computed as the number of rats with one or more diseases (total
disease) out of all listed rats. For the multiple diseases, the
proportion was computed as the number of rats with more than
one disease/abnormality out of all of the listed rats. Not all the rats
were evaluated for all diseases/abnormalities due to technical
limitations. The computation of the percent incidence of disease
data is limiting in this respect and the data presented represent
only the minimal incidence of total or multiple disease. For
example, if more animals in the current set had been evaluated for
ovarian disease, there could have been a higher incidence of either
total disease or multiple disease.
Epididymal Sperm collection The epididymis was dissected free of connective tissue, the fat
pad, the muscles and the vas deferens. A small cut was made to the
cauda epididymis and the tissue was placed in 5 ml F12 culture
medium containing 0.1% bovine serum albumin for 10 minutes at
37uC and then kept at 4uC to immobilize the sperm. The epididymal tissue in the buffer was put on a petri dish and minced
with a blade to release the sperm into the medium, the sperm
released into the buffer was aspirated with a pipette into a 1.5 ml
centrifuge tube and then centrifuged at 13,0006 g to pellet the sperm. Sperm were stored in fresh NIM buffer (Nucleus Isolation
Medium: 123.0 mmol/l KCl, 2.6 mmol/l NaCl, 7.8 mmol/l
NaH2PO4, 1.4 mmol/l KH2PO4 and 3 mmol/l EDTA (disodium
salt) at 220uC until processed further.
Sperm methylated DNA immunoprecipitation (MeDIP) Sperm heads were separated from tails through sonication
following a previously described protocol (without protease
inhibitors) [124] and then purified using a series of washes and
centrifugations [125] from a total of nine F3 generation rats per
lineage (control or plastics) that were 120 days of age. DNA
extraction on the purified sperm heads was performed as
previously described [4]. The same concentrations of DNA from
individual sperm samples were then used to produce pools of DNA
material. Three DNA pools were produced in total per treatment,
each one containing the same amount of sperm DNA from three
different animals. Therefore a total of 18 animals were used for
building three DNA pools per treatment (control or plastics)
making the following groups: C1–C3 and P1–P3. These DNA
pools were then used for chromatin immunoprecipitation of
methylated DNA fragments (MeDIP). MeDIP was performed as
follows: 6 mg of genomic DNA was subjected to series of three 20 pulse sonications at 20% amplitude and the appropriate fragment
size (200–1000 ng) was verified through 2% agarose gels; the
sonicated genomic DNA was resuspended in 350 ml TE buffer and denatured for 10 min at 95uC and then immediately placed on ice for 5 min; 100 ml of 5X IP buffer (50 mM Na-phosphate pH 7, 700 mM NaCl, 0.25% Triton X-100) was added to the sonicated
and denatured DNA. An overnight incubation of the DNA was
performed with 5 mg of antibody anti-5-methylCytidine monoclo- nal from Diagenode (Denville, NJ) at 4uC on a rotating platform. Protein A/G beads from Santa Cruz were prewashed on PBS-BSA
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 14 January 2013 | Volume 8 | Issue 1 | e55387
0.1% and resuspended in 40 ml 1X IP buffer. Beads were then added to the DNA-antibody complex and incubated 2 h at 4uC on a rotating platform. Beads bound to DNA-antibody complex were
washed 3 times with 1 ml 1X IP buffer; washes included
incubation for 5 min at 4uC on a rotating platform and then centrifugation at 6000 rpm for 2 min. Beads-DNA-antibody
complex were then resuspended in 250 ml digestion buffer (50 mM Tris HCl pH 8, 10 mM EDTA, 0.5% SDS) and 3.5 ml of proteinase K (20 mg/ml) was added to each sample and then
incubated overnight at 55uC on a rotating platform. DNA purification was performed first with phenol and then with
chloroform:isoamyl alcohol. Two washes were then performed
with 70% ethanol, 1 M NaCl and glycogen. MeDIP selected DNA
was then resuspended in 30 ml TE buffer.
Tiling Array MeDIP-Chip Analysis and MeDIP-QPCR Analysis
The MeDIP-Chip analysis was previously performed and
reported [20] and the data used in the current study. Roche
Nimblegen’s Rat DNA Methylation 36720 K CpG Island Plus RefSeq Promoter Array was used, which contains three identical
sub-arrays, with 720,000 probes per sub-array, scanning a total of
15,287 promoters (3,880 bp upstream and 970 bp downstream
from transcription start site). Probe sizes range from 50–75 mer in
length with the median probe spacing of 100 bp. Three different
comparative (MeDIP vs. MeDIP) hybridizations experiments were
performed (3 sub-arrays) for plastics lineage versus control, with
each subarray encompassing DNA samples from 6 animals (3 each
from plastics and control). MeDIP DNA samples from experi-
mental groups were labeled with Cy3 and MeDIP DNA samples
from the control lineage were labeled with Cy5 [20].
The MeDIP samples control and vinclozolin lineage F3
generation sperm were used in an MeDIP-QPCR analysis to
confirm the MeDIP-Chip data for a selected gene. A standard
RealTime PCR procedure was used to quantify the amount of
DNA for the DMR in the MeDIP samples, as previously shown
[112]. The PCR primers designed for the genomic DNA sites of
the DMR for Gdnf are: 59ATCCGAGCCTAACTTGCCTG,
39AGAGTGGAGACCTTTTGCGG. The Q-PCR used 30
cycles and PCR products were quantified and the fold change
determined between the F3 generation sperm for control versus
plastic lineage MeDIP samples. Statistical analysis of the data used
a U-Mann Whitney analysis.
Bioinformatic and Statistic Analyses of Chip Data For each comparative hybridization experiment raw data from
both the Cy3 and Cy5 channels were imported into R (R
Development Core Team (2010), R: A language for statistical
computing, R Foundation for Statistical Computing, Vienna,
Austria. ISBN 3-900051-07-0, URL http://www.R-project.org),
checked for quality and converted to MA values (M = Cy52Cy3;
A = (Cy5+Cy3)/2). The normalization procedure as previously described [20]. Following normalization each adjacent .3 probe
set value represents the median intensity difference between
plastics F3 generation lineage and control F3 generation lineage of
a 600 bp window. Significance was assigned to probe differences
between plastics F3 generation lineage samples and control F3
generation lineage samples by calculating the median value of the
intensity differences as compared to a normal distribution scaled to
the experimental mean and standard deviation of the normalized
data. A Z-score and P-value were computed for each probe from
that distribution. In order to assure the reproducibility of the
candidates obtained, only the candidates showing significant
changes in all of the single paired comparisons were chosen as a
having a significant change in DNA methylation between each
experimental group and controls. This is a very stringent approach
to select for changes because it only considers repeated changes in
all paired analysis. The statistically significant differential DNA
methylated regions (DMR) were identified and P-value associated
with each region presented, as previously described [20].
Associations between genes (gene networks) containing DMR
and particular physiologic cellular processes were determined by
an automated, unbiased survey of published literature using
Pathway Studio TM
software (Ariadne, Elsevier Inc., USA). The
specific disease associated genes were also assessed with the
Pathway Studio software. Signaling pathway enrichment with
genes containing DMR was determined by querying the library of
KEGG pathways (Kyto Encyclopedia of Genes and Genomes,
http://www.genome.jp/keff/pathway.html).
Statistical Analysis of Rat Organ and Disease Data The number of animals or samples for different experiments are
presented in the appropriate legends and Tables S2 and S3. For
statistical analysis for all data on body and organ weights were
used as input in the program GraphPad� Prism 5 statistical analysis program and t-tests were used to determine if the data
from the plastics or lower dose plastics group differed from those of
control groups. For the number of rats with disease/abnormalities
(disease incidence) a logistic regression analysis was used to analyze
the data (control or plastics or lower dose plastics, and diseased or
unaffected). For the MeDIP-PCR analysis a Student’s t-test was
utilized. All treatment differences were considered significant if P-
value was less than 0.05.
Supporting Information
Figure S1 Testicular spermatogenic cell apoptosis. Assessed by
Terminal deoxynucleotidyl transferase dUTP nick end labeling
(TUNEL) in F1 and F3 generation control lineage (open bars),
plastics lineage (black bars) and lower dose (LD) plastics lineage
(gray bars) rats. Number of apoptotic germ cells were normalized
to control means. The mean 6 SEM for three different
experiments are presented with related difference from control
indicated (* P,0.05; *** P,0.001).
(PDF)
Figure S2 Steroid hormone analysis in F3 generation animals. A.
Serum estradiol concentrations in proestrus-estrus in F3 generation
control, plastics and lower dose (LD) plastics lineage females. B.
Serum estradiol concentrations in diestrus in F3 generation females
of control, plastics and lower dose (LD) plastics lineages. C. Serum
testosterone concentrations in F3 generation males of control,
plastics and lower dose (LD) plastics lineages. There were no
significant changes (p.0.05) in any of the hormone concentrations
of F3 generation rats of plastics and lower dose plastics lineages.
(PDF)
Table S1 S1A. Body weight and organ weights in control, plastics and lower dose plastics F1 and F3 generation female rats
(Mean 6 Standard Error). Asterisks (*, ***), if present, indicate
statistically significant differences between means of control and
plastics or low dose plastics groups’ rats (P,0.05, and P,0.001
respectively). S1B. Body weight (grams) and organ weights (% of body weight) in control, plastics and lower dose plastics F1 and F3
generation male rats (Mean 6 SE). Asterisks (*, **), if present,
indicate statistically significant differences between means of
control and plastics or low dose plastics groups’ rats (P,0.05,
P,0.01 respectively).
(PDF)
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 15 January 2013 | Volume 8 | Issue 1 | e55387
Table S2 S2A. Individual disease incidence in F1 generation control, plastics and lower dose plastics female rats. The ‘+’ indicates the presence; the ‘2’ indicates the absence of disease; the
blank cell ‘‘no mark’’ indicates not determined. Animal IDs with a
‘C’ belong to Control group, those with a ‘P’ belong to plastics
group and those with a ‘LP’ belong to lower dose plastics group.
PFL = Primordial follicle loss; PCO = Polycystic ovarian disease.
See ‘Materials and Methods’ section for disease assessment in rats.
S2B. Individual disease incidence in F1 generation control, plastics, and lower dose plastics male rats. The ‘+’ indicates the presence; the ‘2’ indicates the absence of disease; the blank cell
‘‘no marks’’ indicates not determined. Animal IDs with a ‘C’
belong to control group, those with a ‘P’ belong to plastics group
and those with a ‘LP’ belong to lower dose plastics group. See
‘Materials and Methods’ section for disease assessment in rats. The
number of animals per litter (litter representation) mean 6 SEM
used for each specific disease/abnormality assessment between the
control versus plastic or lower dose plastic lineages were not found
to be statistically different (p.0.05), so no litter bias detected.
(PDF)
Table S3 S3A. Individual disease incidence in F3 generation control, plastics and lower dose plastics female rats. The ‘+’ indicates the presence and the ‘2’ indicates the absence of disease;
and blank cell ‘‘no mark’’ indicates not determined. Animal IDs
with a ‘C’ belong to Control group, those with a ‘P’ belong to
Plastics group, and those with a ‘LP’ belong to lower dose plastics
group. See ‘Materials and Methods’ section for disease assessment
in rats. S3B. Individual disease incidence in F3 generation control, plastics and lower dose plastics male rats. The ‘+’ indicates the presence; the ‘2’ indicates the absence of disease; and blank cell
‘‘no mark’’ indicates not determined. Animal IDs with a ‘C’
belong to Control group, those with a ‘P’ belong to Plastics group,
and those with a ‘LP’ belong to Lower Dose Plastics group. See
‘Materials and Methods’ section for disease assessment in rats. The
number of animals per litter (litter representation) mean 6 SEM
used for each specific disease/abnormality assessment between the
control versus plastic or lower dose plastic lineages were not found
to be statistically different (p.0.05), so no litter bias detected.
(PDF)
Table S4 List of rat sperm differential DNA methylation regions
(DMR) found in F3-generation plastic lineage sperm. The
functional gene category is presented, chromosomal number, start
and stop genome nucleotide location, gene ID, statistical p-value
for identified DMR, and name of the gene are presented.
(PDF)
Table S5 The F3 generation plastic lineage sperm DMR
associated genes correlation to KEGG pathways. The pathway
name, the number of DMR genes, and total number of genes in
the pathway are listed.
(PDF)
Acknowledgments
We thank the expert technical assistance of Dr. Eric Nilsson, Dr. Marina
Savenkova, Ms. Tiffany Hylkema, Ms. Shelby Weeks, Ms. Renee Espinosa
Najera, Ms. Jessica Shiflett, Ms. Ginger Beiro, Ms. Chrystal Bailey, Ms.
Colleen Johns, Mr. Trevor Covert and Ms. Sean Leonard, as well as the
assistance of Ms. Heather Johnson in preparation of the manuscript. We
acknowledge the helpful advice of Dr. David Jackson and Dr. John Lewis,
US Army Center for Environmental Health Research, Department of
Defense (DOD), and the leadership, including Dr. Paul Nisson, at the
DOD TATRC.
Author Contributions
Edited the manuscript: MKS MM RT CGB. Conceived and designed the
experiments: MKS. Performed the experiments: MM RT CGB. Analyzed
the data: MKS MM RT CGB. Wrote the paper: MKS MM.
References
1. Skinner MK, Manikkam M, Guerrero-Bosagna C (2010) Epigenetic transge-
nerational actions of environmental factors in disease etiology. Trends
Endocrinol Metab 21: 214–222.
2. Anway MD, Cupp AS, Uzumcu M, Skinner MK (2005) Epigenetic
transgenerational actions of endocrine disruptors and male fertility. Science
308: 1466–1469.
3. Guerrero-Bosagna C, Covert T, Haque MM, Settles M, Nilsson EE, et al.
(2012) Epigenetic Transgenerational Inheritance of Vinclozolin Induced
Mouse Adult Onset Disease and Associated Sperm Epigenome Biomarkers.
Reproductive Toxicology 34: 694–707.
4. Guerrero-Bosagna C, Settles M, Lucker B, Skinner M (2010) Epigenetic
transgenerational actions of vinclozolin on promoter regions of the sperm
epigenome. PLoS ONE 5: e13100.
5. Jirtle RL, Skinner MK (2007) Environmental epigenomics and disease
susceptibility. Nat Rev Genet 8: 253–262.
6. Talsness CE, Andrade AJ, Kuriyama SN, Taylor JA, vom Saal FS (2009)
Components of plastic: experimental studies in animals and relevance for
human health. Philos Trans R Soc Lond B Biol Sci 364: 2079–2096.
7. Fiege H, Heinz-Werner V, Toshikazu H, Sumio U, Tadao I, et al. (2002)
Phenol Derivatives. In: Wiley-VCH, editor. Ullmann’s Encyclopedia of
Industrial Chemistry. Weinheim: Wiley-VCH.
8. Richter CA, Birnbaum LS, Farabollini F, Newbold RR, Rubin BS, et al. (2007)
In vivo effects of bisphenol A in laboratory rodent studies. Reprod Toxicol 24:
199–224.
9. Vandenberg LN, Maffini MV, Sonnenschein C, Rubin BS, Soto AM (2009)
Bisphenol-A and the great divide: a review of controversies in the field of
endocrine disruption. Endocr Rev 30: 75–95.
10. Rubin BS, Soto AM (2009) Bisphenol A: Perinatal exposure and body weight.
Mol Cell Endocrinol 304: 55–62.
11. Patisaul HB, Adewale HB (2009) Long-term effects of environmental endocrine
disruptors on reproductive physiology and behavior. Front Behav Neurosci 3:
10.
12. Rubin BS (2011) Bisphenol A: an endocrine disruptor with widespread
exposure and multiple effects. J Steroid Biochem Mol Biol 127: 27–34.
13. Lorz PM, Towae FK, Enke W, Jäckh R, Bhargava N, et al. (2002) Phthalic
Acid and Derivatives. Ullmann’s Encyclopedia of Industrial Chemistry: Wiley-
VCH: Weinheim.
14. Lyche JL, Gutleb AC, Bergman A, Eriksen GS, Murk AJ, et al. (2009)
Reproductive and developmental toxicity of phthalates. J Toxicol Environ
Health B Crit Rev 12: 225–249.
15. Heudorf U, Mersch-Sundermann V, Angerer J (2007) Phthalates: toxicology
and exposure. Int J Hyg Environ Health 210: 623–634.
16. Simoneau C, Van den Eede L, Valzacchi S (2012) Identification and
quantification of the migration of chemicals from plastic baby bottles used as
substitutes for polycarbonate. Food Addit Contam Part A Chem Anal Control
Expo Risk Assess 29: 469–480.
17. Maffini MV, Rubin BS, Sonnenschein C, Soto AM (2006) Endocrine
disruptors and reproductive health: the case of bisphenol-A. Mol Cell
Endocrinol 254–255: 179–186.
18. Vogel SA (2009) The politics of plastics: the making and unmaking of bisphenol
a ‘‘safety’’. Am J Public Health 99 Suppl 3: S559–566.
19. Salian S, Doshi T, Vanage G (2009) Perinatal exposure of rats to Bisphenol A
affects the fertility of male offspring. Life Sci 85: 742–752.
20. Manikkam M, Guerrero-Bosagna C, Tracey R, Haque MM, Skinner MK
(2012) Transgenerational Actions of Environmental Compounds on Repro-
ductive Disease and Epigenetic Biomarkers of Ancestral Exposures. PLoS ONE
7: e31901.
21. Laws SC, Carey SA, Ferrell JM, Bodman GJ, Cooper RL (2000) Estrogenic
activity of octylphenol, nonylphenol, bisphenol A and methoxychlor in rats.
Toxicol Sci 54: 154–167.
22. Ashby J, Tinwell H, Lefevre PA, Joiner R, Haseman J (2003) The effect on
sperm production in adult Sprague-Dawley rats exposed by gavage to
bisphenol A between postnatal days 91–97. Toxicol Sci 74: 129–138.
23. Koo HJ, Lee BM (2007) Toxicokinetic relationship between di(2-ethylhexyl)
phthalate (DEHP) and mono(2-ethylhexyl) phthalate in rats. J Toxicol Environ
Health A 70: 383–387.
24. Kessler W, Numtip W, Grote K, Csanady GA, Chahoud I, et al. (2004) Blood
burden of di(2-ethylhexyl) phthalate and its primary metabolite mono(2-
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 16 January 2013 | Volume 8 | Issue 1 | e55387
ethylhexyl) phthalate in pregnant and nonpregnant rats and marmosets.
Toxicol Appl Pharmacol 195: 142–153.
25. Astill BD, Gingell R, Guest D, Hellwig J, Hodgson JR, et al. (1996)
Oncogenicity testing of 2-ethylhexanol in Fischer 344 rats and B6C3F1 mice.
Fundam Appl Toxicol 31: 29–41.
26. Khaliq MA, Srivastava SP (1993) Induction of hepatic polyamines by di(2-
ethylhexyl)phthalate in rats. Toxicol Lett 66: 317–321.
27. Gray LE Jr, Laskey J, Ostby J (2006) Chronic di-n-butyl phthalate exposure in
rats reduces fertility and alters ovarian function during pregnancy in female
Long Evans hooded rats. Toxicol Sci 93: 189–195.
28. Foster PM, Cattley RC, Mylchreest E (2000) Effects of di-n-butyl phthalate
(DBP) on male reproductive development in the rat: implications for human
risk assessment. Food Chem Toxicol 38: S97–99.
29. Ryu JY, Lee BM, Kacew S, Kim HS (2007) Identification of differentially
expressed genes in the testis of Sprague-Dawley rats treated with di(n-butyl)
phthalate. Toxicology 234: 103–112.
30. Kostka G, Urbanek-Olejnik K, Wiadrowska B (2010) Di-butyl phthalate-
induced hypomethylation of the c-myc gene in rat liver. Toxicol Ind Health 26:
407–416.
31. Skinner MK (2008) What is an epigenetic transgenerational phenotype? F3 or
F2. Reprod Toxicol 25: 2–6.
32. Anway MD, Leathers C, Skinner MK (2006) Endocrine disruptor vinclozolin
induced epigenetic transgenerational adult-onset disease. Endocrinology 147:
5515–5523.
33. Howdeshell KL, Hotchkiss AK, Thayer KA, Vandenbergh JG, vom Saal FS
(1999) Exposure to bisphenol A advances puberty. Nature 401: 763–764.
34. Honma S, Suzuki A, Buchanan DL, Katsu Y, Watanabe H, et al. (2002) Low
dose effect of in utero exposure to bisphenol A and diethylstilbestrol on female
mouse reproduction. Reprod Toxicol 16: 117–122.
35. Rubin BS, Murray MK, Damassa DA, King JC, Soto AM (2001) Perinatal
exposure to low doses of bisphenol A affects body weight, patterns of estrous
cyclicity, and plasma LH levels. Environ Health Perspect 109: 675–680.
36. Monje L, Varayoud J, Munoz-de-Toro M, Luque EH, Ramos JG (2010)
Exposure of neonatal female rats to bisphenol A disrupts hypothalamic LHRH
pre-mRNA processing and estrogen receptor alpha expression in nuclei
controlling estrous cyclicity. Reprod Toxicol 30: 625–634.
37. Prins GS, Ye SH, Birch L, Ho SM, Kannan K (2011) Serum bisphenol A
pharmacokinetics and prostate neoplastic responses following oral and
subcutaneous exposures in neonatal Sprague-Dawley rats. Reprod Toxicol
31: 1–9.
38. Timms BG, Howdeshell KL, Barton L, Bradley S, Richter CA, et al. (2005)
Estrogenic chemicals in plastic and oral contraceptives disrupt development of
the fetal mouse prostate and urethra. Proc Natl Acad Sci U S A 102: 7014–
7019.
39. Gupta C (2000) Reproductive malformation of the male offspring following
maternal exposure to estrogenic chemicals. Proc Soc Exp Biol Med 224: 61–68.
40. Ho SM, Tang WY, Belmonte de Frausto J, Prins GS (2006) Developmental
exposure to estradiol and bisphenol A increases susceptibility to prostate
carcinogenesis and epigenetically regulates phosphodiesterase type 4 variant 4.
Cancer Res 66: 5624–5632.
41. Markey CM, Luque EH, Munoz De Toro M, Sonnenschein C, Soto AM
(2001) In utero exposure to bisphenol A alters the development and tissue
organization of the mouse mammary gland. Biol Reprod 65: 1215–1223.
42. Munoz-de-Toro M, Markey CM, Wadia PR, Luque EH, Rubin BS, et al.
(2005) Perinatal exposure to bisphenol-A alters peripubertal mammary gland
development in mice. Endocrinology 146: 4138–4147.
43. Vandenberg LN, Maffini MV, Schaeberle CM, Ucci AA, Sonnenschein C, et
al. (2008) Perinatal exposure to the xenoestrogen bisphenol-A induces
mammary intraductal hyperplasias in adult CD-1 mice. Reprod Toxicol 26:
210–219.
44. Murray TJ, Maffini MV, Ucci AA, Sonnenschein C, Soto AM (2007) Induction
of mammary gland ductal hyperplasias and carcinoma in situ following fetal
bisphenol A exposure. Reprod Toxicol 23: 383–390.
45. Newbold RR, Jefferson WN, Padilla-Banks E (2007) Long-term adverse effects
of neonatal exposure to bisphenol A on the murine female reproductive tract.
Reprod Toxicol 24: 253–258.
46. Kubo K, Arai O, Omura M, Watanabe R, Ogata R, et al. (2003) Low dose
effects of bisphenol A on sexual differentiation of the brain and behavior in rats.
Neurosci Res 45: 345–356.
47. Rubin BS, Lenkowski JR, Schaeberle CM, Vandenberg LN, Ronsheim PM, et
al. (2006) Evidence of altered brain sexual differentiation in mice exposed
perinatally to low, environmentally relevant levels of bisphenol A. Endocrinol-
ogy 147: 3681–3691.
48. Patisaul HB, Fortino AE, Polston EK (2006) Neonatal genistein or bisphenol-A
exposure alters sexual differentiation of the AVPV. Neurotoxicol Teratol 28:
111–118.
49. Adewale HB, Todd KL, Mickens JA, Patisaul HB (2011) The impact of
neonatal bisphenol-A exposure on sexually dimorphic hypothalamic nuclei in
the female rat. Neurotoxicology 32: 38–49.
50. Khurana S, Ranmal S, Ben-Jonathan N (2000) Exposure of newborn male and
female rats to environmental estrogens: delayed and sustained hyperprolactin-
emia and alterations in estrogen receptor expression. Endocrinology 141:
4512–4517.
51. Ramos JG, Varayoud J, Kass L, Rodriguez H, Costabel L, et al. (2003)
Bisphenol a induces both transient and permanent histofunctional alterations of
the hypothalamic-pituitary-gonadal axis in prenatally exposed male rats.
Endocrinology 144: 3206–3215.
52. Monje L, Varayoud J, Luque EH, Ramos JG (2007) Neonatal exposure to
bisphenol A modifies the abundance of estrogen receptor alpha transcripts with
alternative 59-untranslated regions in the female rat preoptic area. J Endocrinol
194: 201–212.
53. Ishido M, Masuo Y, Kunimoto M, Oka S, Morita M (2004) Bisphenol A causes
hyperactivity in the rat concomitantly with impairment of tyrosine hydroxylase
immunoreactivity. J Neurosci Res 76: 423–433.
54. Jones DC, Miller GW (2008) The effects of environmental neurotoxicants on
the dopaminergic system: A possible role in drug addiction. Biochem
Pharmacol 76: 569–581.
55. Kawai K, Nozaki T, Nishikata H, Aou S, Takii M, et al. (2003) Aggressive
behavior and serum testosterone concentration during the maturation process
of male mice: the effects of fetal exposure to bisphenol A. Environ Health
Perspect 111: 175–178.
56. Farabollini F, Porrini S, Della Seta D, Bianchi F, Dessi-Fulgheri F (2002)
Effects of perinatal exposure to bisphenol A on sociosexual behavior of female
and male rats. Environ Health Perspect 110 Suppl 3: 409–414.
57. Tian YH, Hwan Kim S, Lee SY, Jang CG (2011) Lactational and postnatal
exposure to polychlorinated biphenyls induces sex-specific anxiolytic behavior
and cognitive deficit in mice offspring. Synapse 65: 1032–1041.
58. Mizuo K, Narita M, Miyagawa K, Okuno E, Suzuki T (2004) Prenatal and
neonatal exposure to bisphenol-A affects the morphine-induced rewarding
effect and hyperlocomotion in mice. Neurosci Lett 356: 95–98.
59. Somm E, Schwitzgebel VM, Toulotte A, Cederroth CR, Combescure C, et al.
(2009) Perinatal exposure to bisphenol a alters early adipogenesis in the rat.
Environ Health Perspect 117: 1549–1555.
60. Ryan KK, Haller AM, Sorrell JE, Woods SC, Jandacek RJ, et al. (2010)
Perinatal exposure to bisphenol-a and the development of metabolic syndrome
in CD-1 mice. Endocrinology 151: 2603–2612.
61. Miyawaki J, Sakayama K, Kato H, Yamamoto H, Masuno H (2007) Perinatal
and postnatal exposure to bisphenol a increases adipose tissue mass and serum
cholesterol level in mice. J Atheroscler Thromb 14: 245–252.
62. Alonso-Magdalena P, Vieira E, Soriano S, Menes L, Burks D, et al. (2010)
Bisphenol A exposure during pregnancy disrupts glucose homeostasis in
mothers and adult male offspring. Environ Health Perspect 118: 1243–1250.
63. Martino-Andrade AJ, Chahoud I (2010) Reproductive toxicity of phthalate
esters. Mol Nutr Food Res 54: 148–157.
64. Gangolli SD (1982) Testicular effects of phthalate esters. Environ Health
Perspect 45: 77–84.
65. Gray TJ, Gangolli SD (1986) Aspects of the testicular toxicity of phthalate
esters. Environ Health Perspect 65: 229–235.
66. Dostal LA, Chapin RE, Stefanski SA, Harris MW, Schwetz BA (1988)
Testicular toxicity and reduced Sertoli cell numbers in neonatal rats by di(2-
ethylhexyl)phthalate and the recovery of fertility as adults. Toxicol Appl
Pharmacol 95: 104–121.
67. Richburg JH, Boekelheide K (1996) Mono-(2-ethylhexyl) phthalate rapidly
alters both Sertoli cell vimentin filaments and germ cell apoptosis in young rat
testes. Toxicol Appl Pharmacol 137: 42–50.
68. Gray LE Jr, Ostby J, Furr J, Price M, Veeramachaneni DN, et al. (2000)
Perinatal exposure to the phthalates DEHP, BBP, and DINP, but not DEP,
DMP, or DOTP, alters sexual differentiation of the male rat. Toxicol Sci 58:
350–365.
69. Andrade AJ, Grande SW, Talsness CE, Grote K, Golombiewski A, et al. (2006)
A dose-response study following in utero and lactational exposure to di-(2-
ethylhexyl) phthalate (DEHP): effects on androgenic status, developmental
landmarks and testicular histology in male offspring rats. Toxicology 225: 64–
74.
70. Andrade AJ, Grande SW, Talsness CE, Gericke C, Grote K, et al. (2006) A
dose response study following in utero and lactational exposure to di-(2-
ethylhexyl) phthalate (DEHP): reproductive effects on adult male offspring rats.
Toxicology 228: 85–97.
71. Mylchreest E, Cattley RC, Foster PM (1998) Male reproductive tract
malformations in rats following gestational and lactational exposure to Di(n-
butyl) phthalate: an antiandrogenic mechanism? Toxicol Sci 43: 47–60.
72. Nagao T, Ohta R, Marumo H, Shindo T, Yoshimura S, et al. (2000) Effect of
butyl benzyl phthalate in Sprague-Dawley rats after gavage administration: a
two-generation reproductive study. Reprod Toxicol 14: 513–532.
73. Moore RW, Rudy TA, Lin TM, Ko K, Peterson RE (2001) Abnormalities of
sexual development in male rats with in utero and lactational exposure to the
antiandrogenic plasticizer Di(2-ethylhexyl) phthalate. Environ Health Perspect
109: 229–237.
74. Howdeshell KL, Furr J, Lambright CR, Rider CV, Wilson VS, et al. (2007)
Cumulative effects of dibutyl phthalate and diethylhexyl phthalate on male rat
reproductive tract development: altered fetal steroid hormones and genes.
Toxicol Sci 99: 190–202.
75. Howdeshell KL, Wilson VS, Furr J, Lambright CR, Rider CV, et al. (2008) A
mixture of five phthalate esters inhibits fetal testicular testosterone production
in the sprague-dawley rat in a cumulative, dose-additive manner. Toxicol Sci
105: 153–165.
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 17 January 2013 | Volume 8 | Issue 1 | e55387
76. Martino-Andrade AJ, Morais RN, Botelho GG, Muller G, Grande SW, et al.
(2009) Coadministration of active phthalates results in disruption of foetal testicular function in rats. Int J Androl 32: 704–712.
77. Davis BJ, Maronpot RR, Heindel JJ (1994) Di-(2-ethylhexyl) phthalate
suppresses estradiol and ovulation in cycling rats. Toxicol Appl Pharmacol 128: 216–223.
78. Lamb JCt, Chapin RE, Teague J, Lawton AD, Reel JR (1987) Reproductive effects of four phthalic acid esters in the mouse. Toxicol Appl Pharmacol 88:
255–269.
79. Gray LE Jr, Wolf C, Lambright C, Mann P, Price M, et al. (1999) Administration of potentially antiandrogenic pesticides (procymidone, linuron,
iprodione, chlozolinate, p, p’-DDE, and ketoconazole) and toxic substances (dibutyl- and diethylhexyl phthalate, PCB 169, and ethane dimethane
sulphonate) during sexual differentiation produces diverse profiles of repro- ductive malformations in the male rat. Toxicol Ind Health 15: 94–118.
80. Grande SW, Andrade AJ, Talsness CE, Grote K, Chahoud I (2006) A dose-
response study following in utero and lactational exposure to di(2-ethylhex- yl)phthalate: effects on female rat reproductive development. Toxicol Sci 91:
247–254. 81. Grande SW, Andrade AJ, Talsness CE, Grote K, Golombiewski A, et al. (2007)
A dose-response study following in utero and lactational exposure to di-(2-
ethylhexyl) phthalate (DEHP): reproductive effects on adult female offspring rats. Toxicology 229: 114–122.
82. Fisher JS (2004) Environmental anti-androgens and male reproductive health: focus on phthalates and testicular dysgenesis syndrome. Reproduction 127:
305–315. 83. Hauser R, Sokol R (2008) Science linking environmental contaminant
exposures with fertility and reproductive health impacts in the adult male.
Fertil Steril 89: e59–65. 84. Kumar S (2004) Occupational exposure associated with reproductive
dysfunction. J Occup Health 46: 1–19. 85. Vujovic S (2009) Aetiology of premature ovarian failure. Menopause Int 15:
72–75.
86. Hart R, Hickey M, Franks S (2004) Definitions, prevalence and symptoms of polycystic ovaries and polycystic ovary syndrome. Best Pract Res Clin Obstet
Gynaecol 18: 671–683. 87. Dunaif A (2012) Polycystic ovary syndrome in 2011: Genes, aging and sleep
apnea in polycystic ovary syndrome. Nat Rev Endocrinol 8: 72–74. 88. Nilsson E, Larsen G, Manikkam M, Guerrero-Bosagna C, Savenkova M, et al.
(2012) Environmentally Induced Epigenetic Transgenerational Inheritance of
Ovarian Disease. PLoS ONE 7: e36129. 89. Xu N, Azziz R, Goodarzi MO (2010) Epigenetics in polycystic ovary
syndrome: a pilot study of global DNA methylation. Fertil Steril 94: 781–783 e781.
90. Xu N, Kwon S, Abbott DH, Geller DH, Dumesic DA, et al. (2011) Epigenetic
mechanism underlying the development of polycystic ovary syndrome (PCOS)- like phenotypes in prenatally androgenized rhesus monkeys. PLoS ONE 6:
e27286. 91. DiVall SA, Radovick S (2009) Endocrinology of female puberty. Curr Opin
Endocrinol Diabetes Obes 16: 1–4. 92. Engelbregt MJ, Houdijk ME, Popp-Snijders C, Delemarre-van de Waal HA
(2000) The effects of intra-uterine growth retardation and postnatal
undernutrition on onset of puberty in male and female rats. Pediatr Res 48: 803–807.
93. Jacobson-Dickman E, Lee MM (2009) The influence of endocrine disruptors on pubertal timing. Curr Opin Endocrinol Diabetes Obes 16: 25–30.
94. Traggiai C, Stanhope R (2003) Disorders of pubertal development. Best Pract
Res Clin Obstet Gynaecol 17: 41–56. 95. Newbold RR, Padilla-Banks E, Jefferson WN, Heindel JJ (2008) Effects of
endocrine disruptors on obesity. Int J Androl 31: 201–208. 96. Grun F, Blumberg B (2007) Perturbed nuclear receptor signaling by
environmental obesogens as emerging factors in the obesity crisis. Rev Endocr
Metab Disord 8: 161–171. 97. McMillen IC, Rattanatray L, Duffield JA, Morrison JL, MacLaughlin SM, et
al. (2009) The early origins of later obesity: pathways and mechanisms. Adv Exp Med Biol 646: 71–81.
98. Bremer AA, Mietus-Snyder M, Lustig RH (2012) Toward a unifying hypothesis of metabolic syndrome. Pediatrics 129: 557–570.
99. Lim SS, Davies MJ, Norman RJ, Moran LJ (2012) Overweight, obesity and
central obesity in women with polycystic ovary syndrome: a systematic review and meta-analysis. Hum Reprod Update 18: 618–637.
100. Motta AB (2012) The role of obesity in the development of polycystic ovary syndrome. Curr Pharm Des 18: 2482–2491.
101. Linne Y (2004) Effects of obesity on women’s reproduction and complications
during pregnancy. Obes Rev 5: 137–143.
102. Campos KE, Volpato GT, Calderon IM, Rudge MV, Damasceno DC (2008)
Effect of obesity on rat reproduction and on the development of their adult offspring. Braz J Med Biol Res 41: 122–125.
103. Waterland RA, Travisano M, Tahiliani KG, Rached MT, Mirza S (2008)
Methyl donor supplementation prevents transgenerational amplification of
obesity. Int J Obes (Lond) 32: 1373–1379.
104. Skinner MK (2011) Environmental epigenetic transgenerational inheritance
and somatic epigenetic mitotic stability. Epigenetics 6: 838–842.
105. Skinner MK, Manikkam M, Haque MM, Zhang B, Savenkova M (2012) Epigenetic Transgenerational Inheritance of Somatic Transcriptomes and
Epigenetic Control Regions. Genome Biol 13: R91.
106. Anway MD, Rekow SS, Skinner MK (2008) Transgenerational epigenetic
programming of the embryonic testis transcriptome. Genomics 91: 30–40.
107. Zanni MV, Stanley TL, Makimura H, Chen CY, Grinspoon SK (2010) Effects
of TNF-alpha antagonism on E-selectin in obese subjects with metabolic dysregulation. Clin Endocrinol (Oxf) 73: 48–54.
108. Slocum N, Durrant JR, Bailey D, Yoon L, Jordan H, et al. (2012) Responses of brown adipose tissue to diet-induced obesity, exercise, dietary restriction and
ephedrine treatment. Exp Toxicol Pathol.
109. Fu T, Choi SE, Kim DH, Seok S, Suino-Powell KM, et al. (2012) Aberrantly
elevated microRNA-34a in obesity attenuates hepatic responses to FGF19 by targeting a membrane coreceptor beta-Klotho. Proc Natl Acad Sci U S A 109:
16137–16142.
110. Van Camp JK, Beckers S, Zegers D, Verrijken A, Van Gaal LF, et al. (2012)
Genetic association between WNT10B polymorphisms and obesity in a Belgian case-control population is restricted to males. Mol Genet Metab 105: 489–493.
111. Baudry C, Reichardt F, Marchix J, Bado A, Schemann M, et al. (2012) Diet- induced obesity has neuroprotective effects in murine gastric enteric nervous
system: involvement of leptin and glial cell line-derived neurotrophic factor.
J Physiol 590: 533–544.
112. Manikkam M, Tracey R, Guerrero-Bosagna C, Skinner M (2012) Pesticide and Insect Repellent Mixture (Permethrin and DEET) Induces Epigenetic
Transgenerational Inheritance of Disease and Sperm Epimutations. Repro-
ductive Toxicology 34: 708–719.
113. Nilsson EE, Anway MD, Stanfield J, Skinner MK (2008) Transgenerational
epigenetic effects of the endocrine disruptor vinclozolin on pregnancies and female adult onset disease. Reproduction 135: 713–721.
114. Stouder C, Paoloni-Giacobino A (2010) Transgenerational effects of the
endocrine disruptor vinclozolin on the methylation pattern of imprinted genes
in the mouse sperm. Reproduction 139: 373–379.
115. Bruner-Tran KL, Osteen KG (2011) Developmental exposure to TCDD reduces fertility and negatively affects pregnancy outcomes across multiple
generations. Reprod Toxicol 31: 344–350.
116. Greer EL, Maures TJ, Ucar D, Hauswirth AG, Mancini E, et al. (2011)
Transgenerational epigenetic inheritance of longevity in Caenorhabditis
elegans. Nature 479: 365–371.
117. Ruden DM, Lu X (2008) Hsp90 affecting chromatin remodeling might explain transgenerational epigenetic inheritance in Drosophila. Curr Genomics 9: 500–
508.
118. Hauser MT, Aufsatz W, Jonak C, Luschnig C (2011) Transgenerational
epigenetic inheritance in plants. Biochim Biophys Acta 1809: 459–468.
119. Rassoulzadegan M, Grandjean V, Gounon P, Vincent S, Gillot I, et al. (2006)
RNA-mediated non-mendelian inheritance of an epigenetic change in the mouse. Nature 441: 469–474.
120. Wagner KD, Wagner N, Ghanbarian H, Grandjean V, Gounon P, et al. (2008) RNA induction and inheritance of epigenetic cardiac hypertrophy in the
mouse. Dev Cell 14: 962–969.
121. Pembrey ME (2010) Male-line transgenerational responses in humans. Hum
Fertil (Camb) 13: 268–271.
122. Nilsson EE, Schindler R, Savenkova MI, Skinner MK (2011) Inhibitory actions
of Anti-Mullerian Hormone (AMH) on ovarian primordial follicle assembly. PLoS ONE 6: e20087.
123. Meredith S, Dudenhoeffer G, Jackson K (2000) Classification of small type B/ C follicles as primordial follicles in mature rats. J Reprod Fertil 119: 43–48.
124. Tateno H, Kimura Y, Yanagimachi R (2000) Sonication per se is not as deleterious to sperm chromosomes as previously inferred. Biol Reprod 63: 341–
346.
125. Ward WS, Kimura Y, Yanagimachi R (1999) An intact sperm nuclear matrix
may be necessary for the mouse paternal genome to participate in embryonic development. Biol Reprod 60: 702–706.
Epigenetic Transgenerational Disease Inheritance
PLOS ONE | www.plosone.org 18 January 2013 | Volume 8 | Issue 1 | e55387